Mutant Hydroxyphenylpyruvate Dioxygenase Polypeptide, Encoding Gene Thereof and Use Therefor

Abstract

Provided is a mutant hydroxyphenylpyruvate dioxygenase (HPPD) polypeptide, an encoding gene thereof and a use thereof. The mutant HPPD polypeptide retains the activity of catalyzing the conversion of hydroxyphenylpyruvate acid into homogentisic acid or homogentisate, and the sensitivity to HPPD inhibitor herbicides is lower than that of original unmutated HPPD. On position 372 corresponding to the amino acid sequence represented by SEQ ID NO: 1, the mutant HPPD polypeptide comprises the following mutations: F372A, F372G, F372V, F372P, F372S, F372T, F372C, F372M, F372Q, F372D or F372 deletion. The described mutant can provide plants with high tolerance to HPPD inhibitor herbicides, and can be used to cultivate plants that are tolerant to HPPD inhibitor herbicides.

Claims

1. A mutant hydroxyphenylpyruvate dioxygenase polypeptide, which retains the activity of catalyzing the reaction of transforming 4-hydroxyphenylpyruvic acid into homogentisic acid or homogentisate and is less sensitive to an HPPD-inhibitor herbicide than the native unmutated HPPD, characterized by comprising the following mutation at a position corresponding to position 372 of the amino acid sequence as set forth in SEQ ID NO:1: F372A, F372G, F372V, F372P, F372S, F372T, F372C, F372M, F372Q, F372D, or F372 deletion; Preferably, the mutant hydroxyphenylpyruvate dioxygenase polypeptide comprises the following mutation at a position corresponding to position 372 of the amino acid sequence as set forth in SEQ ID NO: 1: F372A, F372G or F372V. More preferably, the mutant hydroxyphenylpyruvate dioxygenase polypeptide comprises the following mutation at a position corresponding to position 372 of the amino acid sequence as set forth in SEQ ID NO:1: F372A.

2. The mutant hydroxyphenylpyruvate dioxygenase polypeptide according to claim 1, characterized in that the mutant hydroxyphenylpyruvate dioxygenase polypeptide is derived from HPPDs in plants or microorganisms. Preferably, the plant comprises monocotyledonous plants and dicotyledonous plants; more preferably, the plant is oats, wheat, barley, millet, corn, sorghum, Brachypodiumdistachyon, rice, tobacco, sunflower, alfalfa, soybean, cicerarietinum, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato or Arabidopsisthaliana; Preferably, the microorganism is Cyanophyta, Pseudomonasfluorescens, or bacteria from the genus Sphingobium or Burkholderia.

3. The mutant hydroxyphenylpyruvate dioxygenase polypeptide according to claim 2, characterized in that, when the native unmutated HPPD has an amino acid sequence as set forth in SEQ ID NO:1, the polypeptide further comprises the following mutation at position 372 of the amino acid sequence as set forth in SEQ ID NO:1: F372L, F372I, F372W, F372N, F372E or F372K.

4. The mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any of claims 1–3, 3, characterized in that the mutant hydroxyphenylpyruvate dioxygenase polypeptide comprises a second mutation; Preferably, the second mutation at a position corresponding to position 413 of the amino acid sequence as set forth in SEQ ID NO:1 comprises the following mutation: G413W, G413H, G413M, G413F or G413C; more preferably, the second mutation at a position corresponding to position 413 of the amino acid sequence as set forth in SEQ ID NO:1 is G413W mutation; Optionally, when the native unmutated HPPD has an amino acid sequence as set forth in SEQ ID NO:1, the second mutation at position 110 of the amino acid sequence as set forth in SEQ ID NO:1 is deletion mutation.

5. A polynucleotide encoding the mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any of claims 1-4.

6. An expression cassette or a recombinant vector, characterized by comprising the polynucleotide according to claim 5 under the regulation of effectively-linked regulatory sequences.

7. A method for expanding the scope of herbicides to which the plants are tolerant, comprising expressing the mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any of claims 1–4 together with at least one herbicide-tolerant protein other than the mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any of claims 1–4.

8. The method for expanding the scope of herbicides to which the plants are tolerant according to claim 7, characterized in that the herbicide-tolerant protein is 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), glyphosate oxidoreductase, glyphosate-N-acetyltransferase, glyphosate decarboxylase, glufosinate acetyltransferase, alpha-ketoglutarate-dependent dioxygenase, dicamba monooxygenase, acetolactate synthase, cytochrome-like protein and/or protoporphyrinogen oxidase.

9. A method for selecting transformed plant cells, characterized by comprising transforming a plurality of plant cells with the polynucleotide according to claim 5, and cultivating the cells under a concentration of the HPPD-inhibitor herbicide that allows the growth of the transformed cells expressing the polynucleotide, while killing the untransformed cells or inhibiting the growth of the untransformed cells; Preferably, the plant comprises monocotyledonous plants and dicotyledonous plants; more preferably, the plant is oats, wheat, barley, millet, corn, sorghum, Brachypodiumdistachyon, rice, tobacco, sunflower, alfalfa, soybean, Cicerarietinum, peanuts, sugar beet, cucumber, cotton, oilseed rape, potato, tomato or Arabidopsisthaliana; Preferably, the HPPD-inhibitor herbicide comprises an HPPD-inhibitor herbicide from the class of pyrazolinates, triketones and/or isoxazoles; more preferably, the HPPD-inhibitor herbicide of pyrazolinates is topramezone, the HPPD-inhibitor herbicide of triketones is mesotrione, and the HPPD-inhibitor herbicide of isoxazoles is isoxaflutole.

10. A method for controlling weeds, characterized by comprising applying an effective dose of the HPPD-inhibitor herbicide to a field planting with a target plant, wherein the target plant contains the polynucleotide according to claim 5; Preferably, the target plant comprises monocotyledonous plants and dicotyledonous plants; more preferably, the target plant is oats, wheat, barley, millet, corn, sorghum, Brachypodiumdistachyon, rice, tobacco, sunflower, alfalfa, soybean, Cicerarietinum, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato or Arabidopsisthaliana; further preferably, the target plant is glyphosate-tolerant plant, and the weeds are glyphosate-resistant weeds; Preferably, the HPPD-inhibitor herbicide comprises an HPPD-inhibitor herbicide from the class of pyrazolinates, triketones and/or isoxazoles; more preferably, the HPPD-inhibitor herbicide of pyrazolinates is topramezone, the HPPD-inhibitor herbicide of triketones is mesotrione, and the HPPD-inhibitor herbicide of isoxazoles is isoxaflutole.

11. A method for protecting a plant from damages caused by an HPPD-inhibitor herbicide or for conferring tolerance to HPPD-inhibitor herbicide upon a plant, characterized by comprising introducing the polynucleotide according to claim 5 or the expression cassette or the recombinant vector according to claim 6 into the plant, resulting in an amount of the mutant hydroxyphenylpyruvate dioxygenase polypeptide that is sufficient to protect the plant into which the polynucleotide or the expression cassette or the recombinant vector has been introduced from damages caused by the HPPD-inhibitor herbicide, Preferably, the plant comprises monocotyledonous plants and dicotyledonous plants; more preferably, the plant is oats, wheat, barley, millet, corn, sorghum, Brachypodiumdistachyon, rice, tobacco, sunflower, alfalfa, soybean, Cicerarietinum, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato or Arabidopsisthaliana; Preferably, the HPPD-inhibitor herbicide comprises an HPPD-inhibitor herbicide from the class of pyrazolinates, triketones and/or isoxazoles; more preferably, the HPPD-inhibitor herbicide of pyrazolinates is topramezone, the HPPD-inhibitor herbicide of triketones is mesotrione, and the HPPD-inhibitor herbicide of isoxazoles is isoxaflutole.

12. A method for generating a plant which is tolerant to an HPPD-inhibitor herbicide, characterized by comprising introducing the polynucleotide according to claim 5 into the genome of the plant; Preferably, the introduction method comprises genetic transformation, genome editing or gene mutation methods. Preferably, the plant comprises monocotyledonous plants and dicotyledonous plants; more preferably, the plant is oats, wheat, barley, millet, corn, sorghum, Brachypodiumdistachyon, rice, tobacco, sunflower, alfalfa, soybean, Cicerarietinum, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato or Arabidopsisthaliana; Preferably, the HPPD-inhibitor herbicide comprises an HPPD-inhibitor herbicide from the class of pyrazolinates, triketones and/or isoxazoles; more preferably, the HPPD-inhibitor herbicide of pyrazolinates is topramezone, the HPPD-inhibitor herbicide of triketones is mesotrione, and the HPPD-inhibitor herbicide of isoxazoles is isoxaflutole.

13. A method for cultivating a plant which is tolerant to an HPPD-inhibitor herbicide, characterized by comprising: planting at least one plant propagule, wherein the plant propagule comprises in its genome the polynucleotide according to claim 5; allowing the plant propagule to grow into a plant; and applying an effective dose of the HPPD-inhibitor herbicide to a plant growing environment comprising at least the plant, and harvesting the plant having a reduced plant damage and/or increased plant yield compared to other plants without the polynucleotide according to claim 5; Preferably, the plant comprises monocotyledonous plants and dicotyledonous plants; more preferably, the plant is oats, wheat, barley, millet, corn, sorghum, Brachypodiumdistachyon, rice, tobacco, sunflower, alfalfa, soybean, Cicerarietinum, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato or Arabidopsisthaliana; Preferably, the HPPD-inhibitor herbicide comprises an HPPD-inhibitor herbicide from the class of pyrazolinates, triketones and/or isoxazoles; more preferably, the HPPD-inhibitor herbicide of pyrazolinates is topramezone, the HPPD-inhibitor herbicide of triketones is mesotrione, and the HPPD-inhibitor herbicide of isoxazoles is isoxaflutole.

14. A method for obtaining a processed agricultural product, characterized by comprising treating the harvested product obtained by the method according to claim 13 from the plant which is tolerant to the HPPD-inhibitor herbicide to obtain a processed agricultural product.

15. A planting system for controlling the growth of weeds, characterized by comprising an HPPD-inhibitor herbicide and a plant growing environment in which at least one target plant is present, wherein the target plant contains the polynucleotide according to claim 5; Preferably, the target plant comprises monocotyledonous plants and dicotyledonous plants; more preferably, the target plant is oats, wheat, barley, millet, corn, sorghum, Brachypodiumdistachyon, rice, tobacco, sunflower, alfalfa, soybean, Cicerarietinum, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato or Arabidopsisthaliana; further preferably, the target plant is a glyphosate-tolerant plant, and the weeds are glyphosate-resistant weeds. Preferably, the HPPD-inhibitor herbicide comprises an HPPD-inhibitor herbicide from the class of pyrazolinates, triketones and/or isoxazoles; more preferably, the HPPD-inhibitor herbicide of pyrazolinates is topramezone, the HPPD-inhibitor herbicide of triketones is mesotrione, and the HPPD-inhibitor herbicide of isoxazoles is isoxaflutole.

16. Use of the mutant hydroxyphenylpyruvate dioxygenase polypeptide according to any of claims 1–4 for conferring tolerance to an HPPD-inhibitor herbicide upon a plant; Preferably, the plant comprises monocotyledonous plants and dicotyledonous plants; more preferably, the plant is oats, wheat, barley, millet, corn, sorghum, Brachypodiumdistachyon, rice, tobacco, sunflower, alfalfa, soybean, Cicerarietinum, peanut, sugar beet, cucumber, cotton, oilseed rape, potato, tomato or Arabidopsisthaliana; Preferably, the HPPD-inhibitor herbicide comprises an HPPD-inhibitor herbicide from the class of pyrazolinates, triketones and/or isoxazoles; more preferably, the HPPD-inhibitor herbicide of pyrazolinates is topramezone, the HPPD-inhibitor herbicide of triketones is mesotrione, and the HPPD-inhibitor herbicide of isoxazoles is isoxaflutole.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0120] FIG. 1 is a schematic structural diagram of a recombinant expression vector DBN11375 containing the AsHPPDm-F372A-02 nucleotide sequence for Arabidopsisthaliana according to the present invention;

[0121] FIG. 2 is a photo showing the tolerance of the Arabidopsis thaliana T.sub.1 plants into which an Avenasativa HPPD gene (unmutated and mutated) was introduced to topramezone according to the present invention (A: wild-type Arabidopsisthaliana plants; B: Arabidopsisthaliana T.sub.1 plants into which an AsHPPD-02 nucleotide was introduced; C: Arabidopsisthaliana T.sub.1 plants into which an AsHPPDm-F372A-02 nucleotide sequence was introduced);

[0122] FIG. 3 is a phylogenetic tree of HPPDs from different species according to the present invention;

[0123] FIG. 4 is a series of photos showing the tolerance of Arabidopsisthaliana T.sub.1 plants into which HPPD genes (unmutated and mutated) from different sources were introduced to topramezone according to the present invention (A: wild-type Arabidopsisthaliana plants; B: Arabidopsisthaliana T.sub.1 plants into which unmutated HPPD genes (optimized according to codon usage bias) were introduced; C: Arabidopsisthaliana T.sub.1 plants into which mutated HPPD genes (F372A) were introduced);

[0124] FIG. 5 is a schematic structural diagram of a control recombinant expression vector DBN11375NN according to the present invention;

[0125] FIG. 6 is a schematic structural diagram of a recombinant expression vector DBN11950 containing the AsHPPDm-F372A-02 nucleotide sequence for Oryzasativa according to the present invention;

[0126] FIG. 7 is a series of photos showing the tolerance of T.sub.1 soybean plants into which a mutated HPPD gene was introduced to topramezone according to the present invention (A: soybean T.sub.1 plants into which a control vector DBN11375NN was introduced; B: soybean T.sub.1 plants into which an AsHPPDm-F372A-02 nucleotide sequence was introduced; C: soybean T.sub.1 plants into which a ZmHPPDm-F372A-02 nucleotide sequence was introduced; D: soybean T.sub.1 plants into which a PfHPPDm-F372A-02 nucleotide sequence was introduced; E: soybean T.sub.1 plants into which an AsHPPDm-F372A-A110 nucleotide sequence was introduced; F: soybean T.sub.1 plants into which a PfHPPDm-F372A-G413W nucleotide sequence was introduced).

DETAILED DESCRIPTION OF THE INVENTION

[0127] The embodiments of the mutant hydroxyphenylpyruvate dioxygenase polypeptide, the coding gene and use thereof according to the present invention will be further illustrated in specific examples.

Example 1: Selection of Position 372 of AsHPPD for Mutation and Verification of The Mutation Effect

1. Acquisition of AsHPPD and AsHPPDm-F372A Genes

[0128] The amino acid sequence (440 amino acids) of the Avenasativa native HPPD (AsHPPD) is set forth as SEQ ID NO: 1 in the SEQUENCE LISTING; the AsHPPD-01 nucleotide sequence (1323 nucleotides) encoding the AsHPPD is set forth as SEQ ID NO: 2 in the SEQUENCE LISTING, and the AsHPPD-02 nucleotide sequence encoding the AsHPPD, which was obtained based on the Arabidopsisthaliana/soybean/rice common codon usage bias, is set forth as SEQ ID NO: 3 in the SEQUENCE LISTING.

[0129] Position 372 of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), to obtain a mutant AsHPPD (AsHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 4 in the SEQUENCE LISTING. The mutant AsHPPD-01 (AsHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 5 in the SEQUENCE LISTING. The AsHPPDm-F372A-02 nucleotide sequence encoding the AsHPPDm-F372A, which was obtained based on the Arabidopsisthaliana/soybean/rice common codon usage bias, is set forth as SEQ ID NO: 6 in the SEQUENCE LISTING.

2. Synthesis of the Aforementioned Nucleotide Sequences

[0130] The 5′ and 3′ ends of the synthesized AsHPPD-02 nucleotide sequence (SEQ ID NO: 3) and AsHPPDm-F372A-02 nucleotide sequence (SEQ ID NO: 6) were respectively linked to a universal adapter primer 1:

[0131] Universal adapter primer 1 for the 5′ end: 5′-agtttttctgattaacagactagt-3′, as set forth in SEQ ID NO: 399 in the SEQUENCE LISTING; and

[0132] Universal adapter primer 1 for the 3′ end: 5′-caaatgtttgaacgatcggcgcgcc-3′, as set forth in SEQ ID NO: 400 in the SEQUENCE LISTING.

3. Construction of Recombinant Expression Vectors Containing Avena Sativa HPPD Genes (F372A) for Arabidopsis Thaliana

[0133] A plant expression vector DBNBC-01 was subjected to double digestion using restriction enzymes Spe I and Asc I to linearize the plant expression vector. The digestion product was purified to obtain the linearized DBNBC-01 expression vector backbone (vector backbone: pCAMBIA2301 (which is available from CAMBIA)) which then underwent a recombination reaction with the AsHPPDm-F372A-02 nucleotide sequence linked to the universal adapter primer 1, according to the procedure of Takara In-Fusion products seamless connection kit (Clontech, CA, USA, CAT: 121416) instructions, to construct a recombinant expression vector DBN11375 with the schematic structure as shown in FIG. 1 (Spec: spectinomycin gene; RB: right border; eFMV: 34S enhancer of Figwort mosaic virus (SEQ ID NO: 7); prBrCBP: promoter of oilseed rape eukaryotic elongation factor gene 1α (Tsf1) (SEQ ID NO: 8); spAtCTP2: Arabidopsisthaliana chloroplast transit peptide (SEQ ID NO: 9); EPSPS: 5-enolpyruvylshikimate-3-phosphate synthase gene (SEQ ID NO: 10); tPsE9: terminator of a pea RbcS gene (SEQ ID NO: 11); prAtUbi10: promoter of an Arabidopsisthaliana Ubiquitin 10 gene (SEQ ID NO: 12; AsHPPDm-F372A-02: AsHPPDm-F372A-02 nucleotide sequence (SEQ ID NO: 6); tNos: terminator of a nopaline synthase gene (SEQ ID NO: 13); pr35S: the cauliflower mosaic virus 35S promoter (SEQ ID NO: 14); PAT: phosphinothricin acetyltransferase gene (SEQ ID NO: 15); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 16); LB: left border).

[0134] Escherichia coli T.sub.1 competent cells were transformed with the recombinant expression vector DBN11375 by using a heat shock method under the following heat shock conditions: 50 .Math.L of Escherichia coli T.sub.1 competent cells and 10 .Math.L of plasmid DNA (recombinant expression vector DBN11375) were water-bathed at 42° C. for 30 seconds, shake cultured at 37° C. for 1 hour (using a shaker at a rotation speed of 100 rpm for shaking), and then cultured under the condition of a temperature of 37° C. on the LB solid plate containing 50 mg/L of spectinomycin for 12 hours; white bacterial colonies were picked out, and cultured under the condition of a temperature of 37° C. overnight in an LB liquid culture medium (10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and 50 mg/L of spectinomycin; adjusted to a pH of 7.5 with NaOH). The plasmids in the cells were extracted through an alkaline method: the bacteria solution was centrifuged at a rotation speed of 12,000 rpm for 1 min, the supernatant was removed, and the precipitated thalli were suspended with 100 .Math.L of ice pre-cooled solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), and 50 mM glucose, with a pH of 8.0); 200 .Math.L of newly prepared solution II (0.2 M NaOH, 1% SDS (sodium dodecyl sulfate)) was added, mixed by inverting the tube 4 times, and placed on ice for 3-5 min; 150 .Math.L of ice-cold solution III (3 M potassium acetate, 5 M acetic acid) was added, mixed uniformly immediately and placed on ice for 5-10 min; the mixture was centrifuged under the conditions of a temperature of 4° C. and a rotation speed of 12,000 rpm for 5 min, 2-fold volumes of anhydrous ethanol was added to the supernatant, mixed uniformly and placed at room temperature for 5 min; the mixture was centrifuged under the conditions of a temperature of 4° C. and a rotation speed of 12,000 rpm for 5 min, the supernatant was discarded, and the precipitate was washed with ethanol at a concentration of 70% (V/V) and then was air dried; 30 .Math.L of TE (10 mM Tris-HCl, and 1 mM EDTA, with a pH of 8.0) containing RNase (20 .Math.g/mL) was added to dissolve the precipitate; the obtained product was water bathed at a temperature of 37° C. for 30 min to digest the RNA; and stored at a temperature of -20° C. for use. The extracted plasmids were identified by sequencing. The results showed that the nucleotide sequence between the SpeI and AscI sites in the recombinant expression vector DBN11375 was the one as set forth in SEQ ID NO: 6 in the SEQUENCE LISTING, i.e., the AsHPPDm-F372A-02 nucleotide sequence.

[0135] According to the method for constructing the recombinant expression vector DBN11375 as described above, the AsHPPD-02 nucleotide sequence linked to the universal adapter primer 1 was subjected to a recombination reaction with the linearized DBNBC-01 expression vector backbone to constructe a recombinant expression vector DBN11375N. Sequencing verified that the nucleotide sequence in the recombinant expression vector DBN11375N comprises the one as set forth in SEQ ID NO: 3 in the SEQUENCE LISTING; i.e., the AsHPPD-02 nucleotide sequence was inserted correctly.

4. Transformation of Agrobacterium with the Recombinant Expression Vectors for Arabidopsis Thaliana

[0136] The recombinant expression vectors DBN11375 and DBN11375N which had been constructed correctly were respectively transformed into Agrobacterium GV3101 using a liquid nitrogen method, under the following transformation conditions: 100 .Math.L of Agrobacterium GV3101 and 3 .Math.L of plasmid DNA (recombinant expression vector) were placed in liquid nitrogen for 10 minutes, and bathed in warm water at 37° C. for 10 min; the transformed Agrobacterium GV3101 was inoculated into an LB tube, cultured under the conditions of a temperature of 28° C. and a rotation speed of 200 rpm for 2 hours, and spread on the LB solid plate containing 50 mg/L of rifampicin and 50 mg/L of spectinomycin until positive single clones were grown, and single clones were picked out for culturing and the plasmids thereof were extracted. The extracted plasmids were identified by sequencing. The results showed that the structures of the recombinant expression vectors DBN11375 and DBN1137SN were completely correct.

