Method of Producing Fatty Alcohol

20190338318 ยท 2019-11-07

Assignee

Inventors

Cpc classification

International classification

Abstract

A method of producing a long-chain fatty alcohol, containing culturing a microorganism wherein expression of a gene encoding a 3-ketoacyl-ACP synthase and expression of a gene encoding a fatty acyl-CoA reductase are enhanced; a method of providing ability to produce a long-chain fatty alcohol for a microorganism wherein expression of a gene encoding a 3-ketoacyl-ACP synthase and expression of a gene encoding a fatty acyl-CoA reductase are enhanced in a microorganism cell; and a transformant of a microorganism in which expression of a gene encoding a -ketoacyl-ACP synthase and expression of a gene encoding a fatty acyl-CoA reductase are enhanced.

Claims

1. A method of producing a long-chain fatty alcohol including a fatty alcohol having 20 or more carbon atoms, comprising culturing a microorganism wherein expression of a gene encoding at least one kind of -ketoacyl-ACP synthase selected from the group consisting of the following proteins (A) to (F) and expression of a gene encoding at least one kind of fatty acyl-CoA reductase selected from the group consisting of the following proteins (G) to (R) are enhanced; (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; (B) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (A), and having -ketoacyl-ACP synthase II activity; (C) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 96; (D) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (C), and having -ketoacyl-ACP synthase II activity; (E) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 98; (F) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (E), and having -ketoacyl-ACP synthase II activity; (G) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3; (H) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (G), and having fatty acyl-CoA reductase activity; (I) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 5; (J) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (I), and having fatty acyl-CoA reductase activity; (K) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 7; (L) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (K), and having fatty acyl-CoA reductase activity; (M) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9; (N) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (M), and having fatty acyl-CoA reductase activity; (O) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 100; (P) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (O), and having fatty acyl-CoA reductase activity; (Q) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 101; and (R) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (Q), and having fatty acyl-CoA reductase activity.

2. The method of producing a long-chain fatty alcohol according to claim 1, wherein the gene encoding the -ketoacyl-ACP synthase and the gene encoding the fatty acyl-CoA reductase gene are introduced into the microorganism, to enhance the expression of the gene encoding the -ketoacyl-ACP synthase and the gene encoding the fatty acyl-CoA reductase gene introduced.

3. The method of producing a long-chain fatty alcohol according to claim 2, comprising the steps of separating a solution containing fatty alcohols including long-chain fatty alcohols from media, wherein the long-chain fatty alcohol to be produced includes a fatty alcohol having 20 or more carbon atoms.

4. The method of producing a long-chain fatty alcohol according to claim 1, wherein the protein (B) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (A), and having -ketoacyl-ACP synthase II activity; the protein (D) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (C), and having -ketoacyl-ACP synthase II activity; and the protein (F) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (E), and having -ketoacyl-ACP synthase II.

5. The method of producing a long-chain fatty alcohol according to claim 1, wherein the protein (H) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (G), and having fatty acyl-CoA reductase activity; the protein (J) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (I), and having fatty acyl-CoA reductase activity; the protein (L) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (K), and having fatty acyl-CoA reductase activity; the protein (N) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (M), and having fatty acyl-CoA reductase activity; the protein (P) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (O), and having fatty acyl-CoA reductase activity; and the protein (R) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (Q), and having fatty acyl-CoA reductase activity.

6. The method of producing a long-chain fatty alcohol according to claim 1, wherein the microorganism lacked the ability to produce a long-chain fatty alcohol having 20 or more carbon atoms prior to enhancing expression of the gene encoding the -ketoacyl-ACP synthase and the gene encoding the fatty acyl-CoA reductase.

7. The method of producing a long-chain fatty alcohol according to claim 1, wherein the microorganism is Escherichia coli or cyanobacteria.

8. The method of producing a long-chain fatty alcohol according to claim 7, wherein the cyanobacteria are cyanobacteria of the genus Synechocystis or the genus Synechococcus.

9. The method of producing a long-chain fatty alcohol according to claim 1, wherein the long-chain fatty alcohol is a long-chain fatty alcohol having 20 to 26 carbon atoms.

10. The method of producing a long-chain fatty alcohol according to claim 1, wherein the amount of the long-chain fatty alcohols having 20 or more carbon atoms in the amount of the total fatty alcohols produced by the microorganism is 1% or more with respect to the weight of the total fatty alcohols.

11. The method of producing a long-chain fatty alcohol according to claim 1, wherein the long-chain fatty alcohol after culturing exists in an extracellular medium.

12. The method of producing a long-chain fatty alcohol according to claim 11, which comprises the step of separating the microorganism from at least a part of the medium containing the fatty alcohols after culturing.

13. A transformant of a microorganism, in which expression of a gene encoding at least one kind of -ketoacyl-ACP synthase selected from the group consisting of the following proteins (A) to (F) and expression of a gene encoding at least one kind of fatty acyl-CoA reductase selected from the group consisting of the following proteins (G) to (R) are enhanced; (A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1; (B) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (A), and having -ketoacyl-ACP synthase II activity; (C) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 96; (D) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (C), and having P-ketoacyl-ACP synthase II activity; (E) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 98; (F) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (E), and having -ketoacyl-ACP synthase II activity; (G) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3; (H) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (G), and having fatty acyl-CoA reductase activity; (I) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 5; (J) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (I), and having fatty acyl-CoA reductase activity; (K) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 7; (L) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (K), and having fatty acyl-CoA reductase activity; (M) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9; (N) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (M), and having fatty acyl-CoA reductase activity; (O) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 100; (P) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (O), and having fatty acyl-CoA reductase activity; (Q) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 101; and (R) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (Q), and having fatty acyl-CoA reductase activity.

14. The transformant according to claim 13, wherein the gene encoding the -ketoacyl-ACP synthase or a recombinant vector containing the same, and the gene encoding the fatty acyl-CoA reductase or a recombinant vector containing the same are introduced into the microorganism.

15. The transformant according to claim 13, wherein the protein (B) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (A), and having -ketoacyl-ACP synthase II activity; the protein (D) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (C), and having -ketoacyl-ACP synthase II activity; and the protein (F) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (E), and having -ketoacyl-ACP synthase II.

16. The transformant according to claim 13, wherein the protein (H) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (G), and having fatty acyl-CoA reductase activity; the protein (J) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (I), and having fatty acyl-CoA reductase activity; the protein (L) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (K), and having fatty acyl-CoA reductase activity; the protein (N) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (M), and having fatty acyl-CoA reductase activity; the protein (P) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (O), and having fatty acyl-CoA reductase activity; and the protein (R) is a protein consisting of an amino acid sequence having 90% or more identity with the amino acid sequence of the protein (Q), and having fatty acyl-CoA reductase activity.

17. The transformant according to claim 13, wherein the microorganism lacked the ability to produce a long-chain fatty alcohol having 20 or more carbon atoms prior to enhancing expression of the gene encoding the -ketoacyl-ACP synthase and the gene encoding the fatty acyl-CoA reductase.

18. The transformant according to claim 13, wherein the microorganism is Escherichia coli or cyanobacteria.

19. The transformant according to claim 18, wherein the cyanobacteria are cyanobacteria of the genus Synechocystis or the genus Synechococcus.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0018] FIG. 1 is a graph showing a result of gas chromatography mass spectrometry analysis of fatty alcohols produced by transformants prepared in Preparation Example 3 in Example.

[0019] FIG. 2 is a graph showing a result of gas chromatography mass spectrometry analysis of fatty alcohols produced by transformants prepared in Preparation Example 4 in Example.

DESCRIPTION OF EMBODIMENTS

[0020] The present invention relates to providing a method of producing long-chain fatty alcohols, which improves productivity of long-chain fatty alcohols in host microorganisms.

[0021] Further, the present invention relates to providing a method of providing ability to produce long-chain fatty alcohols for a host microorganism which has no ability to produce a long-chain fatty alcohol.

[0022] Furthermore, the present invention relates to providing a transformant for which ability to produce long-chain fatty alcohol is provided.

[0023] The present inventors firstly identified a KAS having function of KAS II as an enzyme involved in synthesis of long-chain fatty acids, from alga belonging to the genus Nannochloropsis being one kind of algae. Then, the present inventors found that this protein has ability of synthesizing a fatty acid having 20 or more carbon atoms which is used as a precursor of a long-chain fatty alcohol.

[0024] Further, the present inventors focused on a FAR derived from Arabidopsis thaliana (hereinafter, also referred to as AtFAR) and a FAR derived from Brassica rapa (hereinafter, also referred to as BrFAR), as a FAR which catalyzes a reaction of synthesizing a fatty alcohol by using an acyl-ACP as a substrate.

[0025] As a result of enhancing expression of a gene encoding the KAS and a gene encoding the AtFAR or the BrFAR in a cell of a host microorganism, the present inventors found that the host microorganism, which originally has no ability to produce a long-chain fatty acid having 20 or more carbon atoms, acquired the ability to produce a long-chain fatty acid, and further found that the host microorganism acquired ability to produce a long-chain fatty alcohol having 20 or more carbon atoms.

[0026] The present invention was completed based on these findings.

[0027] According to the method of producing the fatty alcohols of the present invention, the productivity of long-chain fatty alcohols in host microorganisms can be improved.

[0028] Further, according to the method of providing ability to produce the long-chain fatty alcohols of the present invention, the ability to produce the same can be provided for a host microorganism originally having no ability to produce a long-chain fatty acid.

[0029] Moreover, the transformant of the present invention is excellent in the productivity of long-chain fatty alcohols.

[0030] The term lipid(s) in the present specification, covers a simple lipid such as a neutral lipid (triacylglycerol, or the like), wax, and a ceramide; a complex lipid such as a phospholipid, a glycolipid, and a sulfolipid; and a derived lipid obtained from the lipid such as a fatty acid (free fatty acid), alcohols, and hydrocarbons.

[0031] The fatty acids categorized into the derived lipid generally refer to the fatty acids per se and mean free fatty acids. In the present invention, a part of the fatty acids or a part of the acyl group in molecules of a simple lipid and a complex lipid is expressed as fatty acid residue. Then, unless otherwise specified, a term fatty acid is used as a generic term for free fatty acid and fatty acid residue.

[0032] Further, a term fatty alcohol composition in the present specification means a weight proportion of each fatty alcohol relative to the weight of whole fatty alcohols (total fatty alcohols). The weight (production amount) of the fatty alcohols or the fatty alcohol composition can be measured according to the method used in Examples.

[0033] In the present specification, the description of Cx:y for the fatty alcohol or the acyl group constituting the fatty alcohol means that the number of carbon atoms is x and the number of double bonds is y. The description of Cx means a fatty alcohol or an acyl group having x as the number of carbon atoms. Further, the description of Cx:y-COOH means a fatty acid having x as the number of carbon atoms and y as the number of double bonds, and the description of Cx:y-OH means a fatty alcohol having x as the number of carbon atoms and y as the number of double bonds.

[0034] In the present specification, the identity of the nucleotide sequence and the amino acid sequence is calculated through the Lipman-Pearson method (Science, 1985, vol. 227, p. 1435-1441). Specifically, the identity can be determined through use of a homology analysis (search homology) program of genetic information processing software Genetyx-Win with Unit size to compare (ktup) being set to 2.

[0035] It should be note that, in this description, the stringent conditions includes, for example, the method described in Molecular CloningA LABORATORY MANUAL THIRD EDITION [Joseph Sambrook, David W. Russell., Cold Spring Harbor Laboratory Press], and examples thereof include conditions where hybridization is performed by incubating a solution containing 6SSC (composition of 1SSC: 0.15 M sodium chloride, 0.015 M sodium citrate, pH7.0), 0.5% SDS, 5Denhardt and 100 mg/mL herring sperm DNA together with a probe at 65 C. for 8 to 16 hours.

[0036] Furthermore, in the present specification, the term upstream of a gene means a region subsequent to a 5 side of a targeted gene or region, and not a position from a translational initiation site. On the other hand, the term downstream of the gene means a region subsequent to a 3 side of the targeted gene or region.

[0037] The present inventors focused on a KASII derived from an alga belonging to the genus Nannochloropsis, and an AtFAR described in Non-Patent Literatures 1 to 4 and a BrFAR whose amino acid sequence is highly identical to the amino acid sequence of the AtFAR. Then, expression of each of the above-described KAS, AtFAR and BrFAR was enhanced in the cells of the host microorganisms to measure a formation amount of the fatty alcohols. As a result, even when the above-described proteins were each independently enhanced, production of the long-chain fatty alcohols was unable to be confirmed.

[0038] On the other hand, as shown in Examples mentioned later, a transformant provided with ability to produce the long-chain fatty alcohols can be prepared by enhancing the expression of both the KAS gene and the FAR gene in microorganisms originally have no ability to synthesize long-chain fatty acids having 20 or more carbon atoms, such as Escherichia coli and cyanobacteria.

[0039] The KAS is an enzyme involved in chain length elongation of acyl group in synthetic pathway of a fatty acid which is a precursor of a fatty alcohol. The KAS is one kind of fatty acid synthetic enzyme which catalyzes the condensation reaction of an acyl-ACP with a malonyl-ACP, and is involved in the synthesis of acyl-ACP. In the fatty acid synthetic pathway, generally, the elongation reaction of the carbon chain is repeated starting from an acetyl-CoA, and finally an acyl-ACP having 16 or 18 carbon atoms is synthesized.

[0040] In the first stage of the fatty acid synthesis, an acetoacetyl-ACP is formed by a condensation reaction between the acetyl-CoA and a malonyl-ACP. The KAS catalyzes this reaction. Then, the keto group of the acetoacetyl-ACP is reduced by a -ketoacyl-ACP reductase, to produce a hydroxybutyryl-ACP. Subsequently, the hydroxybutyryl-ACP is dehydrated by a -hydroxyacyl-ACP dehydrase, to produce a crotonyl-ACP. Finally, the crotonyl-ACP is reduced by an enoyl-ACP reductase, to produce a butyryl-ACP. The butyryl-ACP in which two carbon atoms are added to the carbon chain of the acyl group of the acetyl-ACP is produced by a series of these reactions. Hereinafter, the similar reactions are repeated to cause elongation of the carbon chain of the acyl-ACP, and an acyl-ACP having 16 or 18 carbon atoms is finally synthesized.

[0041] KAS is categorized into KAS I, KAS II, KAS III and KAS IV according to their substrate specificity. KAS III uses an acetyl-CoA having 2 carbon atoms as the substrate to catalyze the elongation reaction that the number of carbon atoms is increased from 2 to 4. KAS I mainly catalyzes the elongation reaction that the number of carbon atoms is increased from 4 to 16, to synthesize the palmitoyl-ACP having 16 carbon atoms. KAS II mainly catalyzes the elongation reaction to the long-chain acyl group having 16 to 18 carbon atoms or more, to synthesize a long-chain acyl-ACP. KAS IV mainly catalyzes the elongation reaction that the acyl-ACP having 6 carbon atoms is converted to the acyl-ACP having 14 carbon atoms, to synthesize a medium-chain acyl-ACP.

[0042] KAS that can be preferably used in the present invention is preferably the KAS II which mainly involved in synthesis of long-chain acyl-ACP having 16 or 18 carbon atoms. Specific examples of such KAS II include the following proteins (A) to (F).

(A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1;
(B) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (A), and having -ketoacyl-ACP synthase activity (hereinafter, also referred to as KAS activity);
(C) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 96;
(D) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (C), and having KAS activity;
(E) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 98; and
(F) a protein consisting of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (E), and having KAS activity.

[0043] The proteins (A) to (F) (hereinafter, also referred to as NoKASII) are one kind of KAS, and are involved in synthesis of long-chain fatty acids.

[0044] The protein (A) is a KAS derived from Nannochloropsis oculata strain NIES-2145 being an alga belonging to the genus Nannochloropsis.

[0045] Further, according to localization prediction based on ChloroP (http://www.cbs.dtu.dk/services/ChloroP/) or targetP (http://www.cbs.dtu.dk/services/TargetP/), the above-described protein (A) is considered to be a KAS of a chloroplast-localized type and an N-terminal 30 to 40 amino acid residue is considered to be a chloroplast transit signal sequence.

[0046] The proteins (A) to (F) described above have the KAS activity. In the present specification, the term KAS activity means the activity to catalyze the condensation reaction of the acetyl-CoA or the acyl-ACP with the malonyl-ACP. The KAS activity of the protein can be confirmed by, for example, introducing a DNA produced by linking a gene encoding the protein to the downstream of a promoter which functions in a host cell, into a host cell which lacks a fatty acid degradation system, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced gene, and analyzing any change caused thereby in the fatty acid composition of the host cell or in the cultured liquid by an ordinary technique. Alternatively, the KAS activity can be confirmed by introducing a DNA produced by linking a gene encoding the protein to the downstream of a promoter which functions in a host cell, into a host cell, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced gene, purifying the protein, and conducting a chain length elongation reaction using various acyl-ACPs, as substrates.

[0047] Further, the proteins (A) to (F) are preferably KASII also having synthetic activity of a long-chain -ketoacyl-ACP having 18 or more carbon atoms, among KASII-typed KASs which are mainly involved in elongation reaction to long-chain acyl group having 16 to 18 carbon atoms. In addition, in the present specification, the term long-chain -ketoacyl-ACP synthetic activity means catalytic activity of an elongation reaction of synthesis of a long-chain acyl-ACP having 18 or more carbon atoms by applying an acyl-ACP having mainly 16 or more carbon atoms as a substrate.

[0048] The synthetic activity of the KAS to the long-chain -ketoacyl-ACP can be confirmed by, for example, introducing a DNA produced by linking a gene encoding the protein to the downstream of a promoter which functions in a host cell, into a host cell which lacks a fatty acid degradation system, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced gene, and analyzing any change caused thereby in the fatty acid composition of the host cell or the cultured liquid by an ordinary technique. Alternatively, the synthetic activity to the long-chain -ketoacyl-ACP can be confirmed by introducing a DNA produced by linking a gene encoding the protein to the downstream of a promoter which functions in a host cell, into a host cell, culturing the thus-obtained cell under the conditions suitable for the expression of the introduced gene, purifying the protein, and conducting a chain length elongation reaction using various acyl-ACPs, as substrates.

