Exosome Delivery System

20190338314 ยท 2019-11-07

Assignee

Inventors

Cpc classification

International classification

Abstract

This disclosure relates to the field of exosome delivery systems. In particular, compositions comprising adipose-derived exosomes that may be used as a delivery system are encompassed. The exosome delivery system can be used to deliver exogenous cargo such as miRNA and other inhibitory RNAs, as well as proteins, to target cells in a subject.

Claims

1. A delivery system, comprising: an exosome derived from adipose tissue, a targeting moiety that is not naturally expressed on the exosome, and a recombinant nucleic acid that is not naturally found within an exosome ranging in size from 50 to about several thousand nucleotides.

2. The delivery system of claim 1, wherein the adipose tissue is brown adipose tissue, white adipose, beige adipose, or a combination of one or more of brown, white, and beige adipose tissue.

3. (canceled)

4. (canceled)

5. (canceled)

6. The delivery system of claim 1, wherein the nucleic acid is short hairpin RNA (shRNA), small nucleolar RNA (snoRNA), long non-coding RNA (LncRNA), micro RNA (miRNA), DNA or RNA.

7. (canceled)

8. (canceled)

9. (canceled)

10. (canceled)

11. (canceled)

12. The delivery system of claim 1, wherein the nucleic acid is less than 50, 100, 500, 1000, 2000, or 3000 nucleic acids.

13. The delivery system of claim 1, wherein the exosome is derived from a human.

14. The delivery system of claim 1, wherein the targeting moiety functions to regulate uptake of the exosome by tissues within a subject.

15. (canceled)

16. The delivery system of claim 1, further comprising a recombinant protein, wherein the recombinant protein is part of the CRISPR-Cas ribonucleoprotein complex.

17. The delivery system of claim 1, wherein the targeting moiety is conjugated to the exosome, wherein the targeting moiety is conjugated to the exosome by expressing the targeting moiety as a fusion protein together with an exosomal transmembrane protein.

18. (canceled)

19. The delivery system of claim 1, wherein the targeting moiety is one or more of Asialoglycoprotein Receptor (ASGPR), Toll-Like Receptor 4 ligand (TLR-4 ligand), Notch, CGS-21680, Parathyroid hormone receptor 1 (PTHR1), and Fractalkine receptor (CX3CR1).

20. (canceled)

21. (canceled)

22. (canceled)

23. (canceled)

24. (canceled)

25. (canceled)

26. (canceled)

27. (canceled)

28. (canceled)

29. (canceled)

30. (canceled)

31. (canceled)

32. A method for producing an adipose-derived exosome delivery system, comprising: a. isolating adipose tissue from a subject; b. isolating adipocytes or preadipocytes from the adipose tissue; and c. contacting the isolated adipocytes or preadipocytes with a nucleic acid vector comprising nucleic acids capable of expressing one or more RNA, thereby producing an adipose-derived exosome delivery system.

33. The method of claim 32, wherein the subject is human.

34. The method of claim 32, wherein the adipose tissue is brown adipose tissue, white adipose tissue, beige adipose tissue, or a combination of one or more of brown, white, and beige adipose tissue.

35. (canceled)

36. (canceled)

37. (canceled)

38. The method of claim 32, wherein the nucleic acid is a small interfering RNA (siRNA), short hairpin RNA (shRNA), a small nucleolar RNA (snoRNA), a long non coding RNA (LncRNA), or a micro RNA (miRNA).

39. (canceled)

40. The method of claim 32, wherein the nucleic acid is less than 3000, 2000, 1000, 500, 100, 50, 40, 30, 20, 15, or 10 nucleic acids.

41. (canceled)

42. The method of claim 32, further comprising a step (d), wherein step (d) comprises contacting the isolated adipocytes or preadipocytes with a nucleic acid vector comprising nucleic acids encoding a targeting moiety.

43. The method of claim 42, wherein the targeting moiety is expressed on the surface of the exosome, or within the membrane of the exosome.

44. (canceled)

45. (canceled)

46. The method of claim 42, wherein the nucleic acids encoding the targeting moiety comprise a fusion protein, wherein the fusion protein comprises an exosomal transmembrane protein and a targeting moiety.

47. method of claim 42, wherein the targeting moiety is one or more of Asialoglycoprotein Receptor (ASGPR), Toll-Like Receptor 4 ligand (TLR-4 ligand), Notch, CGS-21680, Parathyroid hormone receptor 1 (PTHR1), and Fractalkine receptor (CX3CR1).

48. (canceled)

49. (canceled)

50. (canceled)

51. (canceled)

52. (canceled)

53. (canceled)

54. (canceled)

55. (canceled)

56. (canceled)

57. (canceled)

58. (canceled)

59. (canceled)

Description

FIGURE LEGENDS

DESCRIPTION OF THE SEQUENCES

[0029] FIGS. 1A, 1B, 1C, 1D, 1E, 1F, and 1G show that fat tissue is a major source of circulating exosomal miRNAs in both mice and humans. (a) Schematic showing creation of ADicerKO mice by crossing floxed Dicer (Dicer.sup.lox-lox) with mice carrying an adiponectin promoter-Cre transgene. (b) Immunoelectron microscopy of the tetraspanins CD63 and CD9 in exosomes isolated from murine sera. (c) Heatmap showing Z-scores of exosomal miRNA expression measurements from serum of ADicerKO (KO) and Lox (WT) control mice (n=4 per group). (d) Waterfall plot representing the relative abundance on a log.sub.2 scale of serum exosomal miRNAs that were statistically different between the ADicerKO and the Lox control mice (n=4 per group, p<0.05). (e) Heatmap showing Z-scores of exosomal miRNA measurements in serum of humans with HIV lipodystrophy (HIV), generalized lipodystrophy (CGL) and normal controls (n=4 per group). (f) Waterfall plots representing the relative abundance on a log.sub.2 scale of fold-change differences of exosomal miRNAs that were differentially expressed between human HIV lipodystrophy, human generalized lipodystrophy and normal subjects (n=4 per group, p<0.05). (g) Venn diagrams representing significantly up-regulated and down-regulated miRNAs in HIV lipodystrophy and human generalized lipodystrophy compared to controls (n=4 per group, p<0.05).

[0030] FIGS. 2A, 2B, 2C, 2D, and 2E show fat depot contributions to circulating exosomal miRNAs using a transplantation approach. (a) Schematic of the fat tissue transplantation experiment using WT donor inguinal (Ing), epididymal (Epi) and brown adipose tissue (BAT) which was transplanted into inguinal region in ADicerKO recipient mice. Mice were followed for a total of 14 days after transplantation. Fat pads from WT donors were assessed for miRNA signatures, and serum exosomal miRNA from ADicerKO transplanted mice was subjected to miRNA profiling at the time of sacrifice. (b) Heatmap showing Z-scores of miRNA expression in inguinal (Ing), epididymal (Epi), and brown adipose tissue (BAT) from WT donor mice (n=4 per group, miRNA expression normalized by global average values for each sample; see methods). The Venn diagram represents number of miRNAs whose expression exceeded U6 snRNA in inguinal (Ing), epididymal (Epi), and brown adipose tissue (BAT) from WT donor mice (n=4 per group). (c) Heatmap exhibiting Z-scores of serum exosomal miRNA measurements in ADicerKO and wild type (WT) C57Bl/6 mice (both receiving sham surgery) and in ADicerKO mice transplanted with Ing, Epi, and BAT fat from WT mice (n=4 per group). The Venn diagram represents miRNAs reconstituted significantly and by at least 50% of the way to WT miRNA values in inguinal (Ing), epididymal (Epi), and brown adipose tissue (BAT) from ADicerKO transplant groups (n=4 per group, p<0.05). (d) Glucose tolerance test of wild-type C57Bl/6 mice and ADicerKO (both 12 days after sham surgery). Mice were fasted for 16 hrs and injected intraperitoneally with 20% glucose at 2 g/kg dose (n=3 per group, p=0.0001, WT vs KO at 0 min; p=0.013, WT vs KO at 15 min; p=0.0001, WT vs KO at 90 min, two-tailed t-test; error bars represent standard deviation from the mean). (e) Area under the curve (AUC) graph of the glucose tolerance test of the ADicerKO (sham surgery), wild type C57Bl/6 mice (sham surgery) and in ADicerKO transplanted with Ing, Epi, and BAT fat from WT mice; each mouse received two fat pads from the donor (n=3 per group, p=0.0002, WT vs KO, p=0.033 KO vs KO+BAT, two-tailed t-test). Error bars represent SEM.

[0031] FIGS. 3A, 3B, 3C, 3D, 3E, and 3F show that fat depot derived exosomal miRNA mediate regulation of fibroblast growth factor 21 (FGF21) and transcription in liver. (a) Enzyme-linked immunoassay of FGF21 in serum of ADicerKO mice and Lox control littermates (n=4 per group, p=0.028, two-tailed Mann-Whitney U test). (b) Quantitative PCR of hepatic FGF21 mRNA abundance in Lox and ADicerKO mice (n=4 per group, p=0.028, two-tailed Mann-Whitney U test). (c) Enzyme-linked immunoassay of FGF21 in serum of ADicerKO (sham surgery), WT C57Bl/6 mice (sham surgery) and of ADicerKO transplanted with Ing, Epi, or BAT fat (n=3 per group, p=0.019, Cont vs KO+BAT, two-tailed t-test). (d) qPCR of hepatic FGF21 mRNA abundance in ADicerKO (sham surgery), wild type C57Bl/6 mice (sham surgery), and ADicerKO transplanted with Ing, Epi, and BAT fat (n=3 per group, p=0.046, Cont vs KO+BAT, two-tailed t-test). (e) Hepatic FGF21 3UTR luciferase activity after incubation of AML-12 hepatic cells with exosomes derived from either Lox control mice (exoWT), ADicerKO mice (exoKO), 10 nM free miR-99b (miR-99b free) or with exosomes derived from ADicerKO mice electroporated with miR-99b (exoKO+miR-99b) (n=3 per group, p=0.008, WT vs. KO, p=0.008, KO vs. KO+99b, two-tailed t-test) (f) Hepatic FGF21 3UTR luciferase activity after incubation of AML-12 hepatic cells with exosomes derived from either ADicerKO, Lox control littermates (WT), or exosomes isolated from ADicerKO mice and electroporated to introduce miR-99a, miR-99b, miR-100 or miR-466i (original concentration 10 nM of miRNA mimic). Electroporated exosomes were resuspended in a total volume of 500 ul PBS per mimic and added to the target cells. (n=3 per group, p=0.0007, exoWT vs. exoKO, p=0.002, exoKO vs. exoKO+99b, two-tailed t-test). Indicated t-test comparisons were the only ones performed.

[0032] FIGS. 4A, 4B, 4C, 4D, 4E, 4F, 4G, and 4H show in vivo regulation of FGF21 via exosomal delivery of at least one regulator miRNA, miR-99b. (a) Lox mice (WT), ADicerKO mice (KO), and ADicerKO injected i.v. with wild type exosomes (KO+exoWT) transduced with pacAd5-Luc-FGF21-3UTR luciferase reporter and subjected to IVIS analysis. (b) Total flux measurements of luminescence obtained via IVIS analysis from ADicerKO (KO), Lox mice (WT), or ADicerKO mice injected i.v. with wild type exosomes (KO+exoWT) transduced with pacAd5-Luc-FGF21-3UTR luciferase reporter (n=3 per group, p=0.039, Kruskal Wallis ANOVA, significant comparison WT vs KO, Dunn's post hoc test). (c) qPCR of hepatic FGF21 mRNA abundance in Lox mice (WT), ADicerKO (KO) and ADicerKO injected i.v. with wild type exosomes (KO+exoWT) (n=3 per group, p=0.039, Kruskal Wallis ANOVA, significant comparison WT vs KO, Dunn's post hoc test). (d) Enzyme-linked immunoassay of FGF21 in serum of Lox mice (WT), ADicerKO (KO) or ADicerKO injected i.v. with wild type exosomes (KO+exoWT) (n=3 per group, p=0.027, Kruskal Wallis ANOVA, significant comparison WT vs KO, Dunn's post hoc test) (e) Lox mice injected i.v. with ADicerKO exosomes (WT+exoKO) and ADicerKO mice injected i.v. with either ADicerKO exosomes (KO+exoKO) or ADicerKO exosomes electroporated with miR-99b (KO+exomiR99b) and subjected to IVIS analysis. (f) Total flux measurements of luminescence obtained via IVIS analysis from Lox mice injected i.v. with ADicerKO exosomes (WT+exoKO) and ADicerKO mice injected i.v. with either ADicerKO exosomes (KO+exoKO) or ADicerKO exosomes electroporated with miR-99b (KO+exomiR99b). (n=3 per group, p=0.079, Kruskal Wallis ANOVA, Dunn's post hoc test). (g) qPCR of hepatic FGF21 mRNA abundance in Lox mice injected i.v. with ADicerKO exosomes (WT+exoKO) and ADicerKO mice injected i.v. with either ADicerKO exosomes (KO+exoKO) or ADicerKO exosomes electroporated with miR-99b (KO+exomiR99b). (n=3 per group, p=0.039, Kruskal Wallis ANOVA, significant comparison WT+exoKO vs KO+exoKO, Dunn's post hoc test). (h) Enzyme-linked immunoassay of FGF21 in serum of Lox mice injected i.v. with ADicerKO exosomes (WT+exoKO) and ADicerKO mice injected i.v. with either ADicerKO exosomes (KO+exoKO) or ADicerKO exosomes electroporated with miR-99b (KO+exomiR99b). (n=3 per group, p=0.027, Kruskal Wallis ANOVA, significant comparison WT+exoKO vs KO+exoKO, Dunn's post hoc test). Error bars represent SEM.

[0033] FIGS. 5A, 5B, 5C, 5D, 5E, 5F, and 5G show that BAT-derived exosomes expressing human-specific miRNA miR-302f target their reporter in liver of mice in vivo. (a) Protocol 1. C57Bl/6 mice were injected with an adenovirus bearing pre-miR-302f or an adenovirus bearing LacZ as control directly into BAT. This miRNA is human specific and does not have a mouse homolog. 8 days later, the same mice were injected i.v. with an adenovirus bearing the 3-UTR of this miR-302f in-frame with the Luciferase gene, thereby allowing expression of this human reporter in the liver of the mouse. Only if there is a communication between the BAT produced miRNA and the liver would suppression of the 302f reporter be observed. IVIS analysis was performed after 5 days. (b) C57Bl/6 mice injected i.v. with an adenovirus bearing the 3-UTR of miR-302f in frame with the luciferase gene after BAT specific injection of Ad-pre-hsa-miR-302f, or Ad-LacZ and subjected to IVIS analysis (n=4 per group). (c) Total flux measurements of luminescence obtained via IVIS analysis from C57Bl/6 mice transduced with pacAd5-hsa_miR-302f 3-UTR luciferase reporter after BAT specific injection of Ad-pre-hsa_miR-302f, or Ad-LacZ. (n=4 per group, p=0.028, Mann-Whitney U test). (d) Protocol 2. To assess exosomal contribution of miR-302f suppression into the liver, two separate cohorts of C57Bl/6 mice were generated: one cohort with the adenovirus bearing pre-miR-302f or LacZ as control directly into BAT (donor cohort) and a second cohort transduced in the liver with the adenovirus containing the 3-UTR of this miR-302f (acceptor cohort). Serum was obtained from the donor cohort on days 3 and 6 and at a terminal bleed on day 8, exosomes were isolated and injected i.v. into the acceptor mice. IVIS analysis was performed on the acceptor mice. (e) C57Bl/6 mice transduced with pacAd5-hsa_miR-302f 3-UTR luciferase reporter after serum exosome i.v. injections from Ad-pre-hsa_miR-302f or Ad-LacZ BAT injected mice and subjected to IVIS analysis (n=4 per group). (f) Total flux measurement of luminescence obtained from IVIS analysis from C57Bl/6 mice transduced with pacAd5-hsa_miR-302f 3-UTR luciferase reporter serum exosome i.v. injections from Ad-pre-hsa_miR-302f or Ad-LacZ BAT injected mice (n=4 per group, p=0.028, two-tailed Mann-Whitney U test). Error bars represent SEM (g) Model of mechanism by which adipose tissue derived exosomal miRNAs in the circulation might regulate target mRNAs in various tissues.

[0034] FIGS. 6A, 6B, 6C, 6D, 6E, 6F, 6G, 6H, 6I, and 6J show characterization of samples from ADicerKO mice and human patients with lipodystrophies. (a) Electron microscopy of exosomes isolated from ADicerKO serum by differential centrifugation. (b) EXOCET ELISA assay (BioCat, Cat#EXOCET96A-1-SBI) measuring cholestererylester transfer protein (CETP) protein in exosome samples, corresponding to isolated exosome number from serum of ADicerKO (KO) or littermate mice (Lox). (c) qNano assay (IZON) measuring exosome numbers and size based on Tunable Resistive Pulse Sensing technology from exosome preparations from ADicerKO or Lox mice. (d) Principle Component Analysis of exosomal miRNA levels in ADicerKO (KO) and Lox (WT), n=4 per group. (e) Heatmap showing Z-scores of miRNA expression measurements from whole serum ADicerKO (KO) or littermate wild type mice (WT) and exosomal miRNAs from ADicerKO (KO) or littermate wild type mice (WT) (n=4 per group). (f) Heatmap showing Z-scores of miRNA expression measurements of exosomal miRNAs from culture supernatant of Dicer.sup.fl/fl preadipocytes transduced with Ad-GFP (GFP) or Ad-CRE (CRE) (n=3 per group). (g) Heatmap showing Z-scores of miRNA expression measurements of exosomal miRNAs from serum of 4-week old ADicerKO (ADicerKO) and Lox (Control) mice (n=3 per group). (h) Demographic information of human patients with HIV lipodystrophy (HIV), congenital generalized lipodystrophy (CGL) or normal subjects. (i) EXOCET ELISA assay measuring CETP protein as a measure of exosome number from isolated from human sera of individuals with HIV Lipodystrophy, congenital generalized lipodystrophy (CGL) and control subjects (n=4 per group). (j) Principle Component Analysis of exosomal miRNA expression in HIV Lipodystrophy, CGL, and control subjects, n=4 per group. Error bars represent SEM.

[0035] FIGS. 7A, 7B, 7C, 7D, and 7E show characterization of effects of adipose tissue transplants on circulating exosomal miRNAs and physiological responses in the recipient. (a) Principle Component Analysis of miRNA expression in mouse fat depots: epididymal (Epi), inguinal (Ing), and brown adipose tissue (BAT), n=4 per group. (b) Weights of the transplanted epididymal (Epi), inguinal (Ing), and brown adipose tissue (BAT) at time of transplantation into ADicerKO mice and at time of sacrifice, n=3-4. (c) Weights of ADicerKO mice undergoing sham surgery (Sal) or with transplanted epididymal (Epi), inguinal (Ing), or brown adipose tissue (BAT) and Lox (WT) mice. (d) Principle component analysis of variance of serum exosomal miRNA levels in ADicerKO after sham surgery or transplantation with inguinal fat, with epididymal fat or BAT, and Lox controls, n=4 per group. (e) Circulating insulin, interleukin 6 (IL-6), leptin, and adipokine levels in WT, ADicerKO, or transplanted ADicerKO mice (n=3-4 per group, two-tailed t-test, p<0.05). Error bars represent SEM.

[0036] FIGS. 8A, 8B, 8C, 8D, and 8E show profiles of selected miRNAs. (a) FGF21 mRNA levels as assessed by qPCR in liver (LIV), BAT, inguinal (Ing), epididymal (Epi), pancreas (Panc), kidney (Kidn), and quadriceps muscle (Quad) of ADicerKO (black bars) or Lox (white bars) (n=4 per group, p=0.0286, two-tailed Mann Whitney U test). (b) Relative abundance (log2FC) as assessed by qPCR of miR-99a, miR-99b, and miR-100 in exosomes from ADicerKO undergoing fat transplantation surgery compared to sham, n=4 per group. (c) FGF21 3UTR luciferase activity in murine liver cells (AML-12) following introduction of miR-99a, miR-99b, miR-100 or miR-466i (10 nM of miRNA mimic) by direct electroporation (n=3 per group, p=0.003, two-tailed t-test). (d) FGF21 mRNA abundance in murine liver cells (AML-12) following transduction with miRNA mimics of miR-99a, miR-99b, miR-100 or miR-466i (10 nM) (n=3 per group, p=0.037, two tailed t-test). (e) Hepatic FGF21 mRNA levels by qPCR followed by 48 hrs incubation of AML-12 hepatic cells with exosomes derived from ADicerKO or Lox littermates (WT) mice or with ADicerKO-isolated exosomes electroporated with 10 nM of miR-99a, miR-99b, miR-100 or miR-466i (n=3 per group, p=0.0001, two-tailed t-test). Error bars represent SEM.

[0037] FIGS. 9A, 9B, and 9C show (a) qPCR of mature miR-16, miR-201, and miR-222 in liver of Lox mice (WT), ADicerKO mice (KO), and ADicerKO transplanted with BAT (KO+BAT) (n=3 per group, p=0.02 for miR-16, p=0.002 for miR-201, and p=0.028 for miR-222; one-way Analysis of variance. Significant comparisons were identified by Tukey's multiple comparisons test). (b) qPCR of pre-miR-16, pre-miR-201, and pre-miR-222 abundance in liver of Lox mice (WT), ADicerKO mice (KO), and ADicerKO transplanted with BAT (KO+BAT) (n=3 per group, p<0.05, one-way analysis of variance). (c) CT values of qPCR of Adenoviral DNA isolated from BAT-p1 and liver-p1 (experimental protocol 1) and liver-p2 (experimental protocol 2) detecting Adenoviral LacZ or pre-miR-302f (n=4 per group). Error bars represent SEM.

DESCRIPTION OF THE SEQUENCES

[0038] Table 10 provides a listing of certain sequences referenced herein.

TABLE-US-00001 TABLE10 DescriptionoftheSequences SEQ ID Description Sequences NO Ad-pre- gatttaaatcggactgaattcctgggttccttggggaggagggggccggggg 1 hsa_miR- cccggactcctgggtcctggcacccacccgtagaaccgaccttgcggggcct 302f tcgccgcacacaagctcgtgtctgtgggtccgtgtcgggggctcaccatcgc ggctgggacctccccggccctccccacccctcgag Ad-LacZ accatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaa 2 accctggcgttacccaacttaatcgccttgcagcacatccccctttcgccag ctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgc agcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgc cggaaagctggctggagtgcgatcttcctgaggccgatactgtcgtcgtccc ctcaaactggcagatgcacggttacgatgcgcccatctacaccaacgtaacc tatcccattacggtcaatccgccgtttgttcccacggagaatccgacgggtt gttactcgctcacatttaatgttgatgaaagctggctacaggaaggccagac gcgaattatttttgatggcgttaactcggcgtttcatctgtggtgcaacggg cgctgggtcggttacggccaggacagtcgtttgccgtctgaatttgacctga gcgcatttttacgcgccggagaaaaccgcctcgcggtgatggtgctgcgttg gagtgacggcagttatctggaagatcaggatatgtggcggatgagcggcatt ttccgtgacgtctcgttgctgcataaaccgactacacaaatcagcgatttcc atgttgccactcgctttaatgatgatttcagccgcgctgtactggaggctga agttcagatgtgcggcgagttgcgtgactacctacgggtaacagtttcttta tggcagggtgaaacgcaggtcgccagcggcaccgcgcctttcggcggtgaaa ttatcgatgagcgtggtggttatgccgatcgcgtcacactacgtctgaacgt cgaaaacccgaaactgtggagcgccgaaatcccgaatctctatcgtgcggtg gttgaactgcacaccgccgacggcacgctgattgaagcagaagcctgcgatg tcggtttccgcgaggtgcggattgaaaatggtctgtgctgctgaacggcaag ccgttgctgattcgaggcgttaaccgtcacgagcatcatcctctgcatggtc aggtcatggatgagcagacgatggtgcaggatatcctgctgatgaagcagaa caactttaacgccgtgcgctgttcgcattatccgaaccatccgctgtggtac acgctgtgcgaccgctacggcctgtatgtggtggatgaagccaatattgaaa cccacggcatggtgccaatgaatcgtctgaccgatgatccgcgctggctacc ggcgatgagcgaacgcgtaacgcgaatggtgcagcgcgatcgtaatcacccg agtgtgatcatctggtcgctggggaatgaatcaggccacggcgctaatcacg acgcgctgtatcgctggatcaaatctgtcgatccttcccgcccggtgcagta tgaaggcggcggagccgacaccacggccaccgatattatttgcccgatgtac gcgcgcgtggatgaagaccagcccttcccggctgtgccgaaatggtccatca aaaaatggctttcgctacctggagagacgcgcccgctgatcctttgcgaata cgcccacgcgatgggtaacagtcttggcggtttcgctaaatactggcaggcg tttcgtcagtatccccgtttacagggcggcttcgtctgggactgggtggatc agtcgctgattaaatatgatgaaaacggcaacccgtggtcggcttacggcgg tgattttggcgatacgccgaacgatcgccagttctgtatgaacggtctggtc tttgccgaccgcacgccgcatccagcgctgacggaagcaaaacaccagcagc agtttttccagttccgtttatccgggcaaaccatcgaagtgaccagcgaata cctgttccgtcatagcgataacgagctcctgcactggatggtggcgctggat ggtaagccgctggcaagcggtgaagtgcctctggatgtcgctccacaaggta aacagttgattgaactgctgaactaccgcagccggagagcgccgggcaactc tggctcacagtacgcgtagtgcaaccgaacgcgaccgcatggtcagaagccg ggcacatcagcgcctggcagcagtggcgtctggcggaaaacctcagtgtgac gctccccgccgcgtcccacgccatcccgcatctgaccaccagcgaaatggat ttttgcatcgagctgggtaataagcgttggcaatttaaccgccagtcaggct ttctttcacagatgtggattggcgataaaaaacaactgctgacgccgctgcg cgatcagttcacccgtgcaccgctggataacgacattggcgtaagtgaagcg acccgcattgaccctaacgcctgggtcgaacgctggaaggcggcgggccatt accaggccgaagcagcgttgttgcagtgcacggcagatacacttgctgatgc ggtgctgattacgaccgctcacgcgtggcagcatcaggggaaaaccttattt atcagccggaaaacctaccggattgatggtagtggtcaaatggcgattaccg ttgatgttgaagtggcgagcgatacaccgcatccggcgcggattggcctgaa ctgccagctggcgcaggtagcagagcgggtaaactggctcggattagggccg caagaaaactatcccgaccgccttactgccgcctgttttgaccgctgggatc tgccattgtcagacatgtataccccgtacgtcttcccgagcgaaaacggtct gcgctgcgggacgcgcgaattgaattatggcccacaccagtggcgcggcgac ttccagttcaacatcagccgctacagtcaacagcaactgatggaaaccagcc atcgccatctgctgcacgcggaagaaggcacatggctgaatatcgacggttt ccatatggggattggtggcgacgactcctggagcccgtcagtatcggcggaa ttccagctgagcgccggtcgctaccattaccagtttctggtgtcaaaaataa taacggctgccgt Ad-Luc-miR- gatttaaatcatggaagacgccaaaaacataaagaaaggcccggcgccattc 3 302f-3UTR tatccgctggaagatggaaccgctggagagcaactgcataaggctatgaaga gatacgccctggttcctggaacaattgcttttacagatgcacatatcgaggt ggacatcacttacgctgagtacttcgaaatgtccgttcggttggcagaagct atgaaacgatatgggctgaatacaaatcacagaatcgtcgtatgcagtgaaa actctcttcaattctttatgccggtgttgggcgcgttatttatcggagttgc agttgcgcccgcgaacgacatttataatgaacgtgaattgctcaacagtatg ggcatttcgcagcctaccgtggtgttcgtttccaaaaaggggttgcaaaaaa ttttgaacgtgcaaaaaaagctcccaatcatccaaaaaattattatcatgga ttctaaaacggattaccagggatttcagtcgatgtacacgttcgtcacatct catctacctcccggttttaatgaatacgattttgtgccagagtccttcgata gggacaagacaattgcactgatcatgaactcctctggatctactggtctgcc taaaggtgtcgctctgcctcatagaactgcctgcgtgagattctcgcatgcc agagatcctatttttggcaatcaaatcattccggatactgcgattttaagtg ttgttccattccatcacggttttggaatgtttactacactcggatatttgat atgtggatttcgagtcgtcttaatgtatagatttgaagaagagctgtttctg aggagccttcaggattacaagattcaaagtgcgctgctggtgccaaccctat tctccttcttcgccaaaagcactctgattgacaaatacgatttatctaattt acacgaaattgcttctggtggcgctcccctctctaaggaagtcggggaagcg gttgccaagaggttccatctgccaggtatcaggcaaggatatgggctcactg agactacatcagctattctgattacacccgagggggatgataaaccgggcgc ggtcggtaaagttgttccattttttgaagcgaaggttgtggatctggatacc gggaaaacgctgggcgttaatcaaagaggcgaactgtgtgtgagaggtccta tgattatgtccggttatgtaaacaatccggaagcgaccaacgccttgattga caaggatggatggctacattctggagacatagcttactgggacgaagacgaa cacttcttcatcgttgaccgcctgaagtctctgattaagtacaaaggctatc aggtggctcccgctgaattggaatccatcttgctccaacaccccaacatctt cgacgcaggtgtcgcaggtcttcccgacgatgacgccggtgaacttcccgcc gccgttgttgttttggagcacggaaagacgatgacggaaaaagagatcgtgg attacgtcgccagtcaagtaacaaccgcgaaaaagttgcgcggaggagttgt gtttgtggacgaagtaccgaaaggtcttaccggaaaactcgacgcaagaaaa atcagagagatcctcataaaggccaagaagggcggaaagatcgccgtgtaat tctaaaacatggaagcaattaatcgaaacatggaagcaattagagggcccta ttctatagtgtcacctaaatgctagagctcgctgatcagcctcgactgtgcc ttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgacc ctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcat cgcattgtctgagtaggtgtcattctattctggggggtggggtggggcagga cagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtg ggctctatggctcgag Ad-Luc- atggaagacgccaaaaacataaagaaaggcccggcgccattctatccgctgg 4 FGF21-3UTR aagatggaaccgctggagagcaactgcataaggctatgaagagatacgccct ggttcctggaacaattgcttttacagatgcacatatcgaggtggacatcact tacgctgagtacttcgaaatgtccgttcggttggcagaagctatgaaacgat atgggctgaatacaaatcacagaatcgtcgtatgcagtgaaaactctcttca attctttatgccggtgttgggcgcgttatttatcggagttgcagttgcgccc gcgaacgacatttataatgaacgtgaattgctcaacagtatgggcatttcgc agcctaccgtggtgttcgtttccaaaaaggggttgcaaaaaattttgaacgt gcaaaaaaagctcccaatcatccaaaaaattattatcatggattctaaaacg gattaccagggatttcagtcgatgtacacgttcgtcacatctcatctacctc ccggttttaatgaatacgattttgtgccagagtccttcgatagggacaagac aattgcactgatcatgaactcctctggatctactggtctgcctaaaggtgtc gctctgcctcatagaactgcctgcgtgagattctcgcatgccagagatccta tttttggcaatcaaatcattccggatactgcgattttaagtgttgttccatt ccatcacggttttggaatgtttactacactcggatatttgatatgtggattt cgagtcgtcttaatgtatagatttgaagaagagctgtttctgaggagccttc aggattacaagattcaaagtgcgctgctggtgccaaccctattctccttctt cgccaaaagcactctgattgacaaatacgatttatctaatttacacgaaatt gcttctggtggcgctcccctctctaaggaagtcggggaagcggttgccaaga ggttccatctgccaggtatcaggcaaggatatgggctcactgagactacatc agctattctgattacacccgagggggatgataaaccgggcgcggtcggtaaa gttgttccattttttgaagcgaaggttgtggatctggataccgggaaaacgc tgggcgttaatcaaagaggcgaactgtgtgtgagaggtcctatgattatgtc cggttatgtaaacaatccggaagcgaccaacgccttgattgacaaggatgga tggctacattctggagacatagcttactgggacgaagacgaacacttcttca tcgttgaccgcctgaagtctctgattaagtacaaaggctatcaggtggctcc cgctgaattggaatccatcttgctccaacaccccaacatcttcgacgcaggt gtcgcaggtcttcccgacgatgacgccggtgaacttcccgccgccgttgttg ttttggagcacggaaagacgatgacggaaaaagagatcgtggattacgtcgc cagtcaagtaacaaccgcgaaaaagttgcgcggaggagttgtgtttgtggac gaagtaccgaaaggtcttaccggaaaactcgacgcaagaaaaatcagagaga tcctcataaaggccaagaagggcggaaagatcgccgtgtaattctactcttc ctgaatctagggctgtttctttttgggtttccacttatttattacgggtatt tatcttatttatttattttagtttttttttcttacttggaataataaagagt ctg

