Methods for diagnosing and treating Alzheimers disease using G72 protein and SLC7A11 mRNA as biomarkers
10473672 ยท 2019-11-12
Assignee
Inventors
Cpc classification
C07K14/70596
CHEMISTRY; METALLURGY
G01N2333/70571
PHYSICS
C12Q1/6883
CHEMISTRY; METALLURGY
C07K14/4705
CHEMISTRY; METALLURGY
International classification
Abstract
A method for diagnosing Alzheimer's disease (AD) includes: obtaining a blood sample from a human subject suspected of having AD; determining a G72 protein level in the blood sample; determining an SLC7A11 mRNA expression level in the blood sample; comparing the G72 protein level with a first predetermined standard; comparing the SLC7A11 mRNA expression level with a second predetermined standard; and diagnosing the human subject with AD when the G72 protein level is higher than the first predetermined standard and the SLC7A11 mRNA expression level is higher than the second predetermined standard. An effective amount of a pharmaceutical composition may be administered to the diagnosed human subject for treating AD.
Claims
1. A method for diagnosing and treating Alzheimer's disease (AD), comprising: obtaining a blood sample from a human subject suspected of having AD; measuring a G72 protein level in the blood sample; measuring an SLC7A11 mRNA expression level in the blood sample; diagnosing the human subject with AD when the G72 protein level is higher than a first predetermined standard and the SLC7A11 mRNA expression level is higher than a second predetermined standard; and administering to the diagnosed human subject an effective amount of a pharmaceutical composition for treating AD.
2. The method according to claim 1, further comprising separating plasma from the blood sample, wherein the plasma is subjected to the measurement of the G72 protein level.
3. The method according to claim 2, further comprising separating white blood cells from the blood sample, wherein the white blood cells are subjected to the measurement of the SLC7A11 mRNA expression level.
4. The method according to claim 1, further comprising separating serum from the blood sample, wherein the serum is subjected to the measurement of the G72 protein level.
5. The method according to claim 1, further comprising separating white blood cells from the blood sample, wherein the white blood cells are subjected to the measurement of the SLC7A11 mRNA expression level.
6. The method according to claim 1, wherein the G72 protein level is measured using an antibody-based binding moiety which specifically binds to G72 protein.
7. The method according to claim 6, wherein the antibody-based binding moiety is labeled with a detectable label selected from the group consisting of a radioactive label, a hapten label, a fluorescent label, a chemiluminescent label, an enzymatic label and an epitope tag.
8. The method according to claim 6, wherein the G72 protein level is measured using at least one of the following methodologies: Western blot immunoassay, multiplex immunoassay, enzyme linked immunosorbent assay, radioimmunoassay, immunoradiometric assay, fluorescent immunoassay, chemiluminescent immunoassay and immunonephelometry.
9. The method according to claim 1, wherein the SLC7A11 mRNA expression level is measured using at least one of the following methodologies: polymerase chain reaction, real time polymerase chain reaction, reverse transcription polymerase chain reaction, hybridization, probe hybridization and gene expression array.
10. The method according to claim 1, wherein the pharmaceutical composition for treating AD contains an active ingredient selected from the group consisting of N-methyl-D-aspartate receptor receptor (NMDAR) antagonists, cholinesterase modulators, A inhibitors, nerve growth factor agonists, hormone receptor blockade agents, neurotransmission modulators, and combinations thereof.
Description
DETAILED DESCRIPTION
(1) It is to be understood that, if any prior art publication is referred to herein, such reference does not constitute an admission that the publication forms a part of the common general knowledge in the art, in Taiwan or any other country.
(2) For the purpose of this specification, it will be clearly understood that the word comprising means including but not limited to, and that the word comprises has a corresponding meaning.
(3) Unless otherwise defined, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this disclosure belongs. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of this disclosure. Indeed, this disclosure is in no way limited to the methods and materials described.
(4) As used herein, the term Alzheimer's disease (AD) refers to a progressive mental deterioration manifested by memory loss, confusion and disorientation beginning in late midlife and typically resulting in death in five to ten years. Pathologically, AD can be characterized by thickening, conglutination, and distortion of the intracellular neurofibrils, neurofibrillary tangles and senile plaques composed of granular or filamentous argentophilic masses with an amyloid core.