[0049] The protein (B) consists of an amino acid sequence having 60% or more identity with the amino acid sequence of the protein (A), and has KAS activity.

[0050] In general, it is known that an amino acid sequence encoding an enzyme protein does not necessarily exhibit enzyme activity unless the sequence in the whole region is conserved, and there exists a region in which the enzyme activity is not influenced even if the amino acid sequence is changed. In such a region which is not essential to the enzyme activity, even if the mutation of the amino acid, such as deletion, substitution, insertion and addition thereof is introduced thereinto, the activity inherent to the enzyme can be maintained. Also in the present invention, such a protein can be used in which the KAS activity is kept and a part of the amino acid sequence is subjected to mutation.

[0051] In the protein (B), the identity with the amino acid sequence of the protein (A) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of KAS activity. Further, specific examples of the protein (B) include a protein in which 1 or several (for example 1 or more and 190 or less, preferably 1 or more and 166 or less, more preferably 1 or more and 142 or less, further preferably 1 or more and 118 or less, furthermore preferably 1 or more and 95 or less, furthermore preferably 1 or more and 71 or less, furthermore preferably 1 or more and 47 or less, furthermore preferably 1 or more and 38 or less, furthermore preferably 1 or more and 23 or less, furthermore preferably 1 or more and 9 or less, and furthermore preferably 1 or more and 4 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (A), and having ACP activity.

[0052] Further, as the protein (B), it is preferable that the protein consists of an amino acid sequence in which the identity with the amino acid sequence of the protein (A) is 60% or more, the protein has the KAS activity, and from which the chloroplast transit signal sequence is deleted.

[0053] Moreover, the protein (B) also preferably includes a protein consisting of an amino acid sequence formed such that a signal peptide engaging in transport or secretion of the protein is added to the amino acid sequence of the protein (A) or (B).

[0054] The protein (C) consists of an amino acid sequence of the 41.sup.st to 475.sup.th amino acids of the amino acid sequence set forth in SEQ ID NO: 1 and a methionine residue added on the side of the N-terminus. Note that the protein (B) also includes the protein (C). In the protein (C), from the protein consisting of the amino acid sequence set forth in SEQ ID NO: 1, the chloroplast transit signal sequence (the 2.sup.nd to 40.sup.th amino acid residues of the amino acid sequence set forth in SEQ ID NO: 1) on the side of the N-terminus is deleted.

[0055] In the protein (D), the identity with the amino acid sequence of the protein (C) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of KAS activity. Further, specific examples of the protein (D) include a protein in which 1 or several (for example 1 or more and 174 or less, preferably 1 or more and 152 or less, more preferably 1 or more and 130 or less, further preferably 1 or more and 108 or less, furthermore preferably 1 or more and 87 or less, furthermore preferably 1 or more and 65 or less, furthermore preferably 1 or more and 43 or less, furthermore preferably 1 or more and 34 or less, furthermore preferably 1 or more and 21 or less, furthermore preferably 1 or more and 8 or less, and furthermore preferably 1 or more and 4 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (C).

[0056] Moreover, the protein (D) also preferably includes a protein consisting of an amino acid sequence formed such that a signal peptide engaging in transport or secretion of the protein is added to the amino acid sequence of the protein (C) or (D).

[0057] The protein (E) consists of an amino acid sequence of the 21.sup.st to 475.sup.th amino acids of the amino acid sequence set forth in SEQ ID NO: 1 and a methionine residue added on the side of the N-terminus. Note that the protein (B) also includes the protein (E). In the protein (E), from the protein consisting of the amino acid sequence set forth in SEQ ID NO: 1, the chloroplast transit signal sequence (the 2.sup.nd to 20.sup.th amino acid residues of the amino acid sequence set forth in SEQ ID NO: 1) on the side of the N-terminus is deleted.

[0058] In the protein (F), the identity with the amino acid sequence of the protein (E) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of KAS activity. Further, specific examples of the protein (F) include a protein in which 1 or several (for example 1 or more and 183 or less, preferably 1 or more and 160 or less, more preferably 1 or more and 137 or less, further preferably 1 or more and 114 or less, furthermore preferably 1 or more and 92 or less, furthermore preferably 1 or more and 69 or less, furthermore preferably 1 or more and 46 or less, furthermore preferably 1 or more and 37 or less, furthermore preferably 1 or more and 23 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (E).

[0059] Moreover, the protein (F) also preferably includes a protein consisting of an amino acid sequence formed such that a signal peptide engaging in transport or secretion of the protein is added to the amino acid sequence of the protein (E) or (F).

[0060] In the present invention, the KAS is preferably the protein (E) or (F). By using the protein (E) or (F) as a KAS, ability to produce long-chain fatty alcohols in the host microorganisms is further improved.

[0061] A method of introducing the mutation into an amino acid sequence includes a method of, for example, introducing a mutation into a nucleotide sequence encoding the amino acid sequence. A method of introducing the mutation includes a method of introducing a site-specific mutation. Specific examples of the method of introducing the site-specific mutation include a method of utilizing the SOE-PCR, the ODA method, and the Kunkel method. Further, commercially available kits such as PrimeSTAR Mutagenesis Basal Kit (Takara Bio), Transformer TM Site-Directed Mutagenesis kit (Clontech Laboratories), and KOD-Plus-Mutagenesis Kit (TOYOBO) can also be utilized. Furthermore, a gene containing a desired mutation can also be obtained by introducing a genetic mutation at random, and then performing an evaluation of the enzyme activities and a gene analysis thereof by an appropriate method.

[0062] The proteins (A) to (F) can be obtained by chemical techniques, genetic engineering techniques or the like that are ordinarily carried out. For example, a natural product-derived protein can be obtained through isolation, purification and the like from Nannochloropsis oculata. In addition, the proteins (A) to (F) can be obtained by artificial chemical synthesis based on the amino acid sequence set forth in SEQ ID NO: 1. Alternatively, as recombinant proteins, proteins (A) to (F) may also be produced by gene recombination technologies. In the case of producing a recombinant protein, the 3-ketoacyl-ACP synthase gene described below can be used.

[0063] Note that the algae such as Nannochloropsis oculata can be obtained from culture collection such as private or public research institutes or the like. For example, Nannochloropsis oculata strain NIES-2145 can be obtained from National Institute for Environmental Studies (NIES).

[0064] An example of a gene encoding the KAS (preferably, any one of the proteins (A) to (F)) (hereinafter, also referred to as KAS gene) includes a gene consisting of at least one of the following DNAs (a) to (f) (hereinafter, also referred to as NoKASII gene).

(a) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 2;
(b) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (a), and encoding a protein having KAS activity;
(c) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 97;
(d) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (c), and encoding a protein having KAS activity;
(e) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 99; and
(f) a DNA consisting of a nucleotide sequence having 60% or more identity with the nucleotide sequence of the DNA (e), and encoding a protein having KAS activity.

[0065] The nucleotide sequence set forth in SEQ ID NO: 2 is a nucleotide sequence of a gene encoding a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1 (KAS derived from Nannochloropsis oculata strain NIES-2145).

[0066] In the DNA (b), the identity with the nucleotide sequence of the DNA (a) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of KAS activity. Further, the DNA (b) is also preferably a DNA in which 1 or several (for example 1 or more and 571 or less, preferably 1 or more and 499 or less, more preferably 1 or more and 428 or less, further preferably 1 or more and 357 or less, further preferably 1 or more and 285 or less, further preferably 1 or more and 214 or less, further preferably 1 or more and 142 or less, further preferably 1 or more and 114 or less, further preferably 1 or more and 71 or less, further preferably 1 or more and 28 or less, and furthermore preferably 1 or more and 14 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence set forth in SEQ ID NO: 2, and encoding the protein (A) or (B) having KAS activity. Furthermore, the DNA (b) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (a) under a stringent condition, and encoding the protein (A) or (B) having KAS activity.

[0067] Further, the DNA (b) may be a DNA consisting of a nucleotide sequence in which the identity with the nucleotide sequence of the DNA (a) is 60% or more, and encoding the protein (A) or (B) having KAS activity, and from which the nucleotide sequence encoding the chloroplast transit signal sequence is deleted.

[0068] Moreover, the DNA (b) also preferably includes a DNA consisting of a nucleotide sequence encoding such that a signal peptide engaging in transport or secretion of the protein is added to the nucleotide sequence of the DNA (a) or (b).

[0069] The DNA (c) consists of a nucleotide sequence of the 121.sup.st to 1428.sup.th nucleotides of the nucleotide sequence set forth in SEQ ID NO: 2 and a start codon (ATG) added on the side of the 5 end, and encoding the protein (C) (a protein consisting of the amino acid sequence set forth in SEQ ID NO: 96). Note that the above-described DNA (b) also includes the DNA (c). In the DNA (c), from the DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 2, the nucleotide sequence encoding the chloroplast transit signal sequence (the 4th to 120.sup.th nucleotides of the nucleotide sequence set forth in SEQ ID NO: 2) is deleted.

[0070] In the DNA (d), the identity with the nucleotide sequence of the DNA (c) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of KAS activity. Further, the DNA (d) is also preferably a DNA in which 1 or several (for example 1 or more and 523 or less, preferably 1 or more and 457 or less, more preferably 1 or more and 392 or less, further preferably 1 or more and 327 or less, further preferably 1 or more and 261 or less, further preferably 1 or more and 196 or less, further preferably 1 or more and 130 or less, further preferably 1 or more and 104 or less, further preferably 1 or more and 65 or less, further preferably 1 or more and 26 or less, and furthermore preferably 1 or more and 13 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (c), and encoding the protein (C) or (D) having KAS activity. Furthermore, the DNA (d) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (c) under a stringent condition, and encoding the protein (C) or (D) having KAS activity.

[0071] Moreover, the DNA (d) also preferably includes a DNA consisting of a nucleotide sequence encoding such that a signal peptide engaging in transport or secretion of the protein is added to the nucleotide sequence of the DNA (c) or (d).

[0072] The DNA (e) consists of a nucleotide sequence of the 61.sup.st to 1428.sup.th nucleotides of the nucleotide sequence set forth in SEQ ID NO: 2 and a start codon (ATG) added on the side of the 5 end, and encoding the protein (E) (a protein consisting of the amino acid sequence set forth in SEQ ID NO: 98). Note that the above-described DNA (b) also includes the DNA (e). In the DNA (e), from the DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 2, the nucleotide sequence encoding the chloroplast transit signal sequence (the 4.sup.th to 60.sup.th nucleotides of the nucleotide sequence set forth in SEQ ID NO: 2) is deleted.

[0073] In the DNA (f), the identity with the nucleotide sequence of the DNA (e) is preferably 65% or more, more preferably 70% or more, further preferably 75% or more, further preferably 80% or more, further preferably 85% or more, further preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of KAS activity. Further, the DNA (f) is also preferably a DNA in which 1 or several (for example 1 or more and 549 or less, preferably 1 or more and 480 or less, more preferably 1 or more and 412 or less, further preferably 1 or more and 343 or less, further preferably 1 or more and 275 or less, further preferably 1 or more and 206 or less, further preferably 1 or more and 138 or less, further preferably 1 or more and 110 or less, further preferably 1 or more and 69 or less, further preferably 1 or more and 28 or less, and furthermore preferably 1 or more and 14 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (e), and encoding the protein (E) or (F) having KAS activity. Furthermore, the DNA (f) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (e) under a stringent condition, and encoding the protein (E) or (F) having KAS activity.

[0074] Moreover, the DNA (f) may be a DNA consisting of a nucleotide sequence in which a nucleotide sequence encoding a signal peptide engaging in transport or secretion of the protein is added to the nucleotide sequence of the DNA (e) or (f).

[0075] In the present invention, the KAS gene is preferably a gene consisting of the DNA (e) or (f). By using a gene consisting of the DNA (e) or (f) as a KAS gene, ability to produce long-chain fatty alcohols in the host microorganisms is further improved.

[0076] In the present specification, FAR is an enzyme having fatty acyl-CoA reductase activity (hereinafter, also referred to as FAR activity) which catalyzes a reaction of synthesizing a fatty alcohol by using an acyl-CoA or an acyl-ACP as a substrate. The FAR is also referred to as a fatty acyl reductase or a fatty acid reductase. A plurality of methods of converting an acyl-CoA or an acyl-ACP into a fatty alcohol is known. Among these, in formation of the fatty alcohols through FAR, a fatty alcohol is formed from an acyl-CoA or an acyl-ACP by a monoenzymatic reaction.

[0077] It can be confirmed that the protein has the FAR activity by a system using a FAR gene deletion strain, for example. Alternatively, it can also be confirmed by examining synthesis of fatty alcohols by introducing the DNA in which a gene encoding the above-described protein is ligated downstream of a promoter functioning in a host cell, into the FAR gene deletion strain. Alternatively, it can also be confirmed by measuring an increase of fatty alcohol amount according to an ordinary method by preparing the FAR or cell lysate containing the same to react the resultant material with the reaction solution containing fatty acyl-CoA, fatty acyl-ACP or the like.

[0078] FAR that is preferred for the present invention is preferably a FAR having substrate specificity to long-chain acyl-CoA or long-chain acyl-ACP. Specific examples of such FAR include the following proteins (G) to (R). The following proteins (G) to (R) all have FAR activity.

(G) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3;
(H) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (G), and having FAR activity;
(I) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 5;
(J) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (I), and having FAR activity;
(K) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 7;
(L) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (K), and having FAR activity;
(M) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9;
(N) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (M), and having FAR activity;
(O) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 100;
(P) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (O), and having FAR activity;
(Q) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 101; and
(R) a protein consisting of an amino acid sequence having 80% or more identity with the amino acid sequence of the protein (Q), and having FAR activity.

[0079] A protein consisting of the amino acid sequence set forth in SEQ ID NO: 3 (protein (G); hereinafter, also referred to as AtFAR1), a protein consisting of the amino acid sequence set forth in SEQ ID NO: 5 (protein (I); hereinafter, also referred to as AtFAR3), a protein consisting of the amino acid sequence set forth in SEQ ID NO: 7 (protein (K); hereinafter, also referred to as AtFAR4), and a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9 (protein (M); hereinafter, also referred to as AtFAR5) are all one kind of FAR derived from Arabidopsis thaliana. In the present specification, the above-described FARs derived from Arabidopsis thaliana are also referred to as AtFAR, as a whole.

[0080] Both a protein consisting of the amino acid sequence set forth in SEQ ID NO: 100 (protein (O); hereinafter, also referred to as BrFAR1) and a protein consisting of the amino acid sequence set forth in SEQ ID NO: 101 (protein (Q); hereinafter, also referred to as BrFAR5) are one kind of FAR derived from Brassica rapa. In the present specification, the above-described FARs derived from Brassica rapa are also referred to as BrFAR, as a whole.

[0081] In the protein (H), the identity with the amino acid sequence of the protein (G) is preferably 85% or more, more preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of FAR activity. Further, specific examples of the protein (H) include a protein in which 1 or several (for example 1 or more and 99 or less, preferably 1 or more and 74 or less, more preferably 1 or more and 50 or less, further preferably 1 or more and 40 or less, furthermore preferably 1 or more and 25 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (G).

[0082] In the protein (J), the identity with the amino acid sequence of the protein (I) is preferably 85% or more, more preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of FAR activity. Further, specific examples of the protein (J) include a protein in which 1 or several (for example 1 or more and 99 or less, preferably 1 or more and 74 or less, more preferably 1 or more and 50 or less, further preferably 1 or more and 40 or less, furthermore preferably 1 or more and 25 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (I).

[0083] In the protein (L), the identity with the amino acid sequence of the protein (K) is preferably 85% or more, more preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of FAR activity. Further, specific examples of the protein (L) include a protein in which 1 or several (for example 1 or more and 99 or less, preferably 1 or more and 74 or less, more preferably 1 or more and 50 or less, further preferably 1 or more and 40 or less, furthermore preferably 1 or more and 25 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (K).

[0084] In the protein (N), the identity with the amino acid sequence of the protein (M) is preferably 85% or more, more preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of FAR activity. Further, specific examples of the protein (N) include a protein in which 1 or several (for example 1 or more and 100 or less, preferably 1 or more and 75 or less, more preferably 1 or more and 50 or less, further preferably 1 or more and 40 or less, furthermore preferably 1 or more and 25 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (M).

[0085] In the protein (P), the identity with the amino acid sequence of the protein (O) is preferably 85% or more, more preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of FAR activity. Further, specific examples of the protein (P) include a protein in which 1 or several (for example 1 or more and 99 or less, preferably 1 or more and 74 or less, more preferably 1 or more and 50 or less, further preferably 1 or more and 40 or less, furthermore preferably 1 or more and 25 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (O).

[0086] In the protein (R), the identity with the amino acid sequence of the protein (Q) is preferably 85% or more, more preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of FAR activity. Further, specific examples of the protein (R) include a protein in which 1 or several (for example 1 or more and 100 or less, preferably 1 or more and 75 or less, more preferably 1 or more and 50 or less, further preferably 1 or more and 40 or less, furthermore preferably 1 or more and 25 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less) amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (Q).

[0087] A method of introducing the mutation into an amino acid sequence includes the methods described above for the KAS.

[0088] In general, it is known that an amino acid sequence encoding an enzyme protein does not necessarily exhibit enzyme activity unless the sequence in the whole region is conserved, and there exists a region in which the enzyme activity is not influenced even if the amino acid sequence is changed. In such a region which is not essential to the enzyme activity, even if the mutation of the amino acid, such as deletion, substitution, insertion and addition thereof is introduced thereinto, the activity inherent to the enzyme can be maintained. Also in the present invention, such a protein can be used in which the FAR activity is kept and a part of the amino acid sequence is subjected to mutation.