5. Acquisition of Transgenic Arabidopsis Thaliana Plants

[0137] Seeds of wild-type Arabidopsisthaliana were suspended in a 0.1% (w/v) agarose solution. The suspended seeds were stored at 4° C. for 2 days to fulfill the need for dormancy, in order to ensure synchronous seed germination. Vermiculite was mixed with horse manure soil, the mixture was sub-irrigated with water to wet, and the soil mixture was allowed to drain the water away for 24 hours. The pretreated seeds were sowed in the soil mixture and covered with a moisturizing cover for 7 days. The seeds were germinated and the plants were cultivated in a greenhouse under long sunlight conditions (16-hour light/8-hour dark) at a constant temperature (22° C.) and a constant humidity (40-50%), with a light intensity of 120-150 .Math.mol/m.sup.2s.sup.-1. The plants were initially irrigated with Hoagland’s nutrient solution and then with deionized water, thus keeping the soil moist, but not water penetrated.

[0138] Arabidopsisthaliana was transformed using the flower soaking method. One or more 15-30 mL pre-cultures of a LB culture solution (10 g/L of tryptone, 5 g/L of yeast extract, and 10 g/L of NaCl; adjusted to a pH of 7.5 with NaOH) containing spectinomycin (50 mg/L) and rifampicin (10 mg/L) were inoculated with the picked Agrobacterium colonies. The pre-cultures were incubated at a temperature of 28° C. and a rotation speed of 220 rpm with shaking at a constant speed overnight. Each pre-culture was used to inoculate two 500 mL cultures of the LB culture solution containing spectinomycin (50 mg/L) and rifampicin (10 mg/L), and the cultures were incubated at 28° C. with continuous shaking overnight. Centrifugation at a rotation speed of about 4,000 rpm was carried out at room temperature for 20 minutes to precipitate cells, and the resulting supernatant was discarded. The cell precipitate was gently re-suspended in 500 mL of an osmotic medium which contained ½×MS salt/B5 vitamin, 10% (w/v) sucrose, 0.044 .Math.M of benzylaminopurine (10 .Math.L/L (1 mg/mL stock solution in DMSO)) and 300 .Math.L/L of Silvet L-77. About 1-month-old Arabidopsisthaliana plants were soaked in an osmotic culture medium which contained re-suspended cells for 15 seconds to ensure immersion of the latest inflorescence. Then, the Arabidopsisthaliana plants were reclined laterally and covered and they were kept wet in dark for 24 hours. The Arabidopsisthaliana plants were normally cultivated with a photoperiod of 16 hours of light/8 hours of darkness at 22° C. Seeds were harvested after about 4 weeks.

[0139] The newly harvested (AsHPPDm-F372A-02 nucleotide sequence and AsHPPD-02 nucleotide sequence) T.sub.1 seeds were dried at room temperature for 7 days. The seeds were sowed in 26.5 cm ×51 cm germination disks, and 200 mg of T.sub.1 seeds (about 10,000 seeds) were accepted per disk, wherein the seeds had been previously suspended in distilled water and stored at 4° C. for 2 days to fulfill the need for dormancy, in order to ensure synchronous seed germination.

[0140] Vermiculite was mixed with horse manure soil, the mixture was sub-irrigated with water to wet, and water was drained by gravity. The pretreated seeds were sowed evenly in the soil mixture using a pipette, and covered with a moisturizing cover for 4-5 days. The cover was removed 1 day before the post-emergence spraying application of glufosinate (used to select the co-transformed PAT gene) for the selection of initial transformant.

[0141] The T.sub.1 plants were sprayed with a 0.2% solution of a Liberty herbicide (200 g ai/L of glufosinate) by a DeVilbiss compressed air nozzle at a spray volume of 10 mL/disk (703 L/ha) 7 days after planting (DAP) and 11 DAP (the cotyledon stage and 2-4 leaf stage, respectively) to provide an effective amount of glufosinate of 280 g ai/ha per application. Surviving plants (actively growing plants) were identified 4-7 days after the final spraying, and transplanted to 7 cm×7 cm square pots prepared from horse manure soil and vermiculite (3-5 plants/disk). The transplanted plants were covered with a moisturizing cover for 3-4 days, and placed in a 22° C. culture chamber or directly transferred into a greenhouse as described above. Then, the cover was removed, and at least 1 day before testing the ability of the mutant HPPD gene to provide topramezone herbicide tolerance, the plants were planted in a greenhouse (22±5° C., 50±30% RH, 14 hours of light: 10 hours of darkness, a minimum of 500 .Math.E/m.sup.2s.sup.-1 natural+supplemental light).

6. Detection of the Herbicide Tolerance of the Transgenic Arabidopsis Thaliana Plants Containing the AsHPPDm-F372A-02 Nucleotide Sequence.

[0142] T.sub.1 transformants were initially selected from the untransformed seeds using a glufosinate selection scheme. About 20,000 T.sub.1 seeds were screened, and 314 T.sub.1 generation positive transformants (PAT gene) were identified, with a transformation efficiency of about 1.6%.

[0143] The Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsis thaliana T.sub.1 plants into which the AsHPPD-02 nucleotide sequence was introduced and wild-type Arabidopsisthaliana plants (18 days after sowing) were sprayed with topramezone at four different concentrations, i.e., 25 g ai/ha (one-fold field concentration, 1×), 50 g ai/ha (two-fold field concentration, 2×), 100 g ai/ha (four-fold field concentration, 4×) and 0 g ai/ha (water, 0×) to determine the tolerance of Arabidopsisthaliana to the herbicide. The degree of damage caused by the herbicide was measured for each plant according to the proportion of bleached leaf area (the proportion of bleached leaf area=bleached leaf area/total leaf area×100%) 7 days after spraying (7 DAT): the case where there is basically no bleached phenotype is defined as grade 0, the case where the proportion of bleached leaf area is less than 50% is defined as grade 1,the case where the proportion of bleached leaf area is more than 50% is defined as grade 2, and the case where the proportion of bleached leaf area is 100% grade is defined as grade 3.

[0144] According to the formula X=[Σ(N×S)/(T×M)]×100, the performance of resistance of the transformation event of each recombinant expression vector was scored (X-the score for pesticide damage, N-the number of plants with the same grade of damage, S- the pesticide damage grade, T-the total number of plants, M-the maximum grade of pesticide damage) and the resistance is evaluated based on the scores: highly resistant plants (scores 0-15), moderately resistant plants (scores 16-33), poorly resistant plants (scores 34-67) and non-resistant plants (scores 68-100). The experimental results are shown in TABLE 1 and FIG. 2.

TABLE-US-00001 Topramezone tolerance of transgenic Arabidopsis thaliana T.sub.1 plants Arabidopsis thaliana genotypes Concentration (g ai/ha) Classification and statistics of the grade of pesticide damage Scores Resistance evaluation Grade 0 Grade 1 Grade 2 Grade 3 Wild type 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 50 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant AsHPPD-02 0 16 0 0 0 0 25 0 4 12 0 58 poorly resistant 50 0 0 6 10 88 non-resistant 100 0 0 4 12 92 non-resistant AsHPPDm-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 50 16 0 0 0 0 highly resistant 100 16 0 0 0 0 highly resistant

[0145] The results of TABLE 1 and FIG. 2 show that the Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced had a good tolerance to (highly resistant to) topramezone, while the wild-type Arabidopsisthaliana plants and the Arabidopsisthaliana T.sub.1 plants into which the AsHPPD-02 nucleotide was introduced had no or relatively low tolerance to topramezone at various concentrations. Thus, it is inferred that mutation of position 372 of the HPPD amino acid sequence (F372A) can confer tolerance to topramezone upon the plants.

Example 2: Mutation of Position 372 of the HPPD Amino Acid Sequences From Different Species (F372A) and Verification of the Mutation Effect

[0146] In order to further verify the effect of mutation of position 372 of the HPPD amino acid sequence, a phylogenetic tree of HPPDs from different species (as shown in FIG. 3) was analyzed. HPPDs from representative species on different branches were selected and position 372 of the amino acid sequence was mutated (F372A) so as to verify the mutation effect.

1. Acquisition of HPPDs From Different Species and Mutant HPPDs (F372A)

[0147] The amino acid sequence (444 amino acids) of the native Zeamays HPPD (ZmHPPD) is set forth as SEQ ID NO: 17 in the SEQUENCE LISTING; the ZmHPPD-01 nucleotide sequence (1335 nucleotides) encoding the ZmHPPD is set forth as SEQ ID NO: 18 in the SEQUENCE LISTING, and the ZmHPPD-02 nucleotide sequence encoding the ZmHPPD, which was obtained based on the Arabidopsisthaliana/soybean/rice common codon usage bias, is set forth as SEQ ID NO: 19 in the SEQUENCE LISTING. Position 372 of the ZmHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant ZmHPPD (ZmHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 20 in the SEQUENCE LISTING. The mutant ZmHPPD-01 (ZmHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 21 in the SEQUENCE LISTING. The ZmHPPDm-F372A-02 nucleotide sequence encoding the ZmHPPDm-F372A, which was obtained based on the Arabidopsisthaliana/soybean/rice common codon usage bias, is set forth as SEQ ID NO: 22 in the SEQUENCE LISTING.

[0148] The amino acid sequence (445 amino acids) of the native Arabidopsisthaliana HPPD (AtHPPD) is set forth as SEQ ID NO: 23 in the SEQUENCE LISTING; the AtHPPD nucleotide sequence (1338 nucleotides) encoding the AtHPPD is set forth as SEQ ID NO: 24 in the SEQUENCE LISTING. Position 372 of the AtHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant AtHPPD (AtHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 25 in the SEQUENCE LISTING. The AtHPPDm-F372A nucleotide sequence encoding the AtHPPDm-F372A is set forth as SEQ ID NO: 26 in the SEQUENCE LISTING.

[0149] The amino acid sequence (358 amino acids) of the native Pseudomonasfluorescens HPPD (PfHPPD) is set forth as SEQ ID NO: 27 in the SEQUENCE LISTING; the PfHPPD-01 nucleotide sequence (1077 nucleotides) encoding the PfHPPD is set forth as SEQ ID NO: 28 in the SEQUENCE LISTING, and the PfHPPD-02 nucleotide sequence encoding the PtHPPD, which was obtained based on the Arabidopsisthaliana/soybean/rice common codon usage bias, is set forth as SEQ ID NO: 29 in the SEQUENCE LISTING. Position 372 of the PfHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant PfHPPD (PfHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 30 in the SEQUENCE LISTING. The mutant PfHPPD-01 (PfHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 31 in the SEQUENCE LISTING. The PfHPPDm-F372A-02 nucleotide sequence encoding the PfHPPDm-F372A, which was obtained based on the Arabidopsisthaliana/soybean/rice common codon usage bias, is set forth as SEQ ID NO: 32 in the SEQUENCE LISTING.

[0150] The amino acid sequence (436 amino acids) of the native Gossypiumhirsutum HPPD (GsHPPD) is set forth as SEQ ID NO: 33 in the SEQUENCE LISTING; the GsHPPD-01 nucleotide sequence (1311 nucleotides) encoding the GsHPPD is set forth as SEQ ID NO: 34 in the SEQUENCE LISTING, and the GsHPPD-02 nucleotide sequence encoding the GsHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 35 in the SEQUENCE LISTING. Position 372 of the GsHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant GsHPPD (GsHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 36 in the SEQUENCE LISTING. The mutant GsHPPD-01 (GsHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 37 in the SEQUENCE LISTING. The GsHPPDm-F372A-02 nucleotide sequence encoding the GsHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 38 in the SEQUENCE LISTING.

[0151] The amino acid sequence (436 amino acids) of the native Triticumaestivum HPPD (TaHPPD) is set forth as SEQ ID NO: 39 in the SEQUENCE LISTING; the TaHPPD-01 nucleotide sequence (1311 nucleotides) encoding the TaHPPD is set forth as SEQ ID NO: 40 in the SEQUENCE LISTING, and the TaHPPD-02 nucleotide sequence encoding the TaHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 41 in the SEQUENCE LISTING. Position 372 of the TaHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant TaHPPD (TaHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 42 in the SEQUENCE LISTING. The mutant TaHPPD-01 (TaHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 43 in the SEQUENCE LISTING. The TaHPPDm-F372A-02 nucleotide sequence encoding the TaHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 44 in the SEQUENCE LISTING.

[0152] The amino acid sequence (436 amino acids) of the native Brachypodiumdistachyon HPPD (BdHPPD) is set forth as SEQ ID NO: 45 in the SEQUENCE LISTING; the BdHPPD-01 nucleotide sequence (1311 nucleotides) encoding the BdHPPD is set forth as SEQ ID NO: 46 in the SEQUENCE LISTING, and the BdHPPD-02 nucleotide sequence encoding the BdHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 47 in the SEQUENCE LISTING. Position 372 of the BdHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant BdHPPD (BdHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 48 in the SEQUENCE LISTING. The mutant BdHPPD-01 (BdHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 49 in the SEQUENCE LISTING. The BdHPPDm-F372A-02 nucleotide sequence encoding the BdHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 50 in the SEQUENCE LISTING.

[0153] The amino acid sequence (434 amino acids) of the native Hordeumvulgare HPPD (HvHPPD) is set forth as SEQ ID NO: 51 in the SEQUENCE LISTING; the HvHPPD-01 nucleotide sequence (1305 nucleotides) encoding the HvHPPD is set forth as SEQ ID NO: 52 in the SEQUENCE LISTING, and the HvHPPD-02 nucleotide sequence encoding the HvHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 53 in the SEQUENCE LISTING. Position 372 of the HvHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant HvHPPD (HvHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 54 in the SEQUENCE LISTING. The mutant HvHPPD-01 (HvHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 55 in the SEQUENCE LISTING. The HvHPPDm-F372A-02 nucleotide sequence encoding the HvHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 56 in the SEQUENCE LISTING.

[0154] The ammo acid sequence (441 amino acids) of the native Setariaitalica HPPD (SiHPPD) is set forth as SEQ ID NO: 57 in the SEQUENCE LISTING; the SiHPPD-01 nucleotide sequence (1326 nucleotides) encoding the SiHPPD is set forth as SEQ ID NO: 58 in the SEQUENCE LISTING, and the SiHPPD-02 nucleotide sequence encoding the SiHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 59 in the SEQUENCE LISTING. Position 372 of the SiHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant SiHPPD (SiHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 60 in the SEQUENCE LISTING. The mutant SiHPPD-01 (SiHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 61 in the SEQUENCE LISTING. The SiHPPDm-F372A-02 nucleotide sequence encoding the SiHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 62 in the SEQUENCE LISTING.

[0155] The amino acid sequence (440 amino acids) of the native Sorghum bicolor HPPD (SbHPPD) is set forth as SEQ ID NO: 63 in the SEQUENCE LISTING; the SbHPPD-01 nucleotide sequence (1323 nucleotides) encoding the SbHPPD is set forth as SEQ ID NO: 64 in the SEQUENCE LISTING, and the SbHPPD-02 nucleotide sequence encoding the SbHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 65 in the SEQUENCE LISTING. Position 372 of the SbHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant SbHPPD (SbHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 66 in the SEQUENCE LISTING. The mutant SbHPPD-01 (SbHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 67 in the SEQUENCE LISTING. The SbHPPDm-F372A-02 nucleotide sequence encoding the SbHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 68 in the SEQUENCE LISTING.

[0156] The amino acid sequence (446 amino acids) of the native Oryzasativa HPPD (OsHPPD) is set forth as SEQ ID NO: 69 in the SEQUENCE LISTING; the OsHPPD-01 nucleotide sequence (1341 nucleotides) encoding the OsHPPD is set forth as SEQ ID NO: 70 in the SEQUENCE LISTING, and the OsHPPD-02 nucleotide sequence encoding the OsHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 71 in the SEQUENCE LISTING. Position 372 of the OsHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant OsHPPD (OsHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 72 in the SEQUENCE LISTING. The mutant OsHPPD-01 (OsHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 73 in the SEQUENCE LISTING. The OsHPPDm-F372A-02 nucleotide sequence encoding the OsHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 74 in the SEQUENCE LISTING.

[0157] The amino acid sequence (488 amino acids) of the native Glycine max HPPD (GmHPPD) is set forth as SEQ ID NO: 75 in the SEQUENCE LISTING; the GmHPPD-01 nucleotide sequence (1467 nucleotides) encoding the GmHPPD is set forth as SEQ ID NO: 76 in the SEQUENCE LISTING, and the GmHPPD-02 nucleotide sequence encoding the GmHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 77 in the SEQUENCE LISTING. Position 372 of the GmHPPD amino acid sequence was mutated 31 from the original phenylalanine to alanine to obtain a mutant GmHPPD (GmHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 78 in the SEQUENCE LISTING. The mutant GmHPPD-01 (GmHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 79 in the SEQUENCE LISTING. The GmHPPDm-F372A-02 nucleotide sequence encoding the GmHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 80 in the SEQUENCE LISTING.

[0158] The amino acid sequence (434 amino acids) of the native Cicerarietinum HPPD (CaHPPD) is set forth as SEQ ID NO: 81 in the SEQUENCE LISTING; the CaHPPD-01 nucleotide sequence (1305 nucleotides) encoding the CaHPPD is set forth as SEQ ID NO: 82 in the SEQUENCE LISTING, and the CaHPPD-02 nucleotide sequence encoding the CaHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 83 in the SEQUENCE LISTING. Position 372 of the CaHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant CaHPPD (CaHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 84 in the SEQUENCE LISTING. The mutant CaHPPD-01 (CaHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 85 in the SEQUENCE LISTING. The CaHPPDm-F372A-02 nucleotide sequence encoding the CaHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 86 in the SEQUENCE LISTING.

[0159] The amino acid sequence (443 amino acids) of the native Brassicanapus HPPD (BnHPPD) is set forth as SEQ ID NO: 87 in the SEQUENCE LISTING; the BnHPPD-01 nucleotide sequence (1332 nucleotides) encoding the BnHPPD is set forth as SEQ ID NO: 88 in the SEQUENCE LISTING, and the BnHPPD-02 nucleotide sequence encoding the BnHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 89 in the SEQUENCE LISTING. Position 372 of the BnHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant BnHPPD (BnHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 90 in the SEQUENCE LISTING. The mutant BnHPPD-01 (BnHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 91 in the SEQUENCE LISTING. The BnHPPDm-F372A-02 nucleotide sequence encoding the BnHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 92 in the SEQUENCE LISTING.

[0160] The amino acid sequence (451 amino acids) of the native Helianthusannuus HPPD (HaHPPD) is set forth as SEQ ID NO: 93 in the SEQUENCE LISTING; the HaHPPD-01 nucleotide sequence (1356 nucleotides) encoding the HaHPPD is set forth as SEQ ID NO: 94 in the SEQUENCE LISTING, and the HaHPPD-02 nucleotide sequence encoding the HaHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 95 in the SEQUENCE LISTING. Position 372 of the HaHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant HaHPPD (HaHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 96 in the SEQUENCE LISTING. The mutant HaHPPD-01 (HaHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 97 in the SEQUENCE LISTING. The HaHPPDm-F372A-02 nucleotide sequence encoding the HaHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 98 in the SEQUENCE LISTING.

[0161] The amino acid sequence (435 amino acids) of the native Medicagosativa HPPD (MsHPPD) is set forth as SEQ ID NO: 99 in the SEQUENCE LISTING; the MsHPPD-01 nucleotide sequence (1308 nucleotides) encoding the MsHPPD is set forth as SEQ ID NO: 100 in the SEQUENCE LISTING, and the MsHPPD-02 nucleotide sequence encoding the MsHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 101 in the SEQUENCE LISTING. Position 372 of the MsHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant MsHPPD (MsHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 102 in the SEQUENCE LISTING. The mutant MsHPPD-01 (MsHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 103 in the SEQUENCE LISTING. The MsHPPDm-F372A-02 nucleotide sequence encoding the MsHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 104 in the SEQUENCE LISTING.

[0162] The amino acid sequence (434 amino acids) of the native Betavulgaris HPPD (BvHPPD) is set forth as SEQ ID NO: 105 in the SEQUENCE LISTING; the BvHPPD-01 nucleotide sequence (1305 nucleotides) encoding the BvHPPD is set forth as SEQ ID NO: 106 in the SEQUENCE LISTING, and the BvHPPD-02 nucleotide sequence encoding the BvHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 107 in the SEQUENCE LISTING. Position 372 of the BvHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant BvHPPD (BvHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 108 in the SEQUENCE LISTING. The mutant BvHPPD-01 (BvHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 109 in the SEQUENCE LISTING. The BvHPPDm-F372A-02 nucleotide sequence encoding the BvHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 110 in the SEQUENCE LISTING.

[0163] The amino acid sequence (447 amino acids) of the native Nicotianatabacum HPPD (NtHPPD) is set forth as SEQ ID NO: 111 in the SEQUENCE LISTING; the NtHPPD-01 nucleotide sequence (1344 nucleotides) encoding the NtHPPD is set forth as SEQ ID NO: 112 in the SEQUENCE LISTING, and the NtHPPD-02 nucleotide sequence encoding the NtHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 113 in the SEQUENCE LISTING. Position 372 of the NtHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant NtHPPD (NtHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 114 in the SEQUENCE LISTING. The mutant NtHPPD-01 (NtHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 115 in the SEQUENCE LISTING. The NtHPPDm-F372A-02 nucleotide sequence encoding the NtHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 116 in the SEQUENCE LISTING.

[0164] The amino acid sequence (455 amino acids) of the native Cucumissativus HPPD (CsHPPD) is set forth as SEQ ID NO: 117 in the SEQUENCE LISTING; the CsHPPD-01 nucleotide sequence (1368 nucleotides) encoding the CsHPPD is set forth as SEQ ID NO: 118 in the SEQUENCE LISTING, and the CsHPPD-02 nucleotide sequence encoding the CsHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 119 in the SEQUENCE LISTING. Position 372 of the CsHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant CsHPPD (CsHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 120 in the SEQUENCE LISTING. The mutant CsHPPD-01 (CsHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 121 in the SEQUENCE LISTING. The CsHPPDm-F372A-02 nucleotide sequence encoding the CsHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 122 in the SEQUENCE LISTING.