(5) As used herein, the terms diagnose, diagnosis or diagnosing refer to distinguishing or identifying a disease, syndrome or condition or distinguishing or identifying a person having a particular disease, syndrome or condition. In illustrative embodiments of the present disclosure, assays and algorithms are used to diagnose AD in a subject based on an analysis of a sample.
(6) The term treat, treating or treatment as used herein, means decrease, suppress, attenuate, diminish, arrest, or stabilize the development or progression of a disease (e.g., a disease or disorder delineated herein), lessen the severity of the disease or improve the symptoms associated with the disease.
(7) In an attempt to identify new biomarkers for AD, the applicants compared the G72 protein level and/or SLC7A11 mRNA expression level of the blood sample between the healthy subjects and the subjects identified as patients having AD. The applicants' study revealed that both the G72 protein level and SLC7A11 mRNA expression level were differentially expressed between the subjects in the AD and control groups, suggesting that the G72 protein or SLC7A11 mRNA can serve as a biomarker for the detection of AD. However, based on the receiver operating characteristics (ROC) curve analysis, the sensitivity for the G72 protein and the specificity for the SLC7A11 mRNA are only modest. To the applicants' surprise, the combination of the G72 protein level and the SLC7A11 mRNA expression level provide for a better diagnostic ability to differentiate between the subjects in the AD and control groups, and thus can lead to an even more reliable diagnosis of AD.
(8) Accordingly, the present disclosure provides a method for diagnosing Alzheimer's disease (AD), which includes: obtaining a blood sample from a human subject suspected of having AD; determining a G72 protein level in the blood sample; determining an SLC7A11 mRNA expression level in the blood sample; comparing the G72 protein level with a first predetermined standard; comparing the SLC7A11 mRNA expression level with a second predetermined standard, and diagnosing the human subject with AD when the G72 protein level is higher than the first predetermined standard and the SLC7A11 mRNA level is higher than the second predetermined standard.
(9) According to the present disclosure, the blood sample can be obtained anytime from the human subject, and may be a fasting or non-fasting blood sample. In one embodiment of the present disclosure, the blood sample is obtained in the morning. In another embodiment of the present disclosure, the blood sample is a fasting blood sample obtained between the hours of 7 AM and 9 AM.
(10) The aforementioned method may further include a blood separation step. The blood separation step may be conducted to separate plasma or serum from the blood sample so as to determine the G72 protein level. Furthermore, the blood separation step may be conducted to separate white blood cells from the blood sample so as to determine the SLC7A11 mRNA expression level.
(11) According to the present disclosure, the G72 protein level and the SLC7A11 mRNA expression level can be determined by any means that is known to those skilled in the art.
(12) In certain embodiments, the G72 protein level can be determined by immunoassays. Exemplary immunoassays may include Western blot immunoassay, multiplex immunoassay, enzyme linked immunosorbent assay (ELISA), radioimmunoassay (RIA), immunoradiometric assay (IRMA), fluorescent immunoassay (FIA), chemiluminescent immunoassay and immunonephelometry.
(13) The G72 protein level may be determined using an antibody-based binding moiety which specifically binds to G72 protein. In an embodiment of this disclosure, the antibody-based binding moiety is an antibody.
(14) Antibody-based binding moiety or antibody includes immunoglobulin molecules and immunologically active determinants of immunoglobulin molecules, e.g., molecules that contain an antigen-binding site that specifically binds to G72 protein. The term antibody-based binding moiety is intended to include whole antibodies of any isotype (e.g., IgG, IgA, IgM, IgE, etc.), and fragments thereof that are also specifically reactive with G72 protein.
(15) In this disclosure, the antibody-based binding moiety may include polyclonal, monoclonal or other purified preparations of antibodies and recombinant antibodies, and is further intended to include humanized antibodies, bi-specific antibodies, and chimeric molecules having at least one antigen-binding determinant derived from an antibody molecule.
(16) In this disclosure, antibody-based binding moiety or antibody may include a capture antibody and a detecting antibody.
(17) The term capture antibody as used herein is defined as an antibody, whether monoclonal, polyclonal or of an immunoreactive fragment, which is capable of binding to an antigen of interest, and thereby allows the recognition of the antigen by a subsequently applied antibody. The capture antibody can be used in either a heterogeneous (solid phase) or homogeneous (solution phase) assay. The capture antibody may be immobilized onto a solid phase.