[0089] Table 1 collectively shows identities of amino acid sequences among various plant-derived FARs mentioned above, enumerated as FAR genes that can be used in the present invention.

TABLE-US-00001 TABLE 1 Identities of amino acid sequences among various FARs AtFAR1 AtFAR3 AtFAR4 AtFAR5 BrFAR1 BrFAR5 AtFAR1 (Protein (G)) 52% 73% 67% 85% 68% AtFAR3 (Protein (I)) 53% 50% 52% 50% AtFAR4 (Protein (K)) 68% 74% 68% AtFAR5 (Protein (M)) 69% 87% BrFAR1 (Protein (O)) 69% BrFAR5 (Protein (Q))

[0090] The proteins (G) to (R) can be obtained by chemical techniques, genetic engineering techniques or the like that are ordinarily carried out. For example, a natural product-derived protein can be obtained through isolation, purification and the like from Arabidopsis thaliana or Brassica rapa. In addition, the proteins (G) to (R) can be obtained by artificial chemical synthesis based on the amino acid sequence set forth in SEQ ID NO: 3, 5, 7, 9, 100 or 101. Alternatively, as recombinant proteins, proteins (G) to (R) may also be produced by gene recombination technologies. In the case of producing a recombinant protein, the gene encoding the FAR described below can be used.

[0091] An example of the gene encoding the FAR (preferably, any one of the proteins (G) to (R)) (hereinafter, also referred to as FAR gene) includes a gene consisting of at least one of the following DNAs (g) to (r).

(g) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 4;
(h) a DNA consisting of a nucleotide sequence having 80% or more identity with the nucleotide sequence of the DNA (g), and encoding a protein having FAR activity;
(i) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 6;
(j) a DNA consisting of a nucleotide sequence having 80% or more identity with the nucleotide sequence of the DNA (i), and encoding a protein having FAR activity;
(k) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 8;
(l) a DNA consisting of a nucleotide sequence having 80% or more identity with the nucleotide sequence of the DNA (k), and encoding a protein having FAR activity;
(m) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 10;
(n) a DNA consisting of a nucleotide sequence having 80% or more identity with the nucleotide sequence of the DNA (m), and encoding a protein having FAR activity;
(o) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 35;
(p) a DNA consisting of a nucleotide sequence having 80% or more identity with the nucleotide sequence of the DNA (o), and encoding a protein having FAR activity;
(q) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 36; and
(r) a DNA consisting of a nucleotide sequence having 80% or more identity with the nucleotide sequence of the DNA (q), and encoding a protein having FAR activity.

[0092] The nucleotide sequence set forth in SEQ ID NO: 4 is a nucleotide sequence of a gene (hereinafter, also referred to as AtFAR1 gene) encoding the protein (AtFAR1) consisting of the amino acid sequence set forth in SEQ ID NO: 3.

[0093] The nucleotide sequence set forth in SEQ ID NO: 6 is a nucleotide sequence of a gene (hereinafter, also referred to as AtFAR3 gene) encoding the protein (AtFAR3) consisting of the amino acid sequence set forth in SEQ ID NO: 5.

[0094] The nucleotide sequence set forth in SEQ ID NO: 8 is a nucleotide sequence of a gene (hereinafter, also referred to as AtFAR4 gene) encoding the protein (AtFAR4) consisting of the amino acid sequence set forth in SEQ ID NO: 7.

[0095] The nucleotide sequence set forth in SEQ ID NO: 10 is a nucleotide sequence of a gene (hereinafter, also referred to as AtFAR5 gene) encoding the protein (AtFAR5) consisting of the amino acid sequence set forth in SEQ ID NO: 9.

[0096] The nucleotide sequence set forth in SEQ ID NO: 35 is a nucleotide sequence of a gene (hereinafter, also referred to as BrFAR1 gene) encoding the protein (BrFAR1) consisting of the amino acid sequence set forth in SEQ ID NO: 100.

[0097] The nucleotide sequence set forth in SEQ ID NO: 36 is a nucleotide sequence of a gene (hereinafter, also referred to as BrFAR5 gene) encoding the protein (BrFAR5) consisting of the amino acid sequence set forth in SEQ ID NO: 101.

[0098] In the DNA (h), the identity with the nucleotide sequence of the DNA (g) is preferably 85% or more, more preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of FAR activity.

[0099] Further, the DNA (h) is also preferably a DNA in which 1 or several (for example 1 or more and 296 or less, preferably 1 or more and 222 or less, more preferably 1 or more and 148 or less, further preferably 1 or more and 119 or less, further preferably 1 or more and 74 or less, further preferably 1 or more and 30 or less, and furthermore preferably 1 or more and 15 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (g), and encoding a protein having FAR activity.

[0100] Furthermore, the DNA (h) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (g) under a stringent condition, and encoding a protein having FAR activity.

[0101] In the DNA (j), the identity with the nucleotide sequence of the DNA (i) is preferably 85% or more, more preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of FAR activity.

[0102] Further, the DNA (j) is also preferably a DNA in which 1 or several (for example 1 or more and 297 or less, preferably 1 or more and 223 or less, more preferably 1 or more and 149 or less, further preferably 1 or more and 119 or less, further preferably 1 or more and 75 or less, further preferably 1 or more and 30 or less, and furthermore preferably 1 or more and 15 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (i), and encoding a protein having FAR activity.

[0103] Furthermore, the DNA (j) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (i) under a stringent condition, and encoding a protein having FAR activity.

[0104] In the DNA (I), the identity with the nucleotide sequence of the DNA (k) is preferably 85% or more, more preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of FAR activity.

[0105] Further, the DNA (I) is also preferably a DNA in which 1 or several (for example 1 or more and 297 or less, preferably 1 or more and 223 or less, more preferably 1 or more and 149 or less, further preferably 1 or more and 119 or less, further preferably 1 or more and 75 or less, further preferably 1 or more and 30 or less, and furthermore preferably 1 or more and 15 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (k), and encoding a protein having FAR activity.

[0106] Furthermore, the DNA (I) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (k) under a stringent condition, and encoding a protein having FAR activity.

[0107] In the DNA (n), the identity with the nucleotide sequence of the DNA (m) is preferably 85% or more, more preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of FAR activity.

[0108] Further, the DNA (n) is also preferably a DNA in which 1 or several (for example 1 or more and 299 or less, preferably 1 or more and 224 or less, more preferably 1 or more and 150 or less, further preferably 1 or more and 120 or less, further preferably 1 or more and 75 or less, further preferably 1 or more and 30 or less, and furthermore preferably 1 or more and 15 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (m), and encoding a protein having FAR activity.

[0109] Furthermore, the DNA (n) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (m) under a stringent condition, and encoding a protein having FAR activity.

[0110] In the DNA (p), the identity with the nucleotide sequence of the DNA (o) is preferably 85% or more, more preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of FAR activity.

[0111] Further, the DNA (p) is also preferably a DNA in which 1 or several (for example 1 or more and 297 or less, preferably 1 or more and 223 or less, more preferably 1 or more and 149 or less, further preferably 1 or more and 119 or less, further preferably 1 or more and 75 or less, further preferably 1 or more and 30 or less, and furthermore preferably 1 or more and 15 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (o), and encoding a protein having FAR activity.

[0112] Furthermore, the DNA (p) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (o) under a stringent condition, and encoding a protein having FAR activity.

[0113] In the DNA (r), the identity with the nucleotide sequence of the DNA (q) is preferably 85% or more, more preferably 90% or more, further preferably 92% or more, further preferably 95% or more, further preferably 98% or more, and furthermore preferably 99% or more, in view of FAR activity.

[0114] Further, the DNA (r) is also preferably a DNA in which 1 or several (for example 1 or more and 299 or less, preferably 1 or more and 225 or less, more preferably 1 or more and 150 or less, further preferably 1 or more and 120 or less, further preferably 1 or more and 75 or less, further preferably 1 or more and 30 or less, and furthermore preferably 1 or more and 15 or less) nucleotides are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (q), and encoding a protein having FAR activity.

[0115] Furthermore, the DNA (r) is also preferably a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (q) under a stringent condition, and encoding a protein having FAR activity.

[0116] Table 2 collectively shows identities of nucleotide sequences among various FAR genes mentioned above, enumerated as FAR genes that can be used in the present invention.

TABLE-US-00002 TABLE 2 Identities of nucleotide sequences among various FAR genes AtFAR1 AtFAR3 AtFAR4 AtFAR5 BrFAR1 BrFAR5 AtFAR1 (DNA (g)) 59% 76% 71% 86% 72% AtFAR3 (DNA (i)) 60% 58% 59% 58% AtFAR4 (DNA (k)) 74% 75% 74% AtFAR5 (DNA (m)) 73% 88% BrFAR1 (DNA (o)) 72% BrFAR5 (DNA (q))

[0117] A method of enhancing the expression of the KAS gene and the FAR gene can be appropriately selected from an ordinarily method. For example, a method of introducing the KAS gene and the FAR gene into a host microorganism, and a method of modifying expression regulation regions of the gene (promoter, terminator, or the like) in a host microorganism having the KAS gene and the FAR gene on a genome, can be selected. Especially, the method of introducing the KAS gene and the FAR gene into a host microorganism to enhance both the KAS gene and the FAR gene expression is preferable. The host for transformant of the present invention may be a host which does not have ability of producing a long-chain fatty acid having 20 or more carbon atoms.

[0118] Hereinafter, in the present specification, a cell in which expression of a gene encoding a target protein herein is enhanced is also referred to as the transformant, and a cell in which the expression of the gene encoding the target protein is not enhanced is also referred to as the host or wild type strain.

[0119] The transformant of the present invention in which expression of the KAS gene and the FAR gene are enhanced is excellent in the productivity of long-chain fatty alcohols. Further, in the transformant of the present invention, the productivity of long-chain fatty alcohols (a production amount of long-chain fatty alcohols or a proportion of long-chain fatty alcohols in the total fatty alcohols to be produced) is tend to increase, in comparison with a host. In addition, even a host originally having no ability to produce a long-chain fatty alcohol acquires the ability to produce the long-chain fatty alcohol. In addition, in the present specification, the term long-chain fatty alcohol means a fatty alcohol in which acyl group, that constitutes the fatty alcohol, has 20 or more carbon atoms, preferably 20, 22, 24 or 26 carbon atoms, more preferably 20 or 22 carbon atoms.

[0120] Among the transformants of the present invention, a transformant in which expression of the KAS gene and FAR gene are enhanced can be preferably applied to production of long-chain fatty alcohols having 20 or more carbon atoms, more preferably long-chain fatty alcohols having 20 to 26 carbon atoms, further preferably saturated long-chain fatty alcohols or mono-unsaturated long-chain fatty alcohols having 20 to 26 carbon atoms, and further preferably saturated long-chain fatty alcohols or mono-unsaturated long-chain fatty alcohols having 20 or 22 carbon atoms.

[0121] The productivity of fatty alcohols in the host and the transformant can be measured by the method used in Examples described below.

[0122] The method of introducing the KAS gene and the FAR gene into a host microorganism to enhance the expression of the genes is described.

[0123] The KAS gene and the FAR gene can be obtained by genetic engineering techniques that are ordinarily carried out. For example, the KAS gene can be artificially synthesized based on the amino acid sequence set forth in SEQ ID NO: 1, 96 or 98, or the nucleotide sequence set forth in SEQ ID NO: 2, 97 or 99. Similar to that, the FAR gene can be artificially synthesized based on the amino acid sequence set forth in SEQ ID NO: 3, 5, 7, 9, 100 or 101, or the nucleotide sequence set forth in SEQ ID NO: 4, 6, 8, 10, 35 or 36.

[0124] The synthesis of the KAS gene and the FAR gene can be achieved by utilizing, for example, the services of Invitrogen. Further, the gene can also be obtained by cloning from Nannochloropsis oculata, Arabidopsis thaliana and Brassica rapa. The cloning can be carried out by, for example, the methods described in Molecular Cloning: A LABORATORY MANUAL THIRD EDITION [Joseph Sambrook, David W. Russell, Cold Spring Harbor Laboratory Press (2001)]. In addition, depending on the type of the host to be used, a part of the nucleotide sequence of the genes may be optimized. For example, GeneArt Gene Synthesis service from Thermo Fisher Scientific can be used therefor.

[0125] Nannochloropsis oculata NIES-2145 used in Examples can be obtained from National Institute for Environmental Studies (NIES).

[0126] Each the KAS gene and the FAR gene used for the present invention may be used alone or in combination with two or more kinds thereof.

[0127] The transformant that can be preferably used in the present invention is obtained by introducing the KAS gene and the FAR gene into a host according to an ordinarily method. Specifically, the transformant can be produced by preparing a recombinant vector or a gene expression cassette which is capable of expressing the KAS gene and the FAR gene in a host cell, introducing this vector or cassette into a host cell, and thereby transforming the host cell.

[0128] The host microorganism for the transformant can be appropriately selected from ordinarily used hosts.

[0129] As the microorganisms, prokaryotes and eukaryotes can be used, and microorganisms belonging to the genus Escherichia, microorganisms belonging to the genus Bacillus, prokaryotes such as cyanobacteria (blue-green bacteria), and eukaryotic microorganisms such as yeast and filamentous fungi or the like can be used. Among these, prokaryotes are preferred, microorganisms belonging to the genus Escherichia or cyanobacteria are more preferred, and Escherichia coli or cyanobacteria are further preferred.

[0130] Cyanobacteria which are preferably used as the host of the transformants of the present invention are one group of prokaryotes that perform photosynthesis using chlorophyll, and have an ability to produce oxygen through photosynthesis and fix carbon dioxide. More than billion years ago, cyanobacteria were engulfed by eukaryotic cells. Such intracellular symbiont (primary symbiosis), cyanobacteria, are considered as an origin of chloroplasts. Thus cyanobacteria have been widely used in photosynthesis studies as an ancestor organism of chloroplasts. Further, cyanobacteria grow faster than other plants, and have high photosynthetic ability. Furthermore, cyanobacteria also have a transformation ability.

[0131] Cyanobacteria are highly diversified. In view of cell morphology, there are bacteria having a unicellular shape such as Synechocystis sp. PCC6803, bacteria having a filamentous shape formed of many cells connected like a string such as Anabaena sp. PCC7120 forming heterocysts and fixing nitrogen, bacteria having a spiral shape and a branched shape, and the like.

[0132] In view of growth environment, there are species adapted in various conditions including thermophilic bacteria such as Thermosynechococcus elongatus BP-1 isolated from Beppu Onsen; and oceanic bacteria such as Synechococcus sp. CC9311 living in the coast or Synechococcus sp. WH8102 living in the outer sea.

[0133] As bacteria having feature intrinsic to the species, Microcystis aeruginosa, which has gas vacuoles and can produce toxin; Gloeobacter violaceus PCC7421 having no thylakoid and a light harvesting antenna, i.e., phycobilisome, bound to plasma membrane; and oceanic Acaryochloris marina having chlorophyll d as a main (>95%) photosynthetic pigment in place of chlorophyll a, as is in general photosynthetic organisms, are also mentioned.

[0134] In cyanobacteria, carbon dioxide fixed by photosynthesis is converted into acetyl-CoA via a large number of enzymatic reaction processes. In the initial stage of fatty acid synthesis, malonyl-CoA is synthesized from acetyl-CoA and carbon dioxide by the function of acetyl-CoA carboxylase. Next, malonyl-CoA is converted into malonyl-ACP by the function of malonyl-CoA:ACP transacylase. Thereafter, while -ketoacyl-ACP synthase progressively works, two carbon units are sequentially added to synthesize acyl-ACP, which are increased in two carbons and used as an intermediate for synthesizing e.g., a membrane lipid.

[0135] Every kind of cyanobacteria can be used as the host of the transformant of the present invention. Specific examples of the cyanobacteria include cyanobacteria of the genus Synechocystis, the genus Synechococcus, the genus Thermosynechococcus, the genus Trichodesmium, the genus Acaryochloris, the genus Crocosphaera, and the genus Anabaena. Among these, cyanobacteria of the genus Synechocystis, the genus Synechococcus, the genus Thermosynechococcus, or the genus Anabaena are preferable, and cyanobacteria of the genus Synechocystis or the genus Synechococcus are more preferable. Further, the host used in the present invention is preferably Synechocystis sp. PCC6803, Synechocystis sp. PCC7509, Synechocystis sp. PCC6714, Synechococcus elongatus sp. PCC7942, Thermosynechococcus elongatus BP-1, Trichodesmium erythraeum IMS101, Acaryochloris mariana MBIC11017, Crocosphaera watsonii WH8501, or Anabaena sp. PCC7120, more preferably Synechocystis sp. PCC6803 or Synechococcus elongatus sp. PCC7942.

[0136] A vector for use as the plasmid vector for gene expression or a vector containing the gene expression cassette (plasmid) may be any vector capable of introducing the gene encoding the objective protein into a host, and expressing the gene in the host cell. For example, a vector which has expression regulation regions such as a promoter and a terminator in accordance with the type of the host to be introduced, and has a replication initiation point, a selection marker or the like, can be used. Furthermore, the vector may also be a vector such as a plasmid capable of self-proliferation and self-replication outside the chromosome, or may also be a vector which is incorporated into the chromosome.

[0137] Specific examples of the expression vector that can be preferably used in the present invention include pBluescript (pBS) II SK() (manufactured by Stratagene), a pSTV-based vector (manufactured by Takara Bio), a pUC-based vector (manufactured by Takara Bio), a pET-based vector (manufactured by Takara Bio), a pGEX-based vector (manufactured by GE Healthcare), a pCold-based vector (manufactured by Takara Bio), pHY300PLK (manufactured by Takara Bio), pUB110 (Mckenzie, T. et al., 1986, Plasmid 15(2), p. 93-103), pBR322 (manufactured by Takara Bio), pRS403 (manufactured by Stratagene), pMW218/219 (manufactured by Nippon Gene), a pRI-based vector (manufactured by Takara Bio), a pBI-based vector (manufactured by Clontech), and an IN3-based vector (manufactured by Inplanta Innovations).