DETAILED DESCRIPTION

[0039] We herein describe that fat-derived exosomes carrying miRNA target the liver in vivo and can affect hepatic gene expression. Exogenous miRNA expressed in brown adipose tissue (BAT) regulates mRNA expression in liver. Fat-derived exosomes may therefore be a delivery systems suitable for small RNAs as well as small proteins. Furthermore, in order to add to the specificity and to possibly eliminate uptake from other tissues altogether, fat-derived exosomes can be modified by adding a dual ligand system which may be tethered to the exosomal membrane.

[0040] Definitions

[0041] Adipose tissue as used herein is equivalent to fat and may be used interchangeably. Adipose tissue refers to any tissue that is composed mainly of adipocytes. Adipose tissue includes white fat, beige fat, and brown fat.

[0042] Exosomes as used herein are membrane-surrounded, cell-derived vesicles that are present in many biological fluids, including blood, urine, and cultured medium of cell cultures. Exosomes may also be referred to as secreted vesicles.

[0043] Lipodystrophy as used herein refers to abnormal or degenerative conditions of the body's adipose tissue. As such, lipoatrophy (or loss of fat) is included in the definition of a lipodystrophy. Lipodystrophy may be congenital or may be secondary to a precipitating condition, such as human immunodeficiency (HIV) lipodystrophy.

[0044] miRNA as used herein refers to small non-coding RNA molecules that are evolutionary conserved. miRNAs are naturally occurring in an organism. Alternatively, a miRNA may be designed artificially and not be present in any organism. An miRNA may be chemically modified to improve stability. A miRNA may affect RNA silencing and post-transcriptional regulation of gene expression.

[0045] Protein as used herein, is a protein, polypeptide, or peptide. As such, a protein as used in this application may refer to only a portion of a full-length protein that is the product of a gene.

I. Compositions

[0046] a. Exosomes

[0047] In some embodiments, the invention comprises exosomes comprising miRNA. In some embodiments, the exosomes further comprise a targeting moiety, wherein the targeting moiety is not native to the exosome.

[0048] In some embodiments, the exosomes are isolated from human or animal subjects. In some embodiments, the exosomes are produced by cells in vitro. In some embodiments, the isolated exosomes are formed inside the cell in compartments known as multivesicular endosomes (MVE) or multivesicular body (MVB). In some embodiments, exosomes are released from a cell without a trigger or signal. In some embodiments, exosomes are released from a cell based on a signal, such as binding of a cell-surface receptor. Exosomes may be harvested from a human or animal subject and engineered ex vivo to comprise on or more miRNA and/or one or more non-native targeting moiety.

[0049] In some embodiments, exosomes are approximately 30 to 100 nm, 20 to 90 nm, 30 to 80 nm, 40 to 70 nm, or 50 to 60 nm. In some embodiments, exosomes are approximately 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, or 200 nm in size.

[0050] In some embodiments, the exosome isolated from an in vivo or in vitro cell source is modified to increase or decrease its size, to comprises one or more targeting moieties, or to comprise one or more miRNA.

[0051] Sometimes, exosomes are internalized by the same cell from which they originated. In some embodiments, exosomes interact with cells that are not the cell from which they originated. In some embodiments, exosomes are internalized by a cell that is different than the one from which they originated. In some embodiments, exosomes are vesicles for transfer of materials between cells. In some embodiments, exosomes are vesicles for transfer of materials between tissues or organs based on movement through the blood. In some embodiments, exosomes secreted by fat can travel through the blood and be taken up by the liver.

[0052] In some embodiments, exosomes play active roles in intercellular communication. In some embodiments, exosomes enable cell-cell crosstalk. In some embodiments, exosomes contain membrane-bound molecules essential for cell-to-cell signaling. In some embodiments, exosomes contain functional immune agents.

[0053] 1. Fat-Derived Exosomes

[0054] In some embodiments, the exosome compositions of the invention are derived from adipose tissue. In some embodiments, exosomes secreted from fat or adipose tissue may be termed fat-derived exosomes. In some embodiments, this adipose tissue can be inguinal, epididymal, or brown adipose tissue (BAT). In some embodiments, this adipose tissue can be brown fat, beige fat, or white fat.

[0055] In some embodiments, an exosome is derived from BAT tissue. In some embodiments, BAT is characterized by numerous small lipid droplets and a higher concentration of mitochondria compared with white fat. In some embodiments, BAT occurs in high concentrations in certain anatomical locations, such as between the shoulder blades, surrounding the kidneys, the neck and supraclavicular area, and along the spinal cord. In some embodiments, BAT occurs in the upper chest and neck, especially paravertebrally.

[0056] In some embodiments, exosomes derived from fat are taken up by the liver.

[0057] In some embodiments, circulating exosomal miRNAs are used for diagnosing disorders affecting fat mass and metabolism. In some embodiments, the disorders affecting fat mass and metabolism are obesity, cachexia, diabetes, and insulin resistance.

[0058] b. Targeting Moieties

[0059] Targeting moieties are molecules that have specific binding or affinity for a particular molecular target. In some embodiments, a targeting moiety is conjugated to an exosome, wherein the targeting moiety acts as a guide for that exosome to travel to an organ, tissue, or cell that comprises the molecular target. In some embodiments, targeting moieties and/or molecular target may be proteins. In some embodiments, molecular targets may be proteins, such receptors expressed on the cell surface of tissues or organs. In some embodiments, targeting moieties may be a full-length or fragment of a ligand for a cell surface receptor. In some embodiments, the targeting moiety is not native to the exosome, i.e., the targeting moiety is not found on the exosome in nature and is added to the exosome.

[0060] In some embodiments, the targeting moiety is expressed on the surface of the exosome. In some embodiments, the targeting moiety is a transmembrane protein. In some embodiments, the targeting moiety is internally expressed and becomes expressed on the surface of the exosome after a targeting event.

[0061] An exosome which has been conjugated to a targeting moiety may be referred to herein as a conjugated exosome.

[0062] In some embodiments, conjugated exosomes are taken up by cells in a target tissue based on a specific interaction of the targeting moiety with a molecular target in the target tissue.

[0063] In some embodiments, the molecular target is chosen based on its pattern of tissue expression. In some embodiments, the molecular target has high expression in some tissues, with substantially lower expression in other tissues. In some embodiments, the molecular target has high expression in only one tissue. In some embodiments, the molecular target is chosen to direct an exosome to a specific target tissue(s). In some embodiments, this specific target tissue is liver, brain, muscle, bone, heart, brain, kidney, lung, placenta, peripheral neurons, kidney or tumors of a variety of types.

[0064] In some embodiments, the molecular target has widespread expression. In some embodiments, the molecular target is expressed in more than one target tissue. In some embodiments, the molecular target is used to produce widespread delivery of exosomes to a variety or organs and tissues.

TABLE-US-00002 TABLE 9 Example of Exosomal Targeting Moieties, Target Tissues, and Engineered Exosomal Priming Targeting Moiety Target Tissue of Molecular Target Conjugated to Exosomal Exosomes in Target Tissue Exosome Priming Liver (normal) N- Asialoglycoprotein miR-122, miR- acetylgalactosamine Receptor (ASGPR) 19a, miR-19b, (Gal-N-Ac) surface conjugated to miR-192,and protein in liver myristoylated TyA miR-128-3p and sequence to ensure administer them sorting into exosomes into patients with Liver Toll-Like Receptor Toll-Like Receptor 4 non alcoholic (overrepresented in 4 (TLR-4) ligand (TLR-4 ligand) fatty liver liver in conditions of conjugated to disease. non-alcoholic fatty myristoylated TyA liver disease- sequence to ensure NAFLD) sorting into exosomes Liver (hepatocellular Alpha Fetoprotein Alpha Fetoprotein inhibitors of carcinoma) (AFP) Receptor (Recaf) miRNAs conjugated to (antagomirs) for myristoylated TyA miR-16, miR- sequence to ensure 34a, miR-122, sorting into exosomes RNAi against Cyclin G1 and PAK4 Brain (normal) DNER Notch Receptor miR-155 (Delta/Notch-like conjugated to targeting - EGF-related myristoylated TyA synuclein, or receptor) sequence to ensure RNAi against - sorting into exosomes synuclein Brain Adenosine A2A CGS-21680 Receptor (overrepresented in receptor analogue conjugated to brain in conditions myristoylated TyA of neurodegenerative sequence to ensure diseases) sorting into exosomes Kidney (normal) Parathyroid Parathyroid hormone miR-17 targeting Hormone 1 (PTH- receptor 1 (PTHR1) PKD-2 in patients 1) conjugated to with polycystic myristoylated TyA kidney disease sequence to ensure sorting into exosomes Kidney Neurotactin Fractalkine receptor (overrepresented in (CX3CL1) (CX3CR1) conjugated kidney in conditions to myristoylated TyA of sequence to ensure glomerulonephritis) sorting into exosomes

[0065] Additional targeting moieties and molecular targets are known to those skilled in the art, and the present invention is not limited by the specific choice of targeting moiety(ies) and target(s).

[0066] In some embodiments, the targeting moiety is a ligand that binds to membrane receptors at the target. In some embodiments, the targeting moiety is one or more of Asialoglycoprotein Receptor (ASGPR), Toll-Like Receptor 4 ligand (TLR-4 ligand), Notch, CGS-21680, Parathyroid hormone receptor 1 (PTHR1), and Fractalkine receptor (CX3CR1).

[0067] In some embodiments, antibody targeting is comprised. In some embodiments, antibodies bind to specific cell surface proteins.

[0068] In some embodiments, the GalNAc ligand and the TLR4 ligand are proceeded by a TyA myristoylated peptide to target these proteins into the MVB and to the produced exosomes.

[0069] In some embodiments, the targeting moiety(ies) are expressed on the surface of the exosome by expressing a targeting moiety as a fusion protein together with an exosomal transmembrane protein, as described in WO2013084001. In some embodiments, the fusion protein is incorporated into the exosome as it is formed based on the known association of the exosomal transmembrane protein with exosomes.

[0070] In some embodiments, more than one targeting moiety is used.

[0071] In some embodiments, exosomes are used that lack targeting moieties.

[0072] c. Contents of Exosomes

[0073] Exosomes can act as messenger molecules that transport materials from one tissue to another. In some embodiments, naturally-occurring exosomes comprise proteins, lipids, and genetic material. In some embodiments, the genetic material is RNA or DNA. In some embodiments, exosomes contain cytoplasm and cytoplasmic contents of the cell from which they were secreted.

[0074] In some embodiments, exosomes are used to deliver exogenous cargo. In some embodiments, exosomes are used as a delivery system. In some embodiments, exosomes are used as a delivery system for therapeutic agents.

[0075] In some embodiments, the cargo delivered by exosomes is a nucleic acid. In some embodiments, the nucleic acid may comprise one or more chemical modifications that improve the stability of the nucleic acid. In some embodiments, the nucleic acid is a small interfering RNA (siRNA), short hairpin (shRNA), or micro RNA (miRNA). In some embodiments, the nucleic acid is miRNA. In some embodiments, the nucleic acid is long noncoding RNA (LNCRNA). In some embodiments, the LNCRNA is longer than 200 nucleotides. In some embodiments, the RNA is less than 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, or 3000 nucleotides.

[0076] In some embodiments, the miRNA comprises a native sequence that is present in the subject organism. In some embodiments, the miRNA does not comprise a native sequence. In some embodiments, the miRNA is non-natural.

[0077] In some embodiments, the miRNA is non-naturally prepared ex vivo. In some embodiments, the miRNA alters gene function.

[0078] In some embodiments, exosomes are loaded in vitro. In some embodiments, exosomes are loaded by electroporation in vitro. In some embodiments, electroporation loads exosomes with non-natural RNA interference or proteins.

[0079] In some embodiments, fat-derived exosomes facilitate delivery of targeting moieties to diseased tissues in order to knockdown critical genes in disease pathology or pathogenesis. In some embodiments, fat-derived exosomes knockdown fibrosis genes in the diseased liver. In some embodiments, fat-derived exosomes knockdown genes contributing to the growth of cancers or tumor cells.

[0080] In some embodiments, exosomes are loaded with clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR associated proteins (Cas). In some embodiments, the Cas is Cas9. In some embodiments, the exosome is loaded with RNA and CRISPR-Cas9 proteins as part of a ribonucleoprotein complex. In some embodiments, the CRISPR-Cas9 ribonucleoprotein complex can regulate gene editing. In some embodiments, the CRISPR-Cas9 ribonuclear complex comprises a guide RNA sequence that targets a specific location in the subject's genome. In some embodiments, the guide RNA of the CRISPR-Cas9 targets specific cells and specific genomic regions.

[0081] In some embodiments, designer exosomes, also known as custom engineered exosomes, are comprised. In some embodiments, designer exosomes comprise exosomes with custom RNA cargo. In some embodiments, exosomes are transfected, a process that may be termed exofection. In some embodiments, a commercially available exofection system is used, for example the Exo-Fect (SBI) or XMIR (BioCat) systems.

[0082] In some embodiments, designer exosomes are developed using commercially systems to package a protein of interest. In some embodiments, designer exosomes are generated using the XPack exosome protein engineering system (SBI). In some embodiments, a specific peptide sequence targets a protein of interest to the interior exosomal membrane allowing the fusion protein to be packaged into exosomes.

II. Methods and Uses

[0083] a. Preparation of Fat-Derived Exosomes

[0084] In some embodiments, autologous exosomes are prepared. Autologous exosomes refers to exosomes that are prepared from the same subject who would receive the exosomes after ex vivo manipulation.

[0085] In some embodiments, exosomes are prepared from adipose tissue. In some embodiments, exosomes are prepared from BAT or WAT. In some embodiments, BAT or WAT adipocytes and precursors can be isolated from surgical or needle biopsies and used in vitro following transfection with a miRNA expressing vector. In some embodiments, the isolated exosomes are readministered or the adipocytes or preadipocytes transplanted back into patients for in vivo administration.

[0086] b. Use of Fat-Derived Exosomes as Treatments

[0087] In some embodiments, heterologous exosomes are prepared. Heterologous exosomes refer to exosomes that are prepared from a different individual than the subject who receives the exosomes after ex vivo manipulation.

[0088] In some embodiments, the subject who receives heterologous exosomes is a subject with a disease, disorder, or condition. In some embodiments, administration of heterologous exosomes is a treatment for a disease, disorder, or condition.

[0089] In some embodiments, administration of heterologous exosomes is a treatment for a lipodystrophy. In some embodiments, administration of heterologous exosomes is a treatment for HIV lipodystrophy or CGL.

[0090] In some embodiments, administration of heterologous exosomes alters the miRNA profile of subjects with a lipodystrophy. In some embodiments, administration of heterologous exosomes alters the miRNA profile of subjects with HIV lipodystrophy or CGL.

[0091] In some embodiments, administration of heterologous exosomes is used as a treatment for a metabolic disorder. In some embodiments, the metabolic disorder is fatty liver disease.

[0092] c. Packaging of miRNA into Fat-Derived Exosomes

[0093] miRNAs and other related RNAs, including mRNAs, may be packaged into fat-derived exosomes in a number of ways. In some embodiments, commercially available motifs can be used to package miRNA into exosomes, such as XMotif (System Biosciences).

[0094] In some embodiments, exosomes are loading with miRNA and other related RNAs, including mRNAs using electroporation. In some embodiments, a Biorad Gene Pulser (Biorad, Hercules, Calif.) or similar system is used for electroporation of exosomes.

[0095] d. Delivery of miRNA to a Subject by an Exosome Delivery System

[0096] In some embodiments, fat-derived exosomes can be delivered by intravenous, intraperitoneal, or subcutaneous injection. In some embodiments, the fat-derived exosomes are delivered parenterally, orally, buccally, transdermally, via sonophoresis, or via inhalation. In some embodiments, the parenteral administration is subcutaneous, intramuscular, intrasternal, or intravenous injection.

[0097] In some embodiments, fat-derived exosomes can be used for delivery of miRNA. In some embodiments, fat-derived exosomes can be used as an exosome delivery system.

[0098] In some embodiments, fat-derived exosomes can be used as an exosome delivery system to the liver. In some embodiments, fat-derived exosomes are taken up by the liver. In some embodiments, fat-derived exosomes are taken up preferentially by the liver compared to uptake by other organs. In some embodiments, the majority of fat-derived exosomes that are administered are taken up by the liver. In some embodiments, fat-derived exosomes are taken up by the liver, but may be taken up by additional organs or tissues, including tumor tissues.

[0099] In some embodiments, delivery of miRNA by an exosome delivery system is of use in treating a disease or condition. In some embodiments, the miRNA affects the expression and/or function of a protein. In some embodiments, the change in expression and/or function of a protein can be measured be any of wide range of assays known to those skilled in the art, such as changes in mRNA levels, changes in protein levels, changes in serum or plasma protein protein concentrations, changes in protein function, changes in cellular function, changes in tissue function, or changes in diagnostic tests performed in a whole subject.

[0100] In some embodiments, delivery of mir99b by an exosome delivery system can decrease expression of fibroblast growth factor 21 (FGF21).

[0101] In some embodiments, changes in expression of FGF21 following administration of mir99b by an exosomal delivery system can improve profiles of glucose and lipid metabolism, insulin sensitivity, obesity, glucose homeostasis, type 1 or type 2 diabetes, dyslipidemia, non-alcoholic fatty liver disease. FGF21 has been shown to have a broad range of effects on metabolism.

[0102] e. Target Tissue Specific Effects After Administration of Conjugated Exosomes

[0103] In some embodiments, choosing a molecular target and conjugating a corresponding targeting moiety to exosomes leads to tissue-specific delivery of exosomes. In some embodiments, choosing a molecular target and conjugating a corresponding targeting moiety to exosomes leads to relatively high uptake of conjugated exosomes by a target tissue(s), with lower uptake by other tissues. In some embodiments, choosing a molecular target and conjugating a corresponding targeting moiety to exosomes leads to exosomes being taken up at a lower rate by non-target tissues versus target tissues.

[0104] In some embodiments, administration of conjugated exosomes causes effects specifically in the target tissue. In some embodiments, administration of conjugated exosomes causes effects that are higher in the target tissue compared to other tissues. In some embodiments, administration of conjugated exosomes does not elicit an effect in non-target tissues.

[0105] This description and exemplary embodiments should not be taken as limiting. For the purposes of this specification and appended claims, unless otherwise indicated, all numbers expressing quantities, percentages, or proportions, and other numerical values used in the specification and claims, are to be understood as being modified in all instances by the term about, to the extent they are not already so modified. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0106] It is noted that, as used in this specification and the appended claims, the singular forms a, an, and the, and any singular use of any word, include plural referents unless expressly and unequivocally limited to one referent. As used herein, the term include and its grammatical variants are intended to be non-limiting, such that recitation of items in a list is not to the exclusion of other like items that can be substituted or added to the listed items.

EXAMPLES

[0107] The following examples are provided to illustrate certain disclosed embodiments and are not to be construed as limiting the scope of this disclosure in any way.

Example 1Identification of Adipose Tissue as a Major Source of Circulating Exosomal miRNAs

[0108] To better understand the role of miRNAs in fat, mice were generated specifically lacking Dicer in adipose tissue using Cre-lox mediated gene recombination (FIG. 1a).sup.13. These ADicerKO mice exhibited a generalized defect in miRNA processing in adipose tissue, which resulted in a marked reduction of WAT, whitening of BAT, insulin resistance with hyperinsulinemia, and altered circulating lipids.sup.14.

[0109] To determine to what extent adipose tissue contributes to circulating miRNAs, exosomes were isolated from sera of ADicerKO and control mice by differential ultracentrifugation.sup.15. These vesicles were 80-200 nm in diameter.sup.16 (FIG. 6a) and stained for the exosomal markers CD63 and CD9 (FIG. 1b).sup.17,18; the number of exosomes isolated from ADicerKO and control mice was comparable (FIGS. 6b and 6c). qPCR profiling of the serum exosomes for 709 known murine miRNAs revealed 653 detectable miRNAs (defined as CT<34). Compared to control, ADicerKO mice exhibited significant alterations in 422 (65.7%) circulating miRNAs. Of these, only 3 miRNAs had a significant increase, while 419 had significant decreases (FIGS. 1c-d, 6d and Table 1) with 88% reduced by >4-fold, suggesting that adipose tissue is a major source of circulating exosomal miRNAs.

[0110] FIG. 6d shows principal component analysis (PCA) of data from ADicerKO and wild-type mice for data decomposition of exosomal miRNA qPCR experiments. These data indicate that different trends were seen for KO and wild-type mice. The axes represent the fraction of total detected miRNAs in the component indicated.

[0111] Consistent with this, among these most reduced miRNAs (Table 1), many have been previously identified as highly expressed in fat, including miR-221, miR-201, miR-222 and miR-16.sup.9,19,20. This phenomenon is cell autonomous and could be reproduced in vitro. Thus, brown preadipocytes isolated from Dicer-floxed animals and recombined by transduction with Ad-Cre exhibited marked reductions in almost all of the exosomal miRNAs released in culture supernatants when compared to control Ad-GFP transduced cells (FIG. 6e).