(18) The term detecting antibody as used herein is defined as an antibody having a detectable label that is specific for (i.e., binds, is bound by, or forms a complex with) one or more analytes of interest in a sample. The term also encompasses an antibody that is specific for one or more analytes of interest, wherein the antibody can be bound by another species that includes a detectable label. Examples of detectable labels include, but are not limited to, a radioactive label, a hapten label, a fluorescent label, a chemiluminescent label, an enzymatic label, a nucleotide (e.g., oligonucleotide) label, an epitope tag, and combinations thereof.
(19) Examples of hapten labels may include biotin/streptavidin and digoxigenin.
(20) Examples of epitope tags may include T7, c-Myc, HA, VSV-G, HSV, FLAG, V5 and HIS.
(21) Antibodies can be fragmented using conventional techniques. The term fragment(s) thereof refers to segments of proteolytically-cleaved or recombinantly-prepared portions of an antibody molecule that are capable of selectively reacting with a certain protein.
(22) Non-limiting examples of proteolytically-cleaved fragments and/or recombinantly-prepared portions include Fab, F(ab)2, Fab, Fv, dabs and a single-chain variable fragment (scFv) containing a VL and VH domain joined by a peptide linker. The scFv's may be covalently or non-covalently linked to form antibodies having two or more binding sites.
(23) According to the present disclosure, the G72 protein level is positively correlated to the intensity of the signal emitted from the detectably labeled antibody.
(24) In one exemplary embodiment of the present disclosure, the antibody-based binding moiety is detectably labeled by linking the antibody to an enzyme. The enzyme, in turn, when exposed to its substrate, will react with the substrate in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorometric or visual means. The enzymes which can be used to react with the detectable label of the antibodies of the present disclosure include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-V-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase (HRP), alkaline phosphatase, asparaginase, glucose oxidase, -galactosidase, ribonuclease, urease, catalase, glucose-VI-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.
(25) In certain embodiments, the antibody may also be labeled with a fluorescent compound. When the fluorescently labeled antibody is exposed to light of the proper wavelength, its presence can be detected due to fluorescence. Fluorescent compounds suitable for the present disclosure include, but are not limited to, CYE dyes, fluorescein isothiocyanate (FITC), rhodamine, phycoerythrin, coriphosphine-O (CPO), phycocyanin (PE), allophycocyanin (APC), o-phthaldehyde, fluorescamine and tandem dyes.
(26) Examples of tandem dyes include PE-Cy5 (PC5), PE-Cy7 (PC7) and PE-Texas Red.
(27) In certain embodiments, the antibody may be detected by fluorescence emitting metals, such as .sup.152Eu or other lanthanide series metals. These metals can be attached to the antibody by means of a metal-chelating group such as diethylenetriaminepentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).
(28) In certain embodiments, the antibody may be detected by coupling to a chemiluminescent. The presence of the chemiluminescent-antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of chemiluminescent compounds include, but are not limited to, luminol, luciferin, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
(29) Detection may also be accomplished using any of a variety of other immunoassays. For example, by radioactively labeling an antibody, it is possible to detect the antibody through the use of radioimmunoassays. Means of detecting radioactive isotopes include, but are not limited to, gamma counter, scintillation counter and autoradiography. The antibody can be detected by radioactive isotopes. Examples of radioactive isotopes include, but are not limited to, .sup.3H, .sup.31P, .sup.35S, .sup.14C, and .sup.125I.
(30) According to the present disclosure, the SLC7A11 mRNA expression level may be determined using at least one of the following methodologies: polymerase chain reaction, real time polymerase chain reaction (q-PCR), reverse transcription polymerase chain reaction (RT-PCR), quantitative RT-PCR (RT-qPCR), hybridization, probe hybridization and gene expression array. In one embodiment of the present disclosure, the SLC7A11 mRNA expression level is determined using quantitative RT-PCR.
(31) According to the present disclosure, the term predetermined standard may indicate a range, a value or a cutoff value for a G72 protein level or an SLC7A11 mRNA expression level in a blood sample of a healthy individual, which is determined by selected means. The cutoff value between a population of healthy individuals and subjects that have AD can be determined by those skilled in the art.
(32) The term healthy individual refers to an individual not having any symptoms associated with AD or not at risk of developing AD, i.e. an individual considered healthy after evaluation by a professional medical practitioner.
(33) In order to assess the progression of AD or the effectiveness of a treatment for AD, a G72 protein level and an SLC7A11 mRNA expression level as detected in a previous examination may also be used as a reference for the human subject.
(34) In one embodiment of the present disclosure, the first and second predetermined standards for the G72 protein level and the SLC7A11 mRNA expression level in the human subject suspected of having AD are respectively determined by Western blot immunoassay and RT-qPCR, giving a standard value of 2.3285 ng/mL and a standard delta CT value of 12.185 (calculated by subtracting the average CT value of the selected housekeeping genes from the CT value of SLC7A11) as the cutoff values for a G72 protein level and an SLC7A11 mRNA expression level.
(35) According to the present disclosure, the presence of AD may also be determined based on a combined cut-off value of the determined G72 protein level and the determined SLC7A11 mRNA expression level. In certain embodiments, the combined cut-off value may be calculated by an equation formulated using statistical analysis (such as discriminant function analysis, logistic regression analysis, receiver operating characteristic curve analysis and ridge regression analysis).
(36) According to the present disclosure, if the human subject is diagnosed with AD, the following treatment step may be used in combination with the steps in the aforesaid diagnostic method: administering to the diagnosed human subject an effective amount of a pharmaceutical composition for treating AD. Therefore, the present disclosure also provides a method for diagnosing and treating AD.
(37) According to the present disclosure, the pharmaceutical composition for treating AD may contain an active ingredient well-known in the art, and hence is only briefly described herein.
(38) In certain embodiments, the active ingredient used in the the pharmaceutical composition for treating AD is selected from the group consisting of N-methyl-D-aspartate receptor receptor (NMDAR) antagonists, cholinesterase modulators (such as acetylcholineesterase inhibitors (AChEIs), acetylcholine synthesis modulators, acetylcholine storage modulators, acetylcholine release modulators, etc.), A inhibitors (such as A plaque removal agents, inhibitors of A plaque formation, inhibitors of amyloid precursor protein processing enzymes, -amyloid converting enzyme inhibitors, -secretase inhibitors, and -secretase modulators), nerve growth factor agonists, hormone receptor blockade agents, neurotransmission modulators, and combinations thereof.
(39) Suitable NMDAR antagonists include, but are not limited to, memantine, rimantadine, and amantadine.
(40) Suitable cholinesterase modulators may be AchEIs which include, but are not limited to, donepezil, rivastigmine, galantamine, tacrine, metrifonate, huperzine-A, physostigmine, neostigmine, icopezil, and zanapezil.
(41) Suitable A inhibitors include, but are not limited to, tarenflurbil, tramiprosate, clioquinol, PBT-2 and other 8-hydroxyquinilone derivatives, A plaque removal agents, inhibitors of AR plaque formation, inhibitors of amyloid precursor protein processing enzymes, -amyloid converting enzyme inhibitors, -secretase inhibitors, and -secretase modulators.
(42) Suitable nerve growth factor agonists include, but not limited to, xaliproden, a brain derived neurotrophic factor, and a nerve growth factor.
(43) Suitable hormone receptor blockade agents include, but are not limited to, leuproelide and a derivative thereof.
(44) Suitable neurotransmission modulators include, but are not limited to, ispronicline.
EXAMPLES
(45) The present disclosure will be described in more detail with reference to the following examples, which are given for the purpose of illustration only and are not intended to limit the scope of the present disclosure.
(46) The experiments below were conducted using a protocol approved by the Institutional Review Board (IRB) in accordance with the current revision of the Declaration of Helsinki. After complete description of the experiments to the participants, written informed consent was obtained in line with IRB guidelines.
(47) 239 human subjects participated. It should be noted that each of the participants had no history of significant cerebrovascular disease, a Hachinski Ischemic Score not greater than 4, and no major neurological, psychiatric or medical conditions other than AD. Moreover, each of the participants had no substance (including alcohol) abuse or dependence, no symptoms of delusion, hallucination or delirium, no severe visual or hearing loss, and was able to follow the protocol. In addition, to exclude potential confounding effects, it was ascertained that each of the participants was a non-smoker and had no DSM-IV diagnosis of substance (including alcohol) abuse.