[0165] The amino acid sequence (447 amino acids) of the native Solanumtuberosum HPPD (StHPPD) is set forth as SEQ ID NO: 123 in the SEQUENCE LISTING; the StHPPD-01 nucleotide sequence (1343 nucleotides) encoding the StHPPD is set forth as SEQ ID NO: 124 in the SEQUENCE LISTING, and the StHPPD-02 nucleotide sequence encoding the StHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 125 in the SEQUENCE LISTING. Position 372 of the StHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant StHPPD (StHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 126 in the SEQUENCE LISTING. The mutant StHPPD-01 (StHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 127 in the SEQUENCE LISTING. The StHPPDm-F372A-02 nucleotide sequence encoding the StHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 128 in the SEQUENCE LISTING.

[0166] The amino acid sequence (441 amino acids) of the native Solanumlycopersicum HPPD (S1HPPD) is set forth as SEQ ID NO: 129 in the SEQUENCE LISTING; the S1HPPD-01 nucleotide sequence (1326 nucleotides) encoding the S1HPPD is set forth as SEQ ID NO: 130 in the SEQUENCE LISTING, and the S1HPPD-02 nucleotide sequence encoding the S1HPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 131 in the SEQUENCE LISTING. Position 372 of the S1HPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant S1HPPD (S1HPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 132 in the SEQUENCE LISTING. The mutant S1HPPD-01 (S1HPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 133 in the SEQUENCE LISTING. The S1HPPDm-F372A-02 nucleotide sequence encoding the S1HPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 134 in the SEQUENCE LISTING.

[0167] The amino acid sequence (504 amino acids) of the native Arachishypogaea HPPD (AhHPPD) is set forth as SEQ ID NO: 135 in the SEQUENCE LISTING; the AhHPPD-01 nucleotide sequence (1515 nucleotides) encoding the AhHPPD is set forth as SEQ ID NO: 136 in the SEQUENCE LISTING, and the AhHPPD-02 nucleotide sequence encoding the AhHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 137 in the SEQUENCE LISTING. Position 372 of the AhHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant AhHPPD (AhHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 138 in the SEQUENCE LISTING. The mutant AhHPPD-01 (AhHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 139 in the SEQUENCE LISTING. The AhHPPDm-F372A-02 nucleotide sequence encoding the AhHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 140 in the SEQUENCE LISTING.

[0168] The amino acid sequence (339 amino acids) of the native Cyanobacteria HPPD (CyHPPD) is set forth as SEQ ID NO: 141 in the SEQUENCE LISTING; the CyHPPD-01 nucleotide sequence (1020 nucleotides) encoding the CyHPPD is set forth as SEQ ID NO: 142 in the SEQUENCE LISTING, and the CyHPPD-02 nucleotide sequence encoding the CyHPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 143 in the SEQUENCE LISTING. Position 372 of the CyHPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant CyHPPD (CyHPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 144 in the SEQUENCE LISTING. The mutant CyHPPD-01 (CyHPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 145 in the SEQUENCE LISTING. The CyHPPDm-F372A-02 nucleotide sequence encoding the CyHPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 146 in the SEQUENCE LISTING.

[0169] The amino acid sequence (350 amino acids) of the native Sphingobiumsp. N1 HPPD (N1HPPD) is set forth as SEQ ID NO: 147 in the SEQUENCE LISTING; the N1HPPD-01 nucleotide sequence (1053 nucleotides) encoding the N1HPPD is set forth as SEQ ID NO: 148 in the SEQUENCE LISTING, and the N1HPPD-02 nucleotide sequence encoding the N1HPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 149 in the SEQUENCE LISTING. Position 372 of the N1HPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant N1HPPD {N1HPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 150 in the SEQUENCE LISTING. The mutant N1HPPD-01 (N1HPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 151 in the SEQUENCE LISTING. The N1HPPDm-F372A-02 nucleotide sequence encoding the N1HPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 152 in the SEQUENCE LISTING.

[0170] The amino acid sequence (363 amino acids) of the native Sphingobiumsp. N2 HPPD (N2HPPD) is set forth as SEQ ID NO: 153 in the SEQUENCE LISTING; the N2HPPD-01 nucleotide sequence (1092 nucleotides) encoding the N2HPPD is set forth as SEQ ID NO: 154 in the SEQUENCE LISTING, and the N2HPPD-02 nucleotide sequence encoding the N2HPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 155 in the SEQUENCE LISTING. Position 372 of the N2HPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant N2HPPD (N2HPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 156 in the SEQUENCE LISTING. The mutant N2HPPD-01 (N2HPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 157 in the SEQUENCE LISTING. The N2HPPDm-F372A-02 nucleotide sequence encoding the N2HPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 158 in the SEQUENCE LISTING.

[0171] The amino acid sequence (365 amino acids) of the native Burkholderiasp. N3 HPPD (N3HPPD) is set forth as SEQ ID NO: 159 in the SEQUENCE LISTING; the N3HPPD-01 nucleotide sequence (1098 nucleotides) encoding the N3HPPD is set forth as SEQ ID NO: 160 in the SEQUENCE LISTING, and the N3HPPD-02 nucleotide sequence encoding the N3HPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 161 in the SEQUENCE LISTING. Position 372 of the N3HPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant N3HPPD (N3HPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 162 in the SEQUENCE LISTING. The mutant N3HPPD-01 (N3HPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 163 in the SEQUENCE LISTING. The N3HPPDm-F372A-02 nucleotide sequence encoding the N3HPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 164 in the SEQUENCE LISTING.

[0172] The amino acid sequence (365 amino acids) of the native Burkholderiasp. N4 HPPD (N4HPPD) is set forth as SEQ ID NO: 165 in the SEQUENCE LISTING; the N4HPPD-01 nucleotide sequence (1098 nucleotides) encoding the N4HPPD is set forth as SEQ ID NO: 166 in the SEQUENCE LISTING, and the N4HPPD-02 nucleotide sequence encoding the N4HPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 167 in the SEQUENCE LISTING. Position 372 of the N4HPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant N4HPPD (N411PPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 168 in the SEQUENCE LISTING. The mutant N4HPPD-01 (N4HPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 169 in the SEQUENCE LISTING. The N4HPPDm-F372A-02 nucleotide sequence encoding the N4HPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 170 in the SEQUENCE LISTING.

[0173] The amino acid sequence (350 amino acids) of the native Sphingobiumsp. N5 HPPD (N5HPPD) is set forth as SEQ ID NO: 171 in the SEQUENCE LISTING; the N5HPPD-01 nucleotide sequence (1053 nucleotides) encoding the N5HPPD is set forth as SEQ ID NO: 172 in the SEQUENCE LISTING, and the N5HPPD-02 nucleotide sequence encoding the N5HPPD, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 173 in the SEQUENCE LISTING. Position 372 of the N5HPPD amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant N5HPPD (N5HPPDm-F372A) amino acid sequence as set forth in SEQ ID NO: 174 in the SEQUENCE LISTING. The mutant N5HPPD-01 (N5HPPDm-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 175 in the SEQUENCE LISTING. TheN5HPPDm-F372A-02 nucleotide sequence encoding the N5HPPDm-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 176 in the SEQUENCE LISTING.

2. Construction of Recombinant Expression Vectors Containing HPPDS from Different Species (F372A) for Arabidopsis Thaliana

[0174] According to the method of constructing the recombinant expression vector DBN11375 containing the AsHPPDm-F372A-02 nucleotide sequence as described above in point 3 of Example 1, the ZmHPPDm-F372A-02 nucleotide sequence, AtHPPDm-F372A nucleotide sequence, PfHPPDm-F372A-02 nucleotide sequence, GsHPPDm-F372A-02 nucleotide sequence, TaHPPDm-F372A-02 nucleotide sequence, BdHPPDm-F372A-02 nucleotide sequence, HvHPPDm-F372A-02 nucleotide sequence, SiHPPDm-F372A-02 nucleotide sequence, SbHPPDm-F372A-02 nucleotide sequence, OsHPPDm-F372A-02 nucleotide sequence, GmHPPDm-F372A-02 nucleotide sequence, CaHPPDm-F372A-02 nucleotide sequence, BnHPPDm-F372A-02 nucleotide sequence, HaHPPDm-F372A-02 nucleotide sequence, MsHPPDm-F372A-02 nucleotide sequence, BvHPPDm-F372A-02 nucleotide sequence, NtHPPDm-F372A-02 nucleotide sequence, CsHPPDm-F372A-02 nucleotide sequence, StHPPDm-F372A-02 nucleotide sequence, SlHPPDm-F372A-0 nucleotide sequence, AhHPPDm-F372A-02 nucleotide sequence, CyHPPDm-F372A-02 nucleotide sequence, N1HPPDm-F372A-02 nucleotide sequence, N2HPPDm-F372A-02 nucleotide sequence, N3HPPDm-F372A-02 nucleotide sequence, N4HPPDm-F372A-02 nucleotide sequence, and N5HPPDm-F372A-02 nucleotide sequence which were linked to the universal adapter primer 1 was respectively subjected to a recombination reaction with the linearized DBNBC-01 expression vector backbone to obtain the recombinant expression vectors DBN11376 to DBN11402 in sequence. Sequencing verified that the aforementioned nucleotide sequences were inserted correctly in the recombinant expression vectors DBN11376 to DBN11402.

[0175] According to the method of constructing the recombinant expression vector DBN11375 containing the AsHPPDm-F372A-02 nucleotide sequence as described above in point 3 of Example 1, the ZmHPPD-02 nucleotide sequence, AtHPPD nucleotide sequence, PfHPPD-02 nucleotide sequence, GsHPPD-02 nucleotide sequence, TaHPPD-02 nucleotide sequence, BdHPPD-02 nucleotide sequence, HvHPPD-02 nucleotide sequence, SiHPPD-02 nucleotide sequence, SbHPPD-02 nucleotide sequence, OsHPPD-02 nucleotide sequence, GmHPPD-02 nucleotide sequence, CaHPPD-02 nucleotide sequence, BnHPPD-02 nucleotide sequence, HaHPPD-02 nucleotide sequence, MsHPPD-02 nucleotide sequence, BvHPPD-02 nucleotide sequence, NtHPPD-02 nucleotide sequence, CsHPPD-02 nucleotide sequence, StHPPD-02 nucleotide sequence, S1HPPD-02 nucleotide sequence, AhHPPD-02 nucleotide sequence, CyHPPD-02 nucleotide sequence, N1HPPD-02 nucleotide sequence, N2HPPD-02 nucleotide sequence, N3HPPD-02 nucleotide sequence, N4HPPD-02 nucleotide sequence and N5HPPD-02 nucleotide sequence which were linked to the universal adapter primer 1 was respectively subjected to a recombination reaction with the linearized DBNBC-01 expression vector backbone to obtain the recombinant expression vectors DBN11376N to DBN11402N in sequence. Sequencing verified that the aforementioned nucleotide sequences were inserted correctly in the recombinant expression vectors DBN11376N to DBN11402N.

3. Transformation of Agrobacterium with the Recombinant Expression Vectors for Arabidopsis Thaliana

[0176] According to the method of transforming Agrobacterium with the recombinant expression vectors for Arabidopsisthaliana as described above in point 4 of Example 1, the recombinant expression vectors DBN11376 to DBN11402 and DBN11376N to DBN1 1402N which had been constructed correctly were transformed into Agrobacterium GV3101 respectively using a liquid nitrogen method. The results were verified by sequencing, showing that the structures of the recombinant expression vectors DBN11376 to DBN11402 and DBN11376N to DBN11402N were completely correct.

4. Detection of the Herbicide Tolerance of the Arabidopsis Thaliana Plants into which the HPPDs (F372A) from Different Species were Introduced

[0177] According to the method as described above in point 5 of Example 1, Arabidopsisthaliana inflorescences were immersed in the Agrobacterium solution as described in Example 3 so as to introduce the T-DNA in the recombinant expression vectors DBN11376 to DBN11402 and DBN11376N to DBN11402N constructed in Example 2 into the Arabidopsisthaliana chromosomes, thereby obtaining the corresponding transgenic Arabidopsisthaliana plants, i.e., Arabidopsisthaliana T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AtHPPDm-F372A nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the GsHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the BdHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the HvHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the SiHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the SbHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the OsHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the GmHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the CaHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the BnHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the HaHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the MsHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the BvHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the NtHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the CsHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the StHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the S1HPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AhHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the CyHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N1HPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N2HPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N3HPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N4HPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N5HPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the ZmHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AtHPPD nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the GsHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the BdHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the HvHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the SiHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the SbHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the OsHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the GmHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the CaHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the BnHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the HaHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the MsHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the BvHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the NtHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the CsHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the StHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the S1HPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AhHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the CyHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N1HPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N2HPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N3HPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N4HPPD-02 nucleotide sequence was introduced, and Arabidopsisthaliana T.sub.1 plants into which the N5HPPD-02 nucleotide sequence was introduced.

[0178] According to the method as described above in point 6 of Example 1, the aforementioned Arabidopsisthaliana T.sub.1 plants and wild-type Arabidopsisthaliana plants (18 days after sowing) were sprayed with topramezone at three different concentrations respectively, i.e., 25 g ai/ha (one-fold field concentration, 1×), 100 g ai/ha (four-fold field concentration, 4×) and 0 g ai/ha(water, 0×) to detect the tolerance of Arabidopsisthaliana to the herbicide. The experimental results are shown in TABLE 2 and FIG. 4.

TABLE-US-00002 Topramezone tolerance of Arabidopsis thaliana T.sub.1 plants into which HPPDs (F372A) from different species were introduced Source of the gene Arabidopsis thaliana genotypes Concentration (g ai/ha) Classification and statistics of pesticide damage grade Scores Resistance evaluation Grade 0 Grade 1 Grade 2 Grade 3 Wild type Arabidopsis thaliana 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant Zea mays ZmHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant ZmHPPDm-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 4 12 0 0 25 moderately resistant Triticum aestivum TaHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant TaHPPDm-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 15 1 0 0 2 highly resistant Brachypodium distachyon BdHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant BdHPPDm-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 6 10 0 0 21 moderately resistant Hordeum vulgare HvHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant HvHPPDm-F372A-02 0 16 0 0 0 0 25 15 1 0 0 2 highly resistant 100 8 8 0 0 17 moderately resistant Setaria ilalica SiHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant SiHPPDm-F372A-02 0 16 0 0 0 0 25 13 2 1 0 8 highly resistant 100 6 8 2 0 25 moderately resistant Sorghum bicolor SbHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant SbHPPDm-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant_ 100 4 4 8 0 42 poorly resistant Oryza saliva OsHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant OsHPPDm-F372A-02 0 16 0 0 0 0 25 8 8 0 0 17 moderately resistant 100 0 0 0 16 100 non-resistant Arabidopsis thaliana AtHPPD 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant AtHPPDm-F372A 0 16 0 0 0 0 25 4 4 8 0 42 poorly resistant 100 0 0 4 12 92 non-resistant Gossypium hirsutum GsHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant GsHPPDm-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 0 0 0 16 100 non-resistant Glycine max GmHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant GmHPPDm-F372A-02 0 16 0 0 0 0 25 0 12 4 0 42 poorly resistant 100 0 0 0 16 100 non-resistant Cicer arietinum CaHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant CaHPPD-F372A-02 0 16 0 0 0 0 25 0 13 3 0 40 poorly resistant 100 0 0 0 16 100 non-resistant Brassica napus BnHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant BnHPPDm-F372A-02 0 16 0 0 0 0 25 0 4 12 0 58 poorly resistant 100 0 0 0 16 100 non-resistant Helianthus annuus HaHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant HaHPPDm-F372A-02 0 16 0 0 0 0 25 0 8 8 0 50 poorly resistant 100 0 2 12 2 67 poorly resistant Medicago saliva MsHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant MsHPPDm-F372A-02 0 16 0 0 0 0 25 5 7 4 0 31 moderately resistant 100 0 4 9 3 65 poorly resistant Beta vulgaris BvHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant BvHPPDm-F372A-02 0 16 0 0 0 0 25 0 6 10 0 54 poorly resistant 100 0 0 4 12 92 non-resistant Nicotiana tabacum NtHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant NtHPPDm-F372A-02 0 16 0 0 0 0 25 0 6 10 0 54 poorly resistant 100 0 0 0 16 100 non-resistant Cucumis sativus CsHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant CsHPPDm-F372A-02 0 16 0 0 0 0 25 0 0 16 0 67 poorly resistant 100 0 0 0 16 100 non-resistant Solanum tuberosum StHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant StHPPDm-F372A-02 0 16 0 0 0 0 25 4 12 0 0 25 moderately resistant 100 0 1 4 11 88 non-resistant Solanum lycopersicum S1HPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant S1HPPDm-F372A-02 0 16 0 0 0 0 25 1 1 14 0 60 poorly resistant 100 0 1 4 11 88 non-resistant Arachis hypogaea AhHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant AhHPPDm-F372A-02 0 16 0 0 0 0 25 2 12 2 0 33 moderately resistant 100 0 0 10 6 79 non-resistant Pseudomonas fluorescens PfHPPD-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant PfHPPDm-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 12 4 0 0 8 highly resistant Cyanobacteria CyHPPD-02 0 16 0 0 0 0 25 0 0 0 0 16 non-resistant 100 0 0 0 0 16 non-resistant CyHPPDm-F372A-02 0 16 0 0 0 0 25 1 14 1 0 33 moderately resistant 100 0 1 15 0 65 poorly resistant N1 N1HPPD-02 0 16 0 0 0 0 25 2 12 1 1 35 poorly resistant 100 0 4 8 4 67 poorly resistant N1HPPDm-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 16 0 0 0 0 highly resistant N2 N2HPPD-02 0 16 0 0 0 0 25 0 1 15 0 65 poorly resistant 100 0 0 0 16 100 non-resistant N2HPPDm-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 16 0 0 0 0 highly resistant N3 N3HPPD-02 0 16 0 0 0 0 25 0 6 8 2 58 poorly resistant 100 0 0 0 16 100 non-resistant N3HPPDm-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 12 4 0 0 8 highly resistant N4 N4HPPD-02 0 16 0 0 0 0 25 5 6 5 0 33 moderately resistant 100 0 8 2 6 63 poorly resistant N4HPPDm-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 12 4 0 0 8 highly resistant N5 N5HPPD-02 0 16 0 0 0 0 25 6 6 4 0 21 moderately resistant 100 0 7 5 4 60 poorly resistant N5HPPDm-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 13 3 0 0 6 highly resistant

[0179] The results of TABLE 2 and FIG. 4 show that compared with the Arabidopsisthaliana plants into which unmutated HPPD genes were introduced, all the Arabidopsisthaliana plants into which HPPD genes with a mutation at position 372 from different species were introduced had different degrees of tolerance to topramezone, and in particular the Arabidopsisthaliana plants into which HPPD genes with a mutation at position 372 from microorganisms had relatively superior tolerance to topramezone, while the wild-type Arabidopsisthaliana plants had no tolerance to topramezone. Thus, it can be seen that position 372 is the key position of HPPDs. Mutation of position 372 (F372A) of amino acid sequences of HPPDs from different species can impart tolerance to topramezone upon plants.

Example 3: Mutation of Position 372 of Amino Acid Sequences of HPPDs From Different Ecotypes Within the Same Species (F372A) and Verification of the Mutation Effect

[0180] In order to verify the effect of mutation of position 372 of the amino acid sequence of HPPDs from different ecotypes within the same species, position 372 of HPPDs from different ecotypes of Triticumaestivum (F372A) was mutated to verify the mutation effect thereof.

1. Acquisition of HPPDs from Different Ecotypes of Triticum Aestivum and Mutant HPPDs (F372A)

[0181] The amino acid sequence (471 amino acids) of the native HPPD of Triticumaestivum ecotype 1 with the UniProt Accession Number A0A3B5YS13 (TaHPPDl) is set forth as SEQ ID NO: 177 in the SEQUENCE LISTING; the TaHPPD1-01 nucleotide sequence (1416 nucleotides) encoding the TaHPPD1 is set forth as SEQ ID NO: 178 in the SEQUENCE LISTING, and the TaHPPD1.02 nucleotide sequence encoding the TaHPPD1, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 179 in the SEQUENCE LISTING. Position 372 of the TaHPPD1 amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant TaHPPD1 (TaHPPD1m-F372A) amino acid sequence as set forth in SEQ ID NO: 180 in the SEQUENCE LISTING. The mutant TaHPPD1-01 (TaHPPD1m-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 181 in the SEQUENCE LISTING. The TaHPPD1m-F372A-02 nucleotide sequence encoding the TaHPPD1m-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 182 in the SEQUENCE LISTING.

[0182] The amino acid sequence (436 amino acids) of the native HPPD of Triticumaestivum ecotype 2 with the UniProt Accession Number Q45FE8 (TaHPPD2) is set forth as SEQ ID NO: 183 in the SEQUENCE LISTING; the TaHPPD2-01 nucleotide sequence (1311 nucleotides) encoding the TaHPPD2 is set forth as SEQ ID NO: 184 in the SEQUENCE LISTING, and the TaHPPD2-02 nucleotide sequence encoding the TaHPPD2, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 185 in the SEQUENCE LISTING. Position 372 of the TaHPPD2 amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant TaHPPD2 (TaHPPD2m-F372A) amino acid sequence as set forth in SEQ ID NO: 186 in the SEQUENCE LISTING. The mutant TaHPPD2-01 (TaHPPD2m-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 187 in the SEQUENCE LISTING. The TaHPPD2m-F372A-02 nucleotide sequence encoding the TaHPPD2m-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 188 in the SEQUENCE LISTING.