TABLE-US-00003 TABLE 1 Exosomal miRNA significantly decreased in sera of ADicerKO mice compared to control mice. WTvsKO WTvsKO WTvsKO WTvsKO miRNA p-value logFC FC FDR mmu-miR-743b-3p 0.021 4.353 20.428 0.042 mmu-miR-2146 0.046 1.803 3.488 0.078 mmu-miR-2138 0.043 1.393 2.625 0.074 mmu-miR-760 0.040 1.155 2.227 0.071 mmu-miR-1962 0.042 1.193 2.285 0.073 mmu-miR-1945 0.030 1.233 2.350 0.056 mmu-let-7g* 0.049 1.238 2.358 0.083 mmu-miR-16 0.024 1.283 2.433 0.047 mmu-miR-434-5p 0.029 1.303 2.467 0.055 mmu-miR-376a* 0.027 1.348 2.545 0.051 mmu-miR-1190 0.027 1.383 2.607 0.052 mmu-miR-1895 0.024 1.388 2.616 0.047 mmu-miR-547 0.040 1.473 2.775 0.071 mmu-miR-466j 0.045 1.488 2.804 0.078 mmu-miR-485* 0.034 1.500 2.828 0.063 mmu-miR-145 0.013 1.543 2.913 0.029 mmu-miR-543 0.011 1.615 3.063 0.027 mmu-miR-1199 0.019 1.615 3.063 0.039 mmu-miR-378* 0.011 1.625 3.084 0.027 mmu-miR-342-3p 0.008 1.648 3.133 0.022 mmu-miR-181c 0.010 1.648 3.133 0.026 mmu-miR-710 0.050 1.655 3.149 0.084 mmu-miR-17* 0.026 1.658 3.155 0.050 mmu-miR-190 0.010 1.665 3.171 0.026 mmu-miR-24-2* 0.039 1.668 3.177 0.070 mmu-miR-1971 0.036 1.680 3.204 0.065 mmu-miR-330 0.008 1.685 3.215 0.022 mmu-miR-152 0.018 1.688 3.221 0.037 mmu-miR-30a 0.006 1.713 3.277 0.018 mmu-miR-1967 0.018 1.718 3.289 0.038 mmu-miR-1959 0.019 1.720 3.294 0.039 mmu-miR-338-3p 0.029 1.725 3.306 0.055 mmu-miR-222 0.007 1.735 3.329 0.022 mmu-miR-223 0.008 1.758 3.381 0.022 mmu-miR-23a 0.006 1.765 3.399 0.019 mmu-miR-1907 0.025 1.768 3.405 0.049 mmu-miR-351 0.004 1.805 3.494 0.015 mmu-miR-291b-5p 0.017 1.808 3.500 0.036 mmu-miR-211 0.011 1.813 3.513 0.027 mmu-miR-23b 0.003 1.815 3.519 0.011 mmu-miR-501-3p 0.003 1.818 3.525 0.012 mmu-miR-467b 0.009 1.850 3.605 0.024 mmu-miR-181d 0.044 1.860 3.630 0.077 mmu-miR-488 0.034 1.865 3.643 0.063 mmu-miR-1947 0.010 1.883 3.687 0.025 mmu-miR-15b 0.003 1.885 3.694 0.012 mmu-miR-574-3p 0.009 1.890 3.706 0.024 mmu-miR-683 0.020 1.905 3.745 0.040 mmu-miR-200a* 0.011 1.933 3.817 0.027 mmu-miR-1955 0.029 1.958 3.884 0.055 mmu-miR-1894-5p 0.011 1.965 3.904 0.027 mmu-miR-1981 0.017 1.980 3.945 0.037 mmu-miR-423-3p 0.005 1.993 3.979 0.016 mmu-miR-92a 0.005 2.005 4.014 0.017 mmu-miR-10a 0.007 2.005 4.014 0.021 mmu-miR-25 0.003 2.010 4.028 0.011 mmu-miR-713 0.007 2.013 4.035 0.020 mmu-miR-30d 0.001 2.028 4.077 0.007 mmu-miR-7a* 0.025 2.038 4.105 0.049 mmu-miR-532-3p 0.017 2.045 4.127 0.037 mmu-miR-467d* 0.018 2.045 4.127 0.038 mmu-miR-678 0.003 2.050 4.141 0.011 mmu-miR-763 0.007 2.053 4.148 0.021 mmu-miR-30c 0.003 2.055 4.155 0.011 mmu-miR-139-5p 0.001 2.065 4.184 0.006 mmu-miR-743b-5p 0.015 2.073 4.206 0.034 mmu-miR-700 0.010 2.075 4.213 0.026 mmu-miR-34c 0.003 2.095 4.272 0.012 mmu-miR-221 0.035 2.108 4.309 0.064 mmu-miR-666-5p 0.004 2.113 4.324 0.013 mmu-miR-143 0.005 2.123 4.354 0.018 mmu-miR-106a 0.001 2.143 4.415 0.007 mmu-miR-329 0.004 2.148 4.431 0.014 mmu-miR-599 0.005 2.158 4.461 0.018 mmu-miR-299* 0.002 2.178 4.524 0.009 mmu-miR-466i 0.002 2.185 4.547 0.010 mmu-miR-489 0.002 2.190 4.563 0.010 mmu-miR-1903 0.036 2.195 4.579 0.065 mmu-miR-302c* 0.011 2.200 4.595 0.027 mmu-miR-19b 0.001 2.205 4.611 0.007 mmu-miR-378 0.001 2.210 4.627 0.007 mmu-miR-466f 0.024 2.213 4.635 0.047 mmu-miR-1941-3p 0.012 2.225 4.675 0.027 mmu-miR-466f-3p 0.002 2.235 4.708 0.009 mmu-miR-330* 0.019 2.235 4.708 0.039 mmu-miR-877* 0.007 2.250 4.757 0.022 mmu-miR-218-2* 0.042 2.253 4.765 0.073 mmu-miR-216a 0.011 2.258 4.782 0.027 mmu-miR-669d 0.009 2.260 4.790 0.024 mmu-miR-33* 0.012 2.260 4.790 0.028 mmu-miR-691 0.009 2.268 4.815 0.024 mmu-miR-467a* 0.017 2.275 4.840 0.037 mmu-miR-122 0.004 2.278 4.848 0.015 mmu-miR-24 0.002 2.283 4.865 0.009 mmu-miR-667 0.014 2.283 4.865 0.033 mmu-miR-1934 0.008 2.288 4.882 0.023 mmu-miR-93 0.001 2.290 4.891 0.006 mmu-miR-770-5p 0.023 2.300 4.925 0.045 mmu-miR-669h-3p 0.002 2.318 4.985 0.009 mmu-miR-493 0.001 2.320 4.993 0.006 mmu-miR-133b 0.006 2.325 5.011 0.018 mmu-miR-30b* 0.017 2.330 5.028 0.036 mmu-miR-200b 0.031 2.335 5.046 0.058 mmu-let-7a* 0.006 2.338 5.054 0.019 mmu-miR-669f 0.008 2.338 5.054 0.022 mmu-miR-193b 0.001 2.348 5.089 0.007 mmu-miR-130a 0.001 2.355 5.116 0.006 mmu-miR-764-5p 0.008 2.358 5.125 0.023 mmu-miR-30e 0.001 2.360 5.134 0.006 mmu-miR-484 0.001 2.373 5.178 0.007 mmu-miR-15a* 0.009 2.373 5.178 0.024 mmu-miR-133a 0.004 2.375 5.187 0.015 mmu-miR-449c 0.001 2.380 5.205 0.006 mmu-miR-203 0.001 2.383 5.214 0.007 mmu-miR-466f-5p 0.004 2.390 5.242 0.014 mmu-miR-666-3p 0.013 2.395 5.260 0.030 mmu-miR-1968 0.010 2.400 5.278 0.026 mmu-miR-220 0.002 2.413 5.324 0.010 mmu-miR-669n 0.008 2.428 5.380 0.022 mmu-miR-17 0.001 2.433 5.398 0.006 mmu-miR-338-5p 0.001 2.450 5.464 0.006 mmu-miR-296-5p 0.001 2.455 5.483 0.006 mmu-miR-1982.1 0.017 2.470 5.540 0.036 mmu-miR-30e* 0.017 2.470 5.540 0.037 mmu-miR-297a 0.001 2.473 5.550 0.006 mmu-miR-483* 0.020 2.473 5.550 0.040 mmu-miR-200c* 0.003 2.483 5.589 0.011 mmu-miR-546 0.000 2.485 5.598 0.005 mmu-miR-327 0.002 2.488 5.608 0.009 mmu-miR-721 0.044 2.488 5.608 0.077 mmu-miR-20b 0.000 2.490 5.618 0.005 mmu-miR-27a 0.001 2.490 5.618 0.005 mmu-miR-126-3p 0.001 2.500 5.657 0.006 mmu-miR-335-3p 0.001 2.505 5.676 0.006 mmu-miR-22 0.001 2.523 5.746 0.005 mmu-miR-692 0.001 2.523 5.746 0.007 mmu-miR-205 0.000 2.528 5.766 0.005 mmu-miR-10b 0.001 2.530 5.776 0.005 mmu-miR-339-3p 0.001 2.565 5.918 0.007 mmu-miR-15a 0.001 2.573 5.948 0.006 mmu-miR-126-5p 0.009 2.573 5.948 0.024 mmu-miR-124 0.001 2.575 5.959 0.005 mmu-miR-1899 0.001 2.575 5.959 0.007 mmu-miR-6691 0.010 2.580 5.979 0.025 mmu-miR-1963 0.007 2.593 6.031 0.021 mmu-miR-370 0.001 2.595 6.042 0.006 mmu-miR-466e-3p 0.021 2.610 6.105 0.042 mmu-miR-452 0.001 2.615 6.126 0.006 mmu-miR-705 0.001 2.615 6.126 0.007 mmu-miR-466h 0.006 2.623 6.158 0.019 mmu-miR-540-3p 0.000 2.630 6.190 0.004 mmu-miR-19a 0.001 2.633 6.201 0.007 mmu-miR-99b 0.008 2.640 6.233 0.023 mmu-miR-451 0.000 2.645 6.255 0.004 mmu-miR-346 0.001 2.650 6.277 0.005 mmu-miR-544 0.006 2.695 6.476 0.019 mmu-miR-375 0.000 2.698 6.487 0.004 mmu-miR-494 0.001 2.703 6.509 0.007 mmu-miR-345-5p 0.000 2.715 6.566 0.004 mmu-miR-29a 0.001 2.715 6.566 0.006 mmu-miR-1306 0.017 2.723 6.600 0.037 mmu-miR-185 0.021 2.733 6.646 0.043 mmu-miR-770-3p 0.003 2.735 6.658 0.012 mmu-miR-210 0.036 2.743 6.692 0.065 mmu-miR-92b 0.000 2.745 6.704 0.004 mmu-miR-449a 0.001 2.748 6.716 0.006 mmu-miR-465b-5p 0.009 2.750 6.727 0.024 mmu-miR-129-5p 0.000 2.753 6.739 0.004 mmu-miR-206 0.004 2.763 6.786 0.013 mmu-miR-463 0.018 2.763 6.786 0.038 mmu-miR-582-3p 0.001 2.770 6.821 0.006 mmu-miR-155 0.003 2.770 6.821 0.011 mmu-miR-381 0.003 2.770 6.821 0.012 mmu-miR-297b-3p 0.000 2.773 6.833 0.004 mmu-miR-764-3p 0.001 2.785 6.892 0.006 mmu-miR-496 0.001 2.790 6.916 0.006 mmu-miR-302d 0.022 2.793 6.928 0.044 mmu-miR-1964 0.001 2.795 6.940 0.006 mmu-let-7f* 0.006 2.800 6.964 0.019 mmu-miR-429 0.001 2.803 6.976 0.006 mmu-miR-377 0.026 2.805 6.989 0.050 mmu-miR-290-5p 0.014 2.810 7.013 0.032 mmu-miR-21 0.001 2.818 7.049 0.006 mmu-miR-487b 0.001 2.828 7.098 0.006 mmu-miR-184 0.003 2.828 7.098 0.012 mmu-miR-21* 0.002 2.835 7.135 0.009 mmu-miR-685 0.000 2.838 7.148 0.005 mmu-miR-654-3p 0.009 2.838 7.148 0.023 mmu-miR-449b 0.000 2.848 7.198 0.005 mmu-miR-669i 0.019 2.848 7.198 0.039 mmu-miR-28* 0.010 2.860 7.260 0.025 mmu-miR-505 0.000 2.865 7.285 0.005 mmu-miR-151-3p 0.000 2.868 7.298 0.005 mmu-miR-30c-1* 0.031 2.868 7.298 0.058 mmu-let-7e 0.003 2.873 7.323 0.012 mmu-miR-1191 0.000 2.878 7.349 0.005 mmu-miR-615-3p 0.001 2.883 7.374 0.007 mmu-miR-30b 0.000 2.893 7.426 0.004 mmu-miR-27b 0.000 2.908 7.503 0.004 mmu-miR-450a-3p 0.005 2.918 7.555 0.017 mmu-miR-1982* 0.013 2.925 7.595 0.031 mmu-miR-675-5p 0.002 2.938 7.661 0.009 mmu-let-7c 0.002 2.938 7.661 0.010 mmu-miR-669h-5p 0.011 2.958 7.768 0.027 mmu-miR-293* 0.037 2.958 7.768 0.068 mmu-miR-188-3p 0.002 2.985 7.917 0.010 mmu-miR-470 0.003 2.995 7.972 0.011 mmu-miR-671-5p 0.002 3.003 8.014 0.008 mmu-miR-468 0.006 3.010 8.056 0.018 mmu-miR-501-5p 0.018 3.010 8.056 0.038 mmu-miR-201 0.000 3.013 8.070 0.004 mmu-miR-20a 0.000 3.020 8.112 0.004 mmu-miR-207 0.000 3.020 8.112 0.004 mmu-miR-197 0.004 3.023 8.126 0.015 mmu-miR-432 0.001 3.028 8.154 0.007 mmu-miR-696 0.000 3.035 8.196 0.004 mmu-miR-686 0.000 3.040 8.225 0.004 mmu-miR-31 0.000 3.043 8.239 0.004 mmu-miR-698 0.002 3.055 8.311 0.008 mmu-miR-668 0.000 3.075 8.427 0.004 mmu-miR-26a 0.001 3.088 8.500 0.006 mmu-miR-31* 0.030 3.098 8.559 0.057 mmu-miR-215 0.040 3.103 8.589 0.071 mmu-miR-92a* 0.040 3.118 8.679 0.071 mmu-miR-214 0.003 3.120 8.694 0.011 mmu-let-7d 0.001 3.140 8.815 0.006 mmu-miR-466g 0.000 3.143 8.831 0.005 mmu-miR-107 0.045 3.148 8.861 0.077 mmu-miR-29c 0.000 3.150 8.877 0.004 mmu-miR-18a 0.010 3.155 8.907 0.026 mmu-miR-99a 0.000 3.160 8.938 0.003 mmu-miR-455 0.003 3.175 9.032 0.012 mmu-miR-665 0.000 3.198 9.174 0.005 mmu-miR-431 0.015 3.203 9.206 0.033 mmu-miR-326 0.002 3.208 9.237 0.008 mmu-miR-34a 0.001 3.210 9.254 0.005 mmu-miR-350 0.000 3.213 9.270 0.003 mmu-miR-295* 0.018 3.213 9.270 0.038 mmu-miR-467h 0.007 3.215 9.286 0.022 mmu-miR-367 0.023 3.220 9.318 0.045 mmu-let-7b 0.002 3.233 9.399 0.010 mmu-miR-805 0.045 3.248 9.497 0.077 mmu-miR-331-5p 0.008 3.258 9.563 0.023 mmu-miR-343 0.001 3.280 9.714 0.005 mmu-miR-384-3p 0.004 3.298 9.832 0.013 mmu-miR-411 0.018 3.298 9.832 0.038 mmu-miR-217 0.000 3.308 9.900 0.004 mmu-miR-466d-3p 0.001 3.308 9.900 0.007 mmu-miR-1902 0.009 3.318 9.969 0.024 mmu-miR-141* 0.046 3.318 9.969 0.079 mmu-miR-149 0.000 3.330 10.056 0.004 mmu-miR-762 0.011 3.333 10.074 0.027 mmu-miR-448 0.040 3.345 10.161 0.071 mmu-miR-670 0.000 3.355 10.232 0.003 mmu-miR-383 0.000 3.360 10.267 0.005 mmu-miR-344 0.000 3.365 10.303 0.004 mmu-miR-361 0.001 3.368 10.321 0.006 mmu-miR-532-5p 0.004 3.388 10.465 0.015 mmu-miR-466b-3p 0.007 3.403 10.574 0.021 mmu-let-7i 0.000 3.405 10.593 0.004 mmu-miR-878-5p 0.026 3.413 10.648 0.050 mmu-miR-212 0.000 3.423 10.722 0.005 mmu-miR-680 0.019 3.423 10.722 0.039 mmu-miR-195 0.032 3.425 10.741 0.059 mmu-miR-151-5p 0.001 3.430 10.778 0.005 mmu-miR-337-5p 0.000 3.438 10.834 0.004 mmu-miR-33 0.009 3.463 11.023 0.024 mmu-miR-676 0.000 3.473 11.100 0.004 mmu-miR-16* 0.001 3.480 11.158 0.006 mmu-miR-679 0.031 3.483 11.177 0.058 mmu-miR-339-5p 0.040 3.485 11.197 0.071 mmu-miR-130b 0.001 3.488 11.216 0.005 mmu-miR-128 0.006 3.500 11.314 0.019 mmu-miR-103 0.008 3.518 11.452 0.023 mmu-miR-465c-5p 0.003 3.525 11.511 0.012 mmu-miR-26b 0.038 3.540 11.632 0.069 mmu-miR-342-5p 0.050 3.540 11.632 0.083 mmu-miR-490 0.013 3.543 11.652 0.031 mmu-miR-186 0.001 3.545 11.672 0.005 mmu-miR-702 0.000 3.550 11.713 0.004 mmu-miR-467b* 0.003 3.555 11.753 0.011 mmu-miR-500 0.000 3.560 11.794 0.003 mmu-miR-509-5p 0.007 3.583 11.980 0.021 mmu-miR-450b-3p 0.044 3.585 12.000 0.077 mmu-miR-1897-3p 0.016 3.590 12.042 0.036 mmu-miR-365 0.007 3.610 12.210 0.020 mmu-miR-325 0.000 3.643 12.488 0.004 mmu-miR-328 0.001 3.680 12.817 0.006 mmu-miR-590-3p 0.002 3.688 12.884 0.009 mmu-miR-497 0.001 3.700 12.996 0.007 mmu-miR-300 0.014 3.725 13.223 0.032 mmu-miR-453 0.009 3.765 13.595 0.024 mmu-miR-100 0.000 3.773 13.666 0.003 mmu-miR-541 0.015 3.785 13.785 0.033 mmu-miR-693-3p 0.008 3.795 13.881 0.022 mmu-miR-376c 0.014 3.805 13.977 0.033 mmu-miR-467f 0.002 3.813 14.050 0.009 mmu-miR-1198 0.002 3.823 14.148 0.009 mmu-miR-382 0.000 3.835 14.271 0.004 mmu-miR-18b 0.001 3.838 14.296 0.006 mmu-miR-423-5p 0.000 3.875 14.672 0.005 mmu-miR-1929 0.022 3.898 14.903 0.043 mmu-miR-669j 0.003 3.903 14.954 0.013 mmu-miR-181a-1* 0.038 3.935 15.295 0.069 mmu-miR-465a-5p 0.013 3.965 15.617 0.031 mmu-miR-340-3p 0.040 3.968 15.644 0.071 mmu-miR-466b-5p 0.024 3.993 15.917 0.048 mmu-miR-101b 0.011 4.005 16.056 0.027 mmu-miR-140 0.000 4.008 16.083 0.003 mmu-miR-299 0.000 4.015 16.167 0.005 mmu-miR-96 0.016 4.028 16.308 0.036 mmu-miR-134 0.000 4.048 16.536 0.005 mmu-miR-471 0.004 4.048 16.536 0.015 mmu-miR-434-3p 0.000 4.080 16.912 0.004 mmu-miR-302a 0.010 4.095 17.089 0.025 mmu-miR-297c 0.001 4.108 17.238 0.005 mmu-miR-142-5p 0.006 4.133 17.539 0.020 mmu-miR-384-5p 0.009 4.150 17.753 0.024 mmu-miR-29b 0.014 4.168 17.970 0.032 mmu-miR-467c 0.045 4.198 18.347 0.077 mmu-miR-374 0.008 4.200 18.379 0.023 mmu-miR-693-5p 0.025 4.225 18.700 0.049 mmu-miR-188-5p 0.000 4.233 18.798 0.003 mmu-miR-147 0.005 4.263 19.193 0.017 mmu-miR-28 0.004 4.268 19.260 0.015 mmu-miR-682 0.031 4.283 19.461 0.058 mmu-miR-485 0.001 4.285 19.495 0.006 mmu-miR-200a 0.009 4.288 19.528 0.024 mmu-miR-291a-5p 0.000 4.310 19.835 0.003 mmu-miR-652 0.000 4.313 19.870 0.004 mmu-miR-296-3p 0.001 4.358 20.499 0.006 mmu-miR-30c-2* 0.008 4.385 20.894 0.022 mmu-miR-199b 0.008 4.423 21.444 0.023 mmu-miR-101a* 0.002 4.433 21.593 0.009 mmu-miR-551b 0.036 4.433 21.593 0.065 mmu-miR-148b 0.000 4.450 21.857 0.003 mmu-miR-323-5p 0.000 4.450 21.857 0.003 mmu-miR-146a 0.001 4.455 21.933 0.007 mmu-miR-146b 0.001 4.553 23.466 0.005 mmu-miR-148a 0.000 4.578 23.876 0.003 mmu-miR-872 0.007 4.578 23.876 0.021 mmu-miR-669g 0.006 4.590 24.084 0.019 mmu-miR-32 0.018 4.593 24.126 0.038 mmu-miR-464 0.008 4.603 24.294 0.023 mmu-miR-380-3p 0.000 4.613 24.463 0.004 mmu-miR-1933-3p 0.012 4.613 24.463 0.028 mmu-miR-1936 0.003 4.620 24.590 0.012 mmu-miR-1898 0.009 4.625 24.675 0.024 mmu-miR-191 0.005 4.648 25.063 0.016 mmu-miR-1961 0.000 4.675 25.546 0.003 mmu-miR-654-5p 0.008 4.688 25.768 0.023 mmu-miR-466b-3-3p 0.029 4.688 25.768 0.055 mmu-miR-467e 0.033 4.710 26.173 0.060 mmu-miR-669k 0.004 4.720 26.355 0.015 mmu-miR-542-5p 0.036 4.730 26.538 0.065 mmu-miR-483 0.000 4.750 26.909 0.004 mmu-miR-186* 0.007 4.750 26.909 0.020 mmu-miR-883b-5p 0.001 4.763 27.143 0.006 mmu-miR-345-3p 0.014 4.805 27.954 0.033 mmu-miR-802 0.015 4.855 28.940 0.034 mmu-let-7a 0.000 4.880 29.446 0.003 mmu-miR-425 0.001 4.890 29.651 0.007 mmu-miR-291b-3p 0.000 4.898 29.805 0.004 mmu-miR-34b-3p 0.025 4.900 29.857 0.049 mmu-miR-138 0.002 4.903 29.909 0.008 mmu-miR-878-3p 0.007 4.925 30.379 0.022 mmu-miR-466e-5p 0.000 4.948 30.856 0.005 mmu-miR-433 0.000 4.963 31.179 0.003 mmu-miR-139-3p 0.001 5.020 32.447 0.007 mmu-miR-433* 0.041 5.028 32.616 0.073 mmu-miR-101a 0.000 5.058 33.301 0.005 mmu-miR-706 0.027 5.063 33.417 0.051 mmu-miR-410 0.001 5.093 34.119 0.005 mmu-miR-491 0.015 5.103 34.356 0.033 mmu-miR-125a-3p 0.002 5.113 34.595 0.008 mmu-miR-466a-3p 0.017 5.113 34.595 0.037 mmu-miR-218-1* 0.047 5.168 35.940 0.080 mmu-miR-412 0.003 5.208 36.950 0.012 mmu-let-7i* 0.049 5.220 37.271 0.083 mmu-miR-363 0.003 5.235 37.661 0.011 mmu-let-7f 0.004 5.258 38.253 0.013 mmu-miR-695 0.010 5.285 38.989 0.025 mmu-miR-290-3p 0.016 5.310 39.671 0.036 mmu-miR-697 0.012 5.313 39.739 0.028 mmu-miR-380-5p 0.000 5.355 40.928 0.005 mmu-miR-883b-3p 0.002 5.453 43.789 0.010 mmu-miR-323-3p 0.000 5.455 43.865 0.003 mmu-miR-568 0.003 5.480 44.632 0.012 mmu-miR-298 0.014 5.625 49.351 0.033 mmu-miR-202-3p 0.001 5.755 54.004 0.006 mmu-miR-148a* 0.011 5.840 57.282 0.027 mmu-miR-294 0.002 5.843 57.381 0.009 mmu-miR-322 0.001 5.858 57.981 0.005 mmu-miR-129-3p 0.002 5.878 58.790 0.008 mmu-miR-302b 0.002 5.910 60.129 0.010 mmu-miR-409-5p 0.000 6.000 64.000 0.003 mmu-miR-337-3p 0.002 6.020 64.893 0.009 mmu-miR-376a 0.001 6.023 65.006 0.007 mmu-miR-141 0.015 6.055 66.487 0.033 mmu-miR-466c-3p 0.004 6.078 67.532 0.015 mmu-miR-196a 0.003 6.085 67.884 0.012 mmu-miR-292-5p 0.001 6.100 68.594 0.006 mmu-miR-671-3p 0.012 6.250 76.109 0.028 mmu-miR-431* 0.045 6.263 76.772 0.077 mmu-miR-136 0.005 6.310 79.341 0.016 mmu-miR-653 0.009 6.348 81.431 0.024 mmu-miR-1 0.002 6.363 82.282 0.010 mmu-miR-194 0.020 6.373 82.854 0.040 mmu-miR-687 0.042 6.725 105.786 0.073 mmu-miR-340-5p 0.009 6.748 107.448 0.024 mmu-miR-127 0.000 6.823 113.182 0.004 mmu-miR-362-5p 0.020 7.180 145.009 0.040 mmu-miR-135b 0.006 7.325 160.341 0.019 mmu-miR-689 0.001 7.413 170.367 0.006 mmu-miR-208a 0.012 8.055 265.948 0.027 mmu-miR-98 0.000 8.670 407.315 0.003 mmu-miR-324-5p 0.000 8.815 450.380 0.003 mmu-miR-421 0.002 9.043 527.307 0.010 mmu-miR-320 0.000 9.743 856.613 0.005 mmu-miR-295 0.005 11.573 3045.577 0.018 mmu-miR-183 0.001 11.580 3061.451 0.006 mmu-miR-615-5p 0.026 13.880 15076.354 0.050 FDR = false discovery rate, * indicates star species miRNA, in which the 3-5 fragment induces the repression.

[0112] To determine if circulating exosomal miRNAs in humans might also originate from fat, exosomal miRNA profiling was performed on sera from patients with congenital generalized lipodystrophy (CGL) and patients with HIV-related lipodystrophy, who have previously been shown to have decreased levels of Dicer in adipose tissue.sup.14 (details in FIG. 6f). FIG. 6f shows expression of exosomal miRNAs from culture supernatant of Dicer.sup.fl/fl preadipocytes transduced with Ad-GFP (GFP) or Ad-CRE (CRE). Isolation yielded similar exosome numbers from both controls and lipodystrophic patients (6h, with subject groups described in 6j). Genome-wide qPCR profiling of 572 miRNAs in exosomes from human sera revealed 119 significantly different between control and HIV lipodystrophy subjects and 213 significantly different between control and CGL (FIGS. 1e-f, Tables 2 and 3).