(48) Among all the 239 participants, 130 human subjects were identified as healthy volunteers, and are hereinafter referred to as the control group. These subjects were aged 18 years, were free of any Axis I or II psychiatric disorders, were physically and neurologically healthy, and had laboratory assessments (including urine/blood routine, biochemical tests, and electrocardiography) within normal limits. The remaining 109 human subjects were identified as patients having AD, and are hereinafter referred to as the AD group. These patients with AD (1) satisfied the criteria for probable AD as proposed by the National Institute of Neurological and Communicative Disorders and Stroke and the Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA) and had a Clinical Dementia Rating (CDR) score of 1 or greater, and (2) were physically healthy and had laboratory assessments (including urine/blood routine, biochemical tests, and electrocardiography) within normal limits.
(49) Out of the 130 control group subjects and 109 AD group subjects, 40 individuals from the control group and 70 patients from the AD group were selected and matched by age for further analysis. Table 1 shows the clinical characteristics (i.e. sex, age, and CDR score) of all the subjects (age-unmatched), as well as the subset of the subjects matched by age (age-matched). Since results were found to be similar irrespective of whether matching or not matching was applied, only the subset of subjects matched by age will be discussed in this example.
(50) TABLE-US-00001 TABLE 1 Demographic Characteristics of Subjects Age-unmatched Age-matched Control AD Control AD Group Group Group Group # Subjects 130 109 40 70 Age .sup.a 43.1 18.2 74.6 7.9 65.9 13.0 70.1 6.1 (Range) (19-88) (50-89) (45-88) (50-78) Sex (F/M) 63/67 71/38 17/23 47/23 CDR score .sup.a 0 1.3 0.6 0 1.2 0.5 .sup.a shown as mean standard deviation
Example 1. Analysis of G72 Protein Level and SLC7A11 mRNA Expression Level for Diagnosis of AD
(51) <Determination of G72 Protein Level in Plasma>
(52) Blood sampling was performed between the hours of 7 am and 9 am after all the subjects had fasted for more than 8 hours.
(53) 10 ml of peripheral venous blood was collected from each of the subjects in the control and AD groups into an EDTA-containing blood collection tube by personnel trained in phlebotomy using sterile technique. The tube was centrifuged at 1500g for 10 minutes at 4 C. The plasma thus obtained was quickly transferred into a different tube and immediately stored at 80 C. until further analysis.
(54) The G72 protein level in the plasma was determined with Western blot analysis. 100 l of the plasma sample was processed by using ProteoPrep Blue Albumin and IgG Depletion Kit (Sigma) to deplete the high abundant proteins in the plasma. The low-abundance protein fractions were collected and were each concentrated to 100 l. Then, 10 l of the respective concentrated fraction was mixed with a 4-fold amount of a sample buffer (containing 500 mM Tris-HCl (pH 6.8), 16% SDS, 80% glycerol, 400 mM DTT, and 0.08% bromophenol blue). Protein separation was conducted on 12% SDS-PAGE. The separated proteins in the gel were transferred to a 0.45 m polyvinylidene difluoride (PVDF) membrane (Millipore). The blotted PVDF membrane thus obtained was subjected to a blocking treatment by virtue of 5% nonfat dry milk in TBST (containing 20 mM Tris-HCl (pH 7.6), 500 mM sodium chloride, and 0.1% Tween 20) for 1 hour at room temperature, and was then incubated with a goat anti-G72 antibody (G72(N15):sc-46118, Santa Cruz Biotechnology) diluted 1:1000 in TBST overnight at 4 C. The membrane was washed 3 times (15 minutes each time) in TBST and was incubated for 2 hours with an HRP-linked anti-goat IgG secondary antibody (sc-2030, Santa Cruz Biotechnology) diluted 1:5000 in TBST. After another 3 washes in TBST, the blot was visualized with an ECL Advance Western Blotting Detection Kit (RPN2135, GE Healthcare). The stained membrane was then photographed on ImageQuant LAS 4000 mini (GE Healthcare), and was quantified using ImageQuant TL 7.0 software (GE Healthcare) by measuring the relative intensity from each band and conducting normalization to the G72 recombinant protein (20 or 50 ng, kindly donated by Dr. Hao-Teng Chang from China Medical University Hospital, Taichung, Taiwan) signals. The Western blot analysis was repeated twice.