[0183] The amino acid sequence (436 amino acids) of the native HPPD of Triticumaestivum ecotype 3 with the UniProt Accession Number A0A3B6PKV0 (TaHPPD3) is set forth as SEQ ID NO: 189 in the SEQUENCE LISTING; the TaHPPD3-01 nucleotide sequence (1311 nucleotides) encoding the TaHPPD3 is set forth as SEQ ID NO: 190 in the SEQUENCE LISTING, and the TaHPPD3-02 nucleotide sequence encoding the TaHPPD3, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 191 in the SEQUENCE LISTING. Position 372 of the TaHPPD3 amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant TaHPPD3 (TaHPPD3m-F372A) amino acid sequence as set forth in SEQ ID NO: 192 in the SEQUENCE LISTING. The mutant TaHPPD3-01 (TaHPPD3m-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 193 in the SEQUENCE LISTING. The TaHPPD3m-F372A-02 nucleotide sequence encoding the TaHPPD3m-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 194 in the SEQUENCE LISTING.

[0184] The amino acid sequence (433 amino acids) of the native HPPD of Triticumaestivum ecotype 4 with the UniProt Accession Number A0A3B6NLC6 (TaHPPD4) is set forth as SEQ ID NO: 195 in the SEQUENCE LISTING; the TaHPPD4-01 nucleotide sequence (1302 nucleotides) encoding the TaHPPD4 is set forth as SEQ ID NO: 196 in the SEQUENCE LISTING, and the TaHPPD4-02 nucleotide sequence encoding the TaHPPD4, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 197 in the SEQUENCE LISTING. Position 372 of the TaHPPD4 amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant TaHPPD4 (TaHPPD4m-F372A) amino acid sequence as set forth in SEQ ID NO: 198 in the SEQUENCE LISTING. The mutant TaHPPD4-01 (TaHPPD4m-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 199 in the SEQUENCE LISTING. The TaHPPD4m-F372A-02 nucleotide sequence encoding the TaHPPD4m-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 200 in the SEQUENCE LISTING.

[0185] The amino acid sequence (413 amino acids) of the native HPPD of Triticumaestivum ecotype 5 with the UniProt Accession Number A0A3B6NNK0 (TaHPPD5) is set forth as SEQ ID NO: 201 in the SEQUENCE LISTING; the TaHPPD5-01 nucleotide sequence (1242 nucleotides) encoding the TaHPPD5 is set forth as SEQ ID NO: 202 in the SEQUENCE LISTING, and the TaHPPD5-02 nucleotide sequence encoding the TaHPPD5, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 203 in the SEQUENCE LISTING. Position 372 of the TaHPPD5 amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant TaHPPD5 (TaHPPD5m-F372A) amino acid sequence as set forth in SEQ ID NO: 204 in the SEQUENCE LISTING. The mutant TaHPPD5-01 (TaHPPD5m-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 205 in the SEQUENCE LISTING. The TaHPPD5m-F372A-02 nucleotide sequence encoding the TaHPPD5m-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 206 in the SEQUENCE LISTING.

[0186] The amino acid sequence (403 amino acids) of the native HPPD of Triticumaestivum ecotype 6 with the UniProt Accession Number A0A3B5YPS5 (TaHPPD6) is set forth as SEQ ID NO: 207 in the SEQUENCE LISTING; the TaHPPD6-01 nucleotide sequence (1212 nucleotides) encoding the TaHPPD6 is set forth as SEQ ID NO: 208 in the SEQUENCE LISTING, and the TaHPPD6-02 nucleotide sequence encoding the TaHPPD6, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 209 in the SEQUENCE LISTING. Position 372 of the TaHPPD6 amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant TaHPPD6 (TaHPPD6m-F372A) amino acid sequence as set forth in SEQ ID NO: 210 in the SEQUENCE LISTING. The mutant TaHPPD6-01 (TaHPPD6m-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 211 in the SEQUENCE LISTING. The TaHPPD6m-F372A-02 nucleotide sequence encoding the TaHPPD6m-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 212 in the SEQUENCE LISTING.

[0187] The amino acid sequence (381 amino acids) of the native HPPD of Triticumaestivum ecotype 7 with the UniProt Accession Number A7WK82 (TaHPPD7) is set forth as SEQ ID NO: 213 in the SEQUENCE LISTING; the TaHPPD7-01 nucleotide sequence (1146 nucleotides) encoding the TaHPPD7 is set forth as SEQ ID NO: 214 in the SEQUENCE LISTING, and the TaHPPD7-02 nucleotide sequence encoding the TaHPPD7, which was obtained based on the Arabidopsis thaliana codon usage bias, is set forth as SEQ ID NO: 215 in the SEQUENCE LISTING. Position 372 of the TaHPPD7 amino acid sequence was mutated from the original phenylalanine to alanine to obtain a mutant TaHPPD7 (TaHPPD7m-F372A) amino acid sequence as set forth in SEQ ID NO: 216 in the SEQUENCE LISTING. The mutant TaHPPD7-01 (TaHPPD7m-F372A-01) nucleotide sequence is set forth as SEQ ID NO: 217 in the SEQUENCE LISTING. The TaHPPD7m-F372A-02 nucleotide sequence encoding the TaHPPD7m-F372A, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO: 218 in the SEQUENCE LISTING.

2. Construction of Recombinant Expression Vectors Containing HPPDs from Different Ecotypes of Triticum Aestivum (F372A) for Arabidopsis Thaliana

[0188] According to the method of constructing the recombinant expression vector DBN11375 containing the AsHPPDm-F372A-02 nucleotide sequence as described above in point 3 of Example 1, the TaHPPD1m-F372A-02 nucleotide sequence, TaHPPD2m-F372A-02 nucleotide sequence, TaHPPD3m-F372A-02 nucleotide sequence, TaHPPD4m-F372A-02 nucleotide sequence, TaHPPD5m-F372A-02 nucleotide sequence, TaHPPD6m-F372A-02 nucleotide sequence and TaHPPD7m-F372A-02 nucleotide sequence which were linked to the universal adapter primer 1 was respectively subjected to a recombination reaction with the linearized DBNBC-01 expression vector backbone to obtain the recombinant expression vectors DBN11403 to DBN11409 in sequence. Sequencing verified that the aforementioned nucleotide sequences were inserted correctly in the recombinant expression vectors DBN11403 to DBN11409.

[0189] According to the method of constructing the recombinant expression vector DBN11375 containing the AsHPPDm-F372A-02 nucleotide sequence as described above in point 3 of Example 1, the TaHPPD1-02 nucleotide sequence, TaHPPD2-02 nucleotide sequence, TaHPPD3-02 sequence, TaHPPD4-02 nucleotide sequence, TaHPPD5-02 nucleotide sequence, TaHPPD6-02 nucleotide sequence and TaHPPD7-02 nucleotide sequence which were linked to the universal adapter primer 1 was respectively subjected to a recombination reaction with the linearized DBNBC-01 expression vector backbone to obtain the recombinant expression vectors DBN11403N to DBN11409N in sequence. Sequencing verified that the aforementioned nucleotide sequences were inserted correctly in the recombinant expression vectors DBN11403N to DBN 11409N.

3. Transformation of Agrobacterium with the Recombinant Expression Vectors for Arabidopsis Thaliana

[0190] According to the method of transforming Agrobacterium with the recombinant expression vectors for Arabidopsisthaliana as described above in point 4 of Example 1, the recombinant expression vectors DBN11403 to DBN11409 and DBN11403N to DBN1 1409N which had been constructed correctly were transformed into Agrobacterium GV3101 respectively using a liquid nitrogen method. The results were verified by sequencing, showing that the structures of the recombinant expression vectors DBN11403 to DBN11409 and DBN11403N to DBN11409N were completely correct.

4. Detection of the Herbicide Tolerance of the Arabidopsis Thaliana Plants into Which HPPDs from Different Ecotypes of Triticum Aestivum (F372A) Were Introduced

[0191] According to the method as described above in point 5 of Example 1, Arabidopsisthaliana inflorescences were immersed in the Agrobacterium solution as described in Example 3 so as to introduce the T-DNA in the recombinant expression vectors DBN11403 to DBN11409 and DBN11403N to DBN11409N constructed in Example 2 into the Arabidopsisthaliana chromosomes, thereby obtaining the corresponding transgenic Arabidopsisthaliana plants, i.e., Arabidopsisthaliana T.sub.1 plants into which the TaHPPD1m-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPD2m-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPD3m-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPD4m-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPD5m-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPD6m-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPD7m-F372A-02 nucleotide sequence was introduced, and Arabidopsisthaliana T.sub.1 plants into which the TaHPPD1-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPD2-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPD3-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPD4-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPD5-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPD6-02 nucleotide sequence was introduced and Arabidopsisthaliana T.sub.1 plants into which the TaHPPD7-02 nucleotide sequence was introduced.

[0192] According to the method as described above in point 6 of Example 1, the aforementioned Arabidopsisthaliana T.sub.1 plants and wild-type Arabidopsisthaliana plants (18 days after sowing) were sprayed with topramezone at three different concentrations respectively, i.e., 25 g ai/ha (one-fold field concentration, 1x), 100 g ai/ha (four-fold field concentration, 4x) and 0 g ai/ha (water, 0x) to detect the tolerance of Arabidopsisthaliana to the herbicide. The experimental results are shown in TABLE 3.

TABLE-US-00003 Topramezone tolerance of Arabidopsis thaliana T.sub.1 plants into which HPPDs from different ecotypes of Triticum aestivum (F372A) were introduced Source of the gene Arabidopsis thaliana genotypes Concentration (g ai/ha) Classification and statistics of pesticide damage grade Scores Resistance evaluation Grade 0 Grade 1 Grade 2 Grade 3 Wild-type Arabidopsis thaliana 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant Ecotype 1 TaHPPD 1-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant TaHPPD1m-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 15 1 0 0 2 highly resistant Ecotype 2 TaHPPD2-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant TaHPPD2m-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 8 8 0 0 17 moderately resistant Ecotype 3 TaHPPD3-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant TaHPPD3m-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 12 4 0 0 8 highly resistant Ecotype 4 TaHPPD4-02 0 16 0 0 0 0 25 0 0 4 12 92 non-resistant 100 0 0 0 16 100 non-resistant TaHPPD4m-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 11 5 0 0 10 highly resistant Ecotype 5 TaHPPD5-02 0 16 0 0 0 0 25 0 0 8 8 83 non-resistant 100 0 0 2 14 96 non-resistant TaHPPD5m-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 6 9 1 0 23 moderately resistant Ecotype 6 TaHPPD6-02 0 16 0 0 0 0 25 0 0 6 10 88 non-resistant 100 0 0 2 14 96 non-resistant TaHPPD6m-F372A-02 0 16 0 0 0 0 25 16 0 0 0 0 highly resistant 100 15 1 0 0 2 highly resistant Ecotype 7 TaHPPD7-02 0 16 0 0 0 0 25 0 0 0 16 100 non-resistant 100 0 0 0 16 100 non-resistant TaHPPD7m-F372A-02 0 16 0 0 0 0 25 12 4 0 0 8 highly resistant 100 6 10 0 0 21 moderately resistant

[0193] The results of TABLE 3 show that all the Arabidopsisthaliana plants into which HPPD genes with a mutation at position 372 from different ecotypes of Triticumaestivum were introduced had good tolerance to topramezone (with high or moderate resistance) while the Arabidopsisthaliana plants into which unmutated HPPD genes were introduced and the wild-type Arabidopsisthaliana plants showed no tolerance to topramezone. This indicates that mutation of position 372 of HPPD amino acid sequences from different ecotypes within the same species (F372A) can impart tolerance to topramezone upone plants; i.e., the effects of mutation are identical for the HPPD amino acid sequences from different ecotypes within the same species.

Example 4: Different Forms of Mutation at the 372 Position of HPPD Amino Acid Sequence from Different Species and Verification of the Mutation Effects

[0194] In order to further verify the effects of different forms of the mutation at the 372 position of HPPD amino acid sequence, saturation mutations of all amino acids were performed at the 372 position of HPPD from the plant source ( Avenasativa) and the microorganism source ( Pseudomonasfluorescens), both of which showed better tolerance to topramezone.

1. Acquisition of Saturation Mutation of HPPD from Avena Sativa and Pseudomonas Fluorescens Sources

[0195] The 372 position of the AsHPPD amino acid sequence was subjected to saturation mutation, that is, the original phenylalanine was mutated into other 18 amino acids respectively (except phenylalanine and alanine) deletion mutation, to obtain the AsHPPDm-F372G amino acid sequence as set forth in SEQ ID NO:219 in the SEQUENCE LISTING, the AsHPPDm-F372V amino acid sequence as set forth in SEQ ID NO:220 in the SEQUENCE LISTING, the AsHPPDm-F372L amino acid sequence as set forth in SEQ ID NO:221 in the SEQUENCE LISTING, the AsHPPDm-F372I amino acid sequence as set forth in SEQ ID NO:222 in the SEQUENCE LISTING, the AsHPPDm-F372P amino acid sequence as set forth in SEQ ID NO:223 in the SEQUENCE LISTING, the AsHPPDm-F372Y amino acid sequence as set forth in SEQ ID NO:224 in the SEQUENCE LISTING, the AsHPPDm-F372W amino acid sequence as set forth in SEQ ID NO:225 in the SEQUENCE LISTING, the AsHPPDm-F372S amino acid sequence as set forth in SEQ ID NO:226 in the SEQUENCE LISTING, the AsHPPDm-F372T amino acid sequence as set forth in SEQ ID NO:227 in the SEQUENCE LISTING, the AsHPPDm-F372C amino acid sequence as set forth in SEQ ID NO:228 in the SEQUENCE LISTING, the AsHPPDm-F372M amino acid sequence as set forth in SEQ ID NO:229 in the SEQUENCE LISTING, the AsHPPDm-F372N amino acid sequence as set forth in SEQ ID NO:230 in the SEQUENCE LISTING, the AsHPPDm-F372Q amino acid sequence as set forth in SEQ ID NO:231 in the SEQUENCE LISTING, the AsHPPDm-F372D amino acid sequence as set forth in SEQ ID NO:232 in the SEQUENCE LISTING, the AsHPPDm-F372E amino acid sequence as set forth in SEQ ID NO:233 in the SEQUENCE LISTING, the AsHPPDm-F372K amino acid sequence as set forth in SEQ ID NO:234 in the SEQUENCE LISTING, the AsHPPDm-F372R amino acid sequence as set forth in SEQ ID NO:235 in the SEQUENCE LISTING, the AsHPPDm-F372H amino acid sequence as set forth in SEQ ID NO:236 in the SEQUENCE LISTING, and the AsHPPDm-F372 amino acid sequence (deletion) as set forth in SEQ ID NO:237 in the SEQUENCE LISTING; the nucleotide sequences encoding the above amino acid sequences were obtained based on the Arabidopsisthaliana/soybean/rice common codon usage bias, that is, the AsHPPDm-F372G nucleotide sequence as set forth in SEQ ID NO:238 in the SEQUENCE LISTING, the AsHPPDm-F372V nucleotide sequence as set forth in SEQ ID NO:239 in the SEQUENCE LISTING, the AsHPPDm-F372L nucleotide sequence as set forth in SEQ ID NO:240 in the SEQUENCE LISTING, the AsHPPDm-F372I nucleotide sequence as set forth in SEQ ID NO:241 in the SEQUENCE LISTING, the AsHPPDm-F372P nucleotide sequence as set forth in SEQ ID NO:242 in the SEQUENCE LISTING, the AsHPPDm-F372Y nucleotide sequence as set forth in SEQ ID NO:243 in the SEQUENCE LISTING, the AsHPPDm-F372W nucleotide sequence as set forth in SEQ ID NO:244 in the SEQUENCE LISTING, the AsHPPDm-F372S nucleotide sequence as set forth in SEQ ID NO:245 in the SEQUENCE LISTING, the AsHPPDm-F372T nucleotide sequence as set forth in SEQ ID NO:246 in the SEQUENCE LISTING, the AsHPPDm-F372C nucleotide sequence as set forth in SEQ ID NO:247 in the SEQUENCE LISTING, the AsHPPDm-F372M nucleotide sequence as set forth in SEQ ID NO:248 in the SEQUENCE LISTING, the AsHPPDm-F372N nucleotide sequence as set forth in SEQ ID NO:249 in the SEQUENCE LISTING, the AsHPPDm-F372Q nucleotide sequence as set forth in SEQ ID NO:250 in the SEQUENCE LISTING, the AsHPPDm-F372D nucleotide sequence as set forth in SEQ ID NO:251 in the SEQUENCE LISTING, the AsHPPDm-F372E nucleotide sequence as set forth in SEQ ID NO:252 in the SEQUENCE LISTING, the AsHPPDm-F372K nucleotide sequence as set forth in SEQ ID NO:253 in the SEQUENCE LISTING, the AsHPPDm-F372R nucleotide sequence as set forth in SEQ ID NO:254 in the SEQUENCE LISTING, the AsHPPDm-F372H nucleotide sequence as set forth in SEQ ID NO:255 in the SEQUENCE LISTING, and the AsHPPDm-F372 nucleotide sequence (deletion) as set forth in SEQ ID NO:256 in the SEQUENCE LISTING.

[0196] The 372 position of the PfHPPD amino acid sequence was subjected to saturation mutation, that is, the original phenylalanine was mutated into other 18 amino acids respectively (except phenylalanine and alanine) and deletion mutation, to obtain the PfHPPDm-F372G amino acid sequence as set forth in SEQ ID NO:257 in the SEQUENCE LISTING, the PfHPPDm-F372V amino acid sequence as set forth in SEQ ID NO:258 in the SEQUENCE LISTING, the PfHPPDm-F372L amino acid sequence as set forth in SEQ ID NO:259 in the SEQUENCE LISTING, the PfHPPDm-F372I amino acid sequence as set forth in SEQ ID NO:260 in the SEQUENCE LISTING, the PfHPPDm-F372P amino acid sequence as set forth in SEQ ID NO:261 in the SEQUENCE LISTING, the PfHPPDm-F372Y amino acid sequence as set forth in SEQ ID NO:262 in the SEQUENCE LISTING, the PfHPPDm-F372W amino acid sequence as set forth in SEQ ID NO:263 in the SEQUENCE LISTING, the PfHPPDm-F372S amino acid sequence as set forth in SEQ ID NO:264 in the SEQUENCE LISTING, the PfHPPDm-F372T amino acid sequence as set forth in SEQ ID NO:265 in the SEQUENCE LISTING, the PfHPPDm-F372C amino acid sequence as set forth in SEQ ID NO:266 in the SEQUENCE LISTING, the PfHPPDm-F372M amino acid sequence as set forth in SEQ ID NO:267 in the SEQUENCE LISTING, the PfHPPDm-F372N amino acid sequence as set forth in SEQ ID NO:268 in the SEQUENCE LISTING, the PfHPPDm-F372Q amino acid sequence as set forth in SEQ ID NO:269 in the SEQUENCE LISTING, the PfHPPDm-F372D amino acid sequence as set forth in SEQ ID NO:270 in the SEQUENCE LISTING, the PfHPPDm-F372E amino acid sequence as set forth in SEQ ID NO:271 in the SEQUENCE LISTING, the PfHPPDm-F372K amino acid sequence as set forth in SEQ ID NO:272 in the SEQUENCE LISTING, the PfHPPDm-F372R amino acid sequence as set forth in SEQ ID NO:273 in the SEQUENCE LISTING, the PfHPPDm-F372H amino acid sequence as set forth in SEQ ID NO:274 in the SEQUENCE LISTING, and the PfHPPDm-F372 amino acid sequence (deletion) as set forth in SEQ ID NO:275 in the SEQUENCE LISTING; the nucleotide sequences encoding the above amino acid sequences were obtained based on the Arabidopsisthaliana/soybean/rice common usage bias, that is, the PfHPPDm-F372G nucleotide sequence as set forth in SEQ ID NO:276 in the SEQUENCE LISTING, the PfHPPDm-F372V nucleotide sequence as set forth in SEQ ID NO:277 in the SEQUENCE LISTING, the PfHPPDm-F372L nucleotide sequence as set forth in SEQ ID NO:278 in the SEQUENCE LISTING, the PfHPPDm-F3721 nucleotide sequence as set forth in SEQ ID NO:279 in the SEQUENCE LISTING, the PfHPPDm-F372P nucleotide sequence as set forth in SEQ ID NO:280 in the SEQUENCE LISTING, the PfHPPDm-F372Y nucleotide sequence as set forth in SEQ ID NO:281 in the SEQUENCE LISTING, the PfHPPDm-F372W nucleotide sequence as set forth in SEQ ID NO:282 in the SEQUENCE LISTING, the PfHPPDm-F372S nucleotide sequence as set forth in SEQ ID NO:283 in the SEQUENCE LISTING, the PfHPPDm-F372T nucleotide sequence as set forth in SEQ ID NO:284 in the SEQUENCE LISTING, the PfHPPDm-F372C nucleotide sequence as set forth in SEQ ID NO:285 in the SEQUENCE LISTING, the PfHPPDm-F372M nucleotide sequence as set forth in SEQ ID NO:286 in the SEQUENCE LISTING, the PfHPPDm-F372N nucleotide sequence as set forth in SEQ ID NO:287 in the SEQUENCE LISTING, the PfHPPDm-F372Q nucleotide sequence as set forth in SEQ ID NO:288 in the SEQUENCE LISTING, the PfHPPDm-F372D nucleotide sequence as set forth in SEQ ID NO:289 in the SEQUENCE LISTING, the PfHPPDm-F372E nucleotide sequence as set forth in SEQ ID NO:290 in the SEQUENCE LISTING, the PfHPPDm-F372K nucleotide sequence as set forth in SEQ ID NO:291 in the SEQUENCE LISTING, the PfHPPDm-F372R nucleotide sequence as set forth in SEQ ID NO:292 in the SEQUENCE LISTING, the PfHPPDm-F372H nucleotide sequence as set forth in SEQ ID NO:293 in the SEQUENCE LISTING, and the PfHPPDm-F372 nucleotide sequence (deletion) as set forth in SEQ ID NO:294 in the SEQUENCE LISTING.