[0138] Moreover, a kind of promoter regulating the expression of the gene encoding an objective protein introduced into the expression vector can also be appropriately selected according to a kind of the host to be used. Specific examples of the promoter that can be preferably used in the present invention include lac promoter, trp promoter, tac promoter, trc promoter, T7 promoter, SpoVG promoter, a promoter that relates to a substance that can be induced by addition of isopropyl -D-1-thiogalactopyranoside (IPTG), a promoter of rrnA operon gene encoding Rubisco operon (rbc), PSI reaction center protein (psaAB), D1 protein of PSII (psbA), c-phycocyanin 13 subunit (cpcB) and ribosomal RNA, cauliflower mosaic virus 35S RNA promoter, promoters for housekeeping genes (e.g., tubulin promoter, actin promoter and ubiquitin promoter), Brassica napus or Brassica raga-derived Napin gene promoter, plant-derived Rubisco promoter, a promoter of a violaxanthin/(chlorophyll a)-binding protein gene derived from the genus Nannochloropsis (VCP1 promoter, VCP2 promoter) (Oliver Kilian, et al., Proceedings of the National Academy of Sciences of the United States of America, 2011, vol. 108(52)), and a promoter of an oleosin-like protein LDSP (lipid droplet surface protein) gene derived from the genus Nannochloropsis (Astrid Vieler, et al., PLOS Genetics, 2012; 8(11): e1003064. doi: 10.1371).

[0139] Moreover, a kind of selection marker for confirming introduction of the gene encoding a target protein can also be appropriately selected according to a kind of the host to be used. Examples of the selection marker that can be preferably used in the present invention include drug resistance genes such as an ampicillin resistance gene, a chloramphenicol resistance gene, an erythromycin resistance gene, a neomycin resistance gene, a kanamycin resistance gene, a spectinomycin resistance gene, a tetracycline resistance gene, a blasticidin S resistance gene, a bialaphos resistance gene, a zeocin resistance gene, a paromomycin resistance gene, a gentamicin resistance gene, and a hygromycin resistance gene. Further, it is also possible to use a deletion of an auxotrophy-related gene or the like as the selection marker gene.

[0140] Introduction of the gene encoding an objective protein to the vector can be conducted by an ordinary technique such as restriction enzyme treatment and ligation.

[0141] Further, the gene to be introduced is preferably optimized in codon in accordance with use frequency of codon in the host microorganism. Information of codons used in each of organisms is available from Codon Usage Database (www.kazusa.or.jp/codon/).

[0142] The method for transformation can be appropriately selected from ordinary techniques according to a kind of the host to be used. Examples of the method for transformation include a spontaneous transformation method, a transformation method of using calcium ion, a general competent cell transformation method, a protoplast transformation method, an electroporation method, an LP transformation method, a method of using Agrobacterium, a particle gun method, and the like.

[0143] In a case where cyanobacteria are used as host microorganisms, the KAS gene and the FAR gene introduced into the cyanobacteria are preferably incorporated into the genome of cyanobacteria by homologous recombination or the like. Positions into which the KAS gene and the FAR gene are incorporated into the genome can be appropriately set.

[0144] The selection of a transformant having a target gene fragment introduced therein can be carried out by utilizing the selection marker or the like. For example, the selection can be carried out by using an indicator whether a transformant acquires the drug resistance as a result of introducing a drug resistance gene into a host cell together with a target DNA fragment upon the transformation. Further, the introduction of a target DNA fragment can also be confirmed by PCR method using a genome as a template or the like.

[0145] In a host having the KAS gene and the FAR gene on a genome, a method of modifying expression regulation regions of the genes and enhancing the expression of the genes is described.

[0146] The expression regulation region indicates the promoter or the terminator, in which these sequences are generally involved in regulation of the expression amount (transcription amount, translation amount) of the gene adjacent thereto. In a host having the above-described gene on a genome, productivity of long-chain fatty alcohols can be improved by modifying expression regulation regions of the genes and enhancing the expression of the genes.

[0147] Specific examples of the method of modifying the expression regulation regions include interchange of promoters. In the host having the various genes on the genome, the expression of the various genes can be enhanced by interchanging the promoter of the gene with a promoter having higher transcriptional activity.

[0148] The above-described modification of a promoter can employ according to an ordinarily method such as homologous recombination. Specifically, a linear DNA fragment containing upstream and downstream regions of a target promoter and containing other promoter instead of the target promoter is constructed, and the resultant DNA fragment is incorporated into a host cell to cause double crossover homologous recombination on the side upstream and downstream of the target promoter of the host genome. As a result, the target promoter on the genome is substituted with other promoter fragment, and the promoter can be modified. The method of modifying a target promoter according to such homologous recombination can be conducted with, for example, referring to literature such as Besher et al., Methods in molecular biology, 1995, vol. 47, p. 291-302.

[0149] In the transformant of the present invention, productivity of long-chain fatty alcohols is improved in comparison with the host in which the expression of the KAS gene and the FAR gene are not enhanced. In addition, even in a case where a host microorganism originally has no ability to produce a long-chain fatty alcohol having 20 or more carbon atoms, the host microorganism acquires the ability to produce the long-chain fatty alcohol by enhancing expression of both the KAS gene and the FAR gene.

[0150] Accordingly, if the transformant of the present invention is cultured under suitable conditions and then the long-chain fatty alcohols are collected from an obtained cultured product, the long-chain fatty alcohols can be efficiently produced. Herein, the term cultured product means liquid medium and a transformant subjected to cultivation.

[0151] The culture condition of the transformant of the present invention can be appropriately selected in accordance with the type of the host, and any ordinary used culture condition for the host can be employed. In addition, from a view point of synthetic efficiency of long-chain fatty alcohols, for example, precursor substances involved in long-chain fatty alcohol biosynthesis system may be added to the medium.

[0152] For example, in the case of using Escherichia coli as a host microorganism, culturing of Escherichia coli may be carried out in LB medium or Overnight Express Instant TB Medium (Novagen) at 30 to 37 C. for half a day to 3 days.

[0153] In a case where cyanobacteria are used as a host microorganism, culturing thereof may be carried out, according to liquid culture or a modified method thereof, by using a medium to be ordinarily used for culturing of cyanobacteria, such as a BG-11 medium (J. Gen. Microbiol., 1979, vol. 111, p. 1-61), an A medium (Proc. Natl. Acad. Sci. U.S.A., 1980, vol. 77, p. 6052-6056) and an AA medium (Plant Physiol., 1955, vol. 30, p. 366-372). The culture period may be a period during which bacterial cells are sufficiently grown to accumulate fatty acids in high concentrations, for example, from 7 to 45 days, preferably from 7 to 30 days, and more preferably from 10 to 14 days, by an aeration/spinner culture or shaking culture.

[0154] A method of collecting the long-chain fatty alcohols from the cultured product is appropriately selected from an ordinary method. For example, the long-chain fatty alcohols can be isolated and collected from the above-described cultured product or growth product by means of filtration, centrifugation, cell disruption, gel filtration chromatography, ion exchange chromatography, chloroform/methanol extraction, hexane extraction, ethanol extraction, or the like. In the case of carrying out the larger scale culturing, the long-chain fatty alcohols can be obtained by collecting oil components from the cultured product or growth product through pressing or extraction, and then performing general purification processes such as degumming, deacidification, decoloration, dewaxing, and deodorization.

[0155] From viewpoints of simplification and ease of a collection step of the fatty alcohols produced by the transformant, it is preferable to secrete the fatty alcohols produced by the transformant extracellularly to be allowed to exist in the medium. Alternatively, it is preferable to separate, according to an ordinary method, the microorganisms from at least a part of the medium containing the fatty alcohols after culturing.

[0156] The amount of the long-chain fatty alcohols in the amount of the total fatty alcohols produced by the transformant of the present invention is preferably 1% or more, more preferably 2% or more, more preferably 5% or more, and more preferably 10% or more, with respect to the weight of the total fatty alcohols. The upper limit thereof is not particularly limited, but it is preferably 99% or less, and more preferably 95% or less.

[0157] The long-chain fatty alcohol obtained by the production method of the present invention can be utilized, as an emulsifier or a surfactant, for cosmetic products, shampoo, conditioner, lubricating oil or the like.

[0158] With regard to the embodiments described above, the present invention also discloses methods of producing fatty alcohols, method of providing ability to produce long-chain fatty alcohols, proteins, genes, transformants, methods of producing a transformant, described below.

<1> A method of producing a long-chain fatty alcohol, which contains culturing a microorganism wherein expression of a KAS and a FAS, or a KAS gene and a FAR gene are enhanced.
<2> A method of providing ability to produce a long-chain fatty alcohol for a microorganism (preferably, a microorganism which originally has no ability to produce a long-chain fatty alcohol), which contains enhancing expression of a KAS and a FAR, or a KAS gene and a FAR gene in a cell of the microorganism.
<3> The method described in the above item <1> or <2>, wherein the expression of the KAS gene and the FAR gene in a cell of the microorganism are enhanced to enhance the expression of the KAS and the FAR.
<4> The method described in any one of the above items <1> to <3>, wherein the KAS gene and the FAR gene are introduced into the microorganism, to enhance the expression of the KAS and the FAR introduced therein.
<5> A method of producing a long-chain fatty alcohol including a fatty alcohol having 20 or more carbon atoms, containing the steps of:

[0159] culturing a microorganism into which at least one kind of KAS gene selected from the group consisting of the proteins (A) to (F) and at least one kind of FAR gene selected from the group consisting of the proteins (G) to (R) are introduced; and

[0160] separating solution containing fatty alcohols including long-chain fatty alcohols form media.