TABLE-US-00004 TABLE 2 Serum Exosomal miRNAs in Humans with HIV Lipodystrophy HIVvsCon HIVvsCon HIVvsCon HIVvsCon miRNA p-value logFC FC FDR hsa-miR-374b 0.003 6.458 87.882 0.099 hsa-miR-101 0.003 6.385 83.575 0.099 hsa-miR-557 0.008 5.305 39.533 0.106 hsa-miR-126 0.027 5.028 32.616 0.163 hsa-miR-338-3p 0.026 4.640 24.933 0.161 hsa-miR-362-3p 0.036 4.128 17.478 0.197 hsa-miR-103 0.039 3.743 13.385 0.204 hsa-miR-19a 0.008 3.735 13.315 0.106 hsa-miR-16 0.012 3.255 9.547 0.124 hsa-miR-195 0.013 3.245 9.481 0.127 hsa-miR-21 0.015 3.230 9.383 0.132 hsa-miR-371-3p 0.035 3.165 8.969 0.194 hsa-miR-19b 0.009 3.055 8.311 0.106 hsa-miR-30a 0.038 2.235 4.708 0.204 hsa-miR-15a 0.032 2.113 4.324 0.181 hsa-miR-193a-5p 0.024 1.858 3.624 0.160 hsa-miR-483-3p 0.031 1.830 3.555 0.178 hsa-miR-631 0.044 1.843 3.586 0.225 hsa-miR-147 0.024 1.905 3.745 0.160 hsa-miR-323-3p 0.016 1.948 3.857 0.140 hsa-miR-483-5p 0.022 2.010 4.028 0.160 hsa-miR-149 0.024 2.128 4.370 0.160 hsa-miR-487b 0.045 2.183 4.539 0.231 hsa-miR-10b 0.018 2.208 4.619 0.146 hsa-miR-646 0.017 2.298 4.916 0.144 hsa-miR-671-5p 0.025 2.405 5.296 0.160 hsa-miR-802 0.049 2.455 5.483 0.237 hsa-miR-485-3p 0.009 2.468 5.531 0.106 hsa-miR-610 0.011 2.513 5.706 0.121 hsa-miR-583 0.020 2.585 6.000 0.155 hsa-miR-141 0.024 2.608 6.094 0.160 hsa-miR-767-5p 0.038 2.623 6.158 0.204 hsa-miR-222 0.008 2.650 6.277 0.106 hsa-miR-770-5p 0.004 2.683 6.420 0.099 hsa-miR-181b 0.018 2.693 6.464 0.145 hsa-miR-511 0.048 2.703 6.509 0.236 hsa-miR-648 0.024 2.728 6.623 0.160 hsa-miR-519e 0.023 2.740 6.681 0.160 hsa-miR-500 0.025 2.773 6.833 0.160 hsa-miR-509-3-5p 0.015 2.918 7.555 0.136 hsa-miR-615-3p 0.037 2.960 7.781 0.204 hsa-miR-935 0.028 2.978 7.876 0.166 hsa-miR-516a-3p 0.039 2.980 7.890 0.204 hsa-miR-422a 0.046 3.048 8.268 0.232 hsa-miR-299-5p 0.006 3.063 8.354 0.106 hsa-miR-130b 0.014 3.088 8.500 0.129 hsa-miR-885-3p 0.020 3.210 9.254 0.151 hsa-miR-920 0.012 3.243 9.464 0.124 hsa-miR-544 0.039 3.273 9.663 0.204 hsa-miR-409-5p 0.003 3.275 9.680 0.099 hsa-miR-630 0.006 3.280 9.714 0.106 hsa-miR-767-3p 0.002 3.340 10.126 0.081 hsa-miR-302e 0.006 3.423 10.722 0.106 hsa-miR-516b 0.000 3.425 10.741 0.050 hsa-miR-448 0.008 3.448 10.909 0.106 hsa-miR-106b 0.001 3.465 11.043 0.081 hsa-miR-486-3p 0.010 3.520 11.472 0.120 hsa-miR-520d-5p 0.048 3.535 11.592 0.236 hsa-miR-490-3p 0.025 3.545 11.672 0.161 hsa-miR-487a 0.007 3.550 11.713 0.106 hsa-miR-183 0.049 3.625 12.338 0.238 hsa-miR-323-5p 0.047 3.735 13.315 0.235 hsa-miR-374a 0.022 3.743 13.385 0.160 hsa-miR-875-3p 0.025 3.743 13.385 0.160 hsa-miR-518d-3p 0.019 3.788 13.809 0.151 hsa-miR-449b 0.009 3.805 13.977 0.108 hsa-miR-516a-5p 0.008 3.815 14.074 0.106 hsa-miR-140-5p 0.007 3.845 14.370 0.106 hsa-miR-449a 0.014 3.848 14.395 0.129 hsa-miR-635 0.017 3.863 14.545 0.144 hsa-miR-654-3p 0.028 3.913 15.058 0.166 hsa-miR-410 0.003 3.990 15.889 0.099 hsa-miR-501-3p 0.010 3.990 15.889 0.114 hsa-miR-508-5p 0.019 4.020 16.223 0.151 hsa-miR-657 0.014 4.113 17.298 0.129 hsa-miR-520c-3p 0.013 4.193 18.284 0.127 hsa-miR-133b 0.049 4.208 18.475 0.237 hsa-miR-889 0.021 4.235 18.831 0.158 hsa-miR-541 0.005 4.270 19.293 0.106 hsa-miR-566 0.017 4.270 19.293 0.144 hsa-miR-342-3p 0.006 4.280 19.427 0.106 hsa-miR-545 0.007 4.340 20.252 0.106 hsa-miR-554 0.008 4.378 20.785 0.106 hsa-miR-100 0.004 4.395 21.039 0.104 hsa-miR-370 0.023 4.405 21.185 0.160 hsa-miR-542-3p 0.014 4.415 21.333 0.129 hsa-miR-220c 0.006 4.485 22.393 0.106 hsa-miR-520c-5p 0.029 4.545 23.344 0.169 hsa-miR-890 0.026 4.570 23.752 0.161 hsa-miR-645 0.006 4.583 23.959 0.106 hsa-miR-603 0.018 4.638 24.890 0.147 hsa-miR-220a 0.031 4.683 25.679 0.178 hsa-miR-520e 0.008 4.713 26.218 0.106 hsa-miR-369-5p 0.005 4.733 26.584 0.106 hsa-miR-632 0.013 4.865 29.141 0.127 hsa-miR-548a-5p 0.004 4.950 30.910 0.101 hsa-miR-421 0.008 4.970 31.341 0.106 hsa-miR-539 0.013 5.028 32.616 0.127 hsa-miR-339-3p 0.008 5.475 44.477 0.106 hsa-miR-525-3p 0.002 5.543 46.608 0.081 hsa-miR-592 0.024 5.550 46.851 0.160 hsa-miR-9 0.002 5.693 51.715 0.081 hsa-miR-452 0.000 5.698 51.894 0.041 hsa-miR-365 0.001 5.773 54.663 0.080 hsa-miR-326 0.039 5.815 56.298 0.204 hsa-miR-383 0.008 5.835 57.083 0.106 hsa-miR-649 0.027 6.000 64.000 0.164 hsa-miR-29c 0.012 6.040 65.799 0.124 hsa-miR-769-5p 0.027 6.418 85.479 0.163 hsa-miR-375 0.000 6.590 96.336 0.059 hsa-miR-34c-5p 0.001 6.693 103.429 0.081 hsa-miR-346 0.004 7.050 132.514 0.099 hsa-miR-199b-5p 0.002 7.110 138.141 0.081 hsa-miR-382 0.003 7.138 140.800 0.099 hsa-miR-362-5p 0.002 7.975 251.602 0.081 hsa-miR-335 0.001 8.105 275.327 0.081 hsa-miR-224 0.004 8.718 420.949 0.101 hsa-miR-548e 0.000 9.018 518.248 0.004 hsa-miR-324-5p 0.002 9.638 796.483 0.081 FDR = false discovery rate the repression.

TABLE-US-00005 TABLE 3 Serum Exosomal miRNAs in Humans with Congenital Generalized Lipodystrophy CGLvsCon CGLvsCon CGLvsCon CGLvsCon miRNA p-value logFC FC FDR hsa-miR-190 0.037 10.825 1814.052 0.110 hsa-miR-101 0.002 6.760 108.383 0.027 hsa-miR-550 0.021 6.365 82.424 0.079 hsa-miR-126 0.010 6.085 67.884 0.055 hsa-miR-374b 0.007 5.563 47.258 0.047 hsa-miR-331- 0.028 5.455 43.865 0.092 3p hsa-miR-17 0.016 4.675 25.546 0.067 hsa-miR-19b 0.001 4.543 23.304 0.017 hsa-miR-19a 0.003 4.500 22.627 0.027 hsa-miR-337- 0.005 4.323 20.008 0.040 5p hsa-miR-557 0.026 4.228 18.733 0.089 hsa-miR-548i 0.034 3.928 15.216 0.106 hsa-miR-21 0.005 3.833 14.246 0.040 hsa-miR-20a 0.027 3.703 13.019 0.090 hsa-miR-16 0.013 3.175 9.032 0.064 hsa-miR-195 0.016 3.123 8.709 0.067 hsa-miR-367 0.014 2.735 6.658 0.065 hsa-miR-106a 0.010 2.613 6.116 0.055 hsa-miR-140- 0.005 2.598 6.052 0.040 3p hsa-miR-30a 0.021 2.543 5.826 0.079 hsa-miR-193a- 0.011 2.173 4.508 0.055 5p hsa-miR-30d 0.035 1.903 3.739 0.106 hsa-miR-450b- 0.049 1.813 3.513 0.132 5p hsa-miR-192 0.044 1.685 3.215 0.122 hsa-miR-651 0.039 1.733 3.323 0.114 hsa-miR-638 0.020 1.778 3.428 0.078 hsa-miR-720 0.020 1.840 3.580 0.077 hsa-let-7d 0.027 1.898 3.726 0.090 hsa-miR-614 0.032 1.925 3.797 0.102 hsa-miR-640 0.029 1.945 3.850 0.095 hsa-miR-135b 0.035 1.993 3.979 0.106 hsa-miR-377 0.025 2.128 4.370 0.088 hsa-miR-665 0.014 2.133 4.385 0.065 hsa-miR-937 0.017 2.158 4.461 0.068 hsa-miR-877 0.017 2.173 4.508 0.070 hsa-miR-212 0.008 2.233 4.699 0.050 hsa-miR-188- 0.014 2.270 4.823 0.065 3p hsa-miR-668 0.020 2.298 4.916 0.077 hsa-miR-933 0.015 2.300 4.925 0.067 hsa-miR-221 0.014 2.320 4.993 0.064 hsa-miR-483- 0.009 2.350 5.098 0.050 3p hsa-miR-10b 0.013 2.353 5.107 0.064 hsa-miR-188- 0.017 2.358 5.125 0.070 5p hsa-miR-610 0.014 2.390 5.242 0.065 hsa-miR-874 0.005 2.423 5.361 0.039 hsa-miR-671- 0.003 2.425 5.370 0.027 3p hsa-miR-92b 0.003 2.460 5.502 0.033 hsa-miR-125a- 0.005 2.475 5.560 0.040 3p hsa-miR-548u 0.016 2.493 5.628 0.068 hsa-miR-147 0.005 2.495 5.637 0.040 hsa-miR-493 0.008 2.518 5.726 0.050 hsa-miR-564 0.013 2.518 5.726 0.064 hsa-miR-513a- 0.050 2.535 5.796 0.133 5p hsa-miR-300 0.010 2.553 5.866 0.055 hsa-miR-507 0.025 2.593 6.031 0.087 hsa-miR-766 0.004 2.613 6.116 0.036 hsa-miR-323- 0.003 2.625 6.169 0.027 3p hsa-miR-153 0.015 2.670 6.364 0.067 hsa-miR-514b- 0.039 2.685 6.431 0.114 5p hsa-miR-659 0.006 2.693 6.464 0.041 hsa-miR-596 0.002 2.743 6.692 0.024 hsa-miR-141 0.019 2.755 6.751 0.074 hsa-miR-339- 0.010 2.760 6.774 0.055 5p hsa-miR-149 0.006 2.765 6.797 0.041 hsa-miR-485- 0.004 2.785 6.892 0.036 3p hsa-miR-802 0.028 2.795 6.940 0.092 hsa-miR-605 0.001 2.823 7.074 0.020 hsa-miR-631 0.005 2.823 7.074 0.040 hsa-miR-30b 0.014 2.865 7.285 0.065 hsa-miR-199a- 0.044 2.883 7.374 0.122 5p hsa-miR-487a 0.020 2.918 7.555 0.077 hsa-miR-623 0.021 2.923 7.582 0.078 hsa-miR-935 0.027 3.000 8.000 0.090 hsa-miR-575 0.045 3.070 8.398 0.124 hsa-miR-519e 0.013 3.080 8.456 0.064 hsa-miR-512- 0.002 3.103 8.589 0.025 3p hsa-miR-647 0.012 3.103 8.589 0.062 hsa-miR-378 0.022 3.120 8.694 0.081 hsa-miR-873 0.043 3.123 8.709 0.121 hsa-miR-147b 0.034 3.137 8.800 0.105 hsa-miR-181b 0.007 3.163 8.954 0.046 hsa-miR-518d- 0.046 3.175 9.032 0.125 5p hsa-miR-646 0.002 3.178 9.047 0.027 hsa-miR-518a- 0.036 3.223 9.334 0.106 3p hsa-miR-936 0.016 3.230 9.383 0.067 hsa-miR-548a- 0.019 3.245 9.481 0.076 3p hsa-miR-490- 0.037 3.255 9.547 0.109 3p hsa-miR-583 0.005 3.268 9.630 0.040 hsa-miR-518d- 0.037 3.293 9.798 0.109 3p hsa-miR-551b 0.035 3.318 9.969 0.106 hsa-miR-600 0.032 3.323 10.004 0.100 hsa-miR-296- 0.002 3.360 10.267 0.025 3p hsa-miR-650 0.033 3.370 10.339 0.103 hsa-miR-216b 0.049 3.380 10.411 0.132 hsa-miR-196b 0.040 3.383 10.429 0.116 hsa-miR-106b 0.001 3.405 10.593 0.020 hsa-miR-211 0.022 3.423 10.722 0.080 hsa-miR-502- 0.007 3.493 11.255 0.044 5p hsa-miR-222 0.001 3.503 11.333 0.021 hsa-miR-206 0.022 3.543 11.652 0.081 hsa-miR-497 0.016 3.545 11.672 0.067 hsa-miR-298 0.002 3.555 11.753 0.027 hsa-miR-887 0.008 3.583 11.980 0.050 hsa-miR-219-2- 0.008 3.598 12.105 0.050 3p hsa-miR-520e 0.031 3.600 12.126 0.098 hsa-miR-210 0.004 3.610 12.210 0.036 hsa-miR-520c- 0.026 3.630 12.381 0.089 3p hsa-miR-587 0.045 3.633 12.402 0.124 hsa-miR-143 0.037 3.635 12.424 0.109 hsa-miR-490- 0.021 3.688 12.884 0.079 5p hsa-miR-202 0.008 3.690 12.906 0.050 hsa-miR-875- 0.026 3.695 12.951 0.090 3p hsa-miR-609 0.045 3.715 13.132 0.124 hsa-miR-654- 0.014 3.733 13.292 0.065 5p hsa-miR-339- 0.049 3.778 13.713 0.132 3p hsa-miR-934 0.026 3.843 14.345 0.088 hsa-miR-508- 0.024 3.845 14.370 0.086 5p hsa-miR-509- 0.007 3.865 14.571 0.044 5p hsa-miR-617 0.016 3.888 14.800 0.068 hsa-miR-921 0.024 3.930 15.242 0.086 hsa-miR-658 0.001 3.933 15.269 0.017 hsa-miR-299- 0.001 3.938 15.322 0.020 5p hsa-miR-566 0.025 3.943 15.375 0.088 hsa-miR-220b 0.019 3.980 15.780 0.074 hsa-miR-453 0.024 3.990 15.889 0.086 hsa-miR-491- 0.006 3.995 15.945 0.041 3p hsa-miR-501- 0.000 4.008 16.083 0.011 5p hsa-miR-603 0.035 4.025 16.280 0.106 hsa-miR-634 0.039 4.038 16.421 0.113 hsa-miR-744 0.004 4.053 16.593 0.034 hsa-miR-34c- 0.011 4.053 16.593 0.055 3p hsa-miR-516b 0.000 4.135 17.569 0.006 hsa-miR-448 0.002 4.143 17.661 0.027 hsa-miR-196a 0.041 4.158 17.846 0.117 hsa-miR-758 0.024 4.188 18.221 0.085 hsa-miR-496 0.015 4.193 18.284 0.067 hsa-miR-593 0.020 4.203 18.411 0.078 hsa-miR-876- 0.023 4.203 18.411 0.082 5p hsa-miR-770- 0.000 4.233 18.798 0.007 5p hsa-miR-449b 0.005 4.235 18.831 0.040 hsa-miR-34b 0.012 4.265 19.226 0.060 hsa-miR-516a- 0.006 4.295 19.630 0.041 3p hsa-miR-554 0.008 4.325 20.043 0.050 hsa-miR-544 0.010 4.328 20.077 0.055 hsa-miR-612 0.028 4.338 20.217 0.092 hsa-miR-519c- 0.005 4.403 21.149 0.040 5p hsa-miR-28-5p 0.044 4.413 21.296 0.124 hsa-miR-133a 0.027 4.475 22.239 0.090 hsa-miR-433 0.002 4.513 22.824 0.027 hsa-miR-520b 0.015 4.553 23.466 0.067 hsa-miR-636 0.035 4.558 23.547 0.106 hsa-miR-505 0.005 4.573 23.794 0.040 hsa-miR-760 0.002 4.593 24.126 0.024 hsa-miR-376a 0.032 4.603 24.294 0.100 hsa-miR-576- 0.030 4.658 25.238 0.096 5p hsa-miR-509-3- 0.001 4.665 25.369 0.018 5p hsa-miR-412 0.001 4.665 25.369 0.020 hsa-miR-765 0.004 4.680 25.634 0.038 hsa-miR-657 0.007 4.683 25.679 0.044 hsa-miR-767- 0.000 4.718 26.309 0.007 3p hsa-miR-511 0.002 4.730 26.538 0.027 hsa-miR-648 0.001 4.813 28.100 0.018 hsa-miR-409- 0.007 4.828 28.394 0.044 3p hsa-miR-449a 0.003 4.838 28.591 0.033 hsa-miR-539 0.015 4.853 28.890 0.067 hsa-miR-526a 0.007 4.858 28.990 0.045 hsa-miR-31 0.010 4.895 29.754 0.055 hsa-miR-645 0.004 4.923 30.326 0.034 hsa-miR-409- 0.000 4.925 30.379 0.007 5p hsa-miR-891b 0.041 4.978 31.505 0.117 hsa-miR-500b 0.008 4.983 31.614 0.050 hsa-miR-302e 0.000 4.993 31.834 0.014 hsa-miR-891a 0.000 4.995 31.889 0.011 hsa-miR-500 0.001 5.000 32.000 0.017 hsa-miR-632 0.011 5.020 32.447 0.055 hsa-miR-487b 0.000 5.025 32.559 0.011 hsa-miR-369- 0.003 5.073 33.649 0.033 5p hsa-miR-582- 0.003 5.223 37.336 0.028 3p hsa-miR-656 0.001 5.293 39.192 0.020 hsa-miR-626 0.013 5.318 39.877 0.064 hsa-miR-133b 0.016 5.365 41.212 0.068 hsa-miR-199b- 0.009 5.410 42.518 0.052 5p hsa-miR-920 0.000 5.540 46.527 0.011 hsa-miR-890 0.009 5.590 48.168 0.052 hsa-miR-220a 0.013 5.608 48.756 0.064 hsa-miR-370 0.005 5.720 52.710 0.040 hsa-miR-888 0.010 5.723 52.801 0.054 hsa-miR-622 0.002 5.785 55.139 0.027 hsa-miR-128 0.017 5.833 56.985 0.070 hsa-miR-525- 0.001 5.883 58.994 0.020 3p hsa-miR-545 0.001 5.913 60.234 0.020 hsa-miR-542- 0.002 5.923 60.653 0.027 3p hsa-miR-29c 0.011 6.060 66.718 0.058 hsa-miR-548a- 0.001 6.140 70.522 0.020 5p hsa-miR-421 0.002 6.158 71.383 0.025 hsa-miR-630 0.000 6.163 71.630 0.006 hsa-miR-383 0.006 6.175 72.254 0.041 hsa-miR-548c- 0.001 6.420 85.627 0.017 5p hsa-miR-34c- 0.001 6.578 95.505 0.020 5p hsa-miR-323- 0.002 6.715 105.055 0.025 5p hsa-miR-452 0.000 6.718 105.237 0.006 hsa-miR-342- 0.000 6.865 116.566 0.010 3p hsa-miR-423- 0.000 6.900 119.428 0.000 3p hsa-miR-375 0.000 7.158 142.765 0.011 hsa-miR-365 0.000 7.318 159.510 0.007 hsa-miR-382 0.002 7.478 178.218 0.027 hsa-miR-346 0.002 7.760 216.767 0.025 hsa-miR-484 0.001 7.783 220.174 0.020 hsa-miR-637 0.001 8.035 262.287 0.020 hsa-miR-362- 0.001 8.665 405.905 0.020 5p hsa-miR-548e 0.000 9.358 655.976 0.002 hsa-miR-324- 0.002 9.525 736.734 0.027 5p hsa-miR-224 0.001 10.530 1478.583 0.020 FDR = false discovery rate

[0113] Of these, only 5% (29 miRNAs) were upregulated in either HIV or CGL patients, while 217 (38%) were robustly decreased in either CGL or HIV lipodystrophy, and 75 were decreased in both lipodystrophy groups (FIG. 1g, Table 4).

TABLE-US-00006 TABLE 4 Exosomal miRNAs Jointly Regulated in both Human HIV and Generalized Lipodystrophy upregulated in HIV common upregulated upregulated in CGL hsa-miR-338-3p hsa-miR-19b hsa-miR-337-5p hsa-miR-15a hsa-miR-101 hsa-miR-140-3p hsa-miR-362-3p hsa-miR-19a hsa-miR-106a hsa-miR-371-3p hsa-miR-374b hsa-miR-367 hsa-miR-103 hsa-miR-21 hsa-miR-17 hsa-miR-16 hsa-miR-550 hsa-miR-557 hsa-miR-190 hsa-miR-195 hsa-miR-20a hsa-miR-193a-5p hsa-miR-331-3p hsa-miR-126 hsa-miR-30d hsa-miR-30a hsa-miR-548i hsa-miR-192 hsa-miR-450b-5p downregulated in common downregulated HIV downregulated CGL hsa-miR-335 hsa-miR-548e hsa-miR-423-3p hsa-miR-9 hsa-miR-452 hsa-miR-658 hsa-miR-410 hsa-miR-516b hsa-miR-891a hsa-miR-100 hsa-miR-630 hsa-miR-501-5p hsa-miR-541 hsa-miR-365 hsa-miR-548c-5p hsa-miR-220c hsa-miR-767-3p hsa-miR-605 hsa-miR-140-5p hsa-miR-375 hsa-miR-596 hsa-miR-516a-5p hsa-miR-409-5p hsa-miR-412 hsa-miR-501-3p hsa-miR-770-5p hsa-miR-484 hsa-miR-486-3p hsa-miR-342-3p hsa-miR-637 hsa-miR-130b hsa-miR-487b hsa-miR-512-3p hsa-miR-889 hsa-miR-920 hsa-miR-656 hsa-miR-885-3p hsa-miR-34c-5p hsa-miR-760 hsa-miR-635 hsa-miR-302e hsa-miR-296-3p hsa-miR-374a hsa-miR-362-5p hsa-miR-298 hsa-miR-671-5p hsa-miR-106b hsa-miR-671-3p hsa-miR-769-5p hsa-miR-525-3p hsa-miR-433 hsa-miR-483-5p hsa-miR-548a-5p hsa-miR-622 hsa-miR-592 hsa-miR-500 hsa-miR-582-3p hsa-miR-767-5p hsa-miR-224 hsa-miR-887 hsa-miR-649 hsa-miR-509-3-5p hsa-miR-92b hsa-miR-654-3p hsa-miR-648 hsa-miR-744 hsa-miR-520c-5p hsa-miR-545 hsa-miR-519c-5p hsa-miR-183 hsa-miR-324-5p hsa-miR-210 hsa-miR-615-3p hsa-miR-299-5p hsa-miR-766 hsa-miR-422a hsa-miR-346 hsa-miR-212 hsa-miR-326 hsa-miR-222 hsa-miR-874 hsa-miR-520d-5p hsa-miR-382 hsa-miR-765 hsa-miR-199b-5p hsa-miR-125a-3p hsa-miR-421 hsa-miR-505 hsa-miR-448 hsa-miR-220b hsa-miR-369-5p hsa-miR-491-3p hsa-miR-542-3p hsa-miR-409-3p hsa-miR-645 hsa-miR-659 hsa-miR-323-5p hsa-miR-514b-5p hsa-miR-646 hsa-miR-502-5p hsa-miR-323-3p hsa-miR-526a hsa-miR-485-3p hsa-miR-509-5p hsa-miR-511 hsa-miR-199a-5p hsa-miR-449a hsa-miR-500b hsa-miR-449b hsa-miR-219-2-3p hsa-miR-383 hsa-miR-202 hsa-miR-554 hsa-miR-493 hsa-miR-657 hsa-miR-888 hsa-miR-583 hsa-miR-153 hsa-miR-370 hsa-miR-300 hsa-miR-147 hsa-miR-31 hsa-miR-149 hsa-miR-221 hsa-miR-631 hsa-miR-339-5p hsa-miR-487a hsa-miR-34c-3p hsa-miR-181b hsa-miR-647 hsa-miR-29c hsa-miR-34b hsa-miR-632 hsa-miR-626 hsa-miR-516a-3p hsa-miR-933 hsa-miR-610 hsa-miR-188-3p hsa-miR-520e hsa-miR-564 hsa-miR-539 hsa-miR-520b hsa-miR-890 hsa-miR-453 hsa-miR-483-3p hsa-miR-30b hsa-miR-10b hsa-miR-720 hsa-miR-339-3p hsa-miR-654-5p hsa-miR-519e hsa-miR-877 hsa-miR-544 hsa-miR-548u hsa-miR-520c-3p hsa-miR-665 hsa-miR-220a hsa-miR-133a hsa-miR-566 hsa-miR-497 hsa-miR-141 hsa-miR-617 hsa-miR-508-5p hsa-miR-668 hsa-miR-603 hsa-miR-496 hsa-miR-133b hsa-miR-188-5p hsa-miR-875-3p hsa-miR-936 hsa-miR-518d-3p hsa-miR-128 hsa-miR-935 hsa-miR-937 hsa-miR-490-3p hsa-miR-593 hsa-miR-802 hsa-miR-378 hsa-miR-377 hsa-miR-548a-3p hsa-miR-135b hsa-miR-638 hsa-miR-876-5p hsa-miR-211 hsa-miR-490-5p hsa-miR-623 hsa-miR-206 hsa-let-7d hsa-miR-758 hsa-miR-634 hsa-miR-921 hsa-miR-507 hsa-miR-376a hsa-miR-934 hsa-miR-551b hsa-miR-576-5p hsa-miR-612 hsa-miR-651 hsa-miR-147b hsa-miR-640 hsa-miR-873 hsa-miR-600 hsa-miR-614 hsa-miR-650 hsa-miR-28-5p hsa-miR-518a-3p hsa-miR-518d-5p hsa-miR-636 hsa-miR-196b hsa-miR-143 hsa-miR-196a hsa-miR-891b hsa-miR-513a-5p hsa-miR-609 hsa-miR-587 hsa-miR-575 hsa-miR-216b

[0114] Again, several of these miRNAs (miR-221, miR-222 and miR-16) have been previously implicated in regulation of adipose tissue.sup.9,10,20,21. Thirty of the miRNAs that were decreased in serum of both patient cohorts were also decreased in the serum of the ADicerKO mice (Table 5).

TABLE-US-00007 TABLE 5 Serum Exosomal miRNAs Which Are Down-regulated in Both Human Lipodystrophies and ADicerKO Mice Homolog common downregulated miR-324-5p miR-323-5p miR-323-3p miR-409-5p miR-500 miR-149 miR-29c miR-375 miR-382 miR-383 miR-449b miR-346 miR-10b miR-370 miR-452 miR-449a miR-487b miR-339-3p miR-421 miR-147 miR-133b miR-544 miR-365 miR-222 miR-342-3p miR-141 miR-802 miR-362-5p miR-770-5p miR-448

[0115] Lipodystrophy and altered metabolism in general might be an important driver of altered exosomal miRNA availability in serum. One way to dissociate altered metabolism from these phenotypes is to compare serum miRNAs from young control and AdicerKO mice at 4 weeks of age, since at this age the metabolic phenotypes of ADicerKO mice have not yet appeared. miRNA profiling of circulating exosomes from 4 week-old ADicerKO mice (FIG. 6g) demonstrated that of the of the 380 miRNAs profiled, 373 were detectable with 202 down-regulated in ADicerKO mice and only 23 miRNAs up-regulated, indicating that reduction in circulating miRNAs reflects primarily the difference in miRNA processing rather than the effect of chronic lipodystrophy.

[0116] These data indicate that adipose tissue is a major source of circulating exosomal miRNA and that exosomal miRNA downregulation is due to Dicer deficiency in fat and not due to onset of lipodystrophy.

Example 2. Adipose Tissue Transplantation Reconstitutes Circulating miRNAs in Lipodystrophic Mice

[0117] Next, fat tissue was transplanted from normal mice into ADicerKO mice and mice were followed for 14 days (FIG. 2a). miRNA profiling of subcutaneous inguinal (ing) white adipose tissue (WAT), intraabdominal epididymal (Epi) WAT, and interscapular BAT from the normal donor mice taken at the time of transplantation revealed distinct, depot-specific signatures consistent with previous studies.sup.22 (FIG. 2b). Considering only the miRNAs that were higher expressed than the control U6, 126 were highly expressed in BAT, 106 in Ing-WAT, and 160 in Epi-WAT, with 82 of these miRNAs expressed in all three depots (FIGS. 2b, 7a; Table 6).

[0118] At the time of sacrifice two weeks later, all mice had maintained body weight, and the transplanted fat weighed 80-90% of the original weight, indicating successful engraftment (FIGS. 7b and 7c). Sal refers to ADicerKO mice that received saline instead of a transplant. Wt refers to wildtype mice, other groups in FIG. 7c are ADicerKO mice that have received fat tissue transplants.

[0119] Table 6 presents miRNA profiling of subcutaneous inguinal (ing) WAT, intraabdominal epididymal (Epi) WAT, and interscapular BAT from the normal donor mice taken at the time of transplantation revealed distinct, depot-specific signatures consistent with previous studies.sup.22. Considering only the miRNAs that were expressed greater than U6, 126 were highly expressed in BAT, 106 in Ing-WAT, and 160 in Epi-WAT, with 82 of these miRNAs expressed in all three depots when compared to ADicerKO Sal group.

TABLE-US-00008 TABLE 6 Fat tissue mouse miRNA signatures EPIvsING EPIvsING EPIvsING EPIvsING miRNA p-value FDR logFC FC mmu-miR-290-5p <0.0001 0.006 6.78 109.861 mmu-miR-574-5p <0.0001 0.02 9.332 644.501 mmu-miR-500 <0.0001 0.02 6.02 64.914 mmu-miR-467h <0.0001 0.02 3.582 11.976 mmu-miR-666-5p <0.0001 0.024 3.02 8.109 mmu-miR-295* <0.0001 0.056 2.628 6.18 mmu-miR-883b-3p 0.001 0.056 7.6 193.986 mmu-miR-26b 0.001 0.031 3.765 13.591 mmu-miR-33 0.001 0.031 4.895 29.744 mmu-miR-1949 0.001 0.056 2.413 5.325 mmu-miR-452 0.001 0.039 3.135 8.782 mmu-miR-200a* 0.001 0.056 2.702 6.508 mmu-miR-883a-5p 0.001 0.056 6.818 112.805 mmu-miR-345-3p 0.001 0.039 3.29 9.778 mmu-miR-1-2-as 0.001 0.039 4.985 31.679 mmu-miR-467a* 0.001 0.056 1.695 3.237 mmu-miR-1 0.001 0.039 14.052 16985.769 mmu-miR-196a* 0.001 0.056 6.927 121.71 mmu-miR-467g 0.001 0.039 11.43 2760.016 mmu-miR-326 0.001 0.039 2.315 4.974 mmu-miR-291a-5p 0.001 0.039 5.885 59.078 mmu-miR-1981 0.001 0.056 2.023 4.063 mmu-miR-1190 0.002 0.056 6.028 65.24 mmu-miR-568 0.002 0.041 7.97 250.812 mmu-miR-804 0.002 0.056 9.055 531.966 mmu-miR-340-5p 0.002 0.041 5.91 60.11 mmu-miR-465a-5p 0.002 0.041 2.162 4.475 mmu-miR-463* 0.002 0.056 7.075 134.848 mmu-miR-6690 0.002 0.056 1.665 3.172 mmu-miR-467a 0.002 0.041 3.562 11.811 mmu-miR-127 0.002 0.041 3.06 8.337 mmu-miR-30b 0.002 0.041 2.51 5.694 mmu-miR-136 0.002 0.041 7.387 167.386 mmu-miR-877 0.002 0.058 2.428 5.38 mmu-miR-343 0.002 0.042 3.66 12.637 mmu-miR-299 0.003 0.044 6.535 92.762 mmu-miR-31 0.003 0.044 2.872 7.321 mmu-miR-106b* 0.003 0.062 1.822 3.536 mmu-miR-1971 0.003 0.062 2.385 5.224 mmu-miR-450b-3p 0.003 0.045 2.755 6.753 mmu-miR-212 0.004 0.051 5.122 34.825 mmu-miR-467f 0.004 0.051 2.905 7.488 mmu-miR-1188 0.004 0.077 2.947 7.713 mmu-miR-328 0.004 0.052 1.707 3.265 mmu-miR-1947 0.004 0.077 2.365 5.152 mmu-miR-467b 0.004 0.054 2.245 4.739 mmu-miR-298 0.004 0.054 2.467 5.529 mmu-miR-449c 0.005 0.054 5.717 52.602 mmu-miR-451 0.005 0.054 1.527 2.882 mmu-miR-25 0.005 0.054 3.262 9.593 mmu-miR-1951 0.005 0.081 2.345 5.081 mmu-miR-148a* 0.005 0.081 4.13 17.511 mmu-miR-449a 0.005 0.055 4.507 22.738 mmu-let-7i* 0.005 0.081 5.05 33.124 mmu-miR-711 0.005 0.081 3.292 9.797 mmu-miR-1933-3p 0.005 0.081 2.665 6.341 mmu-miR-409-3p 0.005 0.059 2.758 6.764 mmu-miR-125a-3p 0.006 0.06 3.307 9.897 mmu-miR-760 0.006 0.084 3.8 13.927 mmu-miR-689 0.006 0.084 3.452 10.946 mmu-miR-1936 0.007 0.088 5.347 40.71 mmu-miR-27b 0.007 0.07 1.692 3.231 mmu-miR-707 0.007 0.091 3.56 11.793 mmu-miR-222 0.007 0.07 3.17 8.998 mmu-miR-877* 0.007 0.092 1.812 3.512 mmu-miR-323-5p 0.008 0.07 3.89 14.821 mmu-miR-1944 0.008 0.092 1.975 3.932 mmu-miR-130b 0.008 0.07 5.103 34.367 mmu-miR-363 0.008 0.07 3.362 10.282 mmu-miR-466a-5p 0.008 0.07 4.78 27.465 mmu-miR-380-3p 0.008 0.07 8.748 429.931 mmu-miR-125b-3p 0.008 0.07 2.707 6.53 mmu-miR-344 0.008 0.07 2.418 5.344 mmu-miR-24 0.009 0.072 1.352 2.553 mmu-miR-712 0.009 0.094 3.485 11.198 mmu-miR-674 0.009 0.094 2.297 4.915 mmu-miR-698 0.009 0.094 5.322 40.011 mmu-miR-351 0.009 0.072 1.76 3.386 mmu-miR-139-3p 0.009 0.072 3.678 12.799 mmu-miR-881* 0.009 0.095 5.342 40.569 mmu-miR-770-5p 0.01 0.097 3.115 8.665 mmu-miR-654-3p 0.01 0.074 2.37 5.168 mmu-miR-687 0.01 0.098 3.69 12.905 mmu-miR-346 0.01 0.074 1.655 3.148 mmu-miR-669e 0.01 0.074 2.063 4.178 mmu-miR-147 0.011 0.074 2.27 4.822 mmu-miR-423-5p 0.011 0.074 1.312 2.483 mmu-miR-23b 0.011 0.074 2.435 5.406 mmu-miR-18a 0.011 0.074 1.912 3.763 mmu-miR-34b-3p 0.011 0.074 2.822 7.072 mmu-miR-324-5p 0.011 0.074 3.062 8.352 mmu-miR-214* 0.011 0.105 2.737 6.668 mmu-miR-33* 0.012 0.105 1.472 2.775 mmu-miR-138* 0.012 0.105 2.217 4.65 mmu-miR-1199 0.012 0.105 1.33 2.514 mmu-miR-1941-5p 0.013 0.11 2.66 6.319 mmu-miR-138 0.013 0.084 3.107 8.616 mmu-miR-668 0.013 0.084 3.072 8.41 mmu-miR-369-3p 0.013 0.084 6.418 85.506 mmu-miR-367 0.013 0.084 4.897 29.796 mmu-miR-148b 0.014 0.084 1.325 2.505 mmu-miR-465b-5p 0.014 0.084 2.9 7.462 mmu-miR-708 0.014 0.112 1.883 3.688 mmu-miR-27a* 0.014 0.112 1.415 2.667 mmu-miR-200c* 0.014 0.112 4.887 29.596 mmu-miR-4661 0.015 0.085 5.29 39.112 mmu-miR-207 0.015 0.085 2.853 7.225 mmu-miR-181b 0.015 0.085 2.512 5.704 mmu-miR-1194 0.015 0.112 1.213 2.318 mmu-miR-547 0.016 0.088 7.647 200.442 mmu-miR-431 0.016 0.088 2.13 4.379 mmu-miR-17 0.016 0.088 1.82 3.53 mmu-miR-1934 0.016 0.122 2.037 4.105 mmu-miR-669h-3p 0.016 0.089 1.3 2.462 mmu-miR-339-3p 0.017 0.089 26.118 72826545.03 mmu-miR-1897-3p 0.017 0.123 2.362 5.142 mmu-miR-509-3p 0.017 0.089 3.058 8.328 mmu-let-7e 0.017 0.089 1.202 2.301 mmu-let-7b* 0.017 0.125 1.458 2.747 mmu-miR-744* 0.018 0.128 3.157 8.922 mmu-miR-22 0.019 0.096 2.12 4.346 mmu-miR-1904 0.019 0.128 1.082 2.117 mmu-miR-183* 0.019 0.129 3.945 15.399 mmu-miR-142-5p 0.02 0.101 3.957 15.531 mmu-miR-34b-5p 0.02 0.101 2.57 5.94 mmu-miR-141* 0.021 0.136 7.707 208.993 mmu-miR-28 0.021 0.101 2.857 7.245 mmu-miR-201 0.021 0.101 3.217 9.299 mmu-miR-665 0.021 0.102 1.907 3.75 mmu-miR-1306 0.022 0.136 1.915 3.772 mmu-miR-342-3p 0.022 0.104 1.325 2.505 mmu-miR-693-3p 0.022 0.136 2.36 5.133 mmu-miR-1927 0.023 0.136 2.12 4.346 mmu-miR-18b 0.023 0.107 4.795 27.752 mmu-miR-300* 0.023 0.136 1.703 3.255 mmu-miR-411* 0.023 0.136 2.392 5.25 mmu-miR-322* 0.023 0.136 1.39 2.621 mmu-miR-493 0.024 0.111 2.227 4.682 mmu-miR-875-5p 0.024 0.136 5.052 33.182 mmu-miR-1967 0.024 0.136 1.948 3.858 mmu-miR-1940 0.024 0.136 1.747 3.357 mmu-miR-470* 0.025 0.137 5.412 42.586 mmu-miR-187 0.025 0.114 1.555 2.937 mmu-miR-205 0.025 0.114 3.205 9.224 mmu-miR-678 0.026 0.138 2.603 6.074 mmu-miR-144 0.026 0.117 6.867 116.731 mmu-miR-29a 0.027 0.12 10.698 1661.144 mmu-miR-20b 0.027 0.12 1.402 2.643 mmu-miR-145* 0.028 0.144 2.16 4.47 mmu-miR-694 0.028 0.144 2.735 6.657 mmu-miR-2183 0.028 0.144 1.68 3.204 mmu-miR-704 0.028 0.144 1.545 2.918 mmu-let-7a 0.029 0.127 1.207 2.309 mmu-miR-876-5p 0.03 0.148 2.825 7.085 mmu-miR-1950 0.03 0.148 3.117 8.678 mmu-miR-101b 0.031 0.129 1.577 2.984 mmu-miR-455 0.031 0.129 2.665 6.34 mmu-miR-129-5p 0.031 0.129 5.353 40.87 mmu-miR-29c 0.032 0.13 1.287 2.44 mmu-miR-764-5p 0.033 0.159 1.738 3.335 mmu-miR-182 0.033 0.135 2.595 6.04 mmu-miR-1963 0.034 0.165 1.378 2.599 mmu-miR-204 0.035 0.14 1.472 2.774 mmu-miR-673-5p 0.035 0.166 1.108 2.155 mmu-miR-615-3p 0.036 0.143 1.482 2.793 mmu-miR-362-5p 0.037 0.147 2.87 7.313 mmu-miR-743a 0.038 0.175 5.602 48.581 mmu-let-7c 0.039 0.152 1.032 2.045 mmu-miR-450a-5p 0.039 0.152 1.072 2.102 mmu-miR-1948 0.04 0.182 5.07 33.587 mmu-miR-338-3p 0.04 0.153 1.978 3.939 mmu-miR-133b 0.041 0.153 3.957 15.531 mmu-miR-652 0.041 0.154 1.332 2.518 mmu-miR-193b 0.042 0.154 1.955 3.876 mmu-miR-191* 0.042 0.189 1.485 2.799 mmu-miR-713 0.043 0.19 1.797 3.476 mmu-miR-497 0.043 0.158 1.585 2.999 mmu-miR-702 0.044 0.19 1.015 2.021 mmu-miR-29b* 0.044 0.19 1.44 2.713 mmu-miR-483 0.044 0.161 2.298 4.918 mmu-let-7g 0.045 0.161 1.237 2.357 mmu-miR-1839-3p 0.045 0.194 1.197 2.293 mmu-miR-194 0.047 0.164 1.137 2.199 mmu-miR-215 0.047 0.164 2.565 5.916 mmu-miR-32 0.048 0.164 1.068 2.096 mmu-miR-434-3p 0.048 0.164 1.238 2.359 mmu-miR-1902 0.048 0.204 1.652 3.143 mmu-miR-7b 0.048 0.164 1.878 3.676 mmu-miR-296-3p 0.049 0.164 1.177 2.261 mmu-miR-411 0.05 0.164 1.067 2.095 BATvsEPI BATvsEPI BATvsEPI BATvsEPI miRNA p-value FDR logFC FC mmu-miR-702 <0.0001 <0.0001 4.239 18.883 mmu-miR-805 <0.0001 <0.0001 3.734 13.306 mmu-miR-378* <0.0001 <0.0001 4.127 17.467 mmu-miR-1949 <0.0001 <0.0001 4.459 21.994 mmu-miR-1963 <0.0001 0.002 3.792 13.847 mmu-miR-714 <0.0001 0.002 2.502 5.663 mmu-miR-715 <0.0001 0.002 2.659 6.316 mmu-miR-2134 <0.0001 0.004 3.762 13.562 mmu-miR-193b <0.0001 0.018 4.789 27.637 mmu-miR-328 <0.0001 0.018 2.566 5.922 mmu-miR-290-5p <0.0001 0.018 5.104 34.38 mmu-miR-455 <0.0001 0.018 5.811 56.142 mmu-miR-666-5p <0.0001 0.018 3.129 8.745 mmu-miR-1981 <0.0001 0.011 2.479 5.575 mmu-miR-1274a <0.0001 0.011 2.214 4.64 mmu-miR-204 <0.0001 0.027 3.031 8.174 mmu-miR-880 <0.0001 0.015 9.812 898.6 mmu-miR-193* 0.001 0.015 2.129 4.374 mmu-miR-182 0.001 0.027 5.146 35.408 mmu-miR-1-2-as 0.001 0.027 5.564 47.307 mmu-miR-1942 0.001 0.016 6.074 67.37 mmu-miR-761 0.001 0.016 2.959 7.776 mmu-miR-883a-5p 0.001 0.016 7.059 133.346 mmu-miR-378 0.001 0.033 5.141 35.286 mmu-miR-2182 0.001 0.016 2.294 4.904 mmu-miR-763 0.001 0.016 1.626 3.086 mmu-miR-1961 0.001 0.016 1.626 3.086 mmu-miR-467h 0.001 0.035 2.926 7.6 mmu-let-7g 0.001 0.035 2.421 5.355 mmu-miR-1947 0.001 0.017 2.884 7.382 mmu-miR-1932 0.001 0.017 2.879 7.357 mmu-let-7a 0.001 0.039 2.064 4.18 mmu-miR-133b 0.001 0.039 7.289 156.337 mmu-miR-343 0.002 0.04 3.906 14.991 mmu-miR-668 0.002 0.04 4.344 20.302 mmu-miR-291a-5p 0.002 0.041 5.731 53.114 mmu-miR-10a* 0.002 0.032 1.934 3.821 mmu-miR-423-5p 0.002 0.051 1.691 3.229 mmu-miR-706 0.002 0.037 1.868 3.651 mmu-miR-27b 0.002 0.053 1.994 3.982 mmu-miR-1935 0.003 0.037 1.726 3.308 mmu-miR-467a* 0.003 0.037 1.511 2.85 mmu-miR-200a* 0.003 0.037 2.288 4.885 mmu-miR-30c-1* 0.003 0.037 4.214 18.559 mmu-miR-324-5p 0.003 0.064 3.779 13.723 mmu-miR-718 0.003 0.037 3.807 13.992 mmu-miR-1945 0.003 0.037 2.724 6.607 mmu-miR-709 0.003 0.037 1.482 2.792 mmu-miR-295* 0.003 0.037 1.967 3.908 mmu-miR-450b-3p 0.004 0.07 2.669 6.36 mmu-miR-503* 0.004 0.039 1.457 2.744 mmu-miR-1901 0.004 0.04 2.137 4.397 mmu-miR-1965 0.004 0.04 1.762 3.391 mmu-miR-22* 0.004 0.043 3.164 8.963 mmu-miR-687 0.005 0.043 4.218 18.616 mmu-miR-134 0.005 0.078 1.756 3.379 mmu-miR-590-3p 0.005 0.078 1.756 3.379 mmu-let-7e 0.005 0.078 1.514 2.855 mmu-miR-376c* 0.005 0.043 5.427 43.008 mmu-miR-1939 0.005 0.043 1.934 3.821 mmu-miR-345-3p 0.005 0.082 2.656 6.303 mmu-miR-677 0.005 0.045 1.874 3.666 mmu-miR-704 0.005 0.045 2.114 4.329 mmu-miR-1896 0.005 0.045 1.859 3.628 mmu-miR-25 0.005 0.084 3.176 9.038 mmu-miR-216b 0.006 0.085 3.881 14.733 mmu-miR-322* 0.006 0.047 1.799 3.48 mmu-let-7d* 0.006 0.047 2.039 4.11 mmu-miR-26b 0.006 0.086 2.654 6.292 mmu-miR-99b* 0.006 0.048 1.559 2.947 mmu-miR-1957 0.006 0.048 4.317 19.925 mmu-miR-877 0.007 0.049 2.049 4.138 mmu-miR-33 0.007 0.086 3.406 10.6 mmu-let-7c 0.007 0.086 1.469 2.767 mmu-miR-652 0.007 0.086 1.914 3.767 mmu-miR-467a 0.007 0.086 2.936 7.653 mmu-miR-2133 0.007 0.05 1.589 3.008 mmu-miR-654-3p 0.007 0.087 2.494 5.631 mmu-miR-676 0.008 0.053 1.699 3.247 mmu-miR-369-3p 0.008 0.087 7.101 137.328 mmu-miR-574-5p 0.008 0.087 5.144 35.347 mmu-miR-302c* 0.008 0.055 3.859 14.511 mmu-miR-804 0.008 0.055 7.192 146.173 mmu-miR-1 0.008 0.089 10.556 1505.491 mmu-miR-494 0.009 0.089 2.181 4.535 mmu-miR-206 0.009 0.089 4.736 26.649 mmu-miR-212 0.009 0.089 4.411 21.274 mmu-miR-883b-5p 0.009 0.061 2.644 6.251 mmu-miR-451 0.009 0.089 1.354 2.555 mmu-miR-188-3p 0.01 0.089 3.049 8.274 mmu-miR-467b 0.01 0.089 1.944 3.846 mmu-miR-1962 0.01 0.063 1.577 2.983 mmu-miR-1933-3p 0.01 0.064 2.396 5.263 mmu-miR-466i 0.011 0.095 1.991 3.976 mmu-miR-30b 0.011 0.095 1.936 3.826 mmu-miR-1186 0.011 0.068 1.293 2.451 mmu-miR-1946b 0.011 0.068 1.826 3.545 mmu-miR-346 0.012 0.095 1.621 3.076 mmu-miR-875-5p 0.012 0.069 5.838 57.221 mmu-miR-133a 0.012 0.095 5.916 60.381 mmu-miR-370 0.012 0.095 1.709 3.268 mmu-miR-21 0.012 0.095 2.516 5.722 mmu-miR-2146 0.012 0.071 1.944 3.848 mmu-miR-326 0.012 0.097 1.636 3.108 mmu-miR-127 0.013 0.1 2.271 4.827 mmu-miR-2142 0.013 0.075 2.177 4.521 mmu-miR-33* 0.013 0.075 1.436 2.706 mmu-miR-874 0.014 0.075 1.222 2.332 mmu-miR-1907 0.014 0.075 1.184 2.272 mmu-miR-298 0.014 0.105 2.024 4.066 mmu-miR-712 0.014 0.076 3.187 9.104 mmu-miR-363 0.014 0.105 3.021 8.117 mmu-miR-409-5p 0.015 0.105 1.889 3.704 mmu-miR-133a* 0.015 0.078 4.687 25.751 mmu-miR-466f-3p 0.015 0.105 1.389 2.619 mmu-miR-449a 0.015 0.105 3.704 13.028 mmu-miR-1936 0.015 0.08 4.606 24.352 mmu-miR-669e 0.015 0.105 1.919 3.782 mmu-miR-466a-5p 0.015 0.105 4.236 18.844 mmu-miR-463* 0.015 0.08 5.034 32.764 mmu-miR-1839-5p 0.016 0.08 1.194 2.288 mmu-miR-1971 0.016 0.08 1.769 3.408 mmu-miR-15b* 0.016 0.08 1.657 3.153 mmu-miR-192 0.017 0.113 1.804 3.491 mmu-miR-881* 0.017 0.083 4.753 26.973 mmu-miR-190b 0.018 0.114 3.184 9.085 mmu-miR-665 0.018 0.114 1.979 3.941 mmu-miR-32 0.018 0.115 1.326 2.508 mmu-miR-467g 0.018 0.115 7.454 175.336 mmu-miR-1938 0.019 0.088 4.093 17.071 mmu-miR-106b* 0.019 0.088 1.306 2.472 mmu-miR-1930 0.019 0.088 1.234 2.352 mmu-miR-18b 0.021 0.13 4.871 29.263 mmu-miR-770-5p 0.022 0.1 2.667 6.349 mmu-miR-222 0.022 0.133 2.574 5.953 mmu-let-7b* 0.023 0.105 1.374 2.592 mmu-miR-101a 0.024 0.14 2.761 6.781 mmu-miR-183 0.024 0.14 5.086 33.966 mmu-miR-425* 0.024 0.107 3.492 11.248 mmu-miR-31 0.024 0.14 1.951 3.866 mmu-miR-882 0.024 0.107 5.444 43.533 mmu-miR-203* 0.026 0.112 2.087 4.247 mmu-miR-27b* 0.026 0.112 1.742 3.344 mmu-miR-344 0.027 0.151 1.924 3.795 mmu-miR-302d 0.028 0.154 6.074 67.346 mmu-miR-34b-3p 0.028 0.156 2.339 5.058 mmu-miR-105 0.03 0.165 5.226 37.427 mmu-miR-223 0.031 0.165 1.431 2.697 mmu-miR-340-5p 0.032 0.165 3.599 12.113 mmu-miR-465c-5p 0.032 0.165 2.731 6.639 mmu-miR-2144 0.032 0.134 1.997 3.99 mmu-miR-150 0.032 0.165 1.361 2.569 mmu-miR-1893 0.032 0.134 2.127 4.367 mmu-miR-376b* 0.034 0.141 2.208 4.622 mmu-miR-669o 0.035 0.144 0.994 1.992 mmu-miR-338-3p 0.035 0.178 2.041 4.117 mmu-miR-484 0.036 0.178 1.104 2.149 mmu-miR-1190 0.036 0.145 3.539 11.624 mmu-miR-1892 0.037 0.145 2.034 4.095 mmu-miR-449c 0.037 0.184 3.809 14.011 mmu-miR-365 0.038 0.184 1.941 3.84 mmu-miR-680 0.038 0.15 1.359 2.565 mmu-miR-669b 0.038 0.184 3.814 14.064 mmu-miR-1951 0.039 0.15 1.562 2.952 mmu-miR-202-5p 0.039 0.185 5.851 57.721 mmu-miR-23b 0.042 0.194 1.836 3.57 mmu-miR-7a 0.042 0.194 1.396 2.632 mmu-let-7i* 0.043 0.163 3.336 10.098 mmu-miR-483 0.043 0.197 2.319 4.99 mmu-miR-30e* 0.043 0.163 1.207 2.308 mmu-miR-24-2* 0.044 0.163 2.326 5.014 mmu-miR-485 0.044 0.199 2.164 4.482 mmu-miR-673-5p 0.045 0.166 1.044 2.062 mmu-miR-684 0.045 0.166 1.063 2.09 mmu-miR-28* 0.046 0.166 1.023 2.033 mmu-miR-452 0.047 0.209 1.551 2.93 mmu-miR-31* 0.047 0.168 2.859 7.255 mmu-miR-409-3p 0.048 0.213 1.779 3.432 mmu-miR-488* 0.048 0.172 3.197 9.168 mmu-miR-496 0.049 0.217 2.199 4.592 BATvsING BATvsING BATvsING BATvsING miRNA p-value FDR logFC FC mmu-miR-378* <0.0001 0.001 4.336 20.201 mmu-miR-805 <0.0001 0.001 3.596 12.095 mmu-miR-715 <0.0001 0.001 3.224 9.343 mmu-miR-702 <0.0001 0.001 3.224 9.343 mmu-miR-1945 <0.0001 0.011 4.039 16.437 mmu-miR-1935 <0.0001 0.015 2.344 5.076 mmu-miR-1199 <0.0001 0.016 2.256 4.778 mmu-miR-30c-1* <0.0001 0.016 5.636 49.74 mmu-miR-1940 0.001 0.021 3.199 9.182 mmu-miR-1942 0.001 0.022 6.009 64.394 mmu-miR-718 0.001 0.023 4.671 25.481 mmu-miR-714 0.001 0.023 1.756 3.378 mmu-miR-2134 0.001 0.023 2.821 7.068 mmu-miR-706 0.001 0.026 2.091 4.261 mmu-miR-1932 0.001 0.026 2.836 7.142 mmu-miR-299 0.001 0.425 7.201 147.184 mmu-miR-1963 0.001 0.029 2.414 5.329 mmu-miR-707 0.002 0.029 4.449 21.839 mmu-miR-763 0.002 0.029 1.474 2.777 mmu-miR-1961 0.002 0.029 1.474 2.777 mmu-miR-503* 0.002 0.029 1.626 3.087 mmu-miR-1839-3p 0.002 0.033 2.116 4.336 mmu-miR-1949 0.002 0.036 2.046 4.131 mmu-miR-1946a 0.003 0.045 1.794 3.467 mmu-miR-874 0.004 0.06 1.486 2.802 mmu-miR-500 0.004 0.425 3.901 14.944 mmu-miR-684 0.005 0.066 1.641 3.119 mmu-miR-1901 0.005 0.066 2.034 4.095 mmu-miR-99b* 0.005 0.066 1.599 3.029 mmu-miR-1897-3p 0.006 0.066 2.859 7.254 mmu-miR-10a* 0.006 0.066 1.639 3.114 mmu-miR-2133 0.006 0.066 1.629 3.093 mmu-miR-1946b 0.006 0.066 2.024 4.066 mmu-miR-193b 0.007 0.425 2.834 7.13 mmu-miR-1191 0.007 0.068 3.381 10.42 mmu-miR-689 0.007 0.072 3.359 10.259 mmu-miR-223 0.008 0.425 1.889 3.703 mmu-miR-15b* 0.008 0.076 1.891 3.71 mmu-miR-877* 0.008 0.076 1.791 3.461 mmu-miR-880 0.009 0.077 6.431 86.303 mmu-miR-761 0.009 0.077 2.029 4.081 mmu-miR-465a-5p 0.009 0.425 1.701 3.251 mmu-miR-1194 0.01 0.081 1.314 2.486 mmu-miR-302c* 0.01 0.081 3.754 13.49 mmu-miR-1907 0.011 0.087 1.244 2.368 mmu-miR-1274a 0.011 0.087 1.314 2.486 mmu-miR-191* 0.011 0.087 1.966 3.908 mmu-miR-21 0.014 0.425 2.451 5.468 mmu-miR-148b 0.014 0.425 1.326 2.507 mmu-miR-455 0.014 0.425 3.146 8.855 mmu-miR-703 0.014 0.108 1.899 3.729 mmu-miR-883b-3p 0.015 0.109 4.551 23.447 mmu-miR-193* 0.016 0.117 1.254 2.385 mmu-miR-147 0.016 0.425 2.106 4.305 mmu-miR-568 0.017 0.425 5.549 46.818 mmu-miR-378 0.017 0.425 3.161 8.947 mmu-miR-34c* 0.017 0.119 1.419 2.673 mmu-miR-669h-3p 0.018 0.425 1.276 2.422 mmu-miR-325 0.019 0.425 6.319 79.837 mmu-miR-1904 0.02 0.139 1.069 2.098 mmu-miR-433* 0.02 0.139 3.996 15.957 mmu-miR-682 0.021 0.144 3.269 9.637 mmu-miR-208a 0.022 0.425 4.296 19.644 mmu-miR-339-3p 0.022 0.425 24.721 27663479.2 mmu-let-7d 0.022 0.425 1.461 2.754 mmu-miR-10b 0.023 0.425 1.274 2.418 mmu-miR-574-5p 0.023 0.425 4.189 18.234 mmu-miR-7b 0.025 0.425 2.199 4.592 mmu-miR-678 0.025 0.165 2.614 6.121 mmu-miR-224 0.026 0.425 1.329 2.511 mmu-miR-99a 0.027 0.425 1.306 2.473 mmu-miR-204 0.027 0.425 1.559 2.946 mmu-miR-100 0.027 0.425 1.291 2.447 mmu-miR-375 0.028 0.425 3.239 9.441 mmu-miR-19b 0.028 0.425 1.624 3.081 mmu-miR-432 0.028 0.181 1.239 2.36 mmu-miR-1930 0.029 0.181 1.131 2.191 mmu-miR-138* 0.03 0.189 1.834 3.565 mmu-miR-2182 0.033 0.202 1.229 2.344 mmu-miR-184 0.035 0.477 2.241 4.727 mmu-miR-182 0.036 0.477 2.551 5.862 mmu-miR-1965 0.036 0.216 1.159 2.233 mmu-miR-337-3p 0.037 0.477 2.224 4.672 mmu-miR-434-3p 0.038 0.477 1.314 2.486 mmu-miR-409-5p 0.038 0.477 1.539 2.905 mmu-miR-876-5p 0.038 0.225 2.669 6.359 mmu-miR-488* 0.039 0.226 3.376 10.384 mmu-miR-1948 0.041 0.232 5.039 32.873 mmu-miR-148a 0.042 0.477 1.009 2.012 mmu-miR-1896 0.043 0.237 1.234 2.352 mmu-miR-452 0.043 0.477 1.584 2.997 mmu-miR-27a* 0.043 0.237 1.111 2.16 mmu-miR-2146 0.044 0.238 1.471 2.773 mmu-miR-34b-5p 0.045 0.477 2.151 4.443 mmu-miR-187 0.045 0.477 1.356 2.56 mmu-miR-134 0.045 0.477 1.121 2.175 mmu-miR-590-3p 0.045 0.477 1.121 2.175 mmu-miR-196a* 0.045 0.242 3.666 12.696 mmu-miR-683 0.047 0.245 4.734 26.609 mmu-miR-183* 0.049 0.25 3.189 9.119 mmu-miR-802 0.05 0.253 4.554 23.488 FDR = false discovery rate, * indicates star species miRNA, in which the 3-5 fragment induces the repression.

[0120] As in the first cohort, in the sham operated ADicerKO mice (KO Con) circulating exosomal miRNAs were markedly reduced compared to controls (FIG. 2c). By comparison, ADicerKO mice that received fat transplants showed remarkable restoration of circulating exosomal miRNAs (FIGS. 2c and 7d; Table 7).

TABLE-US-00009 TABLE 7 Serum exosomal miRNA signatures after fat transplantation SALvsWT SALvsWT SALvsWT SALvsWT miRNA p-value logFC FC FDR mmu-miR-19b <0.0001 14.441 22239.448 <0.0001 mmu-miR-19a <0.0001 14.388 21432.314 <0.0001 mmu-miR-22 <0.0001 13.074 8624.151 <0.0001 mmu-miR-133b <0.0001 12.603 6222.736 <0.0001 mmu-miR-1 <0.0001 11.748 3438.348 <0.0001 mmu-miR-29a <0.0001 11.112 2212.814 <0.0001 mmu-miR-15a <0.0001 10.894 1903.141 <0.0001 mmu-miR-20a <0.0001 10.108 1103.854 <0.0001 mmu-miR-323-5p <0.0001 10.104 1100.67 <0.0001 mmu-miR-212 <0.0001 10.093 1092.436 <0.0001 mmu-miR-328 <0.0001 10.082 1083.638 <0.0001 mmu-miR-106a <0.0001 9.944 985.128 <0.0001 mmu-miR-185 <0.0001 9.764 869.575 <0.0001 mmu-miR-133a <0.0001 9.506 727.011 <0.0001 mmu-let-7a <0.0001 9.418 683.833 <0.0001 mmu-miR-324-3p <0.0001 9.361 657.494 0.001 mmu-miR-101b <0.0001 8.952 495.131 <0.0001 mmu-miR-291a-5p <0.0001 8.915 482.706 <0.0001 mmu-let-7g <0.0001 8.893 475.51 <0.0001 mmu-miR-130a <0.0001 8.788 442.132 <0.0001 mmu-miR-92b <0.0001 8.541 372.432 <0.0001 mmu-miR-103 <0.0001 8.508 363.926 <0.0001 mmu-miR-93 <0.0001 8.392 335.848 <0.0001 mmu-miR-128 <0.0001 8.328 321.424 <0.0001 mmu-miR-29c <0.0001 8.314 318.283 <0.0001 mmu-miR-301a <0.0001 8.168 287.516 <0.0001 mmu-miR-127 <0.0001 8.118 277.722 <0.0001 mmu-miR-146a <0.0001 8.107 275.645 <0.0001 mmu-miR-326 <0.0001 8.094 273.267 <0.0001 mmu-miR-200a <0.0001 8.007 257.186 <0.0001 mmu-miR-101a <0.0001 7.998 255.557 <0.0001 mmu-miR-193b <0.0001 7.954 247.995 <0.0001 mmu-miR-148b <0.0001 7.684 205.667 <0.0001 mmu-miR-338-5p <0.0001 7.679 204.955 <0.0001 mmu-miR-21* <0.0001 7.644 200.043 0.019 mmu-miR-130b <0.0001 7.536 185.572 <0.0001 mmu-miR-20b <0.0001 7.501 181.124 <0.0001 mmu-miR-140 <0.0001 7.428 172.147 <0.0001 mmu-let-7e <0.0001 7.271 154.433 <0.0001 mmu-miR-92a <0.0001 7.203 147.374 <0.0001 mmu-miR-30b <0.0001 7.128 139.908 <0.0001 mmu-miR-320 <0.0001 7.123 139.424 <0.0001 mmu-miR-214 <0.0001 7.084 135.69 <0.0001 mmu-miR-186 <0.0001 7.078 135.064 0.001 mmu-miR-27a <0.0001 7.048 132.284 <0.0001 mmu-miR-127* <0.0001 7.001 128.074 <0.0001 mmu-miR-107 <0.0001 6.951 123.711 <0.0001 mmu-miR-188-3p <0.0001 6.916 120.746 <0.0001 mmu-miR-183 <0.0001 6.908 120.051 0.002 mmu-miR-207 <0.0001 6.888 118.398 <0.0001 mmu-miR-205 <0.0001 6.884 118.125 <0.0001 mmu-miR-125a-5p <0.0001 6.868 116.768 0.04 mmu-miR-195 <0.0001 6.799 111.366 <0.0001 mmu-miR-100 <0.0001 6.769 109.074 <0.0001 mmu-miR-32 <0.0001 6.584 95.947 <0.0001 mmu-miR-199a-3p <0.0001 6.54 93.054 <0.0001 mmu-miR-26a <0.0001 6.473 88.852 0.003 mmu-miR-24 <0.0001 6.449 87.376 <0.0001 mmu-miR-16 <0.0001 6.388 83.768 <0.0001 mmu-miR-324-5p <0.0001 6.378 83.19 <0.0001 mmu-let-7d <0.0001 6.369 82.663 0.019 mmu-miR-335-3p <0.0001 6.343 81.149 <0.0001 mmu-miR-199a-5p <0.0001 6.338 80.868 <0.0001 mmu-miR-539 <0.0001 6.318 79.801 0.072 mmu-miR-187 <0.0001 6.29 78.249 0.03 mmu-miR-34a <0.0001 6.289 78.204 <0.0001 mmu-miR-181d <0.0001 6.185 72.756 <0.0001 mmu-miR-25 <0.0001 6.17 72.004 <0.0001 mmu-miR-222 <0.0001 6.042 65.875 <0.0001 mmu-miR-148a <0.0001 5.957 62.106 <0.0001 mmu-miR-18a <0.0001 5.884 59.062 0.002 mmu-miR-297a <0.0001 5.865 58.283 0.001 mmu-miR-204 <0.0001 5.844 57.447 <0.0001 mmu-let-7c <0.0001 5.816 56.33 <0.0001 mmu-miR-21 <0.0001 5.704 52.135 <0.0001 mmu-miR-125a-3p <0.0001 5.691 51.655 0.002 mmu-miR-145 <0.0001 5.638 49.78 <0.0001 mmu-miR-350 0.015 5.615 49.01 0.04 mmu-miR-542-3p 0.009 5.531 46.232 0.026 mmu-miR-199b <0.0001 5.485 44.787 0.002 mmu-miR-99a <0.0001 5.466 44.196 <0.0001 mmu-miR-150 0.005 5.416 42.69 0.015 mmu-miR-134 0.001 5.385 41.788 0.003 mmu-miR-200b <0.0001 5.381 41.667 0.001 mmu-miR-30e* 0.003 5.377 41.547 0.011 mmu-miR-218 0.003 5.365 41.212 0.011 mmu-miR-346 0.005 5.363 41.141 0.015 mmu-miR-194 0.002 5.348 40.739 0.007 mmu-let-7b <0.0001 5.338 40.457 0.001 mmu-miR-181a 0.011 5.316 39.831 0.03 mmu-miR-301b 0.003 5.316 39.831 0.009 mmu-miR-598 <0.0001 5.304 39.511 0.001 mmu-miR-125b-3p 0.001 5.274 38.697 0.003 mmu-miR-125b-5p <0.0001 5.268 38.541 <0.0001 mmu-miR-129-5p <0.0001 5.251 38.077 0.001 mmu-miR-197 <0.0001 5.221 37.293 <0.0001 mmu-miR-706 <0.0001 5.098 34.237 0.002 mmu-miR-183* 0.023 5.044 32.995 0.055 mmu-miR-302c <0.0001 5.041 32.919 0.001 mmu-miR-135a* 0.013 4.998 31.945 0.035 mmu-miR-30d <0.0001 4.985 31.669 <0.0001 mmu-miR-139-5p 0.001 4.968 31.287 0.004 mmu-miR-221 <0.0001 4.961 31.143 0.001 mmu-miR-339-5p 0.002 4.898 29.823 0.007 mmu-miR-149 0.002 4.879 29.429 0.007 mmu-miR-298 0.001 4.878 29.395 0.002 mmu-miR-7a <0.0001 4.831 28.459 0.002 mmu-miR-129-3p 0.004 4.771 27.3 0.014 mmu-miR-155 <0.0001 4.714 26.249 0.001 mmu-miR-142-5p <0.0001 4.694 25.887 <0.0001 mmu-miR-26b 0.001 4.678 25.605 0.004 mmu-miR-146b 0.01 4.623 24.647 0.028 mmu-miR-181b 0.02 4.428 21.518 0.05 mmu-miR-188-5p 0.001 4.411 21.271 0.002 mmu-miR-33 0.002 4.371 20.69 0.007 mmu-miR-27b <0.0001 4.336 20.194 0.001 mmu-miR-191 <0.0001 4.3 19.698 0.001 mmu-miR-300 0.03 4.271 19.304 0.068 mmu-miR-196a 0.004 4.219 18.625 0.013 mmu-let-7a* 0.015 4.218 18.603 0.039 mmu-miR-1943 0.003 4.191 18.263 0.009 mmu-miR-31* 0.003 4.183 18.168 0.009 mmu-miR-345-5p 0.017 4.112 17.288 0.044 mmu-let-7d* 0.001 4.044 16.497 0.002 mmu-miR-711 0.035 4.043 16.488 0.076 mmu-miR-17 <0.0001 3.975 15.725 0.002 mmu-miR-342-3p 0.011 3.922 15.154 0.03 mmu-miR-210 0.03 3.896 14.885 0.068 mmu-miR-1934 0.042 3.852 14.437 0.088 mmu-miR-670 0.007 3.834 14.263 0.02 mmu-miR-139-3p 0.004 3.81 14.026 0.014 mmu-miR-322 0.023 3.804 13.969 0.055 mmu-miR-124 0.024 3.799 13.921 0.057 mmu-miR-196a* 0.011 3.796 13.889 0.031 mmu-miR-879* 0.013 3.746 13.416 0.036 mmu-miR-15b <0.0001 3.739 13.354 0.002 mmu-miR-296-3p 0.004 3.698 12.981 0.013 mmu-miR-10b 0.029 3.655 12.597 0.066 mmu-miR-92a* 0.044 3.595 12.084 0.091 mmu-miR-296-5p 0.033 3.564 11.828 0.073 mmu-miR-770-3p 0.005 3.548 11.692 0.016 mmu-miR-872* 0.038 3.521 11.478 0.08 mmu-miR-10a 0.002 3.463 11.03 0.006 mmu-miR-511 0.036 3.423 10.728 0.077 mmu-miR-151-5p 0.037 3.422 10.716 0.079 mmu-miR-2140 <0.0001 3.417 10.679 0.002 mmu-miR-337-3p 0.033 3.386 10.453 0.072 mmu-miR-1895 0.021 3.322 9.998 0.051 mmu-miR-669i 0.048 3.215 9.286 0.096 mmu-miR-497 0.019 3.214 9.28 0.048 mmu-miR-493 0.001 3.123 8.714 0.005 mmu-miR-669m 0.034 3.118 8.679 0.073 mmu-miR-1196 0.001 3.096 8.549 0.003 mmu-miR-1983 0.044 3.031 8.173 0.091 mmu-miR-1955 0.02 2.999 7.995 0.05 mmu-miR-1197 0.003 2.986 7.922 0.01 mmu-miR-760 0.025 2.98 7.89 0.059 mmu-miR-152 0.005 2.977 7.872 0.015 mmu-miR-1954 0.007 2.934 7.643 0.02 mmu-miR-30e 0.036 2.893 7.43 0.077 mmu-miR-1898 0.013 2.878 7.353 0.035 mmu-miR-467e* 0.045 2.86 7.26 0.092 mmu-miR-1899 0.006 2.814 7.033 0.017 mmu-miR-540-3p 0.03 2.798 6.952 0.068 mmu-miR-203 0.008 2.762 6.782 0.022 mmu-miR-291b-5p 0.044 2.7 6.498 0.091 mmu-miR-99b 0.012 2.453 5.474 0.033 mmu-miR-151-3p 0.018 2.448 5.458 0.047 mmu-miR-20b* 0.032 2.411 5.318 0.072 mmu-miR-1952 0.042 2.26 4.79 0.087 mmu-miR-126-5p 0.021 2.157 4.459 0.051 mmu-miR-2136 0.019 2.138 4.4 0.047 mmu-miR-130b* 0.027 2.123 4.357 0.064 mmu-miR-184 0.015 2.086 4.245 0.039 mmu-miR-99b* 0.012 2.067 4.189 0.032 mmu-miR-876-3p 0.03 1.978 3.94 0.068 mmu-miR-2133 0.032 1.668 3.177 0.071 INGvsSAL INGvsSAL INGvsSAL INGvsSAL miRNA p-value logFC FC FDR mmu-miR-19a <0.0001 12.755 6912.539 <0.0001 mmu-miR-19b <0.0001 12.303 5051.514 <0.0001 mmu-miR-22 <0.0001 10.543 1491.45 <0.0001 mmu-miR-323-5p <0.0001 11.22 2385.374 <0.0001 mmu-miR-204 <0.0001 11.985 4053.634 <0.0001 mmu-miR-193b <0.0001 8.535 370.929 <0.0001 mmu-let-7a <0.0001 8.408 339.555 <0.0001 mmu-miR-92b <0.0001 7.078 135.064 <0.0001 mmu-miR-17 <0.0001 8.54 372.217 <0.0001 mmu-miR-15a <0.0001 8.268 308.152 <0.0001 mmu-miR-101a <0.0001 9.16 572.051 <0.0001 mmu-miR-133b <0.0001 9.42 685.019 <0.0001 mmu-miR-183 <0.0001 12.338 5175.563 <0.0001 mmu-miR-185 <0.0001 6.898 119.221 <0.0001 mmu-miR-212 <0.0001 8.98 504.951 <0.0001 mmu-miR-199a-5p <0.0001 6.27 77.172 <0.0001 mmu-miR-129-3p <0.0001 10.5 1448.155 <0.0001 mmu-miR-124 <0.0001 11.1 2194.992 <0.0001 mmu-miR-29a <0.0001 9.893 950.472 <0.0001 mmu-miR-130a <0.0001 8.04 263.197 <0.0001 mmu-miR-188-3p <0.0001 6.255 76.373 <0.0001 mmu-miR-207 <0.0001 5.495 45.098 <0.0001 mmu-miR-7a <0.0001 7.49 179.769 <0.0001 mmu-miR-291a-5p <0.0001 6.63 99.044 <0.0001 mmu-miR-200b <0.0001 7.92 242.191 <0.0001 mmu-miR-27a <0.0001 6.25 76.109 <0.0001 mmu-miR-181d <0.0001 7.158 142.765 <0.0001 mmu-miR-706 <0.0001 7.285 155.957 <0.0001 mmu-miR-1955 <0.0001 7.05 132.514 <0.0001 mmu-let-7c <0.0001 4.545 23.344 <0.0001 mmu-miR-129-5p <0.0001 6.298 78.657 <0.0001 mmu-miR-30d <0.0001 4.908 30.013 <0.0001 mmu-let-7e <0.0001 5.223 37.336 <0.0001 mmu-miR-24 <0.0001 4.8 27.858 <0.0001 mmu-miR-148a <0.0001 4.993 31.834 <0.0001 mmu-miR-30b <0.0001 7.488 179.458 <0.0001 mmu-miR-148b <0.0001 6.333 80.588 <0.0001 mmu-miR-335-3p <0.0001 6.225 74.802 <0.0001 mmu-miR-20a <0.0001 7.29 156.498 <0.0001 mmu-miR-328 <0.0001 7.845 229.922 <0.0001 mmu-miR-188-5p <0.0001 5.585 48.001 <0.0001 mmu-miR-184 <0.0001 3.998 15.972 <0.0001 mmu-miR-99a <0.0001 4.658 25.238 <0.0001 mmu-miR-598 <0.0001 5.9 59.714 <0.0001 mmu-let-7g <0.0001 7.613 195.7 <0.0001 mmu-miR-100 <0.0001 5.633 49.608 <0.0001 mmu-miR-127 <0.0001 7.498 180.706 <0.0001 mmu-miR-106a <0.0001 6.918 120.886 <0.0001 mmu-miR-338-5p <0.0001 6.39 83.865 <0.0001 mmu-miR-134 <0.0001 6.28 77.708 <0.0001 mmu-miR-133a <0.0001 6.483 89.418 0.001 mmu-miR-195 <0.0001 4.053 16.593 0.001 mmu-miR-149 <0.0001 6.098 68.475 0.001 mmu-miR-20b <0.0001 4.58 23.918 0.001 mmu-miR-25 <0.0001 3.915 15.085 0.001 mmu-miR-125a-3p <0.0001 5.823 56.591 0.001 mmu-miR-770-3p <0.0001 4.848 28.79 0.001 mmu-miR-92a <0.0001 4.04 16.45 0.001 mmu-miR-101b <0.0001 6.655 100.775 0.001 mmu-miR-125b-5p <0.0001 4.413 21.296 0.001 mmu-miR-326 <0.0001 5.493 45.02 0.001 mmu-miR-205 <0.0001 3.85 14.42 0.002 mmu-miR-31* <0.0001 5.033 32.729 0.002 mmu-miR-301a <0.0001 5.868 58.384 0.002 mmu-miR-218 <0.0001 6.515 91.456 0.002 mmu-miR-127* <0.0001 4.603 24.294 0.002 mmu-miR-26b <0.0001 4.788 27.617 0.002 mmu-miR-16 <0.0001 3.32 9.987 0.002 mmu-miR-291b-5p <0.0001 4.975 31.45 0.002 mmu-miR-222 <0.0001 3.593 12.063 0.002 mmu-miR-1 0.001 5.798 55.619 0.003 mmu-miR-320 0.001 4.708 26.128 0.003 mmu-miR-145 0.001 3.14 8.815 0.004 mmu-miR-27b 0.001 3.368 10.321 0.004 mmu-miR-191 0.001 3.275 9.68 0.004 mmu-miR-93 0.001 4.613 24.463 0.004 mmu-miR-128 0.001 3.29 9.781 0.005 mmu-miR-146a 0.001 4.66 25.281 0.005 mmu-miR-298 0.001 4.085 16.971 0.005 mmu-miR-200a 0.001 4.88 29.446 0.005 mmu-let-7d* 0.001 3.365 10.303 0.005 mmu-miR-342-3p 0.002 4.775 27.379 0.006 mmu-miR-199a-3p 0.002 4.063 16.708 0.007 mmu-miR-197 0.002 3.413 10.648 0.007 mmu-miR-186 0.002 4.88 29.446 0.007 mmu-miR-1196 0.002 2.538 5.806 0.007 mmu-miR-142-5p 0.003 2.678 6.397 0.01 mmu-miR-130b 0.003 4.528 23.063 0.01 mmu-let-7b 0.003 3.515 11.432 0.011 mmu-miR-297a 0.003 4.095 17.089 0.012 mmu-miR-32 0.004 3.903 14.954 0.013 mmu-miR-214 0.004 3.253 9.53 0.013 mmu-miR-324-3p 0.004 6.188 72.882 0.014 mmu-miR-346 0.004 5.025 32.559 0.014 mmu-miR-152 0.005 2.738 6.669 0.015 mmu-miR-33 0.005 3.585 12 0.016 mmu-miR-1952 0.005 3.058 8.325 0.016 mmu-miR-196a 0.005 3.763 13.571 0.016 mmu-miR-181b 0.005 5.09 34.06 0.017 mmu-let-7d 0.006 5.99 63.558 0.017 mmu-miR-872* 0.007 4.478 22.277 0.02 mmu-miR-30e* 0.007 4.493 22.51 0.02 mmu-miR-194 0.007 4.13 17.509 0.021 mmu-miR-187 0.008 6.115 69.31 0.022 mmu-miR-221 0.008 2.783 6.88 0.022 mmu-miR-155 0.008 2.848 7.198 0.023 mmu-miR-99b 0.008 2.413 5.324 0.023 mmu-miR-34a 0.01 2.423 5.361 0.027 mmu-miR-302c 0.011 2.865 7.285 0.029 mmu-miR-301b 0.012 3.925 15.189 0.031 mmu-miR-183* 0.013 5.19 36.504 0.033 mmu-miR-130b* 0.015 2.213 4.635 0.036 mmu-miR-139-5p 0.016 3.123 8.709 0.039 mmu-miR-30e 0.016 3.143 8.831 0.039 mmu-miR-1983 0.018 3.385 10.447 0.043 mmu-miR-345-5p 0.023 3.618 12.274 0.052 mmu-miR-135a* 0.023 4.153 17.784 0.052 mmu-miR-669m 0.023 3.113 8.649 0.053 mmu-miR-139-3p 0.025 2.633 6.201 0.055 mmu-miR-337-3p 0.027 3.273 9.663 0.059 mmu-miR-324-5p 0.027 2.708 6.532 0.06 mmu-miR-107 0.027 2.178 4.524 0.06 mmu-miR-296-3p 0.031 2.405 5.296 0.067 mmu-miR-467e* 0.033 2.838 7.148 0.071 mmu-miR-199b 0.033 2.68 6.409 0.071 mmu-miR-493 0.035 1.74 3.34 0.073 mmu-miR-1954 0.036 2 4 0.074 mmu-miR-760 0.037 2.528 5.766 0.077 mmu-miR-210 0.037 3.443 10.872 0.077 mmu-miR-29c 0.038 2.983 7.904 0.078 mmu-miR-203 0.041 1.858 3.624 0.084 mmu-miR-15b 0.042 1.738 3.335 0.084 mmu-miR-103 0.042 1.703 3.255 0.084 mmu-miR-879* 0.044 2.723 6.6 0.087 mmu-miR-339-5p 0.044 2.683 6.42 0.087 INGvsSAL INGvsSAL INGvsSAL INGvsSAL miRNA p-value logFC FC FDR mmu-miR-19a <0.0001 12.755 6912.539 <0.0001 mmu-miR-19b <0.0001 12.303 5051.514 <0.0001 mmu-miR-22 <0.0001 10.543 1491.45 <0.0001 mmu-miR-323-5p <0.0001 11.22 2385.374 <0.0001 mmu-miR-204 <0.0001 11.985 4053.634 <0.0001 mmu-miR-193b <0.0001 8.535 370.929 <0.0001 mmu-let-7a <0.0001 8.408 339.555 <0.0001 mmu-miR-92b <0.0001 7.078 135.064 <0.0001 mmu-miR-17 <0.0001 8.54 372.217 <0.0001 mmu-miR-15a <0.0001 8.268 308.152 <0.0001 mmu-miR-101a <0.0001 9.16 572.051 <0.0001 mmu-miR-133b <0.0001 9.42 685.019 <0.0001 mmu-miR-183 <0.0001 12.338 5175.563 <0.0001 mmu-miR-185 <0.0001 6.898 119.221 <0.0001 mmu-miR-212 <0.0001 8.98 504.951 <0.0001 mmu-miR-199a-5p <0.0001 6.27 77.172 <0.0001 mmu-miR-129-3p <0.0001 10.5 1448.155 <0.0001 mmu-miR-124 <0.0001 11.1 2194.992 <0.0001 mmu-miR-29a <0.0001 9.893 950.472 <0.0001 mmu-miR-130a <0.0001 8.04 263.197 <0.0001 mmu-miR-188-3p <0.0001 6.255 76.373 <0.0001 mmu-miR-207 <0.0001 5.495 45.098 <0.0001 mmu-miR-7a <0.0001 7.49 179.769 <0.0001 mmu-miR-291a-5p <0.0001 6.63 99.044 <0.0001 mmu-miR-200b <0.0001 7.92 242.191 <0.0001 mmu-miR-27a <0.0001 6.25 76.109 <0.0001 mmu-miR-181d <0.0001 7.158 142.765 <0.0001 mmu-miR-706 <0.0001 7.285 155.957 <0.0001 mmu-miR-1955 <0.0001 7.05 132.514 <0.0001 mmu-let-7c <0.0001 4.545 23.344 <0.0001 mmu-miR-129-5p <0.0001 6.298 78.657 <0.0001 mmu-miR-30d <0.0001 4.908 30.013 <0.0001 mmu-let-7e <0.0001 5.223 37.336 <0.0001 mmu-miR-24 <0.0001 4.8 27.858 <0.0001 mmu-miR-148a <0.0001 4.993 31.834 <0.0001 mmu-miR-30b <0.0001 7.488 179.458 <0.0001 mmu-miR-148b <0.0001 6.333 80.588 <0.0001 mmu-miR-335-3p <0.0001 6.225 74.802 <0.0001 mmu-miR-20a <0.0001 7.29 156.498 <0.0001 mmu-miR-328 <0.0001 7.845 229.922 <0.0001 mmu-miR-188-5p <0.0001 5.585 48.001 <0.0001 mmu-miR-184 <0.0001 3.998 15.972 <0.0001 mmu-miR-99a <0.0001 4.658 25.238 <0.0001 mmu-miR-598 <0.0001 5.9 59.714 <0.0001 mmu-let-7g <0.0001 7.613 195.7 <0.0001 mmu-miR-100 <0.0001 5.633 49.608 <0.0001 mmu-miR-127 <0.0001 7.498 180.706 <0.0001 mmu-miR-106a <0.0001 6.918 120.886 <0.0001 mmu-miR-338-5p <0.0001 6.39 83.865 <0.0001 mmu-miR-134 <0.0001 6.28 77.708 <0.0001 mmu-miR-133a <0.0001 6.483 89.418 0.001 mmu-miR-195 <0.0001 4.053 16.593 0.001 mmu-miR-149 <0.0001 6.098 68.475 0.001 mmu-miR-20b <0.0001 4.58 23.918 0.001 mmu-miR-25 <0.0001 3.915 15.085 0.001 mmu-miR-125a-3p <0.0001 5.823 56.591 0.001 mmu-miR-770-3p <0.0001 4.848 28.79 0.001 mmu-miR-92a <0.0001 4.04 16.45 0.001 mmu-miR-101b <0.0001 6.655 100.775 0.001 mmu-miR-125b-5p <0.0001 4.413 21.296 0.001 mmu-miR-326 <0.0001 5.493 45.02 0.001 mmu-miR-205 <0.0001 3.85 14.42 0.002 mmu-miR-31* <0.0001 5.033 32.729 0.002 mmu-miR-301a <0.0001 5.868 58.384 0.002 mmu-miR-218 <0.0001 6.515 91.456 0.002 mmu-miR-127* <0.0001 4.603 24.294 0.002 mmu-miR-26b <0.0001 4.788 27.617 0.002 mmu-miR-16 <0.0001 3.32 9.987 0.002 mmu-miR-291b-5p <0.0001 4.975 31.45 0.002 mmu-miR-222 <0.0001 3.593 12.063 0.002 mmu-miR-1 0.001 5.798 55.619 0.003 mmu-miR-320 0.001 4.708 26.128 0.003 mmu-miR-145 0.001 3.14 8.815 0.004 mmu-miR-27b 0.001 3.368 10.321 0.004 mmu-miR-191 0.001 3.275 9.68 0.004 mmu-miR-93 0.001 4.613 24.463 0.004 mmu-miR-128 0.001 3.29 9.781 0.005 mmu-miR-146a 0.001 4.66 25.281 0.005 mmu-miR-298 0.001 4.085 16.971 0.005 mmu-miR-200a 0.001 4.88 29.446 0.005 mmu-let-7d* 0.001 3.365 10.303 0.005 mmu-miR-342-3p 0.002 4.775 27.379 0.006 mmu-miR-199a-3p 0.002 4.063 16.708 0.007 mmu-miR-197 0.002 3.413 10.648 0.007 mmu-miR-186 0.002 4.88 29.446 0.007 mmu-miR-1196 0.002 2.538 5.806 0.007 mmu-miR-142-5p 0.003 2.678 6.397 0.01 mmu-miR-130b 0.003 4.528 23.063 0.01 mmu-let-7b 0.003 3.515 11.432 0.011 mmu-miR-297a 0.003 4.095 17.089 0.012 mmu-miR-32 0.004 3.903 14.954 0.013 mmu-miR-214 0.004 3.253 9.53 0.013 mmu-miR-324-3p 0.004 6.188 72.882 0.014 mmu-miR-346 0.004 5.025 32.559 0.014 mmu-miR-152 0.005 2.738 6.669 0.015 mmu-miR-33 0.005 3.585 12 0.016 mmu-miR-1952 0.005 3.058 8.325 0.016 mmu-miR-196a 0.005 3.763 13.571 0.016 mmu-miR-181b 0.005 5.09 34.06 0.017 mmu-let-7d 0.006 5.99 63.558 0.017 mmu-miR-872* 0.007 4.478 22.277 0.02 mmu-miR-30e* 0.007 4.493 22.51 0.02 mmu-miR-194 0.007 4.13 17.509 0.021 mmu-miR-187 0.008 6.115 69.31 0.022 mmu-miR-221 0.008 2.783 6.88 0.022 mmu-miR-155 0.008 2.848 7.198 0.023 mmu-miR-99b 0.008 2.413 5.324 0.023 mmu-miR-34a 0.01 2.423 5.361 0.027 mmu-miR-302c 0.011 2.865 7.285 0.029 mmu-miR-301b 0.012 3.925 15.189 0.031 mmu-miR-183* 0.013 5.19 36.504 0.033 mmu-miR-130b* 0.015 2.213 4.635 0.036 mmu-miR-139-5p 0.016 3.123 8.709 0.039 mmu-miR-30e 0.016 3.143 8.831 0.039 mmu-miR-1983 0.018 3.385 10.447 0.043 mmu-miR-345-5p 0.023 3.618 12.274 0.052 mmu-miR-135a* 0.023 4.153 17.784 0.052 mmu-miR-669m 0.023 3.113 8.649 0.053 mmu-miR-139-3p 0.025 2.633 6.201 0.055 mmu-miR-337-3p 0.027 3.273 9.663 0.059 mmu-miR-324-5p 0.027 2.708 6.532 0.06 mmu-miR-107 0.027 2.178 4.524 0.06 mmu-miR-296-3p 0.031 2.405 5.296 0.067 mmu-miR-467e* 0.033 2.838 7.148 0.071 mmu-miR-199b 0.033 2.68 6.409 0.071 mmu-miR-493 0.035 1.74 3.34 0.073 mmu-miR-1954 0.036 2 4 0.074 mmu-miR-760 0.037 2.528 5.766 0.077 mmu-miR-210 0.037 3.443 10.872 0.077 mmu-miR-29c 0.038 2.983 7.904 0.078 mmu-miR-203 0.041 1.858 3.624 0.084 mmu-miR-15b 0.042 1.738 3.335 0.084 mmu-miR-103 0.042 1.703 3.255 0.084 mmu-miR-879* 0.044 2.723 6.6 0.087 mmu-miR-339-5p 0.044 2.683 6.42 0.087 EPIvsSAL EPIvsSAL EPIvsSAL EPIvsSAL miRNA p-value logFC FC FDR mmu-miR-22 <0.0001 11.77 3492.393 <0.0001 mmu-miR-19b <0.0001 12.65 6427.313 <0.0001 mmu-miR-19a <0.0001 12.458 5624.464 <0.0001 mmu-miR-92b <0.0001 9.335 645.825 <0.0001 mmu-miR-323-5p <0.0001 10.398 1348.837 <0.0001 mmu-miR-193b <0.0001 8.545 373.509 <0.0001 mmu-miR-133b <0.0001 11.94 3929.146 <0.0001 mmu-let-7a <0.0001 8.838 457.459 <0.0001 mmu-miR-207 <0.0001 7.813 224.8 <0.0001 mmu-miR-291a-5p <0.0001 9.528 738.012 <0.0001 mmu-miR-185 <0.0001 8.455 350.92 <0.0001 mmu-miR-15a <0.0001 7.838 228.73 <0.0001 mmu-miR-92a <0.0001 7.528 184.503 <0.0001 mmu-miR-326 <0.0001 10.503 1450.666 <0.0001 mmu-miR-25 <0.0001 6.693 103.429 <0.0001 mmu-miR-125a-3p <0.0001 9.81 897.644 <0.0001 mmu-miR-212 <0.0001 8.663 405.203 <0.0001 mmu-miR-328 <0.0001 10.788 1767.507 <0.0001 mmu-miR-127* <0.0001 7.935 244.722 <0.0001 mmu-let-7c <0.0001 5.385 41.788 <0.0001 mmu-miR-145 <0.0001 5.928 60.863 <0.0001 mmu-let-7e <0.0001 6.23 75.061 <0.0001 mmu-miR-302c <0.0001 7.583 191.673 <0.0001 mmu-miR-706 <0.0001 8.04 263.197 <0.0001 mmu-miR-29a <0.0001 9.32 639.145 <0.0001 mmu-miR-204 <0.0001 6.178 72.379 <0.0001 mmu-miR-199a-5p <0.0001 5.448 43.638 <0.0001 mmu-miR-20a <0.0001 8.748 429.794 <0.0001 mmu-miR-24 <0.0001 5.415 42.666 <0.0001 mmu-miR-133a <0.0001 8.955 496.276 <0.0001 mmu-miR-222 <0.0001 5.745 53.631 <0.0001 mmu-miR-129-5p <0.0001 6.663 101.301 <0.0001 mmu-miR-297a <0.0001 8.133 280.625 <0.0001 mmu-miR-188-3p <0.0001 5.545 46.689 <0.0001 mmu-miR-100 <0.0001 7.02 129.787 <0.0001 mmu-miR-101a <0.0001 6.763 108.571 <0.0001 mmu-miR-205 <0.0001 5.593 48.251 <0.0001 mmu-miR-214 <0.0001 6.425 85.925 <0.0001 mmu-miR-27a <0.0001 5.635 49.694 <0.0001 mmu-miR-195 <0.0001 5.048 33.071 <0.0001 mmu-miR-335-3p <0.0001 6.485 89.573 <0.0001 mmu-miR-106a <0.0001 8.263 307.086 <0.0001 mmu-miR-16 <0.0001 4.778 27.427 <0.0001 mmu-miR-93 <0.0001 7.25 152.219 <0.0001 mmu-miR-188-5p <0.0001 6.01 64.445 <0.0001 mmu-miR-20b <0.0001 5.775 54.758 <0.0001 mmu-miR-148b <0.0001 6.29 78.249 <0.0001 mmu-miR-148a <0.0001 4.905 29.961 <0.0001 mmu-miR-128 <0.0001 5.03 32.672 <0.0001 mmu-miR-99a <0.0001 4.945 30.803 <0.0001 mmu-miR-493 <0.0001 4.478 22.277 <0.0001 mmu-miR-146a <0.0001 7.005 128.444 <0.0001 mmu-miR-181d <0.0001 6.085 67.884 <0.0001 mmu-miR-197 <0.0001 5.325 40.085 <0.0001 mmu-miR-191 <0.0001 4.685 25.723 <0.0001 mmu-miR-130a <0.0001 5.968 62.574 <0.0001 mmu-miR-30d <0.0001 4.318 19.939 <0.0001 mmu-miR-30b <0.0001 6.72 105.42 <0.0001 mmu-miR-129-3p <0.0001 7.378 166.283 <0.0001 mmu-miR-125b-5p <0.0001 5.153 35.568 <0.0001 mmu-miR-338-5p <0.0001 6.528 92.251 <0.0001 mmu-miR-31* <0.0001 5.915 60.338 <0.0001 mmu-miR-139-5p <0.0001 6.245 75.846 <0.0001 mmu-miR-200a <0.0001 6.36 82.139 0.001 mmu-miR-467e* <0.0001 5.99 63.558 0.001 mmu-miR-221 <0.0001 4.498 22.588 0.001 mmu-miR-127 <0.0001 6.835 114.167 0.001 mmu-miR-1943 <0.0001 5.318 39.877 0.001 mmu-miR-1955 <0.0001 5.18 36.252 0.001 mmu-miR-149 <0.0001 5.888 59.199 0.001 mmu-miR-320 <0.0001 5.31 39.671 0.001 mmu-miR-130b* <0.0001 3.748 13.431 0.001 mmu-miR-669i <0.0001 6.415 85.331 0.001 mmu-miR-324-5p <0.0001 5.115 34.655 0.001 mmu-miR-199a-3p <0.0001 5.018 32.391 0.001 mmu-miR-1952 <0.0001 4.27 19.293 0.002 mmu-miR-298 <0.0001 4.69 25.813 0.002 mmu-let-7d <0.0001 8.373 331.416 0.002 mmu-miR-29c <0.0001 5.86 58.081 0.002 mmu-miR-770-3p <0.0001 4.405 21.185 0.002 mmu-miR-339-5p 0.001 5.32 39.947 0.002 mmu-miR-760 0.001 4.813 28.1 0.002 mmu-miR-300 0.001 7.098 136.949 0.002 mmu-miR-2140 0.001 3.013 8.07 0.003 mmu-miR-1898 0.001 3.993 15.917 0.003 mmu-miR-301a 0.001 5.228 37.466 0.003 mmu-miR-18a 0.001 4.95 30.91 0.003 mmu-miR-346 0.001 6.08 67.649 0.004 mmu-miR-10a 0.001 3.378 10.393 0.004 mmu-miR-183 0.001 5.685 51.446 0.004 mmu-let-7d* 0.001 3.443 10.872 0.004 mmu-let-7g 0.001 5.295 39.26 0.005 mmu-miR-324-3p 0.001 7.163 143.261 0.005 mmu-miR-1196 0.001 2.668 6.353 0.005 mmu-miR-1197 0.001 3.018 8.098 0.005 mmu-miR-342-3p 0.002 4.708 26.128 0.006 mmu-miR-1899 0.002 3.015 8.084 0.007 mmu-miR-92a* 0.003 5.445 43.562 0.008 mmu-miR-1 0.003 4.9 29.857 0.008 mmu-miR-21 0.003 2.675 6.386 0.008 mmu-miR-345-5p 0.003 5.078 33.766 0.008 mmu-miR-15b 0.003 2.773 6.833 0.009 mmu-miR-187 0.003 7.09 136.239 0.009 mmu-miR-1954 0.003 3.053 8.296 0.009 mmu-miR-1983 0.003 4.488 22.432 0.009 mmu-miR-181b 0.003 5.498 45.176 0.009 mmu-miR-27b 0.003 2.86 7.26 0.009 mmu-let-7b 0.004 3.45 10.928 0.01 mmu-miR-218 0.004 4.868 29.192 0.01 mmu-miR-540-3p 0.004 3.615 12.252 0.012 mmu-miR-199b 0.004 3.808 14.001 0.012 mmu-miR-30e* 0.005 4.77 27.284 0.012 mmu-miR-124 0.005 4.523 22.983 0.014 mmu-miR-10b 0.006 4.47 22.162 0.015 mmu-miR-183* 0.006 5.888 59.199 0.015 mmu-miR-350 0.007 5.968 62.574 0.016 mmu-miR-186 0.007 4.108 17.238 0.017 mmu-miR-876-3p 0.007 2.368 5.16 0.017 mmu-miR-296-3p 0.007 3.12 8.694 0.017 mmu-miR-99b 0.008 2.428 5.38 0.019 mmu-miR-125b-3p 0.008 3.62 12.295 0.019 mmu-miR-711 0.009 4.868 29.192 0.02 mmu-miR-196a* 0.009 3.658 12.619 0.02 mmu-miR-103 0.009 2.295 4.908 0.02 mmu-miR-194 0.009 3.985 15.835 0.02 mmu-miR-99b* 0.009 1.99 3.972 0.02 mmu-miR-879* 0.009 3.67 12.729 0.021 mmu-miR-101b 0.011 4.063 16.708 0.024 mmu-miR-7a 0.012 2.803 6.976 0.025 mmu-miR-130b 0.013 3.613 12.231 0.027 mmu-miR-872* 0.014 3.998 15.972 0.028 mmu-miR-670 0.014 3.153 8.892 0.028 mmu-miR-151-3p 0.016 2.328 5.019 0.032 mmu-miR-134 0.016 3.178 9.047 0.032 mmu-miR-181a 0.017 4.553 23.466 0.033 mmu-miR-151-5p 0.017 3.725 13.223 0.033 mmu-miR-1895 0.018 3.165 8.969 0.035 mmu-miR-140 0.018 3.035 8.196 0.035 mmu-miR-2133 0.019 1.713 3.277 0.037 mmu-miR-135a* 0.02 4.258 19.126 0.038 mmu-miR-139-3p 0.024 2.658 6.309 0.044 mmu-miR-669m 0.024 3.083 8.471 0.045 mmu-miR-155 0.029 2.26 4.79 0.053 mmu-miR-152 0.031 1.978 3.938 0.056 mmu-miR-32 0.04 2.583 5.99 0.07 mmu-miR-296-5p 0.042 3.133 8.77 0.072 mmu-miR-126-5p 0.045 1.695 3.238 0.076 BATvsSAL BATvsSAL BATvsSAL BATvsSAL miRNA p-value logFC FC FDR mmu-miR-22 <0.0001 13.274 9906.548 <0.0001 mmu-miR-19b <0.0001 15.088 34816.897 <0.0001 mmu-miR-19a <0.0001 15.021 33244.622 <0.0001 mmu-miR-323-5p <0.0001 11.954 3967.918 <0.0001 mmu-let-7a <0.0001 11.794 3551.387 <0.0001 mmu-miR-128 <0.0001 11.455 2807.363 <0.0001 mmu-miR-15a <0.0001 11.421 2741.659 <0.0001 mmu-miR-92b <0.0001 9.158 571.061 <0.0001 mmu-miR-103 <0.0001 9.771 873.603 <0.0001 mmu-let-7e <0.0001 10.161 1144.763 <0.0001 mmu-miR-133b <0.0001 12.843 7349.006 <0.0001 mmu-miR-193b <0.0001 8.048 264.569 <0.0001 mmu-miR-291a-5p <0.0001 10.695 1657.738 <0.0001 mmu-miR-207 <0.0001 8.254 305.318 <0.0001 mmu-miR-185 <0.0001 9.101 549.065 <0.0001 mmu-let-7c <0.0001 7.533 185.143 <0.0001 mmu-miR-195 <0.0001 8.286 312.093 <0.0001 mmu-miR-21 <0.0001 7.794 221.962 <0.0001 mmu-miR-27a <0.0001 8.921 484.661 <0.0001 mmu-miR-25 <0.0001 8.173 288.681 <0.0001 mmu-miR-16 <0.0001 7.592 192.894 <0.0001 mmu-miR-24 <0.0001 7.529 184.716 <0.0001 mmu-miR-212 <0.0001 10.267 1231.898 <0.0001 mmu-miR-145 <0.0001 7.298 157.314 <0.0001 mmu-miR-205 <0.0001 7.888 236.796 <0.0001 mmu-miR-204 <0.0001 8.111 276.442 <0.0001 mmu-miR-20b <0.0001 8.658 403.801 <0.0001 mmu-miR-130a <0.0001 9.748 860.084 <0.0001 mmu-miR-188-3p <0.0001 7.549 187.295 <0.0001 mmu-miR-181d <0.0001 9.562 755.698 <0.0001 mmu-miR-148a <0.0001 7.147 141.697 <0.0001 mmu-miR-29a <0.0001 11.388 2680.587 <0.0001 mmu-miR-199a-5p <0.0001 6.828 113.575 <0.0001 mmu-miR-92a <0.0001 7.473 177.704 <0.0001 mmu-miR-20a <0.0001 10.758 1732.132 <0.0001 mmu-miR-197 <0.0001 8.081 270.753 <0.0001 mmu-miR-302c <0.0001 8.544 373.294 <0.0001 mmu-miR-335-3p <0.0001 8.623 394.122 <0.0001 mmu-miR-222 <0.0001 7.038 131.447 <0.0001 mmu-miR-148b <0.0001 8.584 383.788 <0.0001 mmu-miR-328 <0.0001 11.182 2322.828 <0.0001 mmu-miR-1 <0.0001 11.521 2938.437 <0.0001 mmu-miR-29c <0.0001 11.071 2151.062 <0.0001 mmu-miR-17 <0.0001 6.815 112.595 <0.0001 mmu-miR-214 <0.0001 7.918 241.771 <0.0001 mmu-miR-146a <0.0001 9.69 826.001 <0.0001 mmu-miR-133a <0.0001 10.186 1164.773 <0.0001 mmu-miR-324-5p <0.0001 9.038 525.787 <0.0001 mmu-miR-338-5p <0.0001 9.653 804.808 <0.0001 mmu-miR-30d <0.0001 6.135 70.278 <0.0001 mmu-miR-298 <0.0001 8.434 345.889 <0.0001 mmu-miR-99a <0.0001 6.603 97.174 <0.0001 mmu-miR-7a <0.0001 7.931 244.016 <0.0001 mmu-miR-106a <0.0001 10.274 1238.318 <0.0001 mmu-miR-297a <0.0001 9.375 663.982 <0.0001 mmu-miR-10a <0.0001 6.413 85.233 <0.0001 mmu-miR-142-5p <0.0001 5.774 54.726 <0.0001 mmu-miR-100 <0.0001 7.826 226.888 <0.0001 mmu-miR-93 <0.0001 8.618 392.986 <0.0001 mmu-miR-34a <0.0001 6.109 69.031 <0.0001 mmu-miR-140 <0.0001 8.304 316.085 <0.0001 mmu-let-7g <0.0001 9.813 899.721 <0.0001 mmu-miR-200a <0.0001 8.973 502.623 <0.0001 mmu-miR-326 <0.0001 8.408 339.555 <0.0001 mmu-miR-30b <0.0001 8.485 358.294 <0.0001 mmu-miR-107 <0.0001 6.358 81.997 <0.0001 mmu-miR-199a-3p <0.0001 7.763 217.268 <0.0001 mmu-miR-26b <0.0001 7.598 193.788 <0.0001 mmu-miR-188-5p <0.0001 6.634 99.331 <0.0001 mmu-miR-129-5p <0.0001 6.694 103.549 <0.0001 mmu-miR-101a <0.0001 6.884 118.125 <0.0001 mmu-miR-191 <0.0001 5.567 47.395 <0.0001 mmu-miR-200b <0.0001 7.264 153.721 <0.0001 mmu-miR-1196 <0.0001 4.703 26.037 <0.0001 mmu-miR-127* <0.0001 6.961 124.572 <0.0001 mmu-miR-706 <0.0001 7.318 159.51 <0.0001 mmu-miR-320 <0.0001 7.673 204.128 <0.0001 mmu-miR-27b <0.0001 5.569 47.477 <0.0001 mmu-miR-101b <0.0001 9.525 736.734 <0.0001 mmu-miR-125a-3p <0.0001 7.918 241.771 <0.0001 mmu-miR-186 <0.0001 8.834 456.404 <0.0001 mmu-miR-15b <0.0001 5.223 37.336 <0.0001 mmu-let-7d* <0.0001 5.611 48.869 <0.0001 mmu-miR-301a <0.0001 8.194 292.88 <0.0001 mmu-miR-221 <0.0001 5.881 58.926 <0.0001 mmu-miR-770-3p <0.0001 6.421 85.677 <0.0001 mmu-miR-30e <0.0001 7.247 151.867 <0.0001 mmu-miR-125b-5p <0.0001 5.652 50.271 <0.0001 mmu-miR-493 <0.0001 4.44 21.706 <0.0001 mmu-let-7b <0.0001 5.842 57.348 <0.0001 mmu-miR-18a <0.0001 6.978 126.019 <0.0001 mmu-miR-1955 <0.0001 6.139 70.481 <0.0001 mmu-miR-139-5p <0.0001 6.641 99.791 <0.0001 mmu-miR-26a <0.0001 8.317 318.835 <0.0001 mmu-miR-199b <0.0001 6.445 87.124 <0.0001 mmu-miR-1943 <0.0001 6.078 67.532 <0.0001 mmu-miR-130b <0.0001 7.069 134.286 <0.0001 mmu-miR-1952 <0.0001 5.07 33.591 0.001 mmu-miR-31* <0.0001 5.857 57.947 0.001 mmu-miR-196a* <0.0001 6.479 89.212 0.001 mmu-miR-296-3p <0.0001 5.335 40.364 0.001 mmu-miR-134 <0.0001 6.132 70.116 0.001 mmu-miR-32 <0.0001 5.974 62.864 0.001 mmu-miR-339-5p <0.0001 6.295 78.521 0.001 mmu-miR-598 <0.0001 5.288 39.057 0.001 mmu-miR-155 <0.0001 4.754 26.987 0.001 mmu-miR-346 <0.0001 7.599 193.9 0.001 mmu-miR-126-5p <0.0001 3.887 14.791 0.001 mmu-miR-194 <0.0001 6.648 100.311 0.001 mmu-miR-125b-3p <0.0001 5.938 61.287 0.001 mmu-miR-10b <0.0001 6.892 118.74 0.001 mmu-miR-149 <0.0001 5.916 60.373 0.001 mmu-miR-342-3p <0.0001 6.065 66.949 0.001 mmu-miR-99b <0.0001 3.806 13.985 0.001 mmu-let-7d <0.0001 8.853 462.241 0.001 mmu-miR-152 <0.0001 3.953 15.491 0.001 mmu-miR-184 <0.0001 3.333 10.074 0.001 mmu-miR-760 0.001 5.18 36.252 0.002 mmu-miR-99b* 0.001 3.09 8.515 0.002 mmu-miR-139-3p 0.001 4.877 29.378 0.002 mmu-miR-146b 0.001 6.663 101.359 0.002 mmu-miR-30e* 0.001 6.587 96.113 0.002 mmu-miR-127 0.001 6.338 80.868 0.002 mmu-miR-151-3p 0.001 3.898 14.911 0.002 mmu-miR-876-3p 0.001 3.425 10.741 0.002 mmu-miR-1954 0.001 3.881 14.732 0.002 mmu-miR-1899 0.001 3.604 12.161 0.002 mmu-miR-300 0.001 7.338 161.736 0.002 mmu-miR-1197 0.001 3.396 10.526 0.003 mmu-miR-33 0.001 4.741 26.738 0.003 mmu-miR-540-3p 0.001 4.624 24.661 0.003 mmu-miR-324-3p 0.001 7.791 221.449 0.003 mmu-miR-1983 0.001 5.331 40.248 0.004 mmu-miR-669i 0.002 5.702 52.044 0.004 mmu-miR-203 0.002 3.435 10.815 0.004 mmu-miR-350 0.002 7.798 222.604 0.004 mmu-miR-150 0.002 5.986 63.375 0.006 mmu-miR-511 0.002 5.363 41.165 0.006 mmu-miR-196a 0.003 4.386 20.906 0.007 mmu-miR-467e* 0.003 4.537 23.21 0.008 mmu-miR-92a* 0.004 5.572 47.56 0.009 mmu-miR-497 0.004 4.121 17.398 0.01 mmu-miR-879* 0.004 4.496 22.562 0.01 mmu-miR-151-5p 0.004 5.022 32.484 0.01 mmu-miR-130b* 0.004 2.903 7.482 0.01 mmu-miR-301b 0.005 4.893 29.702 0.011 mmu-miR-183 0.005 4.991 31.797 0.011 mmu-miR-129-3p 0.005 4.658 25.238 0.011 mmu-miR-711 0.006 5.613 48.953 0.012 mmu-miR-670 0.006 3.921 15.146 0.012 mmu-miR-872* 0.006 4.961 31.143 0.012 mmu-miR-669m 0.007 4.141 17.641 0.015 mmu-miR-218 0.008 4.682 25.664 0.017 mmu-miR-1895 0.009 3.852 14.437 0.018 mmu-miR-181a 0.009 5.473 44.4 0.018 mmu-miR-322 0.009 4.448 21.819 0.019 mmu-miR-296-5p 0.011 4.414 21.32 0.022 mmu-miR-1898 0.011 2.952 7.736 0.022 mmu-miR-345-5p 0.012 4.375 20.749 0.024 mmu-miR-135a* 0.013 4.998 31.945 0.025 mmu-miR-2133 0.013 1.968 3.911 0.026 mmu-miR-210 0.014 4.519 22.93 0.026 mmu-miR-20b* 0.017 2.751 6.731 0.031 mmu-miR-2140 0.033 1.807 3.498 0.056 mmu-miR-187 0.043 4.797 27.793 0.071 mmu-miR-183* 0.049 4.261 19.171 0.079 FDR = false discovery rate, * indicates star species miRNA, in which the 3-5 fragment induces the repression.

[0121] Indeed, of the 177 exosomal miRNAs that were detectable in wild-type and significantly decreased in ADicerKO serum, fat transplantation restored the levels of the majority of these at least 50% of the way to normal indicating that adipose tissue is a major source of circulating exosomal miRNAs and that different depots contribute differentially to circulating miRNAs, with BAT being the dominant depot.

[0122] Physiologically, ADicerKO mice had markedly impaired glucose tolerance tests (GTTs) compared to controls with about a 50% increase in area under the curve (FIGS. 2d and 2e). This did not significantly change after sham surgery and showed only small, non-significant changes after transplantation of Ing-WAT or Epi-WAT. However, GTT results were significantly improved in the ADicerKO mice that had received a BAT transplant (FIG. 2e). ADicerKO mice also exhibit marked insulin resistance, as indicated by increased circulating insulin levels; this was also reduced in the group receiving the BAT transplant, but did not quite reach statistical significance (FIG. 7e). Serum interleukin 6 (IL-6), leptin and adiponectin levels were all lower in ADicerKO compared to control and were not restored by transplantation (FIG. 7e).

[0123] These data support the conclusion that BAT transplant into ADicerKO mice improved the metabolic parameters of these mice. BAT and Ing-WAT transplants also showed remarkable restoration of circulating exosomal miRNAs in ADicerKO mice. In addition, ADicerKO mice receiving a BAT transplant had reduced circulating and hepatic FGF21 levels.

Example 3. Identification of FGF-21 as a Potential Target of Regulation by Circulating Exosomal miRNAs

[0124] FGF21 is a member of the fibroblast growth factor family, which is produced in the liver and other tissues, released into the circulation and exerts effects on multiple tissues in the control of metabolism.sup.23. ADicerKO mice had a 3-fold increase in circulating FGF21, associated with increased levels of FGF21 mRNA in liver, as well as muscle, fat and pancreas (FIGS. 3a and 3b, FIG. 8a). After sham surgery or transplantation of Ing-WAT or Epi-WAT, serum FGF21 levels and liver FGF21 mRNA remained unchanged in the ADicerKO mice (FIGS. 3c and 3d). However, ADicerKO mice that received BAT fat transplants showed an 50% reduction in the increased FGF21 mRNA in liver (FIG. 3d). This was paralleled by a reduction of circulating FGF21 levels to near control levels (FIG. 3c), indicating that BAT transplantation provided some factor(s) that directly or indirectly regulated FGF21 expression in liver of the ADicerKO mice. Considering that one of these factors could be a circulating miRNA, miRDB analysis was performed using the online resource http://mirdb.org to identify miRNAs that might target the 3-UTR of murine FGF21 mRNA.sup.24. Four miRNA candidates were identified (miR-99a, miR-99b, miR-100, and miR-466i) using miRDB analysis and incorporated into exosomes via electroporation.

[0125] For exosome loading, exosome preparations were isolated and diluted with PBS to final volume of 100 l. Exosome preparations were mixed with 200 l phosphate-buffered sucrose: 272 mM sucrose/7 mM K.sub.2HPO.sub.4 along with 10 nM of a miRNA mimic, and the mixture was pulsed at 500 mV and 250 F resistance using a Biorad Gene Pulser (Biorad, Hercules, Calif.). Electroporated exosomes were further diluted with PBS and added to the target cells.

[0126] Three of the candidate miRNAs of these (miR-99a, -99b, and -100) were decreased by 75-80% in the serum of ADicerKO mice treated with saline (Sal) compared to control WT mice (FIG. 8b). This was consistent with the fact that these three miRNAs were all also highly expressed in BAT and Ing-WAT (Tables 7 and 8), and after BAT or Ing-WAT transplantation, there was a 50% recovery of these three miRNAs in the serum of ADicerKO mice compared to treatment with saline (FIG. 8b).

TABLE-US-00010 TABLE 8 miRNAs restored in ADicerKO transplant groups more than 50% of the difference to WT and overlapping restored miRNAs BAT EPI ING mmu-miR-17 none mmu-miR-183 mmu-miR-103 mmu-miR-598 mmu-miR-200b mmu-let-7d* mmu-miR-128 mmu-miR-32 mmu-miR-34a mmu-miR-33 mmu-miR-21 mmu-miR-345-5p mmu-miR-1 mmu-miR-135a* mmu-miR-107 mmu-miR-669m mmu-miR-140 mmu-miR-337-3p mmu-miR-30e mmu-miR-203 mmu-miR-26a mmu-miR-18a mmu-miR-196a* mmu-miR-540-3p mmu-miR-146b mmu-miR-497 mmu-miR-150 mmu-miR-511 mmu-miR-322 mmu-miR-20b* mmu-miR-296-5p BAT-EPI BAT-ING EPI-ING common common common ALL common mmu-miR- mmu-miR-204 mmu-miR-124 mmu-miR-22 302c mmu-miR-214 mmu-let-7e mmu-miR- mmu-miR-19b 129-3p mmu-miR-29c mmu-miR- mmu-miR- mmu-miR-19a 199a-5p 467e* mmu-miR- mmu-miR- mmu-miR- mmu-miR-323-5p 324-5p 188-3p 181b mmu-miR-10a mmu-miR-7a mmu-miR- mmu-miR-92b 183* mmu-miR- mmu-miR-197 mmu-let-7a 1943 mmu-miR- mmu-let-7g mmu-miR-193b 15b mmu-miR- mmu-miR- mmu-miR-15a 669i 188-5p mmu-miR- mmu-miR-298 mmu-miR-133b 99b* mmu-miR- mmu-miR- mmu-miR-185 199b 101b mmu-miR- mmu-miR- mmu-miR-291a-5p 126-5p 301a mmu-miR-300 mmu-miR-26b mmu-miR-207 mmu-miR- mmu-miR-186 mmu-miR-212 2140 mmu-miR- mmu-miR- mmu-let-7c 1895 770-3p mmu-miR- mmu-miR- mmu-miR-25 151-3p 130b mmu-miR- mmu-miR-184 mmu-miR-195 1197 mmu-miR- mmu-miR- mmu-miR-92a 876-3p 1952 mmu-miR- mmu-miR- mmu-miR-27a 10b 296-3p mmu-miR- mmu-miR- mmu-miR-16 1899 30e* mmu-miR- mmu-miR- mmu-miR-24 1898 301b mmu-miR-711 mmu-miR-210 mmu-miR-29a mmu-miR- mmu-miR- mmu-miR-130a 92a* 872* mmu-miR-350 mmu-miR-134 mmu-miR-145 mmu-miR- mmu-miR-205 181a mmu-miR- mmu-miR-101a 151-5p mmu-miR- mmu-miR-20b 2133 mmu-miR-328 mmu-miR-20a mmu-miR-326 mmu-miR-148a mmu-miR-222 mmu-miR-181d mmu-miR-133a mmu-miR-148b mmu-miR-106a mmu-miR-335-3p mmu-miR-127* mmu-miR-125a-3p mmu-miR-706 mmu-miR-146a mmu-miR-30d mmu-miR-93 mmu-miR-297a mmu-miR-99a mmu-miR-100 mmu-miR-338-5p mmu-miR-129-5p mmu-miR-30b mmu-miR-200a mmu-miR-1955 mmu-miR-199a-3p mmu-miR-191 mmu-miR-320 mmu-miR-31* mmu-let-7b mmu-miR-149 mmu-miR-339-5p mmu-miR-324-3p mmu-let-7d mmu-miR-346 mmu-miR-760 mmu-miR-342-3p mmu-miR-194 mmu-miR-218 mmu-miR-130b* mmu-miR-152 mmu-miR-99b mmu-miR-1954 mmu-miR-139-3p mmu-miR-1983 mmu-miR-187 mmu-miR-879* * indicates star species miRNA, in which the 3-5 fragment induces the repression.

[0127] To determine which of these candidate miRNAs might regulate FGF21, AML-12 liver cells were transfected with an adenoviral pacAd5-FGF21 3-UTR luciferase reporter (SEQ ID No: 4) and then with 10 nM of the candidate miRNA (miR-99a, Accession No: MIMAT0000131; miR-99b, Accession No: MIMAT0000132; mir-100, Accession No: MIMAT0000655; mir-466i, Accession No: MIMAT0017325) or a control miRNA mimetic (Thermo Fisher Cat. Number AM17110). Of these, only miR-99b resulted in a robust reduction of FGF21 luciferase activity (FIG. 8c), and this correlated with a reduction in FGF21 mRNA level by 65% (FIG. 8d).

[0128] To test directly if these miRNAs could regulate FGF21 when present in exosomes, AML-12 cells expressing the FGF21-3UTR luciferase reporter (SEQ ID No: 4) were exposed to exosomes from control or ADicerKO mice or ADicerKO exosomes which had been electroporated with either miR-99a, miR-99b, miR-100, miR-466i or a control mimic. In vitro the isolated exosomes from control mice were able to suppress FGF21-3UTR luciferase activity in the AML-12 cells by 60%, while the exosomes from the ADicerKO (untreated) had no effect (FIG. 3e, left 3 bars). Furthermore, while ADicerKO exosomes reconstituted with miR-99a, miR-100 or miR-466i had minimal effects (data not shown), ADicerKO exosomes bearing miR-99b resulted in a 55% suppression of the FGF21 luciferase activity (FIG. 3f), and again this was paralleled by an almost equal reduction in FGF21 mRNA levels, mimicking the effect of wild type exosomes (FIG. 8e). This in vitro regulation of FGF21 was dependent on exosomal delivery and was not recapitulated with when naked miRNA was incubated with these cells (miR99b free), indicating the potency of exosomes as a miRNA delivery system (FIG. 3e, right 2 bars)

[0129] In order to address possible regulation of FGF21 by exosomal miRNAs in vivo, ADicerKO and WT mice were transduced with a pacAd5-FGF21 3-UTR luciferase reporter (SEQ ID No: 4), injected with exosomes from ADicerKO mice (i.e., exosomes with low miRNA content), and hepatic FGF21 suppression was measured using the IVIS in vivo imaging system. Consistent with the in vitro study, FGF21 3-UTR activity was 5-fold higher in ADicerKO mice than WT mice, reflecting the absence of repressive miRNAs in the circulation of the ADicerKO mice (FIGS. 4a and 4b). Injection of WT-exosomes in the AdicerKO re-induced suppression of the elevated FGF21 3-UTR reporter activity by 59% of the excess above controls. qPCR from liver samples from the WT, KO, and KO+exoWT mice showed reduced hepatic FGF21 message by 30% of the way toward normal compared to KO mice only and also reduced circulating FGF21 by 25% compared to KO mice only (FIGS. 4c and 4d).

[0130] In a separate experiment the contribution of miR-99b in the regulation of FGF21 in vivo was also assessed by injecting WT and KO mice with KO exosomes with or without reconstitution of miR-99b (FIG. 4e). Again KO mice showed 2.5-fold higher luciferase activity than WT mice, even when both were given exosomes from KO mice. Administration of KO exosomes reconstituted with miR-99b (exomiR99b) in the AdicerKO re-induced suppression of the FGF21 3 -UTR reporter mice by 45% compared to normal (FIG. 4f). qPCR from liver samples from the WT, KO, and KO+exo-miR-99b mice showed a parallel reduction in hepatic FGF21 message (FIG. 4g). This effect was further paralleled by reduced circulating FGF21 in the KO mice (FIG. 4h).

[0131] These data indicate that fat-derived exosomes are a highly efficient means of delivering exosomes.

Example 4. Demonstration of Regulation of Liver Gene Expression by an Adipose Tissue Produced Circulating Exosomal miRNA

[0132] Regulation of FGF21 both at the mRNA and circulating levels is a complex process, which almost certainly involves more than regulation by circulating miRNAs. However, consistent with the liver effect being secondary to BAT produced miRNAs based on transplant experiments, in our transplantation study miRNAs including miR-16, miR-201 and miR-222, which are relatively fat-specific, were significantly decreased in livers of ADicerKO mice and restored toward normal by BAT transplant (FIG. 9a), whereas the pre-miRNA-16 species in the liver were not changed in ADicerKO mice with or without BAT transplantation (FIG. 9b). To better define the potential of adipose-derived circulating miRNAs in vivo, a more specific reporter system was developed. To this end, experiments took advantage of the human miRNA hsa_miR-302f and its 3UTR reporter.sup.25 (SEQ ID No: 3), since this miRNA is human specific and does not have a mouse homolog. We then performed two types of experiments. In Protocol 1 (FIG. 5a), an adenovirus bearing pre-hsa_miR-302f or its LacZ control was injected directly into BAT, using an approach that has been shown to get BAT specific expression of the transduced gene.sup.26. Three days later, the same mice were injected intravenously (i.v.) with an adenovirus bearing the 3-UTR luciferase reporter for hsa_miR-302f (SEQ ID No: 3) to induce its expression in liver. Only if there was communication between the miRNA expressed in BAT and the reporter expressed in liver would suppression of the reporter be observed.

[0133] Indeed, IVIS analysis 5 days after transfection revealed that in mice with Ad-hsa_miR-302f transduced in BAT there was a >95% reduction of luciferase activity in the liver when compared to mice in which the LacZ control was transduced into BAT (FIGS. 5b and 5c). In protocol 2 (FIG. 5d), in order to definitively address whether this hsa_miR-302f suppression of luciferase in the liver was contingent upon exosomal delivery or not, two separate cohorts of C57Bl/6 mice were used. One cohort was transduced with the adenovirus bearing pre-hsa_miR-302f (SEQ ID No: 1) or the control LacZ adenovirus (SEQ ID No: 2) directly into BAT. A second, separate cohort of mice (the acceptor) was transduced in the liver by i.v. injection of the adenovirus bearing the 3-UTR of hsa_miR-302f in-frame with a luciferase reporter (SEQ ID No: 3). Serum was then isolated from the donor cohorts three times over the following 8 days, exosomes were isolated, and the purified exosomes were injected intravenously into the acceptor mice, after which IVIS analysis of the hsa_miR-302f reporter in the acceptor mice was performed. To prepare serum exosomes, serum was centrifuged at 1000 g for 5 min and then at 10,000 g for 10 min to remove whole cells, cell debris and aggregates. The serum was subjected to 0.1 m filtration and ultracentrifuged at 100,000 g for 1 h. Pelleted vesicles were suspended in PBS and ultracentrifuged again at 100,000 g for washing. Pelleted vesicles were finally resuspended in 100 ul sterile 1PBS.

[0134] Compared to the mice receiving exosomes from the control Ad-LacZ BAT transduced mice, the acceptor mice injected with exosomes originating from Ad-hsa_miR-302f BAT transduced mice showed a remarkable 95% reduction of luciferase activity in the liver (FIGS. 5e and 5f), thus demonstrating the direct regulation of this adipose-produced circulating miRNA on gene expression in the liver of the recipient mice.

[0135] In order to show that miR302f expression is BAT specific and does not leak into the liver following adenoviral injection, viral DNA isolation was performed from livers of the animals used in the experimental protocols 1 and 2 and the viral DNA was analyzed by qPCR detecting miR-302f or LacZ. The same procedure was performed for BAT samples from experimental protocol 1. As is evident in FIG. 9C, no adenoviral miR-302f or LacZ can be detected via qPCR in the liver, contrary to BAT.

[0136] Taken together, these data show that adipose tissue is a major source of circulating exosomal miRNAs in both mice and humans. This is demonstrated by the fact that both AdicerKO mice, which lack miRNA processing in adipose tissue, and humans with congenital or HIV-related lipodystrophy, who have severely reduced adipose mass or a defect in Dicer expression in fat, have dramatically reduced levels of one-third to one-half of the circulating exosomal miRNAs. Furthermore, in the ADicerKO mice many of the decreased miRNAs are restored to near normal levels following transplantation of adipose tissue from normal mice, with the pattern of serum miRNAs reflecting the pattern observed in the fat depot used for transplantation. Thus, although many tissues can secrete exosomes, our data show that adipose tissue is a major source of circulating exosomal miRNAs and that different adipose depots contribute different sets of miRNAs with subcutaneous WAT and BAT being the greatest contributors, at least in the mouse.

[0137] These data also demonstrate that the circulating exosomal miRNAs derived from fat may act as regulators of whole body metabolism and mRNA translation in other tissues. Thus, adipose tissue transplantation, especially BAT transplantation, improves glucose tolerance and lowers circulating insulin and FGF21 levels, as well as hepatic FGF21 mRNA in the recipient mouse. The latter appears to be due to a direct effect of the circulating miRNAs on FGF21 translation in liver, as incubation of serum exosomes from control mice with liver cells in vitro can lower FGF21 mRNA levels and repress activity of a FGF21 3-UTR reporter. This does not occur with exosomes isolated from serum of ADicerKO mice, but can be reconstituted in vitro, at least in part, by introduction of miR-99b, a predicted regulator of murine FGF21, into these exosomes. miR-99b is also one of the miRNAs that is highly reduced in circulating exosomes of ADicerKO mice, and one whose level is largely restored by BAT transplantation. Transplantation with Ing-WAT also significantly restored the level of miR-99b in the circulation, but only the BAT transplantation reduced hepatic FGF21 mRNA. This suggests that BAT-derived exosomes may preferentially target the liver compared to Ing-WAT exosomes. Such tissue targeting has been suggested by in vitro studies.sup.18,27 showing that pancreatic exosomes preferentially target peritoneal macrophages as compared to granulocytes or T-lymphocytes.sup.28, implying that inter-organ exosomal delivery has tissue specificity.sup.29. The generalizability of this type of cross-talk between adipose tissue and liver mRNA regulation, is made ever clearer by the use of a miRNA and miRNA reporter system which is human specific. Hence, when the BAT of mice is transduced with an adenovirus producing the human-specific miRNA hsa_miR-302f, exosomes present in the circulation of that mouse can target an hsa_miR-302f 3-UTR reporter in the liver of the same mouse or even a different mouse given isolated exosomes from this donor.

[0138] Since adipose tissue is a major source of circulating miRNAs, the effect of the loss of adipose-derived miRNAs in lipodystrophy and their restoration by fat transplantation may involve many targets and tissues in addition to hepatic FGF21. miRDB analysis of the miRNAs that are restored with BAT transplantation group also includes miR-325 and miR-743b (predicted to target UCP-1) and miR-98 (predicted to target PGC1), suggesting that adipose tissue-derived secreted miRNAs may have both paracrine and endocrine actions and be contributors to multiple aspects of the lipodystrophy phenotype of the ADicerKO mouse, including enlargement and whitening of the interscapular BAT fat pad.sup.14. Regulation of metabolism and mRNA expression in lipodystrophy could also involve other miRNAs or exosomal factors contributed to the circulation by BAT, as well as a whole range of non-exosomal mechanisms, including conventional adipokines and cytokines, such as leptin, adiponectin, and IL6, as well as metabolic intermediates and other hormones.sup.30. What is clear from the present study is that in addition to serving as markers of disease, exosomal miRNAs may have increased potential for transfer of miRNAs between tissues and serve a regulatory role.sup.31,32. In vitro, endothelial exosomes that carry miR-126 have been shown to target vascular cells inducing protection from apoptosis.sup.33. Likewise, exosomes isolated from mast cells in vitro can trigger other mast cells, enhancing their antigen presenting potential.sup.29, and Ismail et al. have shown that exosomes secreted by macrophages and platelets can be taken up by naive monocytes, which then differentiate into macrophages.sup.32. Exosomal miRNA transfer has been also reported in glioblastoma cancers, which secrete exosomes with specific miRNAs (let-7a, miR-16, miR-320) besides EGFR receptors.sup.15,34. Another example of transfer of miRNAs through exosomes has been reported to occur between embryonic stem cells and mouse embryonic fibroblasts.sup.35.

[0139] In summary, these data show that a major source of circulating exosomal miRNAs is adipose tissue and that different adipose depots contribute different exosomal miRNAs into the circulation. The data also show that these adipose-derived circulating miRNAs can have far-reaching systemic effects, including regulation of mRNA expression and translation. As a product of different adipose depots, these exosomal miRNAs could also change in level in diseases with altered fat mass, such as lipodystrophy and obesity, altered adipose distribution, and altered adipose tissue function. Thus, adipose-derived exosomal miRNAs constitute a novel class of adipokines that can be secreted by fat and act as regulators of metabolism in distant tissues providing a new mechanism of cell-cell crosstalk.

REFERENCES

[0140] .sup.1 Krol, J., Loedige, I., and Filipowicz, W., Nat Rev Genet 11 (9), 597. [0141] .sup.2 Sun, L. et al., Nat Cell Biol 13 (8), 958; Bartel, D. P., Cell 136 (2), 215 (2009); Ameres, S. L. and Zamore, P. D., Nat Rev Mol Cell Biol 14 (8), 475. [0142] .sup.3 Trajkovski, M. et al., Nature 474 (7353), 649. [0143] .sup.4 Arroyo, J. D. et al., Proc Natl Acad Sci USA 108 (12), 5003. [0144] .sup.5 Thery, C., Amigorena, S., Raposo, G., and Clayton, A., Curr Protoc Cell Biol Chapter 3, Unit 3 22 (2006). [0145] .sup.6 Gyorgy, B. et al., Cell Mol Life Sci 68 (16), 2667. [0146] .sup.7 Hata, A. and Lieberman, J., Sci Signal 8 (368), re3. [0147] .sup.8 Dumortier, O., Hinault, C., and Van Obberghen, E., Cell Metab 18 (3), 312. [0148] .sup.9 Arner, E. et al., Diabetes 61 (8), 1986. [0149] .sup.10 Capobianco, V. et al., J Proteome Res 11 (6), 3358. [0150] .sup.11 Caroli, A., Cardillo, M. T., Galea, R., and Biasucci, L. M., J Cardiol 61 (5), 315. [0151] .sup.12 Guay, C. et al., Transl Res 157 (4), 253. [0152] .sup.13 Mori, M. A. et al., Cell Metab 16 (3), 336. [0153] .sup.14 Mori, M. A. et al., J Clin Invest 124 (8), 3339. [0154] .sup.15 Skog, J. et al., Nat Cell Biol 10 (12), 1470 (2008). [0155] .sup.16 Taylor, D. D., Zacharias, W., and Gercel-Taylor, C., Methods Mol Biol 728, 235. [0156] .sup.17 Escola, J. M. et al., J Biol Chem 273 (32), 20121 (1998). [0157] .sup.18 Fevrier, B. and Raposo, G., Curr Opin Cell Biol 16 (4), 415 (2004). [0158] .sup.19 Ortega, F. J. et al., PLoS One 5 (2), e9022; Oger, F. et al., J Clin Endocrinol Metab 99 (8), 2821. [0159] .sup.20 Chou, W. W. et al., Cell Physiol Biochem 32 (1), 127. [0160] .sup.21 Keller, P. et al., BMC Endocr Disord 11, 7. [0161] .sup.22 McGregor, R. A. and Choi, M. S., Curr Mol Med 11 (4), 304. [0162] .sup.23 Potthoff, M. J., Kliewer, S. A., and Mangelsdorf, D. J., Genes Dev 26 (4), 312; Badman, M. K. et al., Cell Metab 5 (6), 426 (2007). [0163] .sup.24 Wong, N. and Wang, X., Nucleic Acids Res 43 (Database issue), D146. [0164] .sup.25 Yao, Y. et al., Mol Med Rep 2 (6), 963 (2009). [0165] .sup.26 Uhrig-Schmidt, S. et al., PLoS One 9 (12), e116288. [0166] .sup.27 Atai, N. A. et al., J Neurooncol 115 (3), 343. [0167] .sup.28 Zech, D., Rana, S., Buchler, M. W., and Zoller, M., Cell Commun Signal 10 (1), 37. [0168] .sup.29 Valadi, H. et al., Nat Cell Biol 9 (6), 654 (2007). [0169] .sup.30 Bluher, M., Mol Metab 3 (3), 230. [0170] .sup.31 Thery, C., Ostrowski, M., and Segura, E., Nat Rev Immunol 9 (8), 581 (2009); Bang, C. et al., J Clin Invest 124 (5), 2136; Hergenreider, E. et al., Nat Cell Biol 14 (3), 249; Mittelbrunn, M. et al., Nat Commun 2, 282. [0171] .sup.32 Ismail, N. et al., Blood 121 (6), 984. [0172] .sup.33 Zernecke, A. et al., Sci Signal 2 (100), ra81 (2009). [0173] .sup.34 van der Vos, K. E. et al., Neuro Oncol 18 (1), 58. [0174] .sup.35 Yuan, A. et al., PLoS One 4 (3), e4722 (2009). [0175] .sup.36 Gallo, A., Tandon, M., Alevizos, I., and Illei, G. G., PLoS One 7 (3), e30679. [0176] .sup.37 Turchinovich, A., Weiz, L., Langheinz, A., and Burwinkel, B., Nucleic Acids Res 39 (16), 7223. [0177] .sup.38 Vickers, K. C. et al., Nat Cell Biol 13 (4), 423.