2. Construction of Recombinant Expression Vectors Containing Saturation Mutation of HPPD for Arabidopsis Thaliana

[0197] According to the method of constructing the recombinant expression vector DBN11375 containing AsHPPDm-F372A-02 nucleotide sequence as described in point 3 of Example 1, the AsHPPDm-F372G nucleotide sequence, AsHPPDm-F372V nucleotide sequence, AsHPPDm-F372L nucleotide sequence, AsHPPDm-F372I nucleotide sequence, AsHPPDm-F372P nucleotide sequence, AsHPPDm-F372Y nucleotide sequence, AsHPPDm-F372W nucleotide sequence, AsHPPDm-F372S nucleotide sequence, AsHPPDm-F372T nucleotide sequence, AsHPPDm-F372C nucleotide sequence, AsHPPDm-F372M nucleotide sequence, AsHPPDm-F372N nucleotide sequence, AsHPPDm-F372Q nucleotide sequence, AsHPPDm-F372D nucleotide sequence, AsHPPDm-F372E nucleotide sequence, AsHPPDm-F372K nucleotide sequence, AsHPPDm-F372R nucleotide sequence, AsHPPDm-F372H nucleotide sequence, AsHPPDm-F372 nucleotide sequence, and the PfHPPDm-F372G nucleotide sequence, PfHPPDm-F372V nucleotide sequence, PfHPPDm-F372L nucleotide sequence, PfHPPDm-F372I nucleotide sequence, PfHPPDm-F372P nucleotide sequence, PfHPPDm-F372Y nucleotide sequence, PfHPPDm-F372W nucleotide sequence, PfHPPDm-F372S nucleotide sequence, PfHPPDm-F372T nucleotide sequence, PfHPPDm-F372C nucleotide sequence, PfHPPDm-F372M nucleotide sequence, PfHPPDm-F372N nucleotide sequence, PfHPPDm-F372Q nucleotide sequence, PfHPPDm-F372D nucleotide sequence, PfHPPDm-F372E nucleotide sequence, PfHPPDm-F372K nucleotide sequence, PfHPPDm-F372R nucleotide sequence, PfHPPDm-F372H nucleotide sequence, and PfHPPDm-F372 nucleotide sequence which were linked with the universal adapter primer 1 were respectively subjected to a recombination reaction with the linearized DBNBC-01 expression vector skeleton to obtain the recombinant expression vectors DBN11410 to DBN11447 in sequence. Sequencing verified that the above nucleotide sequences were inserted correctly in the recombinant expression vectors DBN11410 to DBN11447.

3. Transformation of Agrobacterium with the Recombinant Expression Vectors for Arabidopsis Thaliana

[0198] According to the method of transformation of Agrobacterium with the recombinant expression vectors for Arabidopsisthaliana as described above in point 4 of Example 1, the recombinant expression vectors DBN11410 to DBN11447 which had been correctly constructed were transformed into the Agrobacterium GV3101 respectively using a liquid nitrogen method, and the results were verified by sequencing, showing that the structures of the recombinant expression vectors DBN11410 to DBN11447 were completely correct.

4. Detection of the Herbicide Tolerance of the Arabidopsis Thaliana Plants into Which Saturation Mutation of HPPD was Introduced

[0199] According to the method as described above in point 5 of Example 1, Arabidopsisthaliana inflorescences were immersed in the Agrobacterium solution as described in Example 3 so as to introduce the T-DNA of the recombinant expression vectors DBN11410 to DBN11447 constructed in Example 2 into the Arabidopsisthaliana chromosomes, thereby obtaining the corresponding transgenic Arabidopsisthaliana plants, that is, the Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372L nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372I nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372P nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372Y nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372W nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372S nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372T nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372C nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372M nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372N nucleotide sequence was introduced, Arabidopsisthaliana T, plants into which the AsHPPDm-F372Q nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372D nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372E nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372K nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372R nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372H nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372 nucleotide sequence was introduced, and Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372L nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372I nucleotide sequence was introduced, Arabidopsisthaliana Tt plants into which the PfHPPDm-F372P nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372Y nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372W nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372S nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372T nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372C nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372M nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372N nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372Q nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372D nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372E nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372K nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372R nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372H nucleotide sequence was introduced, and Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372 nucleotide sequence was introduced.

[0200] According to the method as described above in point 6 of Example 1, the above-mentioned Arabidopsisthaliana T.sub.1 plants, Arabidopsisthaliana T.sub.1 plants into which the AsHPPD-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPD-02 nucleotide sequence was introduced, and wild-type Arabidopsisthaliana plants (18 days after sowing) were sprayed with topramezone at four different concentrations respectively, that is, 25 g ai/ha (one-fold field concentration, 1x), 50 g ai/ha (two-fold field concentration, 2x), 100 g ai/ha (four-fold field concentration, 4x) and 0 g ai/ha (water, Ox) to detect the herbicide tolerance of Arabidopsisthaliana. The experimental results are shown in TABLEs 4 and 5.

TABLE-US-00004 Topramezone tolerance of Arabidopsis thaliana T.sub.1 plants into which saturation mutation of HPPD from Avena sativa source was introduced Statistical data after evaluation of gene from Avena sativa source Mutation type of HPPD from Avena sativa source Treatment concentration (g ai/ha) Grade 0 Grade 1 Grade 2 Grade 3 score Resistance Grade Wild-type Arabidopsis thaliana 0 20 0 0 0 0 25 20 0 0 0 0 Non-resistant 50 20 0 0 0 0 Non-resistant 100 20 0 0 0 0 Non-resistant AsHPPD-02 0 20 0 0 0 0 25 2 2 16 0 57 Poorly resistant 50 0 2 4 14 87 Non-resistant 100 0 0 4 16 93 Non-resistant F372G 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 50 20 0 0 0 0 Highly resistant 100 20 0 0 0 0 Highly resistant F372V 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 50 20 0 0 0 0 Highly resistant 100 20 0 0 0 0 Highly resistant F372L 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 50 20 0 0 0 0 Highly resistant 100 6 10 4 0 30 Moderately resistant F3721 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 50 20 0 0 0 0 Highly resistant 100 20 0 0 0 0 Highly resistant F372P 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 50 20 0 0 0 0 Highly resistant 100 4 12 4 0 33 Moderately resistant F372Y 0 20 0 0 0 0 25 0 0 0 20 100 Non-resistant 50 0 4 0 16 87 Non-resistant 100 0 0 0 20 100 Non-resistant F372W 0 20 0 0 0 0 25 6 6 8 0 37 Poorly resistant 50 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant F372S 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 50 20 0 0 0 0 Highly resistant 100 20 0 0 0 0 Highly resistant F372T 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 50 18 2 0 0 3 Highly resistant 100 10 10 0 0 17 Moderately resistant F372C 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 50 18 2 0 0 3 Highly resistant 100 8 8 4 0 27 Moderately resistant F372M 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 50 8 12 0 0 20 Moderately resistant 100 2 6 12 0 50 Poorly resistant F372N 0 20 0 0 0 0 25 18 0 2 0 7 Highly resistant 50 20 0 0 0 0 Highly resistant 100 20 0 0 0 0 Highly resistant F372Q 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 50 20 0 0 0 0 Highly resistant 100 20 0 0 0 0 Highly resistant F372D 0 20 0 0 0 0 25 16 4 0 0 7 Highly resistant 50 20 0 0 0 0 Highly resistant 100 20 0 0 0 0 Highly resistant F372E 0 20 0 0 0 0 25 0 8 8 4 60 Poorly resistant 50 0 6 10 4 63 Poorly resistant 100 0 0 2 18 97 Non-resistant F372K. 0 20 0 0 0 0 25 0 20 0 0 33 Moderately resistant 50 2 8 10 0 47 Poorly resistant 100 0 0 6 14 90 Non-resistant F372R 0 20 0 0 0 0 25 0 0 0 20 100 Non-resistant 50 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant F372H 0 20 0 0 0 0 25 0 6 2 12 77 Non-resistant 50 0 2 10 8 77 Non-resistant 100 0 0 0 20 100 Non-resistant F372 deletion 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 50 20 0 0 0 0 Highly resistant 100 18 2 0 0 3 Highly resistant

TABLE-US-00005 Topramezone tolerance of Arabidopsis thaliana T.sub.1 plants into which saturation mutation of HPPD from Pseudomonas fluorescens source was introduced Statistical data after evaluation of gene from Pseudomonas fluorescens source Mutation type of HPPD from Pseudomonas fluorescens source Treatment concentration (g ai/ha) Grade 0 Grade 1 Grade 2 Grade 3 score Resistance Grade PfHPPD-02 0 20 0 0 0 0 25 0 0 0 20 100 Non-resistant 50 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant F372G 0 20 0 0 0 0 25 4 14 2 0 30 Moderately resistant 50 0 18 2 0 37 Poorly resistant 100 0 12 8 0 47 Poorly resistant F372V 0 20 0 0 0 0 25 2 10 8 0 43 Poorly resistant 50 0 14 6 0 43 Poorly resistant 100 0 4 12 4 67 Poorly resistant F372L 0 20 0 0 0 0 25 0 0 0 20 100 Non-resistant 50 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant F3721 0 20 0 0 0 0 25 0 6 6 8 70 Non-resistant 50 0 0 2 18 97 Non-resistant 100 0 0 0 20 100 Non-resistant F372P 0 20 0 0 0 0 25 10 8 2 0 20 Moderately resistant 50 4 8 4 4 47 Poorly resistant 100 0 0 5 15 92 Non-resistant F372Y 0 20 0 0 0 0 25 0 0 0 20 100 Non-resistant 50 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant F372W 0 20 0 0 0 0 25 0 0 2 18 97 Non-resistant 50 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant F372S 0 20 0 0 0 0 25 6 10 4 0 30 Moderately resistant 50 0 8 8 4 60 Poorly resistant 100 0 0 2 18 97 Non-resistant F372T 0 20 0 0 0 0 25 8 6 2 4 37 Poorly resistant 50 0 8 4 8 67 Poorly resistant 100 0 0 2 18 97 Non-resistant F372C 0 20 0 0 0 0 25 0 12 6 2 50 Poorly resistant 50 2 4 4 10 70 Non-resistant 100 0 0 0 20 100 Non-resistant F372M 0 20 0 0 0 0 25 4 6 4 6 53 Poorly resistant 50 2 0 4 14 83 Non-resistant 100 0 0 0 20 100 Non-resistant F372N 0 20 0 0 0 0 25 0 2 6 12 83 Non-resistant 50 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant F372Q 0 20 0 0 0 0 25 2 4 10 4 60 Poorly resistant 50 0 4 6 10 77 Non-resistant 100 0 0 0 20 100 Non-resistant F372D 0 20 0 0 0 0 25 0 8 4 8 67 Poorly resistant 50 0 0 8 12 87 Non-resistant 100 0 0 0 20 100 Non-resistant F372E 0 20 0 0 0 0 25 0 0 4 16 93 Non-resistant 50 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant F372K 0 20 0 0 0 0 25 0 0 0 20 100 Non-resistant 50 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant F372R 0 20 0 0 0 0 25 0 0 0 20 100 Non-resistant 50 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant F372H 0 20 0 0 0 0 25 0 0 0 20 100 Non-resistant 50 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant F372 deletion 0 20 0 0 0 0 25 0 10 10 0 50 Poorly resistant 50 0 6 11 3 62 Poorly resistant 100 0 2 10 8 77 Non-resistant

[0201] The results in TABLEs 4 and 5 showed that: (1) after saturation mutation of HPPD from Avenasativa source, except that the Arabidopsisthaliana plants with mutated forms of F372Y, F372R and F372H had no tolerance to topramezone, the Arabidopsisthaliana plants with other mutated forms had different degrees of tolerance to topramezone, and especially those with mutated forms of F372G, F372V, F372I, F372N, F372Q, F372D, F372(deletion) had better tolerance to topramezone, while the wild-type Arabidopsisthaliana plants and the Arabidopsisthaliana plants into which unmutated HPPD gene (AsHPPD-02) was introduced had no or low tolerance to various concentrations of topramezone; therefore, the mutation at 372 position of HPPD amino acid sequence from Avenasativa source into F372A, F372G, F372V, F372L, F372I, F372P, F372W, F372S, F372T, F372C, F372M, F372N, F372Q, F372D, F372E, F372K and F372 (deletion) can confer tolerance to topramezone upon plants; (2) after saturation mutation of HPPD from Pseudomonasfluorescens source, the Arabidopsisthaliana plants with mutated forms of F372G, F372V, F372P, F372S, F372T, F372C, F372M, F372Q, F372D and F372 (deletion) had different degrees of tolerance to topramezone, the Arabidopsisthaliana plants with other mutated forms had no tolerance to topramezone, while the Arabidopsisthaliana plants into which unmutated HPPD gene (PfHPPD-02) was introduced and the wild-type Arabidopsisthaliana plants had no tolerance to topramezone; therefore, the mutation at 372 position of HPPD amino acid sequence from Pseudomonasfluorescens source into F372A, F372G, F372V, F372P, F372S, F372T, F372C, F372M, F372Q, F372D and F372 (deletion) can confer tolerance to topramezone upon plants. The results also showed that the mutation at 372 position of HPPD amino acid sequence from Avenasativa source and Pseudomonasfluorescens source into F372G and F372V can confer better tolerance to topramezone upon plants.

Example 5: Mutation at 372 Position of HPPD Amino Acid Sequence From Different Species Sources (F372G and F372V) and Verification of the Mutation Effects

[0202] In order to further verify the effects of the F372G or F372V mutation at 372 position of HPPD amino acid sequence from different species sources, mutation (F372G or F372V) was performed at the 372 position of HPPD amino acid sequence from representative species sources selected in the Example 2.

1. Acquisition of Mutant HPPD (F372G and F372V) from Different Species Sources

[0203] The 372 position of the ZmHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated ZmHPPD (ZmHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:295 in the SEQUENCE LISTING, and the ZmHPPDm-F372G nucleotide sequence encoding the ZmHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:296 in the SEQUENCE LISTING.

[0204] The 372 position of the AtHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated AtHPPD (AtHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:297 in the SEQUENCE LISTING, and the AtHPPDm-F372G nucleotide sequence encoding the AtHPPDm-F372G was set forth as SEQ ID NO:298 in the SEQUENCE LISTING.

[0205] The 372 position of the GsHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated GsHPPD (GsHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:299 in the SEQUENCE LISTING, and the GsHPPDm-F372G nucleotide sequence encoding the GsHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:300 in the SEQUENCE LISTING.

[0206] The 372 position of the TaHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated TaHPPD (TaHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:301 in the SEQUENCE LISTING, and the TaHPPDm-F372G nucleotide sequence encoding the TaHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:302 in the SEQUENCE LISTING.

[0207] The 372 position of the BdHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated BdHPPD (BdHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:303 in the SEQUENCE LISTING, and the BdHPPDm-F372G nucleotide sequence encoding the BdHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:304 in the SEQUENCE LISTING.

[0208] The 372 position of the HvHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated HvHPPD (HvHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:305 in the SEQUENCE LISTING, and the HvHPPDm-F372G nucleotide sequence encoding the HvHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:306 in the SEQUENCE LISTING.

[0209] The 372 position of the SiHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated SiHPPD (SiHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:307 in the SEQUENCE LISTING, and the SiHPPDm-F372G nucleotide sequence encoding the SiHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:308 in the SEQUENCE LISTING.

[0210] The 372 position of the SbHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated SbHPPD (SbHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:309 in the SEQUENCE LISTING, and the SbHPPDm-F372G nucleotide sequence encoding the SbHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:310 in the SEQUENCE LISTING.

[0211] The 372 position of the OsHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated OsHPPD (OsHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:311 in the SEQUENCE LISTING, and the OsHPPDm-F372G nucleotide sequence encoding the OsHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:312 in the SEQUENCE LISTING.

[0212] The 372 position of the GmHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated GmHPPD (GmHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:313 in the SEQUENCE LISTING, and the GmHPPDm-F372G nucleotide sequence encoding the GmHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:314 in the SEQUENCE LISTING.

[0213] The 372 position of the CaHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated CaHPPD (CaHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:315 in the SEQUENCE LISTING, and the CaHPPDm-F372G nucleotide sequence encoding the CaHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:316 in the SEQUENCE LISTING.

[0214] The 372 position of the BnHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated BnHPPD (BnHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:317 in the SEQUENCE LISTING, and the BnHPPDm-F372G nucleotide sequence encoding the BnHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:318 in the SEQUENCE LISTING.

[0215] The 372 position of the HaHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated HaHPPD (HaHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:319 in the SEQUENCE LISTING, and the HaHPPDm-F372G nucleotide sequence encoding the HaHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:320 in the SEQUENCE LISTING.

[0216] The 372 position of the MsHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated MsHPPD (MsHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:321 in the SEQUENCE LISTING, and the MsHPPDm-F372G nucleotide sequence encoding the MsHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:322 in the SEQUENCE LISTING.

[0217] The 372 position of the BvHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated BvHPPD (BvHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:323 in the SEQUENCE LISTING, and the BvHPPDm-F372G nucleotide sequence encoding the BvHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:324 in the SEQUENCE LISTING.

[0218] The 372 position of the NtHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated NtHPPD (NtHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:325 in the SEQUENCE LISTING, and the NtHPPDm-F372G nucleotide sequence encoding the NtHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:326 in the SEQUENCE LISTING.

[0219] The 372 position of the CsHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated CsHPPD (CsHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:327 in the SEQUENCE LISTING, and the CsHPPDm-F372G nucleotide sequence encoding the CsHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:328 in the SEQUENCE LISTING.

[0220] The 372 position of the StHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated StHPPD (StHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:329 in the SEQUENCE LISTING, and the StHPPDm-F372G nucleotide sequence encoding the StHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:330 in the SEQUENCE LISTING.

[0221] The 372 position of the SIHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated SlHPPD (SlHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:331 in the SEQUENCE LISTING, and the SlHPPDm-F372G nucleotide sequence encoding the SlHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:332 in the SEQUENCE LISTING.

[0222] The 372 position of the AhHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated AhHPPD (AhHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:333 in the SEQUENCE LISTING, and the AhHPPDm-F372G nucleotide sequence encoding the AhHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:334 in the SEQUENCE LISTING.

[0223] The 372 position of the CyHPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated CyHPPD (CyHPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:335 in the SEQUENCE LISTING, and the CyHPPDm-F372G nucleotide sequence encoding the CyHPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:336 in the SEQUENCE LISTING.

[0224] The 372 position of the N1HPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated N1HPPD (N1HPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:337 in the SEQUENCE LISTING, and the N1HPPDm-F372G nucleotide sequence encoding the N1HPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:338 in the SEQUENCE LISTING.

[0225] The 372 position of the N2HPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated N2HPPD (N2HPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:339 in the SEQUENCE LISTING, and the N2HPPDm-F372G nucleotide sequence encoding the N2HPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:340 in the SEQUENCE LISTING.

[0226] The 372 position of the N3HPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated N3HPPD (N3HPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:341 in the SEQUENCE LISTING, and the N3HPPDm-F372G nucleotide sequence encoding the N3HPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:342 in the SEQUENCE LISTING.

[0227] The 372 position of the N4HPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated N4HPPD (N4HPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:343 in the SEQUENCE LISTING, and the N4HPPDm-F372G nucleotide sequence encoding the N4HPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:344 in the SEQUENCE LISTING.

[0228] The 372 position of the N5HPPD amino acid sequence was mutated from the original phenylalanine to glycine, to obtain the mutated N5HPPD (N5HPPDm-F372G) amino acid sequence as set forth in SEQ ID NO:345 in the SEQUENCE LISTING, and the N5HPPDm-F372G nucleotide sequence encoding the N5HPPDm-F372G, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:346 in the SEQUENCE LISTING.

[0229] The 372 position of the ZmHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated ZmHPPD (ZmHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:347 in the SEQUENCE LISTING, and the ZmHPPDm-F372V nucleotide sequence encoding the ZmHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:348 in the SEQUENCE LISTING.

[0230] The 372 position of the AtHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated AtHPPD (AtHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:349 in the SEQUENCE LISTING, and the AtHPPDm-F372V nucleotide sequence encoding the AtHPPDm-F372V is set forth as SEQ ID NO:350 in the SEQUENCE LISTING.

[0231] The 372 position of the GsHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated GsHPPD (GsHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:351 in the SEQUENCE LISTING, and the GsHPPDm-F372V nucleotide sequence encoding the GsHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:352 in the SEQUENCE LISTING.

[0232] The 372 position of the TaHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated TaHPPD (TaHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:353 in the SEQUENCE LISTING, and the TaHPPDm-F372V nucleotide sequence encoding the TaHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:354 in the SEQUENCE LISTING.

[0233] The 372 position of the BdHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated BdHPPD (BdHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:355 in the SEQUENCE LISTING, and the BdHPPDm-F372V nucleotide sequence encoding the BdHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:356 in the SEQUENCE LISTING.

[0234] The 372 position of the HvHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated HvHPPD (HvHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:357 in the SEQUENCE LISTING, and the HvHPPDm-F372V nucleotide sequence encoding the HvHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:358 in the SEQUENCE LISTING.

[0235] The 372 position of the SiHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated SiHPPD (SiHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:359 in the SEQUENCE LISTING, and the SiHPPDm-F372V nucleotide sequence encoding the SiHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:360 in the SEQUENCE LISTING.

[0236] The 372 position of the SbHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated SbHPPD (SbHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:361 in the SEQUENCE LISTING, and the SbHPPDm-F372V nucleotide sequence encoding the SbHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:362 in the SEQUENCE LISTING.

[0237] The 372 position of the OsHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated OsHPPD (OsHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:363 in the SEQUENCE LISTING, and the OsHPPDm-F372V nucleotide sequence encoding the OsHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:364 in the SEQUENCE LISTING.

[0238] The 372 position of the GmHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated GmHPPD (GmHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:365 in the SEQUENCE LISTING, and the GmHPPDm-F372V nucleotide sequence encoding the GmHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:366 in the SEQUENCE LISTING.

[0239] The 372 position of the CaHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated CaHPPD (CaHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:367 in the SEQUENCE LISTING, and the CaHPPDm-F372V nucleotide sequence encoding the CaHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:368 in the SEQUENCE LISTING.