<6> The method described in any one of the above items <1> to <5>, wherein the KAS is a KAS II mainly involved in synthesizing a long-chain acyl-ACP having 16 or 18 carbon atoms.
<7> The method described in any one of the above items <1> to <6>, wherein the KAS is at least one kind of protein selected from the group consisting of the following proteins (A) to (F), preferably at least one kind of protein selected from the group consisting of the following protein (E) and (F):
(A) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 1;
(B) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (A), and having KAS activity;
(C) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 96;
(D) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (C), and having KAS activity;
(E) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 98; and
(F) a protein consisting of an amino acid sequence having 60% or more, preferably 65% or more, more preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (E), and having KAS activity.
<8> The method described in the above item <7>, wherein the protein (B) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 190 or less, more preferably 1 or more and 166 or less, further preferably 1 or more and 142 or less, furthermore preferably 1 or more and 118 or less, furthermore preferably 1 or more and 95 or less, furthermore preferably 1 or more and 71 or less, furthermore preferably 1 or more and 47 or less, furthermore preferably 1 or more and 38 or less, furthermore preferably 1 or more and 23 or less, furthermore preferably 1 or more and 9 or less, and furthermore preferably 1 or more and 4 or less amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (A).
<9> The method described in the above item <7>, wherein the protein (D) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 174 or less, more preferably 1 or more and 152 or less, further preferably 1 or more and 130 or less, furthermore preferably 1 or more and 108 or less, furthermore preferably 1 or more and 87 or less, furthermore preferably 1 or more and 65 or less, furthermore preferably 1 or more and 43 or less, furthermore preferably 1 or more and 34 or less, furthermore preferably 1 or more and 21 or less, furthermore preferably 1 or more and 8 or less, and furthermore preferably 1 or more and 4 or less amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (C).
<10> The method described in the above item <7>, wherein the protein (F) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 183 or less, more preferably 1 or more and 160 or less, further preferably 1 or more and 137 or less, furthermore preferably 1 or more and 114 or less, furthermore preferably 1 or more and 92 or less, furthermore preferably 1 or more and 69 or less, furthermore preferably 1 or more and 46 or less, furthermore preferably 1 or more and 37 or less, furthermore preferably 1 or more and 23 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (E).
<11> The method described in any one of the above items <7> to <10>, wherein the proteins (A) to (F) are a KAS having long-chain -ketoacyl-ACP synthase activity (activity of catalyzing an elongation reaction of a long-chain acyl-ACP having 18 or more carbon atoms by mainly using an acyl-ACP having 16 or more carbon atoms).
<12> The method described in any one of the above items <1> to <11>, wherein the gene encoding the KAS, preferably encoding any one of the proteins (A) to (F) is a gene consisting of at least one kind of DNA selected from the group consisting of the following DNAs (a) to (f), preferably a gene consisting of at least one kind of DNA selected from the group consisting of the following DNAs (e) and (f):
(a) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 2;
(b) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more identity with the nucleotide sequence of the DNA (a), and encoding a protein having KAS activity;
(c) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 97;
(d) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more identity with the nucleotide sequence of the DNA (c), and encoding a protein having KAS activity;
(e) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 99; and
(f) a DNA consisting of a nucleotide sequence having 60% or more, preferably 65% or more, more preferably 70% or more, further preferably 75% or more, furthermore preferably 80% or more, furthermore preferably 85% or more, furthermore preferably 90% or more, furthermore preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more identity with the nucleotide sequence of the DNA (e), and encoding a protein having KAS activity.
<13> The method described in the above item <12>, wherein the DNA (b) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 571 or less, more preferably 1 or more and 499 or less, further preferably 1 or more and 428 or less, furthermore preferably 1 or more and 357 or less, furthermore preferably 1 or more and 285 or less, furthermore preferably 1 or more and 214 or less, furthermore preferably 1 or more and 142 or less, furthermore preferably 1 or more and 114 or less, furthermore preferably 1 or more and 71 or less, furthermore preferably 1 or more and 28 or less, and furthermore preferably 1 or more and 14 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (a), and encoding the protein (A) or (B) having KAS activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (a) under a stringent condition, and encoding the protein (A) or (B) having KAS activity.
<14> The method described in the above item <12>, wherein the DNA (d) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 523 or less, more preferably 1 or more and 457 or less, further preferably 1 or more and 392 or less, furthermore preferably 1 or more and 327 or less, furthermore preferably 1 or more and 261 or less, furthermore preferably 1 or more and 196 or less, furthermore preferably 1 or more and 130 or less, furthermore preferably 1 or more and 104 or less, furthermore preferably 1 or more and 65 or less, furthermore preferably 1 or more and 26 or less, and furthermore preferably 1 or more and 13 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (c), and encoding the protein (C) or (D) having KAS activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (c) under a stringent condition, and encoding the protein (C) or (D) having KAS activity.
<15> The method described in the above item <12>, wherein the DNA (f) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 549 or less, more preferably 1 or more and 480 or less, further preferably 1 or more and 412 or less, furthermore preferably 1 or more and 343 or less, furthermore preferably 1 or more and 275 or less, furthermore preferably 1 or more and 206 or less, furthermore preferably 1 or more and 138 or less, furthermore preferably 1 or more and 110 or less, furthermore preferably 1 or more and 69 or less, furthermore preferably 1 or more and 28 or less, and furthermore preferably 1 or more and 14 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (e), and encoding the protein (E) or (F) having KAS activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (e) under a stringent condition, and encoding the protein (E) or (F) having KAS activity.
<16> The method described in any one of the above items <1> to <15>, wherein the FAR is at least one kind of protein selected from the group consisting of the following proteins (G) to (R):
(G) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 3;
(H) a protein consisting of an amino acid sequence having 80% or more, preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (G), and having FAR activity;
(I) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 5;
(J) a protein consisting of an amino acid sequence having 80% or more, preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (I), and having FAR activity;
(K) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 7;
(L) a protein consisting of an amino acid sequence having 80% or more, preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (K), and having FAR activity;
(M) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 9;
(N) a protein consisting of an amino acid sequence having 80% or more, preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (M), and having FAR activity;
(O) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 100;
(P) a protein consisting of an amino acid sequence having 80% or more, preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (O), and having FAR activity;
(Q) a protein consisting of the amino acid sequence set forth in SEQ ID NO: 101; and
(R) a protein consisting of an amino acid sequence having 80% or more, preferably 85% or more, more preferably 90% or more, more preferably 92% or more, more preferably 95% or more, more preferably 98% or more, and further preferably 99% or more identity with the amino acid sequence of the protein (Q), and having FAR activity.
<17> The method described in the above item <16>, wherein the protein (H) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 99 or less, more preferably 1 or more and 74 or less, further preferably 1 or more and 50 or less, furthermore preferably 1 or more and 40 or less, furthermore preferably 1 or more and 25 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (G).
<18> The method described in the above item <16>, wherein the protein (J) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 99 or less, more preferably 1 or more and 74 or less, further preferably 1 or more and 50 or less, furthermore preferably 1 or more and 40 or less, furthermore preferably 1 or more and 25 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (I).
<19> The method described in the above item <16>, wherein the protein (L) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 99 or less, more preferably 1 or more and 74 or less, further preferably 1 or more and 50 or less, furthermore preferably 1 or more and 40 or less, furthermore preferably 1 or more and 25 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (K).
<20> The method described in the above item <16>, wherein the protein (N) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 100 or less, more preferably 1 or more and 75 or less, further preferably 1 or more and 50 or less, furthermore preferably 1 or more and 40 or less, furthermore preferably 1 or more and 25 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (M).
<21> The method described in the above item <16>, wherein the protein (P) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 99 or less, more preferably 1 or more and 74 or less, further preferably 1 or more and 50 or less, furthermore preferably 1 or more and 40 or less, furthermore preferably 1 or more and 25 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (O).
<22> The method described in the above item <16>, wherein the protein (R) consists of an amino acid sequence in which 1 or several, preferably 1 or more and 100 or less, more preferably 1 or more and 75 or less, further preferably 1 or more and 50 or less, furthermore preferably 1 or more and 40 or less, furthermore preferably 1 or more and 25 or less, furthermore preferably 1 or more and 10 or less, and furthermore preferably 1 or more and 5 or less amino acids are deleted, substituted, inserted or added to the amino acid sequence of the protein (Q).
<23> The method described in any one of the above items <1> to <22>, wherein the gene encoding the FAR, preferably encoding any one of the proteins (G) to (R) is a gene consisting of at least one kind of DNA selected from the group consisting of the following DNAs (g) to (r):
(g) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 4;
(h) a DNA consisting of a nucleotide sequence having 80% or more, preferably 85% or more, more preferably 90% or more, further preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more identity with the nucleotide sequence of the DNA (g), and encoding a protein having FAR activity;
(i) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 6;
(j) a DNA consisting of a nucleotide sequence having 80% or more, preferably 85% or more, more preferably 90% or more, further preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more identity with the nucleotide sequence of the DNA (i), and encoding a protein having FAR activity;
(k) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 8;
(l) a DNA consisting of a nucleotide sequence having 80% or more, preferably 85% or more, more preferably 90% or more, further preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more identity with the nucleotide sequence of the DNA (k), and encoding a protein having FAR activity;
(m) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 10;
(n) a DNA consisting of a nucleotide sequence having 80% or more, preferably 85% or more, more preferably 90% or more, further preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more identity with the nucleotide sequence of the DNA (m), and encoding a protein having FAR activity;
(o) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 35;
(p) a DNA consisting of a nucleotide sequence having 80% or more, preferably 85% or more, more preferably 90% or more, further preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more identity with the nucleotide sequence of the DNA (o), and encoding a protein having FAR activity;
(q) a DNA consisting of the nucleotide sequence set forth in SEQ ID NO: 36; and
(r) a DNA consisting of a nucleotide sequence having 80% or more, preferably 85% or more, more preferably 90% or more, further preferably 92% or more, furthermore preferably 95% or more, furthermore preferably 98% or more, and furthermore preferably 99% or more identity with the nucleotide sequence of the DNA (q), and encoding a protein having FAR activity;
<24> The method described in the above item <23>, wherein the DNA (h) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 296 or less, more preferably 1 or more and 222 or less, further preferably 1 or more and 148 or less, furthermore preferably 1 or more and 119 or less, furthermore preferably 1 or more and 74 or less, furthermore preferably 1 or more and 30 or less, and furthermore preferably 1 or more and 15 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (g), and encoding a protein having FAR activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (g) under a stringent condition, and encoding a protein having FAR activity.
<25> The method described in the above item <23>, wherein the DNA (j) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 297 or less, more preferably 1 or more and 223 or less, further preferably 1 or more and 149 or less, furthermore preferably 1 or more and 119 or less, furthermore preferably 1 or more and 75 or less, furthermore preferably 1 or more and 30 or less, and furthermore preferably 1 or more and 15 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (i), and encoding a protein having FAR activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (i) under a stringent condition, and encoding a protein having FAR activity.
<26> The method described in the above item <23>, wherein the DNA (I) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 297 or less, more preferably 1 or more and 223 or less, further preferably 1 or more and 149 or less, furthermore preferably 1 or more and 119 or less, furthermore preferably 1 or more and 75 or less, furthermore preferably 1 or more and 30 or less, and furthermore preferably 1 or more and 15 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (k), and encoding a protein having FAR activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (k) under a stringent condition, and encoding a protein having FAR activity.
<27> The method described in the above item <23>, wherein the DNA (n) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 299 or less, more preferably 1 or more and 224 or less, further preferably 1 or more and 150 or less, furthermore preferably 1 or more and 120 or less, furthermore preferably 1 or more and 75 or less, furthermore preferably 1 or more and 30 or less, and furthermore preferably 1 or more and 15 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (m), and encoding a protein having FAR activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (m) under a stringent condition, and encoding a protein having FAR activity.
<28> The method described in the above item <23>, wherein the DNA (p) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 297 or less, more preferably 1 or more and 223 or less, further preferably 1 or more and 149 or less, furthermore preferably 1 or more and 119 or less, furthermore preferably 1 or more and 75 or less, furthermore preferably 1 or more and 30 or less, and furthermore preferably 1 or more and 15 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (o), and encoding a protein having FAR activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (o) under a stringent condition, and encoding a protein having FAR activity.
<29> The method described in the above item <23>, wherein the DNA (r) is a DNA consisting of a nucleotide sequence in which 1 or several, preferably 1 or more and 299 or less, more preferably 1 or more and 225 or less, further preferably 1 or more and 150 or less, furthermore preferably 1 or more and 120 or less, furthermore preferably 1 or more and 75 or less, furthermore preferably 1 or more and 30 or less, and furthermore preferably 1 or more and 15 or less nucleotides, are deleted, substituted, inserted or added to the nucleotide sequence of the DNA (q), and encoding a protein having FAR activity, or a DNA capable of hybridizing with a DNA consisting of the nucleotide sequence complementary with the DNA (q) under a stringent condition, and encoding a protein having FAR activity.
<30> The method of producing a long-chain fatty alcohol described in any one of the above items <1> to <29>, wherein a host of the microorganism is a microorganism which has no ability to produce a long-chain fatty alcohol having 20 or more carbon atoms.
<31> The method described in any one of the above items <1> or <30>, wherein the microorganism is prokaryote, and preferably Escherichia coli or cyanobacteria.
<32> The method described in the above item <31>, wherein the cyanobacteria are cyanobacteria selected from the group consisting of the genus Synechocystis, the genus Synechococcus, the genus Thermosynechococcus, the genus Trichodesmium, the genus Acaryochloris, the genus Crocosphaera, and the genus Anabaena, preferably cyanobacteria of the genus Synechocystis or the genus Synechococcus.
<33> The method described in the above item <31> or <32>, wherein the KAS gene and the FAR gene are incorporated into the genome of cyanobacteria to enhance expression of the genes.
<34> The method described in any one of the above items <1> or <33>, wherein the long-chain fatty alcohol is a long-chain fatty alcohol having 20 or more carbon atoms, preferably a long-chain fatty alcohol having 20 to 26 carbon atoms, more preferably a saturated long-chain fatty alcohol or a mono-unsaturated long-chain fatty alcohol having 20 to 26 carbon atoms, more preferably a saturated long-chain fatty alcohol or mono-unsaturated long-chain fatty alcohol having 20 or 22 carbon atoms.
<35> The method described in any one of the above items <1> or <34>, wherein the amount of the long-chain fatty alcohols in the amount of the total fatty alcohols produced by the microorganism is 1% or more, preferably 2% or more, more preferably 5% or more, and more preferably 10% or more, and 99% or less, and preferably 95% or less, with respect to the weight of the total fatty alcohols.
<36> The method of producing a long-chain fatty alcohol described in any one of the above items <1> to <35>, wherein the long-chain fatty alcohol after culturing exists in an extracellular medium.
<37> The method of producing a long-chain fatty alcohol described in the above item <36>, which contains the step of separating the microorganism from at least a part of the medium containing the fatty alcohols after culturing.
<38> The method of producing a long-chain fatty alcohol described in any one of the above items <1> to <37>, wherein the amount of the long-chain fatty alcohols having 20 or more carbon atoms in the amount of the total fatty alcohols produced by the microorganism is 1% or more with respect to the weight of the total fatty alcohols.
<39> A transformant of a microorganism, wherein expression of the KAS and the FAR, or the KAS gene and the FAR gene are enhanced.
<40> The transformant described in the above item <39>, wherein expression of the KAS gene and the FAR gene are enhanced in a cell of the microorganism, and expression of the KAS and the FAR are enhanced.
<41> A transformant of a microorganism, containing a KAS gene or a recombinant vector containing the same and a FAR gene, or a KAS gene or a recombinant vector containing the same.
<42> A method of preparing a transformant, which contains introducing the KAS gene and the FAR gene, or a recombinant vector containing the KAS gene and a recombinant vector containing the FAR gene into a host microorganism.
<43> The transformant or the method or preparing the same described in any one of the above items <39> to <42>, wherein the KAS is at least one kind of protein selected form the group consisting of the proteins (A) to (F) specified in the above items <7> to <11>, preferably at least one kind of protein selected from the group consisting of the proteins (E) and (F).
<44> The transformant or the method or preparing the same described in any one of the above items <39> to <43>, wherein the KAS gene, preferably a gene encoding at least one kind of protein selected from the group consisting of the proteins (A) to (F) is a gene consisting of at least one kind of DNA selected form the group consisting of the DNAs (a) to (f) specified in the above items <12> to <15>, preferably a gene consisting of at least one kind of DNA selected from the group consisting of the DNAs (e) and (f).
<45> The transformant or the method or preparing the same described in any one of the above items <39> to <44>, wherein the FAR is at least one kind of protein selected form the group consisting of the proteins (G) to (R) specified in the above items <16> to <22>.
<46> The transformant or the method or preparing the same described in any one of the above items <39> to <45>, wherein the FAR gene, preferably a gene encoding at least one kind of protein selected from the group consisting of the proteins (G) to (R) is a gene consisting of at least one kind of DNA selected form the group consisting of the DNAs (g) to (r) specified in the above items <23> to <29>.
<47> The transformant or the method or preparing the same described in any one of the above items <39> to <46>, wherein a host of the microorganism is a microorganism which has no ability to produce a long-chain fatty alcohol having 20 or more carbon atoms.
<48> The transformant or the method or preparing the same described in any one of the above items <39> to <47>, wherein the microorganism is prokaryote, and preferably Escherichia coli or cyanobacteria.
<49> The transformant or the method of producing the same described in the above item <48>, wherein the cyanobacteria are cyanobacteria selected from the group consisting of the genus Synechocystis, the genus Synechococcus, the genus Thermosynechococcus, the genus Trichodesmium, the genus Acaryochloris, the genus Crocosphaera, and the genus Anabaena, preferably cyanobacteria of the genus Synechocystis or the genus Synechococcus.
<50> Use of the transformant or a transformant obtained by the method of producing a transformant described in any one of the above items <39> to <49>, for producing a long-chain fatty alcohol.
<51> The use described in the above item <50>, wherein the long-chain fatty alcohol is a long-chain fatty alcohol having 20 or more carbon atoms, preferably a long-chain fatty alcohol having 20 to 26 carbon atoms, more preferably a saturated long-chain fatty alcohol or a mono-unsaturated long-chain fatty alcohol having 20 to 26 carbon atoms, and further preferably a saturated long-chain fatty alcohol or mono-unsaturated long-chain fatty alcohol having 20 or 22 carbon atoms.
<52> The proteins (G) to (R) specified in any one of the above items <16> to <22>.
<53> A gene encoding the protein described in the above item <52>.
<54> A gene consisting of at least one kind of DNA selected from the group consisting of the DNA (g) to (r) specified in any one of the above items <23> to <29>.
<55> A recombinant vector containing the gene described in the above item <53> or <54>.

EXAMPLES

[0161] Hereinafter, the present invention will be described more in detail with reference to Examples, but the present invention is not limited thereto. Herein, the nucleotide sequences of the primers used in Examples are shown in Tables 3 to 5.

TABLE-US-00003 TABLE3 SEQ ID NO: Primer Nucleotidesequence(5.fwdarw.3) 11 pBS-SK- GCGTTAATATTTTGTTAAAATTCGC fw 12 pBS-SK- CTCTAGAGCGGCCGCCACCGCGG rv 13 pBS/ GCGGCCGCTCTAGAGGAGAAGCTGACCCTCGCAGT NoKASII GG (-ATG)- fw 14 pBS/ ACAAAATATTAACGCCTAGGCAACATACTTCTTGA NoKASII- AGACC rv 15 pBS/ GCGGCCGCTCTAGAGCCCTCGTCCTTCTTCCTCCG NoKASII GC (-20)-fw 16 pBS/ GCGGCCGCTCTAGAGACTGTGCGTCGTGCATCAGG NoKASII (-40)-fw 17 pBS/ GCGGCCGCTCTAGAGAGGGTGGTGATCACGGGTGT NoKASII C (-60)-fw 18 RBS/pBS- ATGTATATCTCCTTCTTACTCTAGAGCGGCCGCCA SK-rv CC 19 RBS/ GAAGGAGATATACATATGGAATCCAATTGTGTTCA AtFAR1- ATTTC fw 20 pBS-SK/ ACAAAATATTAACGCTTATTGTTTAAGCACATGGG AtFAR1- TGATG rv 21 RBS/ GAAGGAGATATACATATGGGACTTGGCATAATCAG AtFAR2 TTTCC (-120)- fw 22 pBS-SK/ ACAAAATATTAACGCTTAAGCTCTTCCTTTCAAGA AtFAR2- CATG rv 23 RBS/ GAAGGAGATATACATATGTCGACAGAAATGGAGGT AtFAR3- CG fw 24 pBS-SK/ ACAAAATATTAACGCTTAGAAGACATACTTAAGCA AtFAR3- GCCC rv 25 RBS/ GAAGGAGATATACATATGGACTCCAATTGCATTCA AtFAR4- GTTC fw 26 pBS-SK/ ACAAAATATTAACGCTTATTTTTTGAGTACATAGG AtFAR4- TGATGAGG rv 27 RBS/ GAAGGAGATATACATATGGAACTCAATTGTGTTCA AtFAR5- ATTTCT fw 28 pBS-SK/ ACAAAATATTAACGCTCACTTCTTAAGCACGTGTG AtFAR5- TGAC rv 30 RBS/ ATGTATATCTCCTTCCTAGGCAACATACTTCTTGA NoKASII- AGACC rv 31 RBS/ GAAGGAGATATACATATGGAATCCAACTGTGTTCA BrFAR1- GTTTC fw 32 pBS-SK/ ACAAAATATTAACGCTTACTGTTTAAGAACATAGG BrFAR1- TGATGAGG rv 33 RBS/ GAAGGAGATATACATATGGAATTCAACTGTGTTCA BrFAR5- ATTTCTC fw 34 pBS-SK/ ACAAAATATTAACGCTTATTTCTTAAGTACGTGTG BrFAR5- TGATGAGG rv

TABLE-US-00004 TABLE4 SEQ ID NO: Primer Nucleotidesequence(5.fwdarw.3) 43 Kmr-F GATAAACCCAGCGAACCA 44 Kmr-R ATCGATACAAATTCCTCG 50 Trbc-F GTTACAGTTTTGGCAATTAC 54 Trbc/ TGCCAAAACTGTAACCTAGGCAACATACTTCT NoKASII-R TGAAGACC 61 Sp-F ATCGATTTTCGTTCGTGAATACATG 62 Sp-R CATATGCAAGGGTTTATTGTTTTC 66 Sp/Trbc-R CGAACGAAAATCGATTTCCCCACTTAGATAAA AAATCCGG 68 Trbc- TGCCAAAACTGTAACTTATTGTTTAAGCACAT AtFAR1-rv GGGTGATG 70 Trbc- TGCCAAAACTGTAACTTATTTTTTGAGTACAT AtFAR4-rv AGGTGATGAGG 71 pUC118/ GGATCCTCTAGAGTCAATGCCTTCTCCAAGGG NS1up-F CGGC 72 Kmr/ TTCGCTGGGTTTATCCTTCTGGAGCAGGAAGA NS1up-R TGTCG 74 Kmr/ GGAATTTGTATCGATTCGAGTCCCTGCTCGTC NS1down-F ACGC 75 pUC118/ GCATGCCTGCAGGTCCGGCATGGCAATGTCTC NS1down-R TCTG 77 NS1down-F TCGAGTCCCTGCTCGTCACGC 78 Kmr/ GGAATTTGTATCGATTTGACAATTAATCATCC Ptrc-F GGCTCG 79 Ptrc-R GGTCTGTTTCCTGTGTGAAATTG 81 NS1down/ CGAGCAGGGACTCGATTCCCCACTTAGATAAA Trbc-R AAATCC 82 Ptrc/ CACAGGAAACAGACCATGACTGTGCGTCGTGC NoKASII ATCAG (-40)-F 83 pUC118/ GGATCCTCTAGAGTCTTGCCGCCAATGTCGAT orf1593up-F GTAGG 84 Sp/ CGAACGAAAATCGATCGCTTTGAAAGTCCAGT orf1593up-R TCAAGG 86 Sp/ AAACCCTTGCATATGATCACGATCGAGAAGAT orf1594down- GGAAGC F 87 pUC118/ GCATGCCTGCAGGTCGCCAGCCATCAGGCAGT orf1594down- CAAGC R 89 orf1594up-R CGCTTTGAAAGTCCAGTTCAAGG 90 orf1593up/ TGGACTTTCAAAGCGTTGACAATTAATCATCC Ptrc-F GGCTCG 91 orf1593up/ TGGACTTTCAAAGCGCTCCGTCTACTCTTCTG PrrnA-F TCCATCC 92 PrrnA-R AAGGGAAAACCTCCTTGGCTTAATTAATCTAC CTAACT 94 Ptrc99A2- CACAGGAAACAGACCATGGAATCCAATTGTGT AtFAR1-F TCAATTTC 95 PrrnA2- AGGAGGTTTTCCCTTATGGACTCCAATTGCAT AtFAR4-F TCAGTTC

TABLE-US-00005 TABLE5 SEQ ID NO: Primer Nucleotidesequence(5.fwdarw.3) 37 pUC118/ GGATCCTCTAGAGTCATCGCCTGTTGGCCTAC slr0168up-F C 38 Kmr/ TTCGCTGGGTTTATCTACCGTTCAAATTCTGT slr0168up-R GGG 40 Kmr/ GGAATTTGTATCGATAGCGGAAGATATTACGG slr0168down- GAC F 41 pUC118/ GCATGCCTGCAGGTCAATCACGTTGGGTCCCA slr0168down- AG R 46 slr0168up-R TACCGTTCAAATTCTGTGGG 47 slr0168up/ AGAATTTGAACGGTAACCTGTAGAGAAGAGTC Pcpc560-F CCTG 48 Pcpc560-R TGAATTAATCTCCTACTTGAC 51 Km/Trbc-R TTCGCTGGGTTTATCTTCCCCACTTAGATAAA AAATCC 53 Pcpc560/ TAGGAGATTAATTCAATGACTGTGCGTCGTGC NoKASII ATCAG (-40)-F 55 pUC118/ GGATCCTCTAGAGTCATTCCTCGCCCATTTTC sII0208up-F AGG 56 Sp/ CGAACGAAAATCGATCGCTTTGAAAGTCCAGT sII0208up-R TCAAGG 58 Sp/ AAACCCTTGCATATGATCACGATCGAGAAGAT sII0209down- GGAAGC F 59 pUC118/ GCATGCCTGCAGGTCATCAGTTGTGCCCGCTG sII0209down- TGC R 64 sII0208up-R GTCAAATTCGGTGCGGACAG 65 sII0208up/ CGCACCGAATTTGACGCTTTCAGCGGGCAACC Pcpc560-F AACGAG 67 Pcpc560- TAGGAGATTAATTCAATGGAATCCAATTGTGT AtFAR1-fw TCAATTTC 69 Pcpc560- TAGGAGATTAATTCAATGGACTCCAATTGCAT AtFAR4-fw TCAGTTC

Preparation Example 1 Preparation of a Transformant which is Obtained by Introducing a NoKASII Gene and an AtFAR Gene into Escherichia coli

(1) Construction of Plasmid for NoKASII Gene Expression Wherein Oligonucleotides at N-Terminal Side Thereof was Modified

[0162] The pBS-SK() plasmid (manufactured by Agilent Technologies) was used as a template, and PCR was carried out by using the primer pBS-SK-fw and the primer pBS-SK-ry described in Table 3 to amplify a linearized pBS-SK() plasmid.

[0163] Further, a cDNA library prepared from Nannochloropsis oculata strain NIES-2145 was used as a template, and PCRs were carried out by using the primer pBS/NoKASII(ATG)-fw and the primer pBS/NoKASII-rv, the primer pBS/NoKASII(20)-fw and the primer pBS/NoKASII-rv, the primer pBS/NoKASII(40)-fw and the primer pBS/NoKASII-rv, and the primer pBS/NoKASII(60)-fw and the primer pBS/NoKASII-ry described in Table 3 respectively, to amplify a NoKASIR-ATG) fragment, a NoKASII(20) fragment, a NoKASII(40) fragment and a NoKASII(60) fragment.

[0164] The NoKASII(ATG) fragment consists of the nucleotide sequence of the 7.sup.th to 1428.sup.th nucleotides of the nucleotide sequence set forth in SEQ ID NO: 2. The NoKASII(20) fragment consists of the nucleotide sequence of the 61.sup.st to 1428.sup.th nucleotides of the nucleotide sequence set forth in SEQ ID NO: 2. The NoKASII(40) fragment consists of the nucleotide sequence of the 121.sup.st to 1428.sup.th nucleotides of the nucleotide sequence set forth in SEQ ID NO: 2. The NoKASII(60) fragment consists of the nucleotide sequence of the 181.sup.st to 1428.sup.th nucleotides of the nucleotide sequence set forth in SEQ ID NO: 2.

[0165] The linearized pBS-SK() plasmid and the NoKASII(ATG) fragment, the NoKASII(20) fragment, the NoKASII(40) fragment or the NoKASII(60) fragment were linked by using the In-Fusion (registered trademark) PCR cloning system (Clontech), to prepare a pBS-SK()-NoKASII plasmid, a pBS-SK()-NoKASII(20) plasmid, a pBS-SK()-NoKASII(40) plasmid and a pBS-SK()-NoKASII(60) plasmid.

[0166] The plasmid was designed so that the 29 amino acid residues of the lacZ derived from pBS-SK() was fused on the N-terminal side of amino acid sequence of the NoKASII.

(2) Construction of Plasmid for AtFAR Gene Expression

[0167] The pBS-SK() plasmid (manufactured by Agilent Technologies) was used as a template, and PCR was carried out by using the primer RBS/pBS-SK-ry and the primer pBS-SK-fw described in Table 3 to amplify a linearized pBS-SK() plasmid.

[0168] Further, a cDNA library prepared from Arabidopsis thaliana was used as a template, and PCR was carried out by using the primer RBS/AtFAR1-fw and the primer pBS-SK/AtFAR1-ry described in Table 3, to amplify an AtFAR1 gene fragment (Gene ID: AT5G22500.1, SEQ ID NO: 4).

[0169] Similar to the method described above, PCRs were carried out by using the primer RBS/AtFAR2(120)-fw and the primer pBS-SK/AtFAR2-rv, the primer RBS/AtFAR3-fw and the primer pBS-SK/AtFAR3-rv, the primer RBS/AtFAR4-fw and the primer pBS-SK/AtFAR4-rv, and the primer RBS/AtFAR5-fw and the primer pBS-SK/AtFAR5-ry described in Table 3 respectively, to amplify an AtFAR2(120) gene fragment (Gene ID: AT3G11980.1; SEQ ID NO: 29), an AtFAR3 gene fragment (Gene ID: AT4G33790.1; SEQ ID NO: 6), an AtFAR4 gene fragment (Gene ID: AT3G44540.1; SEQ ID NO: 8), and an AtFAR5 gene fragment (Gene ID: AT3G44550.1; SEQ ID NO: 10).

[0170] The linearized pBS-SK() plasmid and the AtFAR1 gene fragment, the AtFAR2(120) gene fragment, the AtFAR3 gene fragment, the AtFAR4 gene fragment or the AtFAR5 gene fragment were linked by using the In-Fusion (registered trademark) PCR cloning system (Clontech), to prepare a pBS-SK()-AtFAR1 plasmid, a pBS-SK()-AtFAR2(120) plasmid, a pBS-SK()-AtFAR3 plasmid, a pBS-SK()-AtFAR4 plasmid and a pBS-SK()-AtFAR5 plasmid.

(3) Construction of Plasmid for NoKASII Gene and AtFAR Gene Expression

[0171] The pBS-SK()-NoKASII plasmid, the pBS-SK()-NoKASII(20) plasmid, or the pBS-SK()-NoKASII(40) plasmid was used as a template, and PCRs were carried out by using the primer pBS-SK-fw and the primer RBS/NoKASII-ry described in Table 3 to amplify a linearized pBS-SK()-NoKASII plasmid, a linearized pBS-SK()-NoKASII(20) plasmid and a linearized pBS-SK()-NoKASII(40) plasmid, respectively.

[0172] The linearized pBS-SK()-NoKASII plasmid and the AtFAR1 gene fragment, the AtFAR2(120) gene fragment, the AtFAR3 gene fragment, the AtFAR4 gene fragment or the AtFAR5 gene fragment were linked by using the In-Fusion (registered trademark) PCR cloning system (Clontech), to prepare a pBS-SK()-NoKASII-RBS-AtFAR1 plasmid, a pBS-SK()-NoKASII-RBS-AtFAR2(120) plasmid, a pBS-SK()-NoKASII-RBS-AtFAR3 plasmid, a pBS-SK()-NoKASII-RBS-AtFAR4 plasmid and a pBS-SK()-NoKASII-RBS-AtFAR5 plasmid.

[0173] Similar to that described above, the linearized pBS-SK()-NoKASII(20) plasmid and the AtFAR1 gene fragment, the AtFAR2(120) gene fragment, the AtFAR3 gene fragment, the AtFAR4 gene fragment or the AtFAR5 gene fragment were linked by using the In-Fusion (registered trademark) PCR cloning system (Clontech), to prepare a pBS-SK()-NoKASII(20)-RBS-AtFAR1 plasmid, a pBS-SK()-NoKASII(20)-RBS-AtFAR2(120) plasmid, a pBS-SK()-NoKASII(20)-RBS-AtFAR3 plasmid, a pBS-SK()-NoKASII(20)-RBS-AtFAR4 plasmid and a pBS-SK()-NoKASII(20)-RBS-AtFAR5 plasmid.

[0174] Similar to that described above, the linearized pBS-SK()-NoKASII(40) plasmid and the AtFAR1 gene fragment, the AtFAR2(120) gene fragment, the AtFAR3 gene fragment, the AtFAR4 gene fragment or the AtFAR5 gene fragment were linked by using the In-Fusion (registered trademark) PCR cloning system (Clontech), to prepare a pBS-SK()-NoKASII(40)-RBS-AtFAR1 plasmid, a pBS-SK()-NoKASII(40)-RBS-AtFAR2(120) plasmid, a pBS-SK()-NoKASII(40)-RBS-AtFAR3 plasmid, a pBS-SK()-NoKASII(40)-RBS-AtFAR4 plasmid and a pBS-SK()-NoKASII(40)-RBS-AtFAR5 plasmid. {0107}

(4) Introduction of a Plasmid for NoKASII Gene Expression Wherein Oligonucleotide at N-Terminal Side Thereof was Modified, a Plasmid for AtFAR Gene Expression, and Plasmid for NoKASII Gene and AtFAR Gene Expression into Escherichia coli

[0175] Escherichia coli strain K27AFadD (obtained from Coligenetic stock center, see http://cgsc.biology.yale.edu/Strain.php?ID=5655) inoculated in 1 mL of LB medium was cultured at 37 C. until OD.sub.600 became about 0.3 to 0.4.

[0176] Bacteria cells were collected by centrifugation, and 100 L of an ice-cooled TSS solution (10% PEG6000, 5% DMSO, 35 mM MgSO.sub.4) and the above-described plasmid solution were mixed, and allowed to stand on ice for 30 minutes. Then, heat shock at 42 C. for 1 minute was applied thereto, and the resulting solution was applied to an ampicillin-containing LB plate, and cultured overnight at 30 C. After culturing, strains into which the plasmid was introduced were selected by applying drug resistance as an indicator.

Preparation Example 2 Preparation of Transformant by Introducing NoKASII Gene and BrFAR Gene into Escherichia coli

(1) Construction of Plasmid for BrFAR Gene Expression

[0177] PCR was carried out to amplify a BrFAR1 gene fragment (NCBI Accession number: XM_009122403; SEQ ID NO: 35) by using a cDNA library prepared form Brassica raga as a template, and the primer RBS/BrFAR1-fw and the primer pBS-SK/BrFAR1-ry described in Table 3.

[0178] In a similar manner as described above, PCR was carried out by using the primer RBS/BrFAR5-fw and the primer pBS-SK/BrFAR5-ry described in Table 3 to amplify a BrFAR5 gene fragment (NCBI Accession number: XM_009152061; SEQ ID NO: 36).

(2) Construction of Plasmid for NoKASII Gene and BrFAR Gene Expression

[0179] The linearized pBS-SK()-NoKASII plasmid, the linearized pBS-SK()-NoKASII(20) plasmid or the linearized pBS-SK()-NoKASII(40) plasmid, which were prepared by a method similar to that described in Preparation Example 1, and the BrFAR1 gene fragment or the BrFAR5 gene fragment were linked by using the In-Fusion (registered trademark) PCR cloning system (Clontech), to prepare a pBS-SK()-NoKASII-RBS-BrFAR1 and pBS-SK()-NoKASII-RBS-BrFAR5 plasmid, a pBS-SK()-NoKASII(20)-RBS-BrFAR1 and pBS-SK()-NoKASII(20)-RBS-BrFAR5 plasmid, and a pBS-SK()-NoKASII(40)-RBS-BrFAR1 and pBS-SK()-NoKASII(40)-RBS-BrFAR5 plasmid.

(3) Introduction of a Plasmid for NoKASII Gene and BrFAR Gene Expression into Escherichia coli

[0180] Escherichia coli strain K27AFadD (obtained from Coligenetic stock center, see http://cgsc.biology.yale.edu/Strain.php?ID=5655) inoculated in 1 mL of LB medium was cultured at 37 C. until OD.sub.600 became about 0.3 to 0.4.

[0181] Bacteria cells were collected by centrifugation, and 100 L of an ice-cooled TSS solution (10% PEG6000, 5% DMSO, 35 mM MgSO.sub.4) and the above-described plasmid solution were mixed, and allowed to stand on ice for 30 minutes. Then, heat shock at 42 C. for 1 minute was applied thereto, and the resulting solution was applied to an ampicillin-containing LB plate, and cultured overnight at 30 C. After culturing, strains into which the plasmid was introduced were selected by applying drug resistance as an indicator.

Test Example 1 Production of Fatty Alcohols

[0182] The colonies of the transformants prepared in Preparation Examples 1 and 2 were inoculated into 2 mL of Overnight Express Instant TB Medium (manufactured by Takara), and cultured at 30 C. for 24 hours by shaking (160 rpm).

[0183] The bacterial cells were collected by separating 1 mL of culture fluid into a glass test tube, and by centrifuging at 3,000 rpm. A precipitate obtained by removing a supernatant was suspended into 0.5 mL of distilled water, and as an internal standard, 25 L of C23:0 alcohol (1-tricosanol) (1 mg/mL) dissolved in chloroform was added thereto, respectively. Then, 0.5 mL of chloroform and 1 mL of methanol were added thereto, and the resultant mixture was stirred and further left to stand for 30 minutes. Then, 0.5 mL of chloroform and 0.5 mL of 1.5% KCl solution were added thereto, and the resultant mixture was stirred. The resultant mixture was centrifuged at 3,000 rpm for 15 minutes, and then an organic layer (lower layer) was collected into a test tube with cap by using a Pasteur pipette, and dried and solidified by a nitrogen gas.

[0184] To a dried and solidified lipid fraction, 0.7 mL of 0.5 N KOH methanol solutions was added, and the resultant mixture was saponified at 80 C. for 30 minutes. Further, 1 mL of boron trifluoride-methanol solution was added thereto, and a methyl esterification reaction was carried out thereon at 80 C. for 10 minutes. To this reaction fluid, 0.2 to 0.5 mL of hexane and 1 mL of saturated saline solution were added and the resultant mixture was centrifuged for 10 minutes at room temperature, and then a hexane layer being an upper layer was collected.

[0185] The collected hexane layer was transferred to a test tube with a screw cap, and dried into solid by nitrogen, and 100 L of a silylating agent TMSI-H containing hexamethyldisilazane and trimethylchlorosilane dissolved in pyridine (manufactured by GL Sciences Inc.) was added thereto. The resulting mixture was allowed to react at 80 C. for 30 minutes, and then 300 L of hexane and 0.5 mL of 1.5% KCl solution were added thereto, and stirred. Further, the resulting mixed liquid was subjected to centrifugation at room temperature for 10 minutes, and a hexane layer being an upper layer was collected and provided for GC analysis.

[0186] First, fatty acid methyl esters and trimethylsilylated fatty alcohols were identified by gas chromatography mass spectrometry analysis. Next, based on a peak area of waveform data obtained by gas chromatography analysis, proportions (%) of amounts of various fatty acids in the total amount of fatty acids produced by each transformant, and proportions (%) of amounts of various fatty alcohols in the total amount of fatty alcohols were calculated.

[0187] Conditions of gas chromatography mass spectrometry analysis and gas chromatographic analysis are shown.

<Gas Chromatography Mass Spectrometry Analysis>

[0188] Analysis apparatus: 7890A GC system (manufactured by Agilent), 5975 Inert XL MSD (manufactured by Agilent)
Capillary column: DB-1 MS (30 m20 m0.25 m; manufactured by J&W Scientific)
Mobile phase: High purity Helium
Flow rate inside the column: 1.0 mL/min
Temperature rise program: 100 C. (for 1 min).fwdarw.12.5 C./min (to 200 C.).fwdarw.5 C./min (to 250 C.).fwdarw.250 C. (for 9 min)
Equilibration time: for 0.5 min
Injection port: split injection (split ratio: 0.1:1)

Pressure: 55.793 psi

[0189] Amount of injection: 5 L
Cleaning vial: methanol/chloroform
Detector temperature: 350 C.
<Gas chromatographic analysis >
Analysis apparatus: 7890A GC system (Agilent)
Capillary column: DB-1 MS (30 m20 m0.25 m; manufactured by J&W Scientific)
Mobile phase: Helium
Flow rate inside the column: 0.25 mL/min
Temperature rise program: 80 C. (for 0 min).fwdarw.15 C./min (to 320 C.)
Equilibration time: for 0.5 min
Injection port: split injection (split ratio: 75:1)

Pressure: 48.475 psi

[0190] Amount of injection: 5 L
Cleaning vial: methanol/chloroform
Detector temperature: 350 C.

[0191] Table 6 shows compositions (%) of various fatty acids produced by each transformant, and Tables 7 to 10 show compositions (%) of various fatty alcohols, respectively. These results are shown in terms of an average value and a standard deviation in a series of three culture experiments.

TABLE-US-00006 TABLE 6 % of total fatty acid C12:0- C14:1- C14:0- C15:0- C16:1- C16:0- C17:1- C17:0- C18:1- COOH COOH COOH COOH COOH COOH COOH COOH COOH FadD 0.54 0.01 0.41 0.01 4.79 0.07 1.25 0.11 1.23 0.11 45.36 0.47 27.69 0.37 n.d. 5.79 0.18 NoKASII(-ATG) n.d. n.d. 1.42 0.05 2.07 0.04 7.98 0.61 44.19 0.21 17.66 0.83 3.93 0.14 16.75 0.44 NoKASII(-20) n.d. n.d. 1.02 0.11 0.97 0.37 13.40 0.83 32.77 0.31 14.24 0.57 2.03 0.54 23.43 0.64 NoKASII(-40) n.d. n.d. 1.47 0.05 1.53 0.16 5.01 0.31 43.54 1.04 19.77 0.64 3.45 0.30 13.92 0.12 NoKASII(-60) n.d. n.d. 1.65 0.04 1.62 0.01 4.55 3.73 47.46 1.53 20.63 1.11 2.19 0.12 16.10 0.70 % of total fatty acid C18:0- C19:1- C20:1- C20:0- C22:1- C22:0- C24:1- C26:1- C28:1- COOH COOH COOH COOH COOH COOH COOH COOH COOH FadD 0.78 0.05 12.16 0.33 n.d. n.d. n.d. n.d. n.d. n.d. n.d. NoKASII(-ATG) 2.62 0.03 3.15 0.23 0.23 0.01 n.d. n.d. n.d. n.d. n.d. n.d. NoKASII(-20) 4.46 0.12 2.22 0.17 1.58 0.07 0.41 0.02 0.73 0.02 0.31 0.02 1.22 0.09 0.71 0.06 0.50 0.04 NoKASII(-40) 4.37 0.11 5.38 0.30 0.58 0.01 0.25 0.00 0.16 0.01 0.10 0.00 0.23 0.01 0.13 0.01 0.09 0.00 NoKASII(-60) 1.58 0.03 4.22 0.35 n.d. n.d. n.d. n.d. n.d. n.d. n.d. n.d.: Not Detected

TABLE-US-00007 TABLE 7 % of total fatty alcohol C14:0-OH C16:1-OH C16:0-OH C18:1-OH C18:0-OH FadD n.d. n.d. n.d. n.d. n.d. AtFAR1 3.00 0.08 n.d. 83.37 0.54 12.27 0.52 1.36 0.05 AtFAR2(-120) 13.83 1.30 2.44 0.16 76.62 1.78 7.11 0.33 n.d. AtFAR3 0.00 0.00 n.d. 93.90 10.57 6.10 10.57 n.d. AtFAR4 4.92 2.00 n.d. 67.81 7.06 24.46 6.58 2.80 2.54 AtFAR5 0.48 0.01 n.d. 68.18 0.36 29.20 0.38 2.14 0.03 BrFAR1 2.20 1.00 n.d. 59.43 4.54 33.30 3.38 5.06 4.95 BrFAR5 2.05 0.22 n.d. 85.26 0.52 12.69 0.73 n.d. % of total fatty alcohol C20:1-OH C20:0-OH C22:1-OH C22:0-OH C24:1-OH C26:1-OH FadD n.d. n.d. n.d. n.d. n.d. n.d. AtFAR1 n.d. n.d. n.d. n.d. n.d. n.d. AtFAR2(-120) n.d. n.d. n.d. n.d. n.d. n.d. AtFAR3 n.d. n.d. n.d. n.d. n.d. n.d. AtFAR4 n.d. n.d. n.d. n.d. n.d. n.d. AtFAR5 n.d. n.d. n.d. n.d. n.d. n.d. BrFAR1 n.d. n.d. n.d. n.d. n.d. n.d. BrFAR5 n.d. n.d. n.d. n.d. n.d. n.d. n.d.: Not Detected

TABLE-US-00008 TABLE 8 % of total fatty alcohol C16:0-OH C17:0-OH C18:1-OH C18:0-OH C20:1-OH C20:0-OH NoKASII n.d. n.d. n.d. n.d. n.d. n.d. NoKASII + 66.42 0.22 4.78 0.25 6.53 0.10 19.70 0.35 2.57 0.03 n.d. AtFAR1 NoKASII + 86.83 0.16 n.d. 11.10 0.11 2.07 0.06 n.d. n.d. AtFAR2(-120) NoKASII + n.d. n.d. n.d. n.d. n.d. n.d. AtFAR3 NoKASII + 38.68 1.28 5.21 1.42 12.64 0.32 36.10 1.99 5.95 0.64 1.43 0.22 AtFAR4 NoKASII + 34.86 0.03 2.83 0.23 31.70 0.25 20.42 0.31 8.11 0.09 0.85 0.01 AtFAR5 NoKASII + 56.78 8.50 4.53 1.00 9.82 1.58 26.27 6.34 2.11 0.68 0.49 0.51 BrFAR1 NoKASII + 61.18 0.20 2.78 0.25 12.34 0.43 19.15 0.51 3.67 0.09 0.47 0.03 BrFAR5 % of total fatty alcohol C22:1-OH C22:0-OH C24:1-OH C26:1-OH NoKASII n.d. n.d. n.d. n.d. NoKASII + n.d. n.d. n.d. n.d. AtFAR1 NoKASII + n.d. n.d. n.d. n.d. AtFAR2(-120) NoKASII + n.d. n.d. 55.72 2.06 44.28 2.06 AtFAR3 NoKASII + n.d. n.d. n.d. n.d. AtFAR4 NoKASII + 1.05 0.03 n.d. 0.18 0.00 n.d. AtFAR5 NoKASII + n.d. n.d. n.d. n.d. BrFAR1 NoKASII + 0.41 0.03 n.d. n.d. n.d. BrFAR5 n.d.: Not Detected

TABLE-US-00009 TABLE 9 % of total fatty alcohol C16:0-OH C17:0-OH C18:1-OH C18:0-OH C20:1-OH C20:0-OH NoKASII(-20) n.d. n.d. n.d. n.d. n.d. n.d. NoKASII(-20) + 49.96 1.48 3.67 0.40 2.41 0.28 37.03 1.22 3.08 0.14 3.05 0.04 AtFAR1 NoKASII(-20) + 86.83 0.08 n.d. 9.10 0.26 4.06 0.20 n.d. n.d. AtFAR2(-120) NoKASII(-20) + n.d. n.d. n.d. n.d. n.d. n.d. AtFAR3 NoKASII(-20) + 15.50 1.83 2.25 0.86 5.20 0.68 47.19 1.97 14.66 1.72 8.39 0.49 AtFAR4 NoKASII(-20) + 26.56 0.79 2.00 0.11 20.99 0.03 28.38 0.03 13.27 0.33 2.50 0.13 AtFAR5 NoKASII(-20) + 47.79 6.52 3.10 0.21 4.15 0.34 40.49 5.88 2.42 0.21 2.05 0.35 BrFAR1 NoKASII(-20) + 29.59 1.42 n.d. 11.54 0.39 33.74 0.83 13.56 0.65 3.66 0.24 BrFAR5 % of total fatty alcohol C22:1-OH C22:0-OH C24:1-OH C26:1-OH NoKASII(-20) n.d. n.d. n.d. n.d. NoKASII(-20) + 0.80 0.10 n.d. n.d. n.d. AtFAR1 NoKASII(-20) + n.d. n.d. n.d. n.d. AtFAR2(-120) NoKASII(-20) + n.d. n.d. 42.00 5.31 58.00 5.31 AtFAR3 NoKASII(-20) + 4.17 0.60 1.29 0.21 1.35 0.09 n.d. AtFAR4 NoKASII(-20) + 4.15 0.12 0.53 0.01 1.62 0.08 n.d. AtFAR5 NoKASII(-20) + n.d. n.d. n.d. n.d. BrFAR1 NoKASII(-20) + 7.91 1.04 n.d. n.d. n.d. BrFAR5 n.d.: Not Detected

TABLE-US-00010 TABLE 10 % of total fatty alcohol C16:0-OH C17:0-OH C18:1-OH C18:0-OH C20:1-OH NoKASII(-40) n.d. n.d. n.d. n.d. n.d. NoKASII(-40) + 45.35 1.08 15.62 2.99 4.59 0.96 28.51 0.57 4.10 0.58 AtFAR1 NoKASII(-40) + 85.64 0.84 n.d. 12.06 0.82 2.29 0.07 n.d. AtFAR2(-120) NoKASII(-40) + n.d. n.d. n.d. n.d. n.d. AtFAR3 NoKASII(-40) + 24.06 3.09 8.41 1.58 9.54 0.39 45.08 2.14 9.27 1.34 AtFAR4 NoKASII(-40) + 24.79 2.92 4.83 1.24 21.82 1.44 29.97 1.03 12.53 2.13 AtFAR5 NoKASII(-40) + 36.10 1.93 3.97 0.88 9.64 0.48 42.66 1.66 4.61 0.30 BrFAR1 NoKASII(-40) + 60.10 0.97 3.99 0.57 19.50 1.23 13.65 0.20 2.77 0.23 BrFAR5 % of total fatty alcohol C20:0-OH C22:1-OH C22:0-OH C24:1-OH C26:1-OH NoKASII(-40) n.d. n.d. n.d. n.d. n.d. NoKASII(-40) + 1.83 0.11 n.d. n.d. n.d. n.d. AtFAR1 NoKASII(-40) + n.d. n.d. n.d. n.d. n.d. AtFAR2(-120) NoKASII(-40) + n.d. n.d. n.d. 47.21 0.84 52.79 0.84 AtFAR3 NoKASII(-40) + 3.64 0.53 n.d. n.d. n.d. n.d. AtFAR4 NoKASII(-40) + 1.94 0.21 3.15 0.80 n.d. n.d. n.d. AtFAR5 NoKASII(-40) + 2.60 0.19 0.42 0.37 n.d. n.d. n.d. BrFAR1 NoKASII(-40) + n.d. n.d. n.d. n.d. n.d. BrFAR5 n.d.: Not Detected

[0192] As shown in Table 6, long-chain fatty acids (fatty acids having 20 or more carbon atoms), which were not observed in the FadD strain being a control, were detected in the transformants prepared by introducing a gene encoding the NoKASII, the NoKASII(20) in which 20 residues of amino acids at N-terminal side of NoKASII containing a putative chloroplast localization signal were deleted or the NoKASII(40) in which 40 residues thereof were deleted. Here, the long-chain fatty acid is a substrate for a long-chain fatty alcohol having 20 or more carbon atoms, and a supply amount of acyl-ACP having 20 or more carbon atoms increased in the transformants prepared by introducing each of the NoKASII, the NoKASII(20) gene or the NoKASII(40) gene thereinto.

[0193] As shown in Table 7, when various FAR genes were independently introduced, fatty alcohols having 18 or less carbon atoms were detected. However, no long-chain fatty alcohol was detected.

[0194] On the other hand, as shown in Tables 8 to 10, formation of fatty alcohols having 20 to 26 carbon atoms was confirmed in strains prepared by introducing the NoKASII gene, the NoKASII (20) gene or the NoKASII (40) gene, together with the AtFAR1 gene, the AtFAR3 gene, the AtFAR4 gene, the AtFAR5 gene, the BrFAR1 gene or the BrFAR5 gene and expressing both. Accordingly, expression of both the KASII gene and the FAR gene is necessary for producing long-chain fatty alcohols.

[0195] However, no formation of alcohols having 20 or more carbon atoms was observed in strains prepared by introducing the NoKASII gene, NoKASII(20) gene or NoKASII(40) gene, and the AtFAR2(120) gene and expressing both. Therefore, it is necessary to use appropriately in combination of the NoKASII gene with the FAR gene wherein the FAR uses acyl-ACP having 20 or more carbon atoms as the substrate. In addition, identities of the amino acid sequence of AtFAR2(120) to the amino acid sequences of every kind of FARs are, 39% to the AtFAR1, 38% to the AtFAR3, 41% to the AtFAR4, 40% to the AtFAR5, 40% to the BrFAR1, and 40% to the BrFAR5.

[0196] Moreover, even when the same FAR gene was introduced thereinto, a proportion of amounts of long-chain fatty alcohols in the total fatty alcohols was the highest when the NoKASII(20) gene was introduced thereinto, and tended to be higher subsequently when the NoKASII(40) gene was introduced thereinto, and when the NoKASII gene was introduced thereinto.

Preparation Example 3 Preparation of Transformant by Introducing NoKASII Gene and AtFAR Gene into Cyanobacteria

(1) Construction of Plasmid for Kanamycin Resistance Gene Expression

[0197] Using genomic DNA of Synechococcus elongatus sp. strain PCC7942 as a template, and the primer pUC118/NS1up-F and the primer Kmr/NS1up-R described in Table 4, PCR was carried out to amplify the upstream fragment of a neutral site NS1 region (NS1up fragment; SEQ ID NO: 73). Further, using the genomic DNA described above as a template, and the primer Kmr/NS1down-F and the primer pUC118/NS1down-R described in Table 4, PCR was carried out to amplify the downstream fragment of a neutral site NS1 region (NS1down fragment; SEQ ID NO: 76).

[0198] Furthermore, using a plasmid of pJH1 (Trieu-Cuot P et al., Gene, 1983, vol. 23, p. 331-341) as a template, and the primer Kmr-F and the primer Kmr-R described in Table 4, PCR was carried out to amplify a kanamycin resistance marker gene fragment (Kmr fragment; SEQ ID NO: 45).

[0199] A pUC118-NS1::Km plasmid was obtained by inserting the NS1up fragment, the NS1down fragment, and the Kmr fragment into a place between the HincII sites of the pUC118 plasmid (manufactured by Takara Bio) by using the In-Fusion (registered trademark) PCR cloning system (Clontech).

(2) Construction of Plasmid for NoKASII Gene Expression

[0200] Using the pUC118-NS1::Km plasmid as a template and the primer Kmr-R and the primer NS1down-F described in Table 4, PCR was carried out to amplify a linearized pUC118-NS1::Km plasmid.

[0201] Then, using a trc promoter sequence, which was artificially synthesized form the sequence of a pTrc99A cloning plasmid (NCBI Accession number: M22744), as a template, and the primer Kmr/Ptrc-F and the primer Ptrc-R described in Table 4, PCR was carried out to amplify a trc promoter fragment (Ptrc fragment; SEQ ID NO: 80).

[0202] Further, PCR was carried out by using genomic DNA of the wild-type strains of Synechocystis sp. strain PCC6803 as a template, and the primer Trbc-F and the primer NS1down/Trbc-R described in Table 4 to amplify a terminator fragment of a rbc gene (Trbc fragment, SEQ ID NO: 52).

[0203] Furthermore, using a cDNA library prepared from Nannochloropsis oculata strain NIES-2145 as a template, and the primer Ptrc/NoKASII(40)-F and the primer Trbc/NoKASII-R described in Table 4, PCR was carried out to amplify a chloroplast transit signal deleted NoKASII gene fragment (NoKASII(40) fragment; a nucleotide sequence of the 121.sup.st to 1428.sup.th nucleotides set forth in SEQ ID NO: 2 wherein a start codon (ATG) was added to 5 end side thereof; SEQ ID NO: 97).

[0204] Then, the linearized pUC118-NS1::Km plasmid, the Ptrc fragment, the Trbc fragment, and the NoKASII(40) fragment were mixed, and the resultant mixture was cloned by using the In-Fusion (registered trademark) PCR Cloning system (Clontech) to obtain a pUC118-NS1::Km-Ptrc-NoKASII(40)-Trbc plasmid in which the kanamycin resistance gene cassette, the trc promoter region, the NoKASII(40) gene, and the rbc terminator were inserted in this order into a neutral site NS1 region derived from Synechococcus elongatus sp. strain PCC7942.

(3) Construction of Plasmid for Spectinomycin Resistance Gene Expression

[0205] Using genomic DNA of the wild-type strain of Synechococcus elongatus sp. PCC7942 as a template, and the primer pUC118/orf1593up-F and the primer Sp/orf1593up-R described in Table 4, PCR was carried out to amplify the upstream fragment of an orf1593 region (orf1593up fragment; SEQ ID NO: 85). Further, using the genomic DNA described above as a template, and the primer Sp/orf1594down-F and the primer pUC118/orf1594down-R described in Table 4, PCR was carried out to amplify the downstream fragment of an orf1594 region (orf1594down fragment; SEQ ID NO: 88).

[0206] Furthermore, using a pDG1726 plasmid (Guerout-Fleury et al., Gene, 1995, vol. 167, p. 335-336) as a template, and the primer Sp-F and the primer Sp-R described in Table 4, PCR was carried out to amplify a spectinomycin resistance marker gene fragment (Sp fragment; SEQ ID NO: 63).

[0207] A pUC118-orf1593/1594::Sp plasmid was obtained by inserting the orf1593up fragment, the orf1594down fragment, and the Sp fragment into a place between the Hincll sites of the pUC118 plasmid (manufactured by Takara Bio) by using the In-Fusion (registered trademark) PCR cloning system (Clontech).

(4) Construction of Plasmid for AtFAR Gene Expression

[0208] Using the pUC118-orf1593/1594::Sp plasmid as a template and the primer Sp-F and the primer orf1594up-R described in Table 4, PCR was carried out to amplify a linearized pUC118-orf1593/1594::Sp plasmid.

[0209] Then, using a trc promoter sequence, which was artificially synthesized form the sequence of a pTrc99A cloning plasmid (NCBI Accession number: M22744) as a template, and the primer orf1593up/Ptrc-F and the primer Ptrc-R described in Table 4, PCR was carried out to amplify a trc promoter fragment (Ptrc fragment, SEQ ID NO: 80). In a manner similar to that described above, using genomic DNA of Synechococcus elongatus sp. strain PCC7942 as a template, and the primer orf1593up/PrrnA-F and the primer PrrnA-R described in Table 4, PCR was carried out to amplify a promoter fragment of an rrnA operon gene derived from Synechococcus elongatus sp. strain PCC7942 (Prrn fragment; SEQ ID NO: 93).

[0210] Further, PCR was carried out by using genomic DNA of the wild-type strains of Synechocystis sp. strain PCC6803, and the primer Trbc-F and the primer Sp/Trbc-R described in Table 4 to amplify a terminator fragment of a rbc gene (Trbc fragment, SEQ ID NO: 52).

[0211] Furthermore, using a cDNA library prepared from Arabidopsis thaliana as a template, and the primer Ptrc99A2-AtFAR1-F and the primer Trbc/AtFAR1-ry described in Table 4, PCR was carried out to amplify an AtFAR1 gene fragment (SEQ ID NO: 4). In a manner similar to that described above, using the primer PrrnA2-AtFAR4-F and the primer Trbc/AtFAR4-ry described in Table 4, PCR was carried out to amplify an AtFAR4 gene fragment (SEQ ID NO: 8).

[0212] Then, the linearized pUC118-orf1593/1594::Sp plasmid, the Ptrc fragment, the Trbc fragment, and the AtFAR1 gene fragment were mixed, and the resultant mixture was cloned by using the In-Fusion (registered trademark) PCR Cloning system (Clontech) to obtain a pUC118-orf1593/1594::Ptrc-AtFAR1-Trbc-Sp plasmid in which the trc promoter, the AtFAR1 gene fragment, and the rbc terminator and the spectinomycin resistance gene cassette were inserted in this order into an orf1593/1594 region derived from Synechococcus elongatus sp. strain PCC7942.

[0213] By a method in a manner similar to that described above, the linearized pUC118-orf1593/1594::Sp plasmid, the PrrnA fragment, the Trbc fragment, and the AtFAR4 gene fragment were mixed, and the resultant mixture was cloned by using the In-Fusion (registered trademark) PCR Cloning system (Clontech) to obtain a pUC118-orf1593/1594::PrrnA-AtFAR4-Trbc-Sp plasmid in which a promoter of an rrnA operon gene, the AtFAR4 gene fragment, and the rbc terminator and the spectinomycin resistance gene cassette were inserted in this order into an orf1593/1594 region derived from Synechococcus elongatus sp. strain PCC7942.

(5) Introduction of Plasmid for NoKASII Gene Expression and Plasmid for AtFAR Gene Expression into Cyanobacteria

[0214] Using thus-obtained pUC118-NS1::Km-Ptrc-NoKASII(40)-Trbc plasmid, pUC118-orf1593/1594::Ptrc-AtFAR1-Trbc-Sp plasmid and pUC118-orf1593/1594::PrrnA-AtFAR4-Trbc-Sp plasmid, Synechococcus elongatus sp. strain PCC7942 was transformed by a spontaneous transformation method, and the resultant material was selected by kanamycin resistance and spectinomycin resistance.

[0215] In this way, a NS1::NoKASII(40)orf1593/1594::AtFAR1 strain and a NS1::NoKASII(40)orf1593/1594::AtFAR4 strain were obtained, in which the construct for the NoKASII(40) gene expression was introduced into the NS1 region and the AtFAR1 gene or the AtFAR4 gene was introduced into the orf1593/1594 region on a genome of Synechococcus elongatus sp. strain PCC7942.

[0216] In addition, in a manner similar to that described above, a NS1::NoKASII(40) strain into which the construct for NoKASII(40) gene expression was introduced, and a orf1593/1594::AtFAR4 strain wherein the AtFAR4 gene was introduced into the orf1593/1594 region, were obtained respectively.

Test Example 2 Production of Fatty Alcohols

[0217] In a 50 mL Erlenmeyer flask to which 20 mL of BG-11 medium having the composition shown in Table 9 below was added, the transformant prepared in Preparation Example 3, and Synechococcus elongatus sp. strain PCC7942 (wild type) were cultured for 14 days. The cultivations were conducted by using a rotary shaker (120 rpm) at 30 C. under predetermined lighting (60 E.Math.m.sup.2.Math.sec.sup.1), and an initial bacterial cell concentration set to 0.2 in OD.sub.730. In addition, suitable antibiotic was added to the BG-11 medium for cultivation of the transformants to be 25 g/mL in a concentration.

TABLE-US-00011 TABLE 11 Composition of BG-11 liquid medium Stock solution A solution 2 mL B solution 50 mL C solution 2 mL D solution 1 mL 1.0M TES-KOH (pH 8.2) 5 mL Total 1000 mL Composition of stock solution A solution B solution Citric acidH.sub.2O 0.33 g NaNO.sub.3 30 g Ferric ammonium citrate 0.3 g K.sub.2HPO.sub.4 0.78 g Na.sub.2EDTA 0.05 g MgSO.sub.47H.sub.2O 1.5 g total 100 mL total 100 mL
C solution CaCl.sub.2.2H.sub.2O 1.9 g/100 mL
D solution
[H.sub.3BO.sub.3 2.86 g, MnCl.sub.2.4H.sub.2O 1.81 g, ZnSO.sub.4.7H.sub.2O 0.22 g, CuSO.sub.4.5H.sub.2O 0.08 g, Na.sub.2MoO.sub.4 0.021 g, Co(NO.sub.3).6H.sub.2O 0.0494 g, H.sub.2SO.sub.4 single drop, H.sub.2O]/1000 mL

[0218] The bacterial cells were collected by separating 2 to 5 mL of culture fluid into a glass test tube, and by centrifuging at 3,000 rpm. A precipitate obtained by removing a supernatant was suspended into 0.5 mL of distilled water, and as an internal standard, 25 L of C23:0 alcohol (1-tricosanol) (1 mg/mL) dissolved in chloroform was added thereto. Then, 0.5 mL of chloroform and 1 mL of methanol were added thereto, and the resultant mixture was stirred and further left to stand for 30 minutes. Then, 0.5 mL of chloroform and 0.5 mL of 1.5% KCl solution were added thereto, and the resultant mixture was stirred. The resultant mixture was centrifuged at 3,000 rpm for 15 minutes, and then an organic layer (lower layer) was collected into a test tube with cap by using a Pasteur pipette, and dried and solidified by a nitrogen gas.

[0219] To a dried and solidified lipid fraction, 0.7 mL of 0.5 N KOH methanol solutions was added, and the resultant mixture was stirred and saponified at 80 C. for 30 minutes. Further, 1 mL of boron trifluoride-methanol solution was added thereto, and a methyl esterification reaction was carried out thereon at 80 C. for 10 minutes. To this reaction fluid, 0.2 to 0.5 mL of hexane and 1 mL of saturated saline solution were added and the resultant mixture was centrifuged for 10 minutes at room temperature, and then a hexane layer being an upper layer was collected.

[0220] The collected hexane layer was transferred to a test tube with a screw cap, and dried into solid by nitrogen, and 100 L of a silylating agent TMSI-H containing hexamethyldisilazane and trimethylchlorosilane dissolved in pyridine (manufactured by GL Sciences Inc.) was added thereto. The resulting mixture was allowed to react at 80 C. for 30 minutes, and then 300 L of hexane and 0.5 mL of 1.5% KCl solution were added thereto, and stirred. Further, the resulting mixed liquid was subjected to centrifugation at room temperature for 10 minutes, and a hexane layer being an upper layer was collected and provided for GC analysis.

[0221] First, fatty acid methyl esters and trimethylsilylated fatty alcohols were identified by gas chromatography mass spectrometry analysis. Next, based on a peak area of waveform data obtained by gas chromatography analysis, proportions (%) of amounts of various fatty alcohols in the total amount of fatty alcohols produced by each transformant were calculated. Conditions of gas chromatography mass spectrometry analysis and gas chromatography analysis are the same with the conditions in Test Example 1.

[0222] FIG. 1 shows a chromatograph obtained by gas chromatography mass spectrometry analysis. Further, Table 12 shows the results of calculating the proportion (%) of the amounts of various fatty alcohols in the total amount of fatty alcohols by each transformant.

TABLE-US-00012 TABLE 12 % of total fatty alcohol C18:0-OH C20:0-OH C22:0-OH wild type n.d. n.d. n.d. orf1593/1594::AtFAR4 100.00 n.d. n.d. NS1::NoKASII(40) n.d. n.d. n.d. NS1::NoKASII(40)orf1593/ 26.86 73.14 n.d. 1594::AtFAR4 NS1::NoKASII(40)orf1593/ 29.10 60.26 10.64 1594::AtFAR1 n.d.: Not Detected

[0223] As shown in FIG. 1, Synechococcus elongatus sp. strain PCC7942 acquires ability to produce long-chain fatty acids having 20 or more carbon atoms by introducing a NoKASII gene thereinto. Moreover, as shown in FIG. 1 and Table 12, when the AtFAR4 gene was introduced into a wild strain, production of fatty alcohols having 18 carbon atoms was confirmed. However, in these strains, no long-chain fatty alcohol having 20 or more carbon atoms was detected.

[0224] On the other hand, as shown in FIG. 1 and Table 12, production of the long-chain fatty alcohol having 20 carbon atoms was confirmed by introducing the NoKASII gene and the AtFAR4 gene into the Synechococcus elongatus sp. strain PCC7942.

[0225] Further, ability to produce long-chain fatty alcohols having 20 and 22 carbon atoms was able to be provided by introducing the NoKASII gene and the AtFAR1 gene into the Synechococcus elongatus sp. strain PCC7942.

[0226] As described above, introduction of both the NoKASII gene and the AtFAR gene is important for acquiring the ability to produce the long-chain fatty alcohols and improving productivity in cyanobacteria.

Preparation Example 4 Preparation of Transformant by Introducing NoKASII Gene and AtFAR Gene into Cyanobacteria

(1) Construction of Plasmid for Kanamycin Resistance Gene Expression

[0227] Using genomic DNA of Synechocystis sp. strain PCC6803 as a template, and the primer pUC118/sIr0168up-F and the primer Kmr/sIr0168up-R described in Table 5, PCR was carried out to amplify the upstream fragment of a neutral site sIr0168 region (sIr0168up fragment; SEQ ID NO: 39). Further, using the genomic DNA described above as a template, and the primer Kmr/sIr0168down-F and the primer pUC118/sIr0168down-R described in Table 5, PCR was carried out to amplify the downstream fragment of a neutral site sIr0168 region (sIr0168down fragment; SEQ ID NO: 42).

[0228] A pUC118-sIr0168::Km plasmid was obtained by inserting the sIr0168up fragment, the sIr0168down fragment, and a Kmr fragment prepared by a method in a manner similar to that described in Preparation Example 3, into the HincII site of the pUC118 plasmid (manufactured by Takara Bio) by using the In-Fusion (registered trademark) PCR cloning system (Clontech).

(2) Construction of Plasmid for NoKASII Expression

[0229] Using the pUC118-sIr0168::Km plasmid as a template and the primer Kmr-F described in Table 4 and the primer sIr0168up-R described in Table 5, PCR was carried out to amplify a linearized pUC118-sIr0168::Km plasmid.

[0230] Then, using genomic DNA of Synechocystis sp. strain PCC6803 as a template, and the primer sIr0168up/Pcpc560-F and the primer Pcpc560-R described in Table 5, PCR was carried out to amplify a fragment of high expression promoter of cpc560 (Jie Z et al., Scientific Reports, 2014, vol. 4, p. 4500; Pcpc560 fragment; SEQ ID NO: 49).

[0231] Further, PCR was carried out by using genomic DNA of Synechocystis sp. strain PCC6803 as a template, and the primer Trbc-F described in Table 4 and the primer Km/Trbc-R described in Table 5 to amplify a terminator fragment of a rbc gene (Trbc fragment, SEQ ID NO: 52).

[0232] Furthermore, using a cDNA library prepared from Nannochloropsis oculata strain NIES-2145 as a template, and the primer Pcpc560/NoKASII(40)-F described in Table 5 and the primer Trbc/NoKASII-R described in Table 4, PCR was carried out to amplify a NoKASII(40) gene fragment.

[0233] Then, the linearized pUC118-sIr0168::Km plasmid, the Pcpc560 fragment, the Trbc fragment, and the NoKASII(40) gene fragment were mixed, and the resultant mixture was cloned by using the In-Fusion (registered trademark) PCR Cloning system (Clontech) to obtain a pUC118-sIr0168::Pcpc560-NoKASII(40)-Trbc-Km plasmid in which the cpc560 promoter, the NoKASII(40) gene fragment, the rbc terminator, and the kanamycin resistance gene cassette were inserted in this order into a neutral site sIr0168 region derived from Synechocystis sp. strain PCC6803.

(3) Construction of Plasmid for Spectinomycin Resistance Gene Expression

[0234] Using genomic DNA of the wild-type strain of Synechocystis sp. strain PCC6803 as a template, and the primer pUC118/sII0208up-F and the primer Sp/sII0208up-R described in Table 5, PCR was carried out to amplify the upstream fragment of an sII0208 region (sII0208up fragment; SEQ ID NO: 57). Further, using the genomic DNA described above as a template, and the primer Sp/sII0209down-F and the primer pUC118/sII0209down-R described in Table 5, PCR was carried out to amplify the downstream fragment of an sII0209 region (sII0209down fragment; SEQ ID NO: 60).

[0235] A pUC118-sII0208/0209::Sp plasmid was obtained by inserting the sII0208up fragment, the sII0209down fragment, and a Sp fragment prepared by a method in a manner similar to that described in Preparation Example 3, into the HincII site of the pUC118 plasmid (manufactured by Takara Bio) by using the In-Fusion (registered trademark) PCR cloning system (Clontech).

(4) Construction of Plasmid for AtFAR Gene Expression

[0236] Using the pUC118-sII0208/0209::Sp plasmid as a template and the primer Sp-F described in Table 4 and the primer sII0208up-R described in Table 5, PCR was carried out to linearize the pUC118-sII0208/0209::Sp plasmid.

[0237] Then, using genomic DNA of Synechocystis sp. strain PCC6803 as a template, and the primer sII0208up/Pcpc560-F and the primer Pcpc560-R described in Table 5, PCR was carried out to amplify the Pcpc560 fragment (SEQ ID NO: 49).

[0238] Further, PCR was carried out by using a cDNA library prepared from Arabidopsis thaliana as a template, and the primer Pcpc560/AtFAR1-fw described in Table 5 and the primer Trbc/AtFAR1-ry described in Table 4 to amplify an AtFAR1 gene fragment (SEQ ID NO: 4). In a manner similar to that described above, PCR was carried out by using the primer Pcpc560/AtFAR4-fw described in Table 5 and the primer Trbc/AtFAR4-ry described in Table 4 to amplify an AtFAR4 gene fragment (SEQ ID NO: 8).

[0239] Then, the linearized pUC118-sII0208/0209::Sp plasmid, the Pcpc560 fragment, a Trbc fragment prepared by a method in a manner similar to that described in Preparation Example 3, and the AtFAR1 gene fragment or the AtFAR4 gene fragment were mixed, and the resultant mixture was cloned by using the In-Fusion (registered trademark) PCR Cloning system (Clontech) to obtain a pUC118-sII0208/0209::Pcpc560-AtFAR1-Trbc-Sp plasmid or a pUC118-sII0208/0209::Pcpc560-AtFAR4-Trbc-Sp plasmid in which the cpc560 promoter, the AtFAR1 gene fragment or the AtFAR4 gene fragment, the rbc terminator, and the spectinomycin resistance gene cassette were inserted in this order into a neutral site sIr0168 region derived from Synechocystis sp. strain PCC6803.

(5) Introduction of Plasmid for NoKASII Gene Expression and Plasmid for AtFAR Gene Expression into Cyanobacteria

[0240] Using thus-obtained pUC118-sIr0168::Pcpc560-NoKASII(40)-Trbc-Km plasmid, pUC118-sII0208/0209::Pcpc560-AtFAR1-Trbc-Sp plasmid, and pUC118-sII0208/0209::Pcpc560-AtFAR4-Trbc-Sp plasmid, Synechocystis sp. strain PCC6803 was transformed by a spontaneous transformation method, and the resultant material was selected by kanamycin resistance and spectinomycin resistance.

[0241] In this way, a sIr0168::NoKASII(40)sII0208/0209::AtFAR1 strain and a sIr0168::NoKASII(40)sII0208/0209::AtFAR4 strain were obtained, in which the construct for the NoKASII gene expression was introduced into the sIr0168 region and the AtFAR1 gene or the AtFAR4 gene was introduced into the sII0208/0209 region on a genome of Synechocystis sp. strain PCC6803.

[0242] In addition, in a manner similar to that described above, a sIr0168::NoKASII(40) strain into which the construct for NoKASII(40) gene expression was introduced into the sIr0168 region, and a sII0208/0209::AtFAR1 strain or a sII0208/0209::AtFAR4 strain wherein the AtFAR1 gene or AtFAR4 gene was introduced into the sII0208/0209 region, were obtained respectively.

Test Example 3 Production of Fatty Alcohols

[0243] By a method in a manner similar to that described in Test Example 2, lipids were extracted from the transformants prepared in Preparation Example 4. Fatty acid methyl esters and trimethylsilylated fatty alcohols were identified by gas chromatography mass spectrometry analysis. Next, based on a peak area of waveform data obtained by gas chromatography analysis, proportions (%) of amounts of various fatty alcohols in the total amount of fatty alcohols produced by each transformant were calculated.

[0244] FIG. 2 shows the results of a chromatograph obtained by gas chromatography mass spectrometry analysis. Further, Table 13 shows the results of calculating the proportion (%) of the amounts of various fatty alcohols in the total amount of fatty alcohols by each transformant.

TABLE-US-00013 TABLE 13 % of total fatty alcohol C18:0-OH C20:0-OH wild type n.d. n.d. sII0208/0209::AtFAR1 100.00 n.d. sII0208/0209::AtFAR4 100.00 n.d. 0168::NoKASII(40) n.d. n.d. 0168::NoKASII(40)sII0208/0209::AtFAR1 66.78 33.22 0168::NoKASII(40)sII0208/0209::AtFAR4 39.64 60.36 n.d.: Not Detected

[0245] As shown in FIG. 2 and Table 13, similarly to the Synechococcus elongatus sp. strain PCC7942, the ability to produce the long-chain fatty alcohol having 20 carbon atoms was able to be provided also in the Synechocystis sp. strain PCC6803 by introducing the NoKASII gene and the AtFAR gene thereinto.

[0246] As described above, host microorganisms can be provided with the ability to produce the long-chain fatty alcohols by enhancing the expression of both the KAS gene and the FAR gene described above in cells of the host microorganisms such as Escherichia coli and cyanobacteria. The production amount of long-chain fatty alcohols is tend to increase in comparison with the host in which the expression of the genes is not enhanced. Such an effect is not obtained merely by enhancing the expression of the KAS gene and the FAR gene described above independently.

[0247] Therefore, a transformant in which the productivity of long-chain fatty alcohols is acquired or a transformant in which the productivity of long-chain fatty alcohols is improved can be prepared by enhancing the expression of both the KAS gene and the FAR gene. Further, the productivity of long-chain fatty alcohols can be improved by culturing the transformant.

[0248] Having described our invention as related to the present embodiments, it is our intention that the invention not be limited by any of the details of the description, unless otherwise specified, but rather be construed broadly within its spirit and scope as set out in the accompanying claims.

[0249] This application claims priority on Patent Application No. 2017-021708 filed in Japan on Feb. 8, 2017, which is entirely herein incorporated by reference.