(55) <Determination of SLC7A11 mRNA Expression Level in White Blood Cells (WBC)>
(56) 10 ml of peripheral venous blood was collected from each of the subjects in the control and AD groups into an EDTA-containing blood collection tube by personnel trained in phlebotomy using sterile technique. The tube was centrifuged at 1500g for 10 minutes at 4 C. Red blood cells (RBC) were lysed by adding 1RBC lysis buffer (Genepure Technology Co.) to the tube, and then WBC were obtained after centrifugation at 1500g for 10 minutes.
(57) To investigate the gene expression of a light chain subunit of system x.sub.c.sup. in WBC, the mRNA expression level of SLC7A11 in WBC was examined with quantitative real-time PCR.
(58) RNA was isolated from the WBC obtained above using TRI Reagent (Molecular Research Center, Inc.) according to the protocol provided by the manufacturer. The RNA sample thus prepared was treated with DNase I to avoid DNA contamination. RNA concentration was determined by absorbance at 260 nm using an ND-1000 UV-Vis spectrophotometer (Thermo Fisher Scientific Inc.), followed by storage at 80 C.
(59) First-strand cDNA was then synthesized by the following steps. A 2.5 g aliquot of the isolated RNA was incubated with 0.5 g of a random hexamer and oligo-dT primers at 70 C. for 5 minutes to briefly denature the RNA secondary structure, followed by rapid cooling on ice to facilitate the annealing process between the primer and the RNA. 1500 uM dNTP, 20 U RNase inhibitor, 200 U MMLV reverse transcriptase (Promega), and a reverse transcription buffer were added to the PCR tube containing the RNA and primers, for a final volume of 20 l. The PCR tube was then incubated at 37 C. for 90 minutes for extension, followed by heating at 70 for 10 minutes so as to inactivate the reverse transcriptase. Synthesized first-strand cDNA was thus obtained.
(60) After cDNA synthesis, SYBR Green Master Mix on Real-Time PCR Detection System was employed to measure the mRNA expression of SLC7A11.
(61) Specifically, 2 l of the synthesized cDNA sample (250 ng), 10 l of Master mix (Roche), and each primer at a concentration of 600 nM (the primer pair for amplifying SLC7A11 is listed in Table 2) were added in a PCR tube, for a total of 20 l reaction volume. The sample in the PCR tube was pre-incubated at 95 C. for 10 minutes during the denaturation process to activate the Hot-Start DNA polymerase, followed by primer annealing at 58 C. for 45 seconds and DNA elongation for 45 cycles at 95 C. for 15 seconds. A melting curve program was run to verify the PCR product specificity. The RT-qPCR reaction was carried out twice. Negative controls were included to confirm that the sample was not cross-contaminated.
(62) Three housekeeping genes were used as endogenous controls, including the genes of glyceradehyde-3-photosphate dehydrogenase (GAPDH) (for which two primer pairs were used), beta-2-microglobulin (B2M), and hypoxanthine phosphoribosyltransferase (HPRT). The primer pairs of these housekeeping genes used in RT-qPCR are shown in Table 2. The average of the CT values of these housekeeping genes was used in the calculation of the relative mRNA expression level of SLC7A11 in the sample (CT=C.sub.T, targetC.sub.T, housekeeping).
(63) TABLE-US-00002 TABLE 2 Primer Pairs Used in RT-qPCR The corresponding PCR nucleotide residues in Product Target Gene the target Gene/ Size Name Primer Sequence (5-3) (bp) SLC7A11 F1 1269-1287 60 (corresponding ccatgaacggtggtgtgtt to NCBI (SEQ ID NO: 1) accession no. R1 1328-1310 NM_014331.3) gaccctctcgagacgcaac (SEQ ID NO: 2) GAPDH F2 1058-1076 102 (corresponding ccactcctccacctttgac to NCBI (SEQ ID NO: 3) accession no. R2 1159-1142 NM_002046.5) accctgttgctgtagcca (SEQ ID NO: 4) GAPDH F3 169-187 66 (corresponding agccacatcgctcagacac to NCBI (SEQ ID NO: 5) accession no. R3 234-216 NM_002046.5) gcccaatacgaccaaatcc (SEQ ID NO: 6) B2M F4 105-123 86 (corresponding ttctggcctggaggctatc to NCBI (SEQ ID NO: 7) accession no. R4 190-168 NM_004048.2) tcaggaaatttgactttccattc (SEQ ID NO: 8) HPRT F5 308-327 102 (corresponding acgtcttgctcgagatgtga to NCBI (SEQ ID NO: 9) accession no. R5 409-390 NM_000194.2 taatccagcaggtcagcaaa (SEQ ID NO: 10)
<Statistical Analysis of G72 Protein Level and SLC7A11 mRNA Expression Level>
(64) Baseline characteristics were calculated for the AD and control groups. Numeric data are presented as meansstandard deviation (SD). P-value between the AD and control groups was calculated based on t-test, and a probability value less than 0.05 (p<0.05) was considered to indicate statistical significance.
(65) A receiver operating characteristics (ROC) analysis for G72 Protein, SLC7A11 mRNA and the combination thereof was applied by plotting the proportion of true-positive results (sensitivity) vs. the proportion of false-positive results (1specificity).
(66) An equation (I) for the weighted value of G72 protein level and SLC7A11 mRNA expression level in combination as shown below was formulated using the logistic regression model, with G72 protein level and SLC7A11 mRNA expression level as the covariates:
A=13.246+B3.197+C2.273(I) A=Weighted value B=G72 protein level (ng/L) C=CT value
(67) An area under the ROC curve (AUC) for each biomarker was also calculated and used as an index to determine which biomarker had a good diagnostic ability to distinguish patients from healthy subjects (see Zweig M. H. (1993), Clin. Chem., 39:561-577). Interpretations of AUC value include: outstanding (AUC>0.9), excellent (AUC=0.80.9), acceptable (AUC=0.70.8), poor (AUC=0.60.7), and no discrimination (AUC=0.5).
(68) Results:
(69) G72 Protein as a Biomarker for Diagnosing AD
(70) As shown in Table 3, regarding the matched cohort, the expression level of G72 protein in the plasma of the AD group was markedly higher than that of the control group. Specifically, the expression levels of G72 protein in the matched AD group and control group were 2.631.20 ng/L and 1.720.71 ng/L, respectively. These results indicate that the G72 protein in a plasma sample can serve as a biomarker for the detection of AD.
(71) As shown in Table 4, the ROC analysis of the G72 expression level for the AD group vs. control group indicated an optimal cutoff value of 2.3285 ng/L, suggesting that a G72 protein level in plasma which is equal to or greater than 2.3285 ng/L may be indicative of AD. Findings also showed that the ROC curve analysis of G72 expression levels for the AD group vs. control group had good specificity (0.900) but only modest sensitivity (0.543). Thus, a diagnostic method with higher levels of sensitivity may be warranted.
(72) In addition, the AUC for G72 protein levels in plasma is 0.726, suggesting an acceptable diagnostic ability to distinguish the subjects in the control group from those in the AD group.
(73) Overall, these results indicate that using the G72 protein in plasma as the sole biomarker for AD is considered to provide an acceptable diagnostic ability to distinguish subjects in the control group from those in the AD group. Moreover, a diagnostic method with higher levels of sensitivity may be warranted.
(74) SLC7A11 mRNA as a Biomarker for Diagnosing AD
(75) The CT value indicative of the SLC7A11 mRNA expression level in WBC of the AD group was markedly higher than that of the control group (see Table 3). Specifically, the CT values indicative of the expression levels of SLC7A11 mRNA in the matched AD group and control group were 13.821.29 and 12.441.37, respectively. These results indicate that the SLC7A11 mRNA in WBC samples can serve as a biomarker for the detection of AD.
(76) Referring to Table 4, the ROC analysis of the CT values of SLC7A11 mRNA expression levels for the AD group vs. control group indicated an optimal cutoff value of 12.185, suggesting that a CT value of SLC7A11 mRNA expression level in WBC which is equal to or greater than 12.185 may be indicative of AD. Findings also showed that the ROC curve analysis of CT values indicative of SLC7A11 mRNA expression levels for the AD group vs. control group had good sensitivity (0.929) but only modest specificity (0.45). Thus, a diagnostic method with higher levels of specificity may be warranted.
(77) As shown in Table 4, the AUC for SLC7A11 mRNA expression levels in WBC is 0.764, suggesting an acceptable diagnostic ability to distinguish the subjects in the control group from those in the AD group.
(78) Overall, similar to using only the G72 protein in plasma as the sole biomarker for AD, using the SLC7A11 mRNA in WBC as the sole biomarker for AD is also considered to provide an acceptable diagnostic ability to distinguish the subjects in the control group from those in the AD group. A diagnostic method with higher levels of specificity may be warranted.
(79) Combination of G72 Protein Level in Plasma and SLC7A11 mRNA Expression Level in WBC for Diagnosing AD
(80) Overall, the G72 protein level and the CT value indicative of SLC7A11 mRNA expression level of the AD group were markedly higher than those of the control group (see Table 3). These results indicate that the plasma G72 protein level and WBC SLC7A11 mRNA expression level can be used in combination to detect AD.
(81) As shown in Table 4, the ROC analysis of the G72 protein levels and the CT values indicative of SLC7A11 mRNA expression levels in combination for the AD group vs. control group indicated an optimal cutoff value of 21.723, with good sensitivity (0.857) and modest specificity (0.675). These results suggest that the combination of the G72 protein level and the CT value indicative of the SLC7A11 mRNA expression level, which has a cut-off value equal to or greater than 21.723, may be indicative of AD.
(82) In addition, it can be seen that the sensitivity of the combination of the G72 protein level and the CT value indicative of the SLC7A11 mRNA expression level (0.857) is greater than that of the G72 level (0.543) alone. Furthermore, the specificity of the combination of the G72 protein level and the CT value indicative of the SLC7A11 mRNA expression level (0.675) is greater than that of the CT value indicative of the SLC7A11 mRNA expression level (0.45) alone.
(83) In particular, the combination of the G72 protein level and the CT value indicative of the SLC7A11 mRNA expression level (AUC=0.833) was higher in AUC than either the G72 protein level (AUC=0.726) or the CT value indicative of the SLC7A11 mRNA expression level (AUC=0.764) alone. Such AUC findings reveal that the combination of the G72 protein level and the SLC7A11 mRNA expression level provide for a better diagnostic ability to differentiate between the subjects in the AD and control groups than either the G72 protein level or the SLC7A11 mRNA expression level alone. Thus, there is a synergic effect when using the two biomarkers in combination when distinguishing individuals with AD from those without AD.
(84) TABLE-US-00003 TABLE 3 Expression levels of Plasma G72 protein and WBC SLC7A11 mRNA in the control group and AD group Parameter Control Group AD Group P-value G72 level (ng/L) 1.72 0.71 2.63 1.20 <0.001 mRNA of SLC7A11.sup. 12.44 1.37 13.82 1.29 <0.001 G72 + mRNA of 20.54 4.03 26.59 4.83 <0.001 SLC7A11.sup. .sup.shown as delta CT values of mRNA expressions of SLC7A11 .sup.shown as a weighted value calculated by the equation (I)
(85) TABLE-US-00004 TABLE 4 ROC Curve Analysis and Multivariate Logistic Regression of Plasma G72 Protein and/or WBC mRNA of SLC7A11 Levels of Control vs. AD groups ROC curve analysis Cut-off Sensitivity Specificity AUC G72 >2.3285 54.3 90.0 0.726 mRNA of >12.185 92.9 45.0 0.764 SLC7A11.sup. G72 + mRNA of >21.723 85.7 67.5 0.833 SLC7A11.sup. .sup.shown as delta CT values of mRNA expressions of SLC7A11 .sup.shown as a weighted value calculated by the equation (I)
(86) All patents and literature references cited in the present specification as well as the references described therein, are hereby incorporated by reference in their entirety. In case of conflict, the present description, including definitions, will prevail.
(87) While this disclosure has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the disclosure following, in general, the principles of the disclosure and including such departures from the present customary practice within the art to which the disclosure pertains and as may be applied to the essential features hereinbefore set forth, and as follows in the scope of the appended claims.