[0240] The 372 position of the BnHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated BnHPPD (BnHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:369 in the SEQUENCE LISTING, and the BnHPPDm-F372V nucleotide sequence encoding the BnHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:370 in the SEQUENCE LISTING.

[0241] The 372 position of the HaHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated HaHPPD (HaHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:371 in the SEQUENCE LISTING, and the HaHPPDm-F372V nucleotide sequence encoding the HaHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:372 in the SEQUENCE LISTING.

[0242] The 372 position of the MsHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated MsHPPD (MsHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:373 in the SEQUENCE LISTING, and the MsHPPDm-F372V nucleotide sequence encoding the MsHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:374 in the SEQUENCE LISTING.

[0243] The 372 position of the BvHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated BvHPPD (BvHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:375 in the SEQUENCE LISTING, and the BvHPPDm-F372V nucleotide sequence encoding the BvHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:376 in the SEQUENCE LISTING.

[0244] The 372 position of the NtHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated NtHPPD (NtHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:377 in the SEQUENCE LISTING, and the NtHPPDm-F372V nucleotide sequence encoding the NtHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:378 in the SEQUENCE LISTING.

[0245] The 372 position of the CsHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated CsHPPD (CsHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:379 in the SEQUENCE LISTING, and the CsHPPDm-F372V nucleotide sequence encoding the CsHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:380 in the SEQUENCE LISTING.

[0246] The 372 position of the StHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated StHPPD (StHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:381 in the SEQUENCE LISTING, and the StHPPDm-F372V nucleotide sequence encoding the StHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:382 in the SEQUENCE LISTING.

[0247] The 372 position of the S1HPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated S1HPPD (S1HPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:383 in the SEQUENCE LISTING, and the S1HPPDm-F372V nucleotide sequence encoding the S1HPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:384 in the SEQUENCE LISTING.

[0248] The 372 position of the AhHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated AhHPPD (AhHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:385 in the SEQUENCE LISTING, and the AhHPPDm-F372V nucleotide sequence encoding the AhHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:386 in the SEQUENCE LISTING.

[0249] The 372 position of the CyHPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated CyHPPD (CyHPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:387 in the SEQUENCE LISTING, and the CyHPPDm-F372V nucleotide sequence encoding the CyHPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:388 in the SEQUENCE LISTING.

[0250] The 372 position of the N1HPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated N1HPPD (N1HPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:389 in the SEQUENCE LISTING, and the N1HPPDm-F372V nucleotide sequence encoding the N1HPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:390 in the SEQUENCE LISTING.

[0251] The 372 position of the N2HPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated N2HPPD (N2HPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:391 in the SEQUENCE LISTING, and the N2HPPDm-F372V nucleotide sequence encoding the N2HPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:392 in the SEQUENCE LISTING.

[0252] The 372 position of the N3HPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated N3HPPD (N3HPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:393 in the SEQUENCE LISTING, and the N3HPPDm-F372V nucleotide sequence encoding the N3HPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:394 in the SEQUENCE LISTING.

[0253] The 372 position of the N4HPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated N4HPPD (N4HPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:395 in the SEQUENCE LISTING, and the N4HPPDm-F372V nucleotide sequence encoding the N4HPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:396 in the SEQUENCE LISTING.

[0254] The 372 position of the N5HPPD amino acid sequence was mutated from the original phenylalanine to valine, to obtain the mutated N5HPPD (N5HPPDm-F372V) amino acid sequence as set forth in SEQ ID NO:397 in the SEQUENCE LISTING, and the N5HPPDm-F372V nucleotide sequence encoding the N5HPPDm-F372V, which was obtained based on the Arabidopsisthaliana codon usage bias, is set forth as SEQ ID NO:398 in the SEQUENCE LISTING.

2. Construction of the Recombinant Expression Vectors Containing Mutated HPPD (F372G and F372V) from Different Species Sources for Arabidopsis Thaliana

[0255] According to the method of constructing the recombinant expression vector DBN11375 containing AsHPPDm-F372A-02 nucleotide sequence as described in point 3 of Example 1, the ZmHPPDm-F372G nucleotide sequence, AtHPPDm-F372G nucleotide sequence, GsHPPDm-F372G nucleotide sequence, TaHPPDm-F372G nucleotide sequence, BdHPPDm-F372G nucleotide sequence, HvHPPDm-F372G nucleotide sequence, SiHPPDm-F372G nucleotide sequence, SbHPPDm-F372G nucleotide sequence, OsHPPDm-F372G nucleotide sequence, GmHPPDm-F372G nucleotide sequence, CaHPPDm-F372G nucleotide sequence, BnHPPDm-F372G nucleotide sequence, HaHPPDm-F372G nucleotide sequence, MsHPPDm-F372G nucleotide sequence, BvHPPDm-F372G nucleotide sequence, NtHPPDm-F372G nucleotide sequence, CsHPPDm-F372G nucleotide sequence, StHPPDm-F372G nucleotide sequence, S1HPPDm-F372G nucleotide sequence, AhHPPDm-F372G nucleotide sequence, CyHPPDm-F372G nucleotide sequence, N1HPPDm-F372G nucleotide sequence, N2HPPDm-F372G nucleotide sequence, N3HPPDm-F372G nucleotide sequence, N4HPPDm-F372G nucleotide sequence and N5HPPDm-F372G nucleotide sequence which were linked with the universal adapter primer 1 were respectively subjected to a recombination reaction with the linearized DBNBC-01 expression vector skeleton to obtain the recombinant expression vectors DBN11448 to DBN11473 in sequence. Sequencing verified that the above nucleotide sequences were correctly inserted in the recombinant expression vectors DBN11448 to DBN11473.

[0256] According to the method of constructing the recombinant expression vector DBN11375 containing AsHPPDm-F372A-02 nucleotide sequence as described in point 3 of Example 1, the ZmHPPDm-F372V nucleotide sequence, AtHPPDm-F372V nucleotide sequence, GsHPPDm-F372V nucleotide sequence, TaHPPDm-F372V nucleotide sequence, BdHPPDm-F372V nucleotide sequence, HvHPPDm-F372V nucleotide sequence, SiHPPDm-F372V nucleotide sequence, SbHPPDm-F372V nucleotide sequence, OsHPPDm-F372V nucleotide sequence, GmHPPDm-F372V nucleotide sequence, CaHPPDm-F372V nucleotide sequence, BnHPPDm-F372V nucleotide sequence, HaHPPDm-F372V nucleotide sequence, MsHPPDm-F372V nucleotide sequence, BvHPPDm-F372V nucleotide sequence, NtHPPDm-F372V nucleotide sequence, CsHPPDm-F372V nucleotide sequence, StHPPDm-F372V nucleotide sequence, S1HPPDm-F372V nucleotide sequence, AhHPPDm-F372V nucleotide sequence, CyHPPDm-F372V nucleotide sequence, N1HPPDm-F372V nucleotide sequence, N2HPPDm-F372V nucleotide sequence, N3HPPDm-F372V nucleotide sequence, N4HPPDm-F372V nucleotide sequence and N5HPPDm-F372V nucleotide sequence which were linked with the universal adapter primer 1 were respectively subjected to a recombination reaction with the linearized DBNBC-01 expression vector skeleton to obtain the recombinant expression vectors DBN11474 to DBN11499 in sequence. Sequencing verified that the above nucleotide sequences were correctly inserted in the recombinant expression vectors DBN11474 to DBN11499.

3. Transformation of Agrobacterium with the Recombinant Expression Vectors for Arabidopsis Thaliana

[0257] According to the method of transformation of Agrobacterium with the recombinant expression vectors for Arabidopsis thaliana as described in point 4 of Example 1, the recombinant expression vectors DBN11448 to DBN11499 which had been correctly constructed were transformed into the Agrobacterium GV3101 respectively using a liquid nitrogen method, and the results were verified by sequencing, showing that the structures of the recombinant expression vectors DBN11448 to DBN11499 were completely correct.

4. Detection of the Herbicide Tolerance Effects of Arabidopsis Thaliana Plants into Which Mutated HPPD (F372G and F372V) from Different Species Sources was Introduced

[0258] According to the method as described in point 5 of Example 1, the Arabidopsisthaliana inflorescences were immersed in the Agrobacterium solution as described in Example 3, so as to introduce the T-DNA of the recombinant expression vectors DBN11448 to DBN11499 constructed in Example 2 into the Arabidopsisthaliana chromosome, thereby obtaining the corresponding transgenic Arabidopsisthaliana plants, that is, the Arabidopsisthaliana T.sub.1 plants into which the ZmHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AtHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the GsHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the BdHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the HvHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the SiHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the SbHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the OsHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the GmHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the CaHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the BnHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the HaHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the MsHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the BvHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the NtHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the CsHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the StHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the S1HPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AhHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the CyHPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N1HPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N2HPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N3HPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N4HPPDm-F372G nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N5HPPDm-F372G nucleotide sequence was introduced, and Arabidopsisthaliana T.sub.1 plants into which the ZmHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AtHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the GsHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the TaHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the BdHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the HvHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the SiHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the SbHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the OsHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the GmHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the CaHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the BnHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the HaHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the MsHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the BvHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the NtHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the CsHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the StHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the S1HPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AhHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the CyHPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N1HPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N2HPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N3HPPDm-F372V nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the N4HPPDm-F372V nucleotide sequence was introduced, and Arabidopsisthaliana T.sub.1 plants into which the N5HPPDm-F372V nucleotide sequence was introduced.

[0259] According to the method as described in point 6 of Example 1, the above-mentioned Arabidopsisthaliana T.sub.1 plants and wild-type Arabidopsisthaliana plants (18 days after sowing) were sprayed with topramezone at two different concentrations respectively, that is, 25 g ai/ha (one-fold field concentration, 1x) and 100 g ai/ha (four-fold field concentration, 4x) to detect the herbicide tolerance of Arabidopsisthaliana,. The experimental results are shown in TABLEs 6 and 7.

TABLE-US-00006 Topramezone tolerance of Arabidopsis thaliana T.sub.1 plants into which mutated HPPD (F372G) from different species sources was introduced Source of the gene Arabidopsis thaliana genotype Concentration (g ai/ha) Resistance evaluation Wild-type Arabidopsis thaliana 25 Non-resistant 100 Non-resistant Zea mays ZmHPPDm-F372G 25 Highly resistant 100 Moderately resistant Gossypium hirsutum GsHPPDm-F372G 25 Moderately resistant 100 Non-resistant Triticum aestivum TaHPPDm-F372G 25 Highly resistant 100 Moderately resistant Brachypodium distachyon BdHPPDm-F372G 25 Highly resistant 100 Moderately resistant Hordeum vulgare HvHPPDm-F372G 25 Highly resistant 100 Poorly resistant Setaria italica SiHPPDm-F372G 25 Moderately resistant 100 Poorly resistant Sorghum bicolor SbHPPDm-F372G 25 Moderately resistant 100 Non-resistant Oryza sativa OsHPPDm-F372G 25 Moderately resistant 100 Non-resistant Arabidopsis thaliana AtHPPDm-F372G 25 Poorly resistant 100 Non-resistant Glycine max GmHPPDm-F372G 25 Poorly resistant 100 Non-resistant Cicer arielinum CaHPPDm-F372G 25 Poorly resistant 100 Non-resistant Brassica napus BnHPPDm-F372G 25 Poorly resistant 100 Non-resistant Helianthus anuuus HaHPPDm-F372G 25 Poorly resistant 100 Non-resistant Medicago sativa MsHPPDm-F372G 25 Moderately resistant 100 Non-resistant Beta vulgaris BvHPPDm-F372G 25 Moderately resistant 100 Non-resistant Nicotiana tabacum NtHPPDm-F372G 25 Poorly resistant 100 Non-resistant Cucumis sativus CsHPPDm-F372G 25 Poorly resistant 100 Non-resistant Solanum tuberosum StHPPDm-F372G 25 Poorly resistant 100 Non-resistant Solanum lycopersicum SlHPPDm-F372G 25 Poorly resistant 100 Non-resistant Arachis hypogaea AhHPPDm-F372G 25 Poorly resistant 100 Non-resistant Cyanobacteria CyHPPDm-F372G 25 Moderately resistant 100 Non-resistant N1 N1HPPDm-F372G 25 Highly resistant 100 Highly resistant N2 N2HPPDm-F372G 25 Highly resistant 100 Highly resistant N3 N3HPPDm-F372G 25 Highly resistant 100 Highly resistant N4 N4HPPDm-F372G 25 Highly resistant 100 Highly resistant N5 N4HPPDm-F372G 25 Highly resistant 100 Highly resistant

TABLE-US-00007 Topramezone tolerance of Arabidopsis thaliana T.sub.1 plants into which mutated HPPD (F372V) from different species sources was introduced Source of the gene Arabidopsis thaliana genotype Concentration (g ai/ha) Resistance evaluation Wild-type Arabidopsis thaliana 25 Non-resistant 100 Non-resistant Zea mays ZmHPPDm-F372V 25 Highly resistant 100 Poorly resistant Gossypium hirsutum GsHPPDm-F372V 25 Moderately resistant 100 Non-resistant Triticum aestivum TaHPPDm-F372V 25 Highly resistant 100 Moderately resistant Brachypodium dislachyon BdHPPDm-F372V 25 Highly resistant 100 Poorly resistant Hordeum vulgare HvHPPDm-F372V 25 Highly resistant 100 Poorly resistant Setaria italica SiHPPDm-F372V 25 Moderately resistant 100 Poorly resistant Sorghum bicolor SbHPPDm-F372V 25 Poorly resistant 100 Non-resistant Oryza sativa OsHPPDm-F372V 25 Moderately resistant 100 Non-resistant Arabidopsis thaliana AtHPPDm-F372V 25 Poorly resistant 100 Non-resistant Glycine max GmHPPDm-F372V 25 Poorly resistant 100 Non-resistant Cicer artietinum CaHPPDm-F372V 25 Poorly resistant 100 Non-resistant Brassica napus BnHPPDm-F372V 25 Poorly resistant 100 Non-resistant Helianthus annuus HaHPPDm-F372V 25 Poorly resistant 100 Non-resistant Medicago sativa MsHPPDm-F372V 25 Poorly resistant 100 Non-resistant Beta vulgaris BvHPPDm-F372V 25 Poorly resistant 100 Non-resistant Nicotiana tabacum NtHPPDm-F372V 25 Poorly resistant 100 Non-resistant Cucumis sativus CsHPPDm-F372V 25 Poorly resistant 100 Non-resistant Solatium tuberosturt StHPPDm-F372V 25 Poorly resistant 100 Non-resistant Solanum lycopersicum SlHPPDm-F372V 25 Poorly resistant 100 Non-resistant Arachis hypogaea AhHPPDm-F372V 25 Poorly resistant 100 Non-resistant Cyanobacteria CyHPPDm-F372V 25 Poorly resistant 100 Non-resistant N1 N1HPPDm-F372V 25 Highly resistant 100 Highly resistant N2 N2HPPDm-F372V 25 Highly resistant 100 Highly resistant N3 N3HPPDm-F372V 25 Highly resistant 100 Highly resistant N4 N4HPPDm-F372V 25 Highly resistant 100 Highly resistant N5 N5HPPDm-F372V 25 Highly resistant 100 Highly resistant

[0260] The results in TABLEs 6 and 7 showed that: as compared with the Arabidopsisthaliana plants into which unmutated HPPD gene was introduced in Example 2 and the wild-type Arabidopsisthaliana plants, the Arabidopsisthaliana plants into which the mutation (F372G or F372V) at 372 position of HPPD gene from different species sources was introduced had different degrees of tolerance to topramezone, and especially the Arabidopsisthaliana plants into which the mutation at 372 position of HPPD gene from the microorganism source was introduced had better tolerance to topramezone. Therefore, the mutation (F372G or F372V) at 372 position of HPPD amino acid sequence from different species sources can confer tolerance to topramezone upon plants.

Example 6: Combination of Mutation of the 372 Position With That of Other Position in the HPPD Amino Acid Sequence and the Mutation Effect Thereof

1. Acquisition of the Sequence with Mutation Combination

[0261] The 372 position of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and deletion mutation was performed upon the alanine (A) at the 110 position, to obtain the mutated AsHPPD (AsHPPDm-F372A-A110) amino acid sequence as set forth in SEQ ID NO:412 in the SEQUENCE LISTING; the AsHPPDm-F372A-A110 nucleotide sequence encoding the above amino acid sequence, which was obtained based on the Arabidopsisthaliana /soybean/rice common codon usage bias, is set forth in SEQ ID NO:413 in the SEQUENCE LISTING.

[0262] Deletion mutation was performed upon the alanine (A) at the position 110 of the AsHPPD amino acid sequence, to obtain the mutated AsHPPD (AsHPPDm-A110) amino acid sequence as set forth in SEQ ID NO:414 in the SEQUENCE LISTING; the AsHPPDm-A110 nucleotide sequence encoding the above amino acid sequence, which was obtained based on the Arabidopsisthaliana/soybean/rice common codon usage bias, is set forth in SEQ ID NO:415 in the SEQUENCE LISTING.

[0263] The 372 position of the PfHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), and the 336 position (corresponding to the 413 position of the amino acid sequence as set forth in SEQ ID NO:1, that is, 413 position) was mutated from the original glycine (G) to tryptophan (W), to obtain the mutated PfHPPD (PfHPPDm-F372A-G413W) amino acid sequence as set forth in SEQ ID NO:416 in the SEQUENCE LISTING; the PfHPPDm-F372A-G413 W nucleotide sequence encoding the above amino acid sequence, which was obtained based on the Arabidopsisthaliona/soybean/rice common codon usage bias, is set forth in SEQ ID NO:417 in the SEQUENCE LISTING.

[0264] The 336 position of the PfHPPD amino acid sequence (corresponding to the 413 position of the amino acid sequence as set forth in SEQ ID NO:1, that is, 413 position) was mutated from the original glycine (G) to tryptophan (W), to obtain the mutated PfHPPD (PfHPPDm-G413W) amino acid sequence as set forth in SEQ ID NO:418 in the SEQUENCE LISTING; the PfHPPDm-G413W nucleotide sequence encoding the above amino acid sequence, which was obtained based on the Arabidopsisthaliana/soybean/rice common codon usage bias, is set forth in SEQ ID NO:419 in the SEQUENCE LISTING.

2. Construction of the Recombinant Expression Vectors Containing the Mutation Combination of HPPD for Arabidopsis Thaliana

[0265] According to the method of constructing the recombinant expression vector DBN11375 containing AsHPPDm-F372A-02 nucleotide sequence as described in point 3 of Example 1, the AsHPPDm-F372A-A110 nucleotide sequence, AsHPPDm-A110 nucleotide sequence, PfHPPDm-F372A-G413W nucleotide sequence and PfHPPDm-G413W nucleotide sequence which were linked with the universal adapter primer 1 were respectively subjected to a recombination reaction with the linearized DBNBC-01 expression vector skeleton, to obtain the recombinant expression vectors DBN11500 to DBN11503 in sequence. Sequencing verified that the above nucleotide sequences were correctly inserted in the recombinant expression vectors DBN11500 to DBN11503.

3. Transformation of Agrobacterium With the Recombinant Expression Vectors for Arabidopsis Thaliana

[0266] According to the method of transformation of Agrobacterium with the recombinant expression vectors for Arabidopsisthaliana as described in point 4 of Example 1, the recombinant expression vectors DBN11500 to DBN11503 which had been correctly constructed were transformed into the Agrobacterium GV3101 respectively using a liquid nitrogen method. The results were verified by sequencing, showing that the structures of the recombinant expression vectors DBN11500 to DBN11503 were completely correct.

4. Detection of the Herbicide Tolerance of the Arabidopsis Thaliana Plants into Which Mutation Combination of HPPD was Introduced

[0267] According to the method as described in point 5 of Example 1, the Arabidopsisthaliana inflorescences were immersed in the Agrobacterium solution as described in Example 3, so as to introduce the T-DNA of the recombinant expression vectors DBN11500 to DBN11503 constructed in Example 2, the recombinant expression vectors DBN11375 to DBN11375N constructed in point 3 of Example 1, and the recombinant expression vectors DBN11378 to DBN11378N constructed in point 2 of Example 2, into Arabidopsisthaliana chromosome, thereby obtaining the corresponding transgenic Arabidopsisthaliana plants, that is, the Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-AH110 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372A-G413W nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-G413W nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-02 nucleotide sequence was introduced and Arabidopsisthaliana Ti plants into which the PfHPPDm-02 nucleotide sequence was introduced.

[0268] According to the method as described in point 6 of Example 1, the Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372A-G413W nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-G413W nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-02 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-02 nucleotide sequence was introduced and wild-type Arabidopsisthaliana plants (18 days after sowing) were sprayed with topramezone at three different concentrations respectively, that is, 25 g ai/ha (one-fold field concentration, 1x), 100 g ai/ha (four-fold field concentration, 4x) and 0 g ai/ha (water, 0x) to detect the herbicide tolerance of Arabidopsisthaliana. The experimental results are shown in TABLE 8.

TABLE-US-00008 Topramezone tolerance of Arabidopsis thaliana T.sub.1 plants into which the mutation combination of HPPD was introduced HPPD mutation type Treatment concentration (g ai/ha) Grade 0 Grade 1 Grade 2 Grade 3 Score Resistance Grade AsHPPDm-F372A-A110 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 100 20 0 0 0 0 Highly resistant AsHPPDm-F372A-02 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 100 20 0 0 0 0 Highly resistant AsHPPDm-A110 0 20 0 0 0 0 25 4 16 0 0 27 Moderately resistant 100 0 0 14 6 77 Non-resistant AsHPPD-02 0 20 0 0 0 0 25 2 2 16 0 57 Poorly resistant 100 0 0 4 16 93 Non-resistant PfHPPDm-F372A-G413W 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 100 20 0 0 0 0 Highly resistant PfHPPDm-F372A-02 0 20 0 0 0 0 25 20 0 0 0 0 Highly resistant 100 16 4 0 0 7 Highly resistant PfHPPDm-G413W 0 20 0 0 0 0 25 2 18 0 0 30 Moderately resistant 100 0 0 10 10 83 Non-resistant PfHPPD-02 0 20 0 0 0 0 25 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant Wild-type Arabidopsis thaliana 0 20 0 0 0 25 0 0 0 20 100 Non-resistant 100 0 0 0 20 100 Non-resistant

[0269] The results in TABLE 8 showed that: (1) compared with wild-type Arabidopsisthaliana plants and the Arabidopsisthaliana T.sub.1 plants into which AsHPPDm-02 nucleotide sequence was introduced, the Arabidopsisthaliana T.sub.1 plants into which AsHPPDm-F372A-Al 10 nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which PfHPPDm-F372A-G413W nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which AsHPPDm-F372A-02 nucleotide sequence was introduced and Arabidopsisthaliana T.sub.1 plants into which PfHPPDm-F372A-02 nucleotide sequence was introduced had better tolerance to topramezone (highly resistant); (2) compared with the Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-02 nucleotide sequence was introduced, the Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-A110 nucleotide sequence was introduced had a certain tolerance to low concentration of topramezone, but the tolerance was significantly lower than that of the Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced and the Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced; (3) compared with the Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-02 nucleotide sequence was introduced, the Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-G413W nucleotide sequence was introduced had a certain tolerance to low concentration of topramezone, but the tolerance was significantly lower than that of the Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372A-G413W nucleotide sequence was introduced and the Arabidopsisthaliana T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced. It can be seen that the combination of the mutations at 372 position and at other positions of the HPPD amino acid sequence did not affect the tolerance of the single mutation at 372 position to topramezone, indicating that the mutation at 372 position of the HPPD amino acid sequence conferred the plants with the importance and stability of the tolerance to topramezone.

Example 7: Mutation of Other Positions (non-372 Positions) of AsHPPD Amino Acid Sequence and Verification of the Mutation Effect

1. Acquisition of Mutant Genes at Other Positions of AsHPPD Amino Acid Sequence (Non-Position 372)

[0270] The 284 position (corresponding to the 284 position of the amino acid sequence as set forth in SEQ ID NO: 1, i.e. the 284 position) of the AsHPPD amino acid sequence was mutated from the original glutamine (Q) to alanine (A), to obtain the mutant AsHPPD (AsHPPDm-Q284A) amino acid sequence as set forth in SEQ ID NO: 420 in the SEQUENCE LISTING. The AsHPPDm-Q284A nucleotide sequence encoding the above amino acid sequence, which was obtained based on the Arabidopsisthaliana/soybean/rice common codon usage bias, is set forth in SEQ ID NO: 421 in the SEQUENCE LISTING.

[0271] The 359 position (corresponding to the 359 position of the amino acid sequence as set forth in SEQ ID NO: 1, i.e. the 359 position) of the AsHPPD amino acid sequence was mutated from the original leucine (L) to tryptophan (W), to obtain the mutant AsHPPD (AsHPPDm-L359W) amino acid sequence as set forth in SEQ ID NO: 422 in the SEQUENCE LISTING. The AsHPPDm-L359W nucleotide sequence encoding the above amino acid sequence, which was obtained based on the Arabidopsisthaliana/soybean/rice common codon usage bias, is set forth in SEQ ID NO: 423 in the SEQUENCE LISTING.

[0272] The 415 position (corresponding to the 415 position of the amino acid sequence as set forth in SEQ ID NO: 1, i.e. the 415 position) of the AsHPPD amino acid sequence was mutated from the original phenylalanine (F) to alanine (A), to obtain the mutant AsHPPD (AsHPPDm-F415A) amino acid sequence as set forth in SEQ ID NO: 424 in the SEQUENCE LISTING. The AsHPPDm-F415A nucleotide sequence encoding the above amino acid sequence, which was obtained based on the Arabidopsisthaliana/soybean/rice common codon usage bias, is set forth in SEQ ID NO: 425 in the SEQUENCE LISTING.

2. Construction of the Recombinant Expression Vectors Containing HPPD Gene Mutated at Other Positions (Non-Position 372) for Arabidopsis Thaliana

[0273] According to the method of constructing the recombinant expression vector DBN11375 containing the AsHPPDm-F372A-02 nucleotide sequence as described in point 3 of Example 1, the AsHPPDm-Q284A nucleotide sequence, AsHPPDm-L359W nucleotide sequence and AsHPPDm-F415A nucleotide sequence which were linked to the universal adapter primer 1 were respectively subjected to a recombination reaction with the linearized DBNBC-01 expression vector backbone, to obtain the recombinant expression vectors DBN11504, DBN11505 and DBN1 1506 in sequence. Sequencing verified that the above nucleotide sequences were correctly inserted in the recombinant expression vectors DBN11504, DBN11505 and DBN11506.

3. Transformation of Agrobacterium with the Recombinant Expression Vectors for Arabidopsis Thaliana

[0274] According to the method of transformation of Agrobacterium with the recombinant expression vectors for Arabidopsisthaliana as described in point 4 of Example 1, the recombinant expression vectors DBN11504, DBN11505 and DBN11506 which had been correctly constructed were transformed into the Agrobacterium GV3101 respectively using a liquid nitrogen method. The results were verified by sequencing, showing that the structures of the recombinant expression vectors DBN11504, DBN11505 and DBN11506 were completely correct.

4. Detection of the Herbicide Tolerance of the Arabidopsis Thaliana Plants Into Which the Mutation at Other Positions (Non-Position 372) of the HPPD Gene was Introduced

[0275] According to the method as described in point 5 of Example 1, the Arabidopsisthaliana inflorescences were soaked in the Agrobacterium solution of Example 3, so as to transform the T-DNA of the recombinant expression vectors DBN11504, DBN11505 and DBN11506 into the Arabidopsisthaliana chromosome, thereby obtaining the corresponding transgenic Arabidopsisthaliana plants, i.e. Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-Q284A nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-L359W was introduced and Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F415A nucleotide sequence was introduced.

[0276] According to the method as described in point 6 of Example l,the Arabidopsisthaliana Ti plants into which the AsHPPDm-Q284A nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-L359W nucleotide sequence was introduced, Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F415A nucleotide sequence was introduced and the wild-type Arabidopsisthaliana plants (18 days after sowing) were sprayed with topramezone at three different concentrations respectively, i.e. 25 g ai/ha (one-fold field concentrations, 1 x), 100 g ai/ha (four-fold field concentrations, 4 x) and 0 g ai/ha (water, 0 x). The experimental results were shown in TABLE 9.

TABLE-US-00009 Topramezone tolerance of Arabidopsis thaliana T.sub.1 plants into which HPPD gene mutated at other positions (non-372 positions) was introduced HPPD mutation type Treatment concentration (gai/ha) Grade 0 Grade 1 Grade 2 Grade 3 Score Resistance Grade wild-type 0 20 0 0 0 25 0 0 0 20 100 non-resistant 100 0 0 0 20 100 non-resistant AsHPPD-02 0 20 0 0 0 25 0 5 13 2 62 poorly resistant 100 0 0 4 16 93 non-resistant AsHPPDm-Q284A 0 20 0 0 0 25 0 2 16 2 67 poorly resistant 100 0 0 5 15 92 non-resistant AsHPPDm-L359W 0 20 0 0 0 25 0 0 2 18 97 non-resistant 100 0 0 0 20 100 non-resistant AsHPPDm-F415A 0 20 0 0 0 25 0 6 12 2 60 poorly resistant 100 0 0 0 20 100 non-resistant

[0277] The results in TABLE 9 showed that: as compared with the Arabidopsisthaliana T.sub.1 plant into which the AsHPPD-02 nucleotide was introduced, the Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-Q284A nucleotide sequence was introduced, the Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-L359W nucleotide sequence was introduced, and the Arabidopsisthaliana T.sub.1 plants into which the AsHPPDm-F415A nucleotide sequence was introduced showed no significant difference in terms of the tolerance to topramezone. It can be seen that not all the mutations of any positions in the HPPD amino acid sequence (such as the three positions described in this example or the adjacent positions of other known effective mutation positions) can confer topramezone tolerance to the plants, and it also indicates that the mutation at position 372 of the HPPD amino acid sequence of the present invention is of unpredictable technical effect.

Example 8: Acquisition and Verification of Transgenic Soybean Plants

1. Transformation of Agrobacterium with the Recombinant Expression Vectors

[0278] According to the method for constructing the recombinant expression vector DBN11375 containing AsHPPDm-F372A-02 nucleotide sequence as described in point 3 of Example 1, the recombinant expression vector DBN11375NN was constructed as a control, and its structure was shown in FIG. 5 (Spec: the spectinomycin gene; RB: right border; eFMV: 34S enhancer of figwort mosaic virus (SEQ ID NO:7); prBrCBP: promoter of oilseed rape eukaryotic elongation factor gene 1α (Tsfl) (SEQ ID NO:8); spAtCTP2: Arabidopsisthaliana chloroplast transit peptide (SEQ ID NO:9); EPSPS: 5-enol-pyruvylshikimate-3-phosphate synthase gene (SEQ ID NO:10); tPsE9: terminator of pea RbcS gene (SEQ ID NO: 11); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO: 14); PAT: phosphinothricin-N-acetyl-transferase gene (SEQ ID NO: 15); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 16); LB: left border).

[0279] The recombinant expression vectors DBN11375 described in point 3 of Example 1, DBN11376 and DBN11378 described in point 2 of Example 2, DBN11500 and DBN11502 described in Example 6, and the above-mentioned control recombinant expression vectors DBN11375NN were transformed into the Agrobacterium LBA4404 (Invitrogen, Chicago, USA, CAT: 18313-015) respectively using a liquid nitrogen method, under the following transformation conditions: 100 .Math.L of Agrobacterium LBA4404, and 3 .Math.L of plasmid DNA (recombinant expression vector) were placed in liquid nitrogen for 10 minutes, and bathed in warm water at 37° C. for 10 minutes; the transformed Agrobacterium LBA4404 were inoculated into an LB tube, cultured under the conditions of a temperature of 28° C. and a rotation speed of 200 rpm for 2 hours, and then spread on the LB plate containing 50 mg/L of rifampicin and 50 mg/L of spectinomycin until positive single clones were grown, and single clones were picked out for culturing and the plasmids thereof were extracted. The extracted plasmids were identified by sequencing. The results showed that the structures of the recombinant expression vectors DBN11375, DBN11376, DBN11378, DBN11500, DBN11502 and DBN11375NN were completely correct.

2. Acquisition of Transgenic Soybean Plants

[0280] According to the conventional Agrobacterium infection method, the cotyledonary node tissue of a sterilely cultured soybean variety Zhonghuangl3 was co-cultured with the Agrobacterium as described in point 1 of this Example, so as to introduce the T-DNA (including the figwort mosaic virus 34S enhancer sequence, the oilseed rape eukaryotic elongation factor gene 1α (Tsfl) promoter sequence, the Arabidopsisthaliana chloroplast transit peptide sequence, a 5-enolpyruvylshikimate-3-phosphate synthase gene, the pea RbcS gene terminator sequence, the Arabidopsisthaliana Ubiquitin10 gene promoter sequence, AsHPPDm-F372A-02 nucleotide sequence, ZmHPPDm-F372A-02 nucleotide sequence, PfHPPDm-F372A-02 nucleotide sequence, AsHPPDm-F372A-A110 nucleotide sequence, PfHPPDm-F372A-G413W nucleotide sequence, the nopaline synthetase gene terminator sequence, the cauliflower mosaic virus 35S promoter sequence, phosphinothricin-N-acetyl-transferase gene, and the cauliflower mosaic virus 35S terminator sequence) of the recombinant expression vectors DBN11375, DBN11376, DBN11378, DBN11500, DBN11502 and DBN11375NN into the soybean chromosomes, thereby obtaining soybean plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, soybean plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, soybean plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, soybean plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, soybean plants into which the PfHPPDm-F372A-G413W nucleotide sequence was introduced, and soybean plants into which the control vector DBN11375NN was introduced.

[0281] For the Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in a soybean germination culture medium (3.1 g/L of B5 salt, B5 vitamin, 20 g/L of sucrose, and 8 g/L of agar, pH 5.6), and then cultured under the conditions of a temperature of 25 ± 1° C.; and a photoperiod (light/dark) of 16 h/8 h. After 4-6 days of germination, soybean sterile seedlings swelling at bright green cotyledonary nodes were taken, hypocotyledonary axes were cut off 3-4 millimeters below the cotyledonary nodes, the cotyledons were cut longitudinally, and apical buds, lateral buds and seminal roots were removed. A wound was created at a cotyledonary node using the knife back of a scalpel, and the wounded cotyledonary node tissues were contacted with an Agrobacterium suspension, wherein the Agrobacterium can transfer the AsHPPDm-F372A-02 nucleotide sequence, ZmHPPDm-F372A-02 nucleotide sequence, PfHPPDm-F372A-02 nucleotide sequence, AsHPPDm-F372A-A110 nucleotide sequence, or PfHPPDm-F372A-G413W nucleotide sequence to the wounded cotyledonary node tissues (step 1: the infection step). In this step, the cotyledonary node tissues were preferably immersed in the Agrobacterium suspension (OD.sub.660 = 0.5-0.8, an infection culture medium (2.15 g/L of MS salt, B5 vitamin, 20 g/L of sucrose, 10 g/L of glucose, 40 mg/L of acetosyringone (AS), 4 g/L of 2-morpholine ethanesulfonic acid (MES), and 2 mg/L of zeatin (ZT), pH 5.3)) to initiate the inoculation. The cotyledonary node tissues were co-cultured with Agrobacterium for a period of time (3 days) (step 2: the co-culturing step). Preferably, after the infection step, the cotyledonary node tissues were cultured in a solid culture medium (4.3 g/L of MS salt, B5 vitamin, 20 g/L of sucrose, 10 g/L of glucose, 4 g/L of MES, 2 mg/L of ZT, and 8 g/L of agar, pH 5.6). After this co-culturing stage, there can be an optional “recovery” step in which a recovery culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of MES, 30 g/L of sucrose, 2 mg/L of ZT, 8 g/L of agar, 150 mg/L of cephalosporin, 100 mg/L of glutamic acid, and 100 mg/L of aspartic acid, pH 5.6) with the addition of at least one antibiotic (150-250 mg/L of cephalosporin) for inhibiting the growth of Agrobacterium, and without the addition of a selective agent for a plant transformant, was used (step 3: the recovery step). Preferably, tissue blocks regenerated from the cotyledonary nodes were cultured in a solid culture medium containing the antibiotic and no selective agent, to eliminate Agrobacterium and provide a recovery stage for the infected cells. Subsequently, the tissue blocks regenerated from the cotyledonary nodes were cultured in a culture medium containing a selective agent (glyphosate), and on-growing transformed calli were selected (step 4: the selection step). Preferably, the tissue blocks regenerated from the cotyledonary nodes were cultured in a screening solid culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of MES, 30 g/L of sucrose, 1 mg/L of 6-benzyladenine (6-BAP), 8 g/L of agar, 150 mg/L of cephalosporin, 100 mg/L of glutamic acid, 100 mg/L of aspartic acid, and 0.25 mol/L of N-(phosphonomethyl)glycine, pH 5.6) containing a selective agent, thus resulting in selective growth of the transformed cells. Then, plants were regenerated from the transformed cells (step 5: the regeneration step). Preferably, the tissue blocks regenerated from the cotyledonary nodes grown in a culture medium containing a selective agent were cultured in solid culture media (a B5 differentiation culture medium and B5 rooting culture medium) to regenerate plants.

[0282] The screened out resistant tissues were transferred onto the B5 differentiation culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of MES, 30 g/L of sucrose, 1 mg/L of ZT, 8 g/L of agar, 150 mg/L of cephalosporin, 50 mg/L of glutamic acid, 50 mg/L of aspartic acid, 1 mg/L of gibberellin, 1 mg/L of auxin, and 0.25 mol/L of N-(phosphonomethyl)glycine, pH 5.6), and cultured at 25° C. for differentiation. The differentiated seedlings were transferred onto the B5 rooting culture medium (3.1 g/L of B5 salt, B5 vitamin, 1 g/L of MES, 30 g/L of sucrose, 8 g/L of agar, 150 mg/L of cephalosporin, and 1 mg/L of indole-3-butyric acid (IBA)), cultured in the rooting culture medium at 25° C. until a height of about 10 cm, and then transferred to a glasshouse until fruiting. In the greenhouse, the plants were cultured at 26° C. for 16 hours, and then cultured at 20° C. for 8 hours per day.

[0283] The soybean T.sub.0 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.0 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.0 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.0 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, and soybean T.sub.0 plants into which the PfHPPDm-F372A-G413W nucleotide sequence was introduced were transplanted into the greenhouse for cultivation and propagation to obtain corresponding transgenic T.sub.1 plants.

3. Verification of the Transgenic Soybean Plants Using TaqMan

[0284] About 100 mg of leaves from the soybean T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, soybean T.sub.1 plants into which the PfHPPDm-F372A-G413W nucleotide sequence was introduced, and soybean T.sub.1 plants into which the control vector DBN11375NN was introduced were taken as samples, and the genomic DNA thereof was extracted with a DNeasy Plant Maxi Kit of Qiagen, and copy numbers of an EPSPS gene were detected by the Taqman probe fluorescence quantitative PCR method so as to determine the copy numbers of the mutant HPPD gene. At the same time, wild-type soybean plants were used as controls, and detected and analyzed according to the above-mentioned method. Triple repeats were set for the experiments, and were averaged.

[0285] The specific method for detecting the copy number of the EPSPS gene was as follows: [0286] Step 11. 100 mg of leaves of the soybean T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, soybean T.sub.1 plants into which the PfHPPDm-F372A-G413W nucleotide sequence was introduced, soybean T.sub.1 plants into which the control vector DBN11375NN was introduced, and wild-type soybean plants were taken, and ground into a homogenate using liquid nitrogen in a mortar, and triple repeats were taken for each sample; [0287] Step 12. The genomic DNA of the above-mentioned samples was extracted using a DNeasy Plant Mini Kit of Qiagen, with the particular method as described in the product manual; [0288] Step 13. The concentrations of the genomic DNA of the above-mentioned samples were detected using NanoDrop 2000 (Thermo Scientific); [0289] Step 14. The concentrations of the genomic DNA of the above-mentioned samples were adjusted to a same value in the range of from 80 to 100 ng/.Math.L; [0290] Step 15. The copy numbers of the samples were identified using the Taqman probe fluorescence quantitative PCR method, wherein samples for which the copy numbers were known and had been identified were taken as standards, the samples of the wild-type soybean plants were taken as the control, and triple repeats were taken for each sample, and were averaged; the sequences of fluorescence quantitative PCR primers and a probe were as follows: [0291] the following primers and probe were used to detect the EPSPS gene sequence: [0292] primer 1:ctggaaggcgaggacgtcatcaata, as set forth in SEQ ID NO: 401 in the SEQUENCE LISTING; [0293] primer 2: tggcggcattgccgaaatcgag, as set forth in SEQ ID NO: 402 in the SEQUENCE LISTING; [0294] probe 1: atgcaggcgatgggcgcccgcatccgta, as set forth in SEQ ID NO: 403 in the SEQUENCE LISTING;

TABLE-US-00010 PCR reaction system: JumpStart™ Taq ReadyMix™ (Sigma) 10 .Math.L 50× primer/probe mixture 1 .Math.L genomic DNA 3 .Math.L water (ddH.sub.20) 6 .Math.L

[0295] The 50× primer/probe mixture comprises 45 .Math.L of each primer at a concentration of 1 mM, 50 .Math.L of the probe at a concentration of 100 .Math.M, and 860 .Math.L of 1× TE buffer, and was stored at 4° C. in an amber tube.

TABLE-US-00011 PCR reaction conditions: Step Temperature Time 21 95° C. 5 min 22 95° C. 30 s 23 60° C. 1 min 24 go back to step 22, and repeat 40 times

[0296] Data was analyzed using software SDS2.3 (Applied Biosystems).

[0297] By analyzing the experimental results of the copy number of the EPSPS gene, it was further demonstrated that the AsHPPDm-F372A-02 nucleotide sequence, ZmHPPDm-F372A-02 nucleotide sequence, PfHPPDm-F372A-02 nucleotide sequence, AsHPPDm-F372A-A110 nucleotide sequence, PfHPPDm-F372A-G413W nucleotide sequence had all been incorporated into the chromosome of the detected soybean plants, and all of the soybean T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, soybean T.sub.1 plants into which the PfHPPDm-F372A-G413W nucleotide sequence was introduced, and the soybean T.sub.1 plants into which the control vector DBN11375NN was introduced resulted in single-copy transgenic soybean plants.

4. Detection of the Herbicide Tolerance of the Transgenic Soybean Plants to Topramezone

[0298] The soybean T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, soybean T.sub.1 plants into which, the PfHPPDm-F372A-G413W nucleotide sequence was introduced, soybean T.sub.1 plants into which the control vector DBN11375NN was introduced and wild-type soybean plants (V3-V4 at seedling stage) were sprayed with topramezone at two different concentrations respectively, i.e. 50 g ai/ha (2-fold field concentration, 2 ×) and 100 g ai/ha (4-fold field concentration, 4 ×) to detect the herbicide tolerance of soybean plants. According to the method in point 6 of Example 1, after 7 days of spraying (7 DAT), the damage degree of each plant by the herbicide was statistically analyzed, and the scoring and resistance evaluation were carried out accordingly. The soybean plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced were of two strains in total (S1 and S2), the soybean plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced were of two strains in total (S3 and S4), the soybean plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced were of two strains in total (S5 and S6), the soybean plants into which the AsHPPDm-F372A-Al 10 nucleotide sequence was introduced were of two strains in total (S7 and S8), the soybean plants into which the PfHPPDm-F372A-G413W nucleotide sequence was introduced were of two strains in total (S9 and S10), the soybean plants into which the control vector DBN11375NN nucleotide sequence was introduced were of one strain in total (S11), and the wild-type soybean plants were of one strain in total (CK1); and 8 plants were selected from each strain and detected. The results were shown in TABLE 10 and FIG. 7.

TABLE-US-00012 Herbicide tolerance of transgenic soybean T.sub.1 plants Source of the gene Strain Treatment concentration (gai/ha) Classification and statistics of phytotoxicity Score Resistance evaluation Grade 0 Grade 1 Grade 2 Grade 3 CK1 50 0 0 0 8 100 non-resistant 100 0 0 0 8 100 non-resistant S11 50 0 0 0 8 100 non-resistant 100 0 0 0 8 100 non-resistant Avena sativa S1 50 8 0 0 0 0 Highly resistant 100 8 0 0 0 0 Highly resistant S2 50 8 0 0 0 0 Highly resistant 100 8 0 0 0 0 Highly resistant S7 50 8 0 0 0 0 Highly resistant 100 8 0 0 0 0 Highly resistant S8 50 8 0 0 0 0 Highly resistant 100 8 0 0 0 0 Highly resistant Zea mays S3 50 7 1 0 0 4 Highly resistant 100 2 5 1 0 29 Moderately resistant S4 50 6 2 0 0 8 Highly resistant 100 2 6 0 0 25 Moderately resistant Pseudomonas fluorescens S5 50 5 3 0 0 13 Moderately resistant 100 1 3 4 0 46 Poorly resistant S6 50 4 3 1 0 21 Moderately resistant 100 0 5 3 0 46 Poorly resistant S9 50 4 4 0 0 17 Moderately resistant 100 2 2 4 0 42 Poorly resistant S10 50 5 2 1 0 17 Moderately resistant 100 0 4 4 0 50 Poorly resistant

[0299] For soybeans, 4-fold field concentration of topramezone is an effective dose for high-pressure treatment. The results in TABLE 10 and FIG. 7 showed: (1) as compared to the soybean T.sub.1 plants into which the control vector DBN11375NN was introduced and the wild-type soybean plants, the soybean T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced and soybean T.sub.1 plants into which the PfHPPDm-F372A-G413W nucleotide sequence was introduced were able to produce higher tolerance to topramezone herbicides, indicating that the mutant HPPD (F372A) can confer the transgenic soybean plants a high level of tolerance to topramezone; (2) as compared to the soybean T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced and soybean T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, there was no significant difference in the topramezone tolerance of soybean T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced and the soybean T.sub.1 plants into which the PfHPPDm-F372A-G413W nucleotide sequence was introduced, further indicating that the mutation at position 372 of the HPPD amino acid sequence confers importance and stability of the tolerance to topramezone upon the plants.

Example 9: Acquisition and Verification of Transgenic Rice Plants

1. Construction of the Recombinant Expression Vectors of Rice Containing HPPD Gene

[0300] The 5′ and 3′ ends of the AsHPPDm-F372A-02 nucleotide sequence as described in point 1 of Example 1, the ZmHPPDm-F372A-02 nucleotide sequence and the PfHPPDm-F372A-02 nucleotide sequence as described in point 1 of Example 2, and the AsHPPDm-F372A-A110 nucleotide sequence as described in Example 6 were respectively linked to the following universal adapter primer 2: [0301] Universal adapter primer 2 for the 5′ end: 5′- tgcagataccaagcggccactagt -3′, as set forth in SEQ ID NO: 404 in the SEQUENCE LISTING; [0302] Universal adapter primer 2 for the 3′ end: 5′- caaatgtttgaacgatcggcgcgcc -3′, as set forth in SEQ ID NO: 400 in the SEQUENCE LISTING;

[0303] A plant expression vector DBNBC-02 was subjected to double digestion using restriction enzymes Spe I and Asc I to linearize the plant expression vector. The digestion product was purified to obtain the linearized DBNBC-02 expression vector backbone (vector backbone: pCAMBIA2301 (which is available from CAMBIA)), which then underwent a recombination reaction with the AsHPPDm-F372A-02 nucleotide sequence linked to the universal adapter primer 2, according to the procedure of Takara In-Fusion products seamless connection kit (Clontech, CA, USA, CAT: 121416) instructions, to construct a recombinant expression vector DBN11950 with the vector structure as shown in FIG. 6. (Spec: spectinomycin gene; RB: right border; prOsActl: rice actin 1 promoter (SEQ ID NO:405); PAT: phosphinothricin-N-acetyl-transferase gene (SEQ ID NO:15); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO: 16); pr35S: cauliflower mosaic virus 35S promoter (SEQ ID NO:14); iZmHSP70: Zea mays heat shock 70 kDa protein intron (SEQ ID NO:406); AsHPPDm-F372A-02: AsHPPDm-F372A-02 nucleotide sequence (SEQ ID NO:6); tNos: nopaline synthetase gene terminator (SEQ ID NO:13); prZmUbi: Zea mays ubiquitin 1 gene promoter (SEQ ID NO:407); Hpt: hygromycin phosphotransferase gene (SEQ ID NO:408); t35S: cauliflower mosaic virus 35S terminator (SEQ ID NO:16); LB: left border).

[0304] Escherichia coli T.sub.1 competent cells were transformed according to the heat shock method described in point 3 of Example 1, and the plasmids in the cells were extracted through the alkaline method. The extracted plasmid was identified by sequencing. The results indicated that the recombinant expression vector DBN11950 contained the nucleotide sequence set forth in SEQ ID NO: 6 in the SEQUENCE LISTING, i.e. the AsHPPDm-F372A-02 nucleotide sequence.

[0305] According to the above method for constructing recombinant expression vector DBN11950, the ZmHPPDm-F372A-02 nucleotide sequence, the PfHPPDm-F372A-02 nucleotide sequence and the AsHPPDm-F372A-A110 nucleotide sequence which were linked to the universal adapter primer 2 were respectively subjected to a recombination reaction with the linearized DBNBC-02 expression vector backbone, to construct the recombinant expression vectors DBN11951 to DBN11953 in sequence. Sequencing verified that the ZmHPPDm-F372A-02 nucleotide sequence, the PfHPPDm-F372A-02 nucleotide sequence and the AsHPPDm-F372A-A110 nucleotide sequence were correctly inserted in the recombinant expression vectors DBN11951 to DBN11953.

2. Transformation of Agrobacterium With the Recombinant Expression Vectors

[0306] The recombinant expression vectors DBN11950 to DBN11953 which had been constructed correctly were respectively transformed into Agrobacterium EHA105α using a liquid nitrogen method, with the following transformation conditions: 100 .Math.L of Agrobacterium EHA105α, and 3 .Math.L of plasmid DNA (recombinant expression vector) were placed in liquid nitrogen for 10 minutes, and bathed in warm water at 37° C. for 10 minutes; the transformed Agrobacterium EHA105α was inoculated into an LB tube, cultured under the conditions of a temperature of 28° C. and a rotation speed of 200 rpm for 2 hours, and spread on the LB plate containing 50 mg/L of rifampicin and 50 mg/L of spectinomycin until positive single clones were grown, and single clones were picked out for culturing and the plasmids thereof were extracted. The extracted plasmids were identified by sequencing. The results showed that the structures of the recombinant expression vectors DBN11950 to DBN11953 were completely correct.

3. Acquisition of Transgenic Rice Plants

[0307] For the Agrobacterium-mediated rice transformation, briefly, the rice cultivar Nipponbare were germinated in the induction culture medium (3.1 g/L N6 salts, N6 vitamins, 300 mg/L casein, 30 g/L sucrose, 2 mg/L dichlorophenoxyacetic acid (2,4-D), 3 g/L plant gel; pH 5.8), and the calli were induced from mature rice embryos (Step 1: calli induction step). After that, calli were selected and then were contacted with an Agrobacterium suspension, wherein Agrobacterium can transfer the nucleotide sequences of AsHPPDm-F372A-02 nucleotide sequence, AsHPPDm-F372A-A110 nucleotide sequence, ZmHPPDm-F372A-02 nucleotide sequence or PfHPPDm-F372A-02 nucleotide sequence into at least one cell in one of the calli (step 2: infection step). In this step, the calli were preferably immersed in the Agrobacterium suspension (OD.sub.660 = 0.3, infection medium (3.1 g/L N6 salts, N6 vitamins, 300 mg/L casein, 30 g/L sucrose, 10 g/L glucose, 40 mg/L AS, 2 mg/L 2,4-D; pH 5.4)) to start the inoculation. The calli were co-cultured with Agrobacterium for a period of time (3 days) (step 3: co-culturing step). Preferably, after the infection step, the calli were cultured in a solid medium (3.1 g/L N6 salts, N6 vitamins, 300 mg/L casein, 30 g/L sucrose, 10 g/L glucose, 40 mg/L AS, 2 mg/L 2,4-D, 3 g/L plant gel; pH 5.8). After the co-culturing step, there may be a “recovery” step in which a recovery medium (3.1 g/L N6 salts, N6 vitamins, 300 mg/L casein, 30 g/L sucrose, 2 mg/L 2,4-D, 3 g/L plant gel; pH 5.8) with the addition of at least one antibiotic (150-250 mg/L of cephamycin) for inhibiting the growth of Agrobacterium, and without the addition of any selective agent for plant transformants, was used (step 4: recovery step). Preferably, the calli were cultured in a solid medium comprising antibiotic but no selective agent, so as to eliminate Agrobacterium and provide a recovery period for the infected cells. Then, the inoculated calli were cultured on a medium containing a selective agent (hygromycin) and the on-growing transformed calli were selected (step 5: selection step). Preferably, the calli were cultured in a solid selective medium (3.1 g/L N6 salts, N6 vitamins, 300 mg/L casein, 30 g/L sucrose, 50 mg/L of hygromycin, 2 mg/L 2,4-D, 3 g/L plant gel; pH 5.8) comprising a selective agent, which resulted in the selective growth of the transformed cells. Then, the calli was regenerated into plants (step 6: regeneration step). Preferably, the calli growing on the medium containing a selective agent were cultured in a solid medium (N6 differential medium and MS rooting medium) to regenerate plants.

[0308] The resistant calli obtained from screening were transferred to N6 differential medium (3.1 g/L N6 salts, N6 vitamins, 300 mg/L casein, 30 g/L sucrose, 150 mg/L of cephamycin, 20 mg/L of hygromycin, 2 mg/L 6-benzyladenine, 1 mg/L napthalene acetic acid, 3 g/L plant gel; pH 5.8), and cultured for differentiation at 25° C. The differentiated plantlets were transferred to MS rooting medium (2.15 g/L MS salts, MS vitamins, 300 mg/L casein, 15 g/L sucrose, 3 g/L plant gel; pH 5.8), and cultured at 25° C. When the plantlets reached about 10 cm in height, they were moved to greenhouse and cultured until fruiting. In the greenhouse, they were cultured at 30° C. to obtain transformed T.sub.0 rice plants.

[0309] The rice T.sub.0 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, rice T.sub.0 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, rice T.sub.0 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced and rice T.sub.0 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced were transplanted into the greenhouse for cultivation and propagation to obtain corresponding transgenic T.sub.1 plants.

4. Verification of the Transgenic Rice Plants Using TaqMan

[0310] About 100 mg of leaves from the rice T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, rice Ti plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, rice T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, and rice T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced were taken as samples, and the genomic DNA thereof was extracted with a DNeasy Plant Maxi Kit of Qiagen, and copy numbers of an Hpt gene were detected by the Taqman probe fluorescence quantitative PCR method so as to determine the copy numbers of the mutant HPPD gene. At the same time, wild-type rice plants were used as controls, and detected and analyzed according to the above-mentioned method. Triple repeats were set for the experiments, and were averaged.

[0311] The specific method for detecting the copy number of the Hpt gene was as follows: [0312] Step 31. 100 mg of leaves of the rice plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, rice plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, rice plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, rice plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, and wild-type rice plants were taken, and ground into a homogenate using liquid nitrogen in a mortar, and triple repeats were taken for each sample; [0313] Step 32. The genomic DNA of the above-mentioned samples was extracted using a DNeasy Plant Mini Kit of Qiagen, with the particular method as described in the product manual; [0314] Step 33. The concentrations of the genomic DNA of the above-mentioned samples were detected using NanoDrop 2000 (Thermo Scientific); [0315] Step 34. The concentrations of the genomic DNA of the above-mentioned samples were adjusted to a consistent value in the range of from 80 to 100 ng/.Math.L; [0316] Step 35. The copy numbers of the samples were identified using the Taqman probe fluorescence quantitative PCR method, wherein samples for which the copy numbers were known and had been identified were taken as standards, the samples of the wild-type rice plants were taken as the control, and triple repeats were taken for each sample, and were averaged; the sequences of fluorescence quantitative PCR primers and a probe were as follows: [0317] the following primers and probe were used to detect the Hpt gene sequence: [0318] primer 3: gcataacagcggtcattgactg, as set forth in SEQ ID NO: 409 in SEQUENCE LISTING; [0319] primer 4: agaagatgttggcgacctcg, as set forth in SEQ ID NO: 410 in SEQUENCE LISTING; [0320] probe 2: agcgaggcgatgttcggggattc, as set forth in SEQ ID NO: 411 in the SEQUENCE LISTING;

TABLE-US-00013 PCR reaction system: JumpStart™ Taq ReadyMix™ (Sigma) 10 .Math.L 50× primer/probe mixture 1 .Math.L genomic DNA 3 .Math.L water (ddH.sub.20) 6 .Math.L

[0321] The 50× primer/probe mixture comprises 45 .Math.L of each primer at a concentration of 1 mM, 50 .Math.L of the probe at a concentration of 100 .Math.M, and 860 .Math.L of 1 × TE buffer, and was stored at 4° C. in an amber tube.

TABLE-US-00014 PCR reaction conditions: Step Temperature Time 41 95° C. 5 min 42 95° C. 30 s 43 60° C. 1 min 44 go back to step 42, and repeat 40 times

[0322] Data was analyzed using software SDS2.3 (Applied Biosystems).

[0323] By analyzing the experimental results of the copy number of the EPSPS gene, it was further demonstrated that the AsHPPDm-F372A-02 nucleotide sequence, AsHPPDm-F372A-A110 nucleotide sequence, ZmHPPDm-F372A-02 nucleotide sequence and PfHPPDm-F372A-02 nucleotide sequence had all been incorporated into the chromosome of the detected rice plants, and all of the rice T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, rice T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, rice T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced and rice T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced resulted in single-copy transgenic soybean plants.

5. Detection of the Herbicide Tolerance of the Transgenic Rice Plants

[0324] The rice T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, rice T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, rice T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, rice T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced and wild-type rice plants (V3-V4 at seedling stage) were sprayed with topramezone at two different concentrations respectively, i.e. 50 g ai/ha (2-fold field concentration, 2 ×) and 100 g ai/ha (4-fold field concentration, 4 ×) to detect the herbicide tolerance of rice plants. According to the method in point 6 of Example 1, after 7 days of spraying (7 DAT), the damage degree of each plant by the herbicide was statistically analyzed, and the scoring and resistance evaluation were carried out accordingly. The rice T.sub.1 plants into which AsHPPDm-F372A-02 nucleotide sequence was introduced were of two strains in total (S12 and S13), rice T.sub.1 plants into which AsHPPDm-F372A-A1 10 nucleotide sequence was introduced were of two strains in total (S14 and S15), rice T.sub.1 plants into which ZmHPPDm-F372A-02 nucleotide sequence was introduced were of two strains in total (S16 and S17), rice T.sub.1 plants into which PfHPPDm-F372A-02 nucleotide sequence was introduced were of two strains in total (S18 and S19), and the wild-type rice plants were of one strain in total (CK2); and 8 plants were selected from each strain and tested. The results were shown in TABLE 11.

TABLE-US-00015 Herbicide tolerance of transgenic rice T.sub.1 plants Source of the gene Strain Treatment concentration (gai/ha) Classification and statistics of phytotoxicity Score Resistance evaluation Grade 0 Grade 1 Grade 2 Grade 3 CK2 50 0 0 0 8 100 non-resistant 100 0 0 0 8 100 non-resistant Avena saliva S12 50 8 0 0 0 0 Highly resistant 100 8 0 0 0 0 Highly resistant S13 50 8 0 0 0 0 Highly resistant 100 85 0 0 0 0 Highly resistant S14 50 8 0 0 0 0 Highly resistant 100 8 0 0 0 0 Highly resistant S15 50 8 0 0 0 0 Highly resistant 100 7 1 0 0 4 Highly resistant Zea mays S16 50 8 0 0 0 0 Highly resistant 100 3 3 2 0 29 Moderately resistant S17 50 6 2 0 0 8 Highly resistant 100 5 2 1 0 17 Moderately resistant Pseudomonas fluorescens S18 50 4 3 1 0 21 Moderately resistant 100 1 4 3 0 42 Poorly resistant S19 50 4 4 0 0 17 Moderately resistant 100 0 3 5 0 54 Poorly resistant

[0325] For rice, 4-fold field concentration of topramezone is an effective dose for high-pressure treatment. The results in TABLE 11 showed that as compared to the wild-type rice plants, the rice T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, rice T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, rice T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, rice T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced were able to produce higher tolerance to topramezone herbicides. Meanwhile, there was no significant difference between the topramezone tolerance of the rice T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced and that of the rice T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, indicating that the mutation at position 372 of the HPPD amino acid sequence is sufficient to provide the transgenic rice plants with a high level of tolerance to topramezone herbicides.

Example 10: Verification of the Tolerance of Transgenic Soybean Plants to Other HPPD Inhibitors

[0326] In order to further verify the tolerance effect of HPPD (F372A) on other HPPD inhibitors, the soybean T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, soybean T.sub.1 plants into which the control vector DBN11375NN was introduced in Example 8, and the wild-type soybean plants (V3-V4 at seedling stage) were sprayed as follows to detect the herbicide tolerance of each soybean plants, (1) 140 g ai/ha (2-fold field concentration, 2 ×) isoxaflutole; (2) 280 g ai/ha (4-fold field concentration, 4 ×) isoxaflutole; (3) 210 g ai/ha (2-fold field concentration, 2 ×) mesotrione; (4) 420 g ai/ha (4-fold field concentration, 4 ×) mesotrione. According to the method in point 6 of Example 1, after 7 days of spraying (7 DAT), the damage degree of each plant by the herbicide was statistically analyzed, and the scoring and resistance evaluation were carried out accordingly. The soybean T.sub.1 plants into which AsHPPDm-F372A-02 nucleotide sequence was introduced were of two strains in total (S1 and S2), the soybean T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced were of two strains in total (S3 and S4), the soybean T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced were of two strains in total (S5 and S6), the soybean T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced were of two strains in total (S7 and S8), the soybean T.sub.1 plants into which the control vector DBN11375NN nucleotide sequence was introduced were of one strain in total (S11), and the wild-type soybean plants were of one strain in total (CK1); and 8 plants were selected from each strain and tested. The results were shown in TABLE 12.

TABLE-US-00016 Herbicide tolerance of transgenic rice T.sub.1 plants Source of the gene Strain Treatment concentration of isoxaflutole (g ai/ha) Resistance evaluation Treatment concentration of mesotrione (gai/ha) Resistance evaluation CK1 140 non-resistant 210 non-resistant 280 non-resistant 420 non-resistant S11 140 non-resistant 210 non-resistant 280 non-resistant 420 non-resistant Avena sativa S1 140 Highly resistant 210 Highly resistant 280 Moderately resistant 420 Highly resistant S2 140 Highly resistant 210 Highly resistant 280 Moderately resistant 420 Highly resistant S7 140 Highly resistant 210 Highly resistant 280 Moderately resistant 420 Highly resistant S8 140 Highly resistant 210 Highly resistant 280 Moderately resistant 420 Highly resistant Zea mays S3 140 Moderately resistant 210 Moderately resistant 280 Poorly resistant 420 Poorly resistant S4 140 Moderately resistant 210 Poorly resistant 280 Poorly resistant 420 Poorly resistant Pseudomonas fluorescens S5 140 Highly resistant 210 Moderately resistant 280 Moderately resistant 420 Poorly resistant S6 140 Highly resistant 210 Moderately resistant 280 Moderately resistant 420 Poorly resistant

[0327] For soybeans, 4-fold field concentration of isoxaflutole and 4-fold field concentration of mesotrione are effective doses for high-pressure treatment. The results in TABLE 12 showed: (1) as compared to the soybean T.sub.1 plants into which the control vector DBN11375NN was introduced and the wild-type soybean plants, the soybean T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the ZmHPPDm-F372A-02 nucleotide sequence was introduced, soybean T.sub.1 plants into which the PfHPPDm-F372A-02 nucleotide sequence was introduced and soybean T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced were able to produce different degrees of tolerance to isoxaflutole and mesotrione herbicides, and especially soybean T.sub.1 plants with HPPD gene at position 372 mutated from Avenasativa origin have better herbicide tolerance to isoxaflutole and mesotrione, indicating that the mutant HPPD (F372A) can confer the tolerance to these two HPPD inhibitor herbicides upon the transgenic soybean plants; (2) as compared to the soybean T.sub.1 plants into which the AsHPPDm-F372A-02 nucleotide sequence was introduced, there was no significant difference in the isoxaflutole and mesotrione herbicides tolerance of soybean T.sub.1 plants into which the AsHPPDm-F372A-A110 nucleotide sequence was introduced, indicating that the mutation at position 372 of the HPPD amino acid sequence is sufficient to provide the plants with a high level of tolerance to isoxaflutole and mesotrione herbicides.

[0328] In conclusion, the present invention discloses for the first time that mutation at position 372 of hydroxyphenyl pyruvate dioxygenase polypeptides from different species can confer a higher tolerance to pyrazolinates, isoxazoles and triketones HPPD inhibitor herbicides upon plants, to such an extent that the plants can tolerate at least one-fold field concentration of topramezone, isoxaflutole or mesotrione. Therefore, the present invention has a broad application prospect in plants.

[0329] At last, it should be noted that all the above Examples are only used to illustrate the embodiments of the present invention rather than to limit the present invention. Although the present invention is described in detail with reference to the preferred Examples, those skilled in the art should understand that the embodiments of the present invention could be modified or substituted equivalently without departing from the spirit and scope of the technical solutions of the present invention.