SNAP25 ANTISENSE OLIGONUCLEOTIDES
20190338291 ยท 2019-11-07
Inventors
- Daram Jung (Hwaseong-Si, KR)
- Kangwon Jang (Yongin-Si, KR)
- Bongjun Cho (Yongin-Si, KR)
- Min Wook Shin (Yongin-Si, KR)
- Hyun Ju Jeon (Yongin-Si, KR)
- Soyoung Kim (Seoul, KR)
Cpc classification
C07K7/02
CHEMISTRY; METALLURGY
C07K14/705
CHEMISTRY; METALLURGY
A61K9/0014
HUMAN NECESSITIES
C12N15/1138
CHEMISTRY; METALLURGY
International classification
C12N15/113
CHEMISTRY; METALLURGY
C07K14/00
CHEMISTRY; METALLURGY
A61K9/00
HUMAN NECESSITIES
Abstract
Provided are peptide nucleic acid derivatives targeting a 3 splice site of the human SNAP25 pre-mRNA. The peptide nucleic acid derivatives potently induce at least a splice variant of the human SNAP25 mRNA in cells, and are useful to safely treat dermatological indications or conditions involving the expression of the human SNAP25 protein by topical administration.
Claims
1. A peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof: ##STR00007## wherein, n is an integer between 10 and 25; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA, or partially complementary to the human SNAP25 pre-mRNA with one or two mismatches; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido [D], hydrido [H], substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; X and Y independently represent hydrido, formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], aminothiocarbonyl [NH.sub.2C(S)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, substituted or non-substituted aryloxythiocarbonyl, substituted or non-substituted alkylsulfonyl, substituted or non-substituted arylsulfonyl, substituted or non-substituted alkylphosphonyl radical, or substituted or non-substituted arylphosphonyl radical; Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and, at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.
2. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 10 and 25; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA, or partially complementary to the human SNAP25 pre-mRNA with one or two mismatches; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido, hydrido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; X and Y independently represent hydrido, formyl, aminocarbonyl, aminothiocarbonyl, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, substituted or non-substituted aryloxythiocarbonyl, substituted or non-substituted alkylsulfonyl, substituted or non-substituted arylsulfonyl, substituted or non-substituted alkylphosphonyl radical, or substituted or non-substituted arylphosphonyl radical; Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and, at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV: ##STR00008## wherein, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; L.sub.1, L.sub.2 and L.sub.3 are a covalent linker represented by Formula V covalently linking the basic amino group to the nucleobase moiety: ##STR00009## wherein, Q.sub.1 and Q.sub.m are substituted or non-substituted methylene (CH.sub.2) radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen (O), sulfur (S), and substituted or non-substituted amino radical [N(H), or N(substituent)-]; and, m is an integer between 1 and 15.
3. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 11 and 21; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA, or partially complementary to the human SNAP25 pre-mRNA with one or two mismatches; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; Q.sub.1 and Q.sub.m are substituted or non-substituted methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen, and amino radical; and, m is an integer between 1 and 11.
4. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 11 and 19; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, oxygen, and amino radical; and, m is an integer between 1 and 9.
5. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 11 and 19; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.3, and R.sub.5 are hydrido radical, and R.sub.2, R.sub.4, and R.sub.6 independently represent hydrido, or substituted or non-substituted alkyl radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, oxygen radical; and, m is an integer between 1 and 8.
6. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 11 and 19; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from adenine, thymine, guanine, cytosine, and unnatural nucleobases; at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, and oxygen radical; and, m is an integer between 1 and 8.
7. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 11 and 19; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA; the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X is hydrido radical; Y represents substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents substituted or non-substituted amino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from adenine, thymine, guanine, cytosine, and unnatural nucleobases; at least five of B1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical; L.sub.1 represents (CH.sub.2).sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.3, CH.sub.2O(CH.sub.2).sub.4, or CH.sub.2O-(CH.sub.2).sub.5 with the right end is directly linked to the basic amino group; and, L.sub.2 and L.sub.3 are independently selected from (CH.sub.2).sub.2, (CH.sub.2).sub.3, (CH.sub.2).sub.4, (CH.sub.2).sub.5, (CH.sub.2).sub.6, (CH.sub.2).sub.7, (CH.sub.2).sub.8, (CH.sub.2).sub.2O(CH.sub.2).sub.2, (CH.sub.2).sub.3O(CH.sub.2).sub.2, and (CH.sub.2).sub.2O(CH.sub.2).sub.3 with the right end is directly linked to the basic amino group.
8. The peptide nucleic acid derivative according to claim 1, which is selected from the group of peptide nucleic acid derivatives provided below, or a pharmaceutically acceptable salt thereof: (N.fwdarw.C) Fethoc-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH.sub.2; (N.fwdarw.C) Fethoc-A(6)TC-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH.sub.2; (N.fwdarw.C) Piv-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH.sub.2; (N.fwdarw.C) Fethoc-A(6)TT-TG(6)T-TA(2O2)C-CC(1O2)T-GG(5)G-A(5)-NH.sub.2; (N.fwdarw.C) Fmoc-Lys-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH.sub.2; (N.fwdarw.C) Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(5)-NH.sub.2; (N.fwdarw.C) Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)T-A(5)-NH.sub.2; (N.fwdarw.C) Fethoc-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-NH.sub.2; (N.fwdarw.C) Fethoc-Lys-Leu-TG(5)T-TA(5)C-CC(1O2)T-GG(5)G-A(2O2)T-Lys-NH.sub.2; (N.fwdarw.C) H-TG(5)T-TA(5)C-CC(1O2)T-GG(3)G-A(5)T-NH.sub.2; (N.fwdarw.C) Benzoyl-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-Val-Lys-NH.sub.2; (N.fwdarw.C) Benzoyl-TG(5)T-TA(5)C-CC(1O3)T-GG(5)G-A(5)T-NH.sub.2; (N.fwdarw.C) n-Hexanoyl-TG(5)T-TA(8)C-CC(1O2)T-GG(5)G-A(5)T-NH.sub.2; (N.fwdarw.C) n-Propyl-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-NH.sub.2; (N.fwdarw.C) Ac-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-NH.sub.2; (N.fwdarw.C) [N-(2-Phenylethyl)amino]carbonyl-TG(5)T-TA(4)C-CC(1O2)T-GG(5)G-A(5)T-NH.sub.2; (N.fwdarw.C) n-Propyl-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T-NH.sub.2; (N.fwdarw.C) FAM-HEX-HEX-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T-NH.sub.2; (N.fwdarw.C) n-Propyl-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T-Arg-NH.sub.2; (N.fwdarw.C) n-Benzoyl-Gly-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T-NH.sub.2; (N.fwdarw.C) N-Me-N-Phenyl-TG(5)T-TA(5)C-CC(1O5)T-GG(5)G-A(5)T-NH.sub.2; (N.fwdarw.C) p-Toluenesulfonyl-TG(2O3)T-TA(5)C-CC(1O2)T-GG(5)G-A(5)T-Lys-NH.sub.2; (N.fwdarw.C) Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(6)T-NH.sub.2; (N.fwdarw.C) Bezenesulfonyl-TG(5)T-TA(2O3)C-CC(1O5)T-GG(5)G-A(6)T-NH.sub.2; (N.fwdarw.C) Phenyl-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(6)T-NH.sub.2; (N.fwdarw.C) Fethoc-TG(5)G-TA(5)C-C(1O2)CT-TG(5)G-A(5)T-NH.sub.2; (N.fwdarw.C) Fethoc-TG(5)T-AA(5)C-CC(1O2)T-GG(5)T-A(5)T-NH.sub.2; (N.fwdarw.C) Fethoc-TG(6)T-TA(3)C-CC(1O5)T-GG(6)G-A(3)T-NH.sub.2; (N.fwdarw.C) Fethoc-G(5)TT-A(5)CC(1O2)-CTG-G(5)GA(5)-TC(1O2)-NH.sub.2; (N.fwdarw.C) Benzyl-G(5)TT-A(5)CC(1O2)-CTG-G(5)GA(5)-TC(1O2)-NH.sub.2; (N.fwdarw.C) Fethoc-GTT-A(3)CC(1O5)-CTG(6)-GGA(3)-TC(1O5)-NH.sub.2; (N.fwdarw.C) Fethoc-TA(5)C-C(1O2)CT(1O5)-GG(5)G-A(5)TC-C(1O2)A-NH.sub.2; (N.fwdarw.C) Fmoc-Leu-TA(4)C-C(1O3)CT-GG(5)G-A(4)TC-C(1O3)A-NH.sub.2; (N.fwdarw.C) Fethoc-C(1O2)AT-TTG(6)-TTA(5)-CCC(1O2)-TG(6)-NH.sub.2; (N.fwdarw.C) Fethoc-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)-NH.sub.2; (N.fwdarw.C) Fethoc-A(6)TT-TG(5)T-TA(5)C-C(1O2)CT-G(5)-NH.sub.2; (N.fwdarw.C) Fethoc-CA(6)T-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)-NH.sub.2; (N.fwdarw.C) Fethoc-A(5)TT-TG(5)T-TA(5)C-CC(1O2)T-GG(5)G-A(5)-NH.sub.2; (N.fwdarw.C) Fethoc-A(6)TT-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(5)-NH.sub.2; and, (N.fwdarw.C) Fethoc-A(6)TT-TG(5)T-TA(6)C-C(1O2)CT-G(5)G-NH.sub.2: wherein, A, G, T, and C are PNA monomers with a natural nucleobase of adenine, guanine, thymine, and cytosine, respectively; C(pOq), A(p), A(pOq), G(p), and G(pOq) are PNA monomers with an unnatural nucleobase represented by Formula VI, Formula VII, Formula VIII, Formula IX, and Formula X, respectively; ##STR00010## wherein, p and q are integers; and, the abbreviations for the N- and C-terminus substituents are specifically defined as follows: Fmoc- is the abbreviation for [(9-fluorenyl)methyloxy]carbonyl-; Fethoc- for [2-(9-fluorenyl)ethyl-1-oxy]carbonyl; Ac- for acetyl-; Benzoyl- for benzenecabonyl-; Piv- for pivalyl-; n-Propyl- for 1-(n-propyl)-; H- for hydrido- group; p-Toluenesulfonyl for (4-methylbenzene)-1-sulfonyl-; -Lys- for amino acid residue lysine; -Val- for amino acid residue valine; -Leu- for amino acid residue leucine; -Arg- for amino acid residue arginine; -Gly- for amino acid residue glycine; [N-(2-Phenylethyl)amino]carbonyl- for [N-1-(2-phenylethyl)amino]carbonyl-; Benzyl- for 1-(phenyl)methyl- ; Phenyl- for phenyl-; Me- for methyl-; -HEX- for 6-amino-1-hexanoyl-, FAM- for 5, or 6-fluorescein-carbonyl-(isomeric mixture), and NH.sub.2 for non-substituted -amino group.
9. A method to treat a disease or condition involving the expression of the human SNAP25 gene comprising administering the peptide nucleic acid derivative according to claim 1 to a human subject.
10. A method to treat a disease or condition involving the expression of the human SNAP25 gene comprising topically administering the peptide nucleic acid derivative according to claim 1 to a human subject.
Description
BRIEF DESCRIPTION OF FIGURES
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
SUMMARY OF INVENTION
[0074] The present invention provides a peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof:
##STR00001##
[0075] wherein,
[0076] n is an integer between 10 and 25;
[0077] the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA;
[0078] the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA, or partially complementary to the human SNAP25 pre-mRNA with one or two mismatches;
[0079] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido [D], hydrido [H], substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0080] X and Y independently represent hydrido, formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], aminothiocarbonyl [NH.sub.2C(S)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, substituted or non-substituted aryloxythiocarbonyl, substituted or non-substituted alkylsulfonyl, substituted or non-substituted arylsulfonyl, substituted or non-substituted alkylphosphonyl radical, or substituted or non-substituted arylphosphonyl radical;
[0081] Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0082] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and,
[0083] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.
[0084] The compound of Formula I induces the skipping of exon 7 in the human SNAP25 pre-mRNA, yields the human SNAP25 mRNA splice variant(s) lacking exon 7, and therefore is useful to inhibit the functional activity of the gene transcribing the human SNAP25 pre-mRNA.
DESCRIPTION OF INVENTION
[0085] The present invention provides a peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof:
##STR00002##
[0086] wherein,
[0087] n is an integer between 10 and 25;
[0088] the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA;
[0089] the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA, or partially complementary to the human SNAP25 pre-mRNA with one or two mismatches;
[0090] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido [D], hydrido [H], substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0091] X and Y independently represent hydrido, formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], aminothiocarbonyl [NH2-C(=S)-], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, substituted or non-substituted aryloxythiocarbonyl, substituted or non-substituted alkylsulfonyl, substituted or non-substituted arylsulfonyl, substituted or non-substituted alkylphosphonyl radical, or substituted or non-substituted arylphosphonyl radical;
[0092] Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0093] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and,
[0094] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.
[0095] The compound of Formula I induces the skipping of exon 7 in the human SNAP25 pre-mRNA, yields the human SNAP25 mRNA splice variant(s) lacking exon 7, and therefore is useful to inhibit the functional activity of the gene transcribing the human SNAP25 pre-mRNA.
[0096] The condition adopted to describe the compound of Formula I that n is an integer between 10 and 25 literally states that n is an integer selectable from a group of integers of 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, and 24.
[0097] The compound of Formula I complementarily binds to the 3 splice site of exon 7 of the human SNAP25 pre-mRNA read out from the human SNAP25 gene [accessed from NCBI Reference Sequence: NG_029626.1]. The 14-mer sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] spanning the junction of intron 6 and exon 7 in the human SNAP25 pre-mRNA is a 3 splice site consisting of 7-mer from intron 6 and 7-mer from exon 7. Thus the 14-mer pre-mRNA sequence may be conventionally denoted as [(5.fwdarw.3) aucccag | GGUAACA (SEQ ID NO: 1)], wherein the intron and exon sequence are denoted with small and capital letters, respectively, and the intron-exon junction is marked with |. The conventional denotation for pre-mRNA is further illustrated by a 30-mer sequence of [(5.fwdarw.3) cucuuuggaucccag | GGUAACAAAUGAUGC (SEQ ID NO: 2)] spanning the junction of intron 6 and exon 7 in the human SNAP25 pre-mRNA. The exon numbering may vary depending on reported SNAP25 mRNA transcripts. Provision of the 30-mer SNAP25 sequence is to unequivocally identify the target splice site of the compound of Formula I regardless of the exon numbering of the SNAP25 mRNA.
[0098] The chemical structures of natural (i.e., naturally occurring) or unnatural (i.e., non-naturally occurring) nucleobases in the PNA derivative of Formula I are exemplified in
[0099] The substituents adopted to describe the PNA derivative of Formula I are exemplified in
[0100] The compound of Formula I tightly binds to the complementary DNA as exemplified in the prior art [PCT/KR2009/001256]. The duplex between the PNA derivative of Formula I and its full-length complementary DNA or RNA possesses a T.sub.m value too high to be reliably determined in aqueous buffer. The PNA compound of Formula I yields high T.sub.m values with complementary DNAs of shorter length.
[0101] The compound of Formula I tightly binds to the target 3 splice site of the human SNAP25 pre-mRNA transcribed from the human SNAP25 gene, and interferes with the formation of splicesome early complex involving the said compound's target exon. Since the compound of this invention sterically inhibits the formation of splicesome early complex, the SNAP25 exon 7 is spliced out to yield SNAP25 mRNA splice variant(s) lacking exon 7. Consequently the compound of this invention induces the skipping of the SNAP25 exon 7.
[0102] Owing to the said compound's strong affinity for the complementary pre-mRNA sequence, the compound of this invention may also tightly bind to a partially complementary pre-mRNA sequence wuth one or two mismatches, and induce the skipping of the target exon within the SNAP25 pre-mRNA.
[0103] The compound of Formula I possesses good cell permeability and can be readily delivered into cell as naked oligonucleotide as exemplified in the prior art [PCT/KR2009/001256]. Thus the compound of this invention induces the skipping of exon 7 in the SNAP25 pre-mRNA to yield SNAP25 mRNA splice variant(s) lacking SNAP25 exon 7 in cells treated with the compound of Formula I as naked oligonucleotide. The compound of Formula I does not require any means or formulations for delivery into cell to potently induce the skipping of the target exon in cells. The compound of Formula I readily induces the skipping of the SNAP25 exon 7 in cells treated with the compound of this invention as naked oligonucleotide at sub-femtomolar concentration.
[0104] Owing to the good cell or membrane permeability, the PNA derivative of Formula I can be topically administered as naked oligonucleotide to induce the skipping of the SNAP25 exon 7 in target skin. The said compound does not require a formulation to increase trans-dermal delivery into target tissue for the intended therapeutic or biological activity. Usually the compound of Formula I is dissolved in water and co-solvent, and topically or trans-dermally administered at subpicomolar concentration to elicit the desired therapeutic or biological activity around the dermal administration site. The compound of this invention does not need to be heavily or invasively formulated to elicit the topical therapeutic activity.
[0105] The compound of Formula I may be used as combined with a pharmaceutically acceptable acid or base including but not limited to sodium hydroxide, potassium hydroxide, hydrochloric acid, methanesulfonic acid, citric acid, trifluoroacetic acid, and so on.
[0106] The PNA derivative of Formula I or a pharmaceutically acceptable salt thereof can be administered to a subject in combination with a pharmaceutically acceptable adjuvant including but not limited to citric acid, hydrochloric acid, tartaric acid, stearic acid, polyethyleneglycol, polypropyleneglycol, ethanol, isopropanol, sodium bicarbonate, distilled water, preservative(s), and so on.
[0107] The compound of the present invention can be topically administered to a subject at a therapeutically or biologically effective concentration ranging from 1 aM (i.e., 10.sup.18 M) to higher than 1 nM, which would vary depending on the dosing schedule, conditions or situations of the subject, and so on.
[0108] Preferred is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:
[0109] wherein,
[0110] n is an integer between 10 and 25;
[0111] the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA;
[0112] the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA, or partially complementary to the human SNAP25 pre-mRNA with one or two mismatches;
[0113] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido, hydrido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0114] X and Y independently represent hydrido, formyl, aminocarbonyl, aminothiocarbonyl, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, substituted or non-substituted aryloxythiocarbonyl, substituted or non-substituted alkylsulfonyl, substituted or non-substituted arylsulfonyl, substituted or non-substituted alkylphosphonyl radical, or substituted or non-substituted arylphosphonyl radical;
[0115] Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, substituted or non-substituted amino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0116] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and,
[0117] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV:
##STR00003##
[0118] wherein,
[0119] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical;
[0120] L.sub.1, L.sub.2 and L.sub.3 are a covalent linker represented by Formula V covalently linking the basic amino group to the nucleobase moiety:
##STR00004##
[0121] wherein,
[0122] Q.sub.1 and Q.sub.m are substituted or non-substituted methylene (CH.sub.2) radical, and Q.sub.m is directly linked to the basic amino group;
[0123] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen (O), sulfur (S), and substituted or non-substituted amino radical [N(H), or N(substituent)-]; and,
[0124] m is an integer between 1 and 15.
[0125] The condition adopted to describe Formula V that m is an integer between 1 and 15 literally states that m is an integer selectable from a group of integers of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14.
[0126] Of interest is a PNA oligomer of Formula I, or a pharmaceutically acceptable salt thereof:
[0127] wherein,
[0128] n is an integer between 11 and 21;
[0129] the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA;
[0130] the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA, or partially complementary to the human SNAP25 pre-mRNA with one or two mismatches;
[0131] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0132] X and Y independently represent hydrido, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical;
[0133] Z represents substituted or non-substituted amino radical;
[0134] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases;
[0135] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0136] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical;
[0137] Q.sub.1 and Q.sub.m are substituted or non-substituted methylene radical, and Q.sub.m is directly linked to the basic amino group;
[0138] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen, and amino radical; and,
[0139] m is an integer between 1 and 11.
[0140] Of particular interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:
[0141] wherein,
[0142] n is an integer between 11 and 19;
[0143] the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA;
[0144] the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA;
[0145] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0146] X and Y independently represent hydrido, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted alkylsulfonyl, or substituted or non-substituted arylsulfonyl radical;
[0147] Z represents substituted or non-substituted amino radical;
[0148] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases;
[0149] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0150] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical;
[0151] Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group;
[0152] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, oxygen, and amino radical; and,
[0153] m is an integer between 1 and 9.
[0154] Of high interest is a PNA oligomer of Formula I, or a pharmaceutically acceptable salt thereof:
[0155] wherein,
[0156] n is an integer between 11 and 19;
[0157] the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA;
[0158] the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA;
[0159] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0160] X and Y independently represent hydrido, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical;
[0161] Z represents substituted or non-substituted amino radical;
[0162] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases;
[0163] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0164] R.sub.1, R.sub.3, and R.sub.5 are hydrido radical, and R.sub.2, R.sub.4, and R.sub.6 independently represent hydrido, or substituted or non-substituted alkyl radical;
[0165] Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group;
[0166] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, oxygen radical; and,
[0167] m is an integer between 1 and 8.
[0168] Of higher interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:
[0169] wherein,
[0170] n is an integer between 11 and 19;
[0171] the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA;
[0172] the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA;
[0173] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0174] X and Y independently represent hydrido, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical;
[0175] Z represents substituted or non-substituted amino radical;
[0176] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from adenine, thymine, guanine, cytosine, and unnatural nucleobases;
[0177] at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0178] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical;
[0179] Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group;
[0180] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, and oxygen radical; and,
[0181] m is an integer between 1 and 8.
[0182] Of highest interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:
[0183] wherein,
[0184] n is an integer between 11 and 19;
[0185] the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer pre-mRNA sequence of [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 1)] in the human SNAP25 pre-mRNA;
[0186] the compound of Formula I is fully complementary to the human SNAP25 pre-mRNA;
[0187] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0188] X is hydrido radical;
[0189] Y represents substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical;
[0190] Z represents substituted or non-substituted amino radical;
[0191] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from adenine, thymine, guanine, cytosine, and unnatural nucleobases;
[0192] at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0193] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical;
[0194] L.sub.1 represents (CH.sub.2).sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.3, CH.sub.2O(CH.sub.2).sub.4, or CH.sub.2O(CH.sub.2).sub.5 with the right end is directly linked to the basic amino group; and,
[0195] L.sub.2 and L.sub.3 are independently selected from (CH.sub.2).sub.2, (CH.sub.2).sub.3, (CH.sub.2).sub.4, (CH.sub.2).sub.5, (CH.sub.2).sub.6, (CH.sub.2).sub.7, (CH.sub.2).sub.8, (CH.sub.2).sub.2O(CH.sub.2).sub.2, (CH.sub.2)3O(CH.sub.2).sub.2, and (CH.sub.2).sub.2O(CH.sub.2).sub.3 with the right end is directly linked to the basic amino group.
[0196] Of specific interest is a PNA derivative of Formula I which is selected from the group of compounds provided below, or a pharmaceutically acceptable salt thereof: [0197] (N.fwdarw.C) Fethoc-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH.sub.2; [0198] (N.fwdarw.C) Fethoc-A(6)TC-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH.sub.2; [0199] (N.fwdarw.C) Piv-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH.sub.2; [0200] (N.fwdarw.C) Fethoc-A(6)TT-TG(6)T-TA(2O2)C-CC(1O2)T-GG(5)G-A(5)-NH.sub.2; [0201] (N.fwdarw.C) Fmoc-Lys-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH.sub.2; [0202] (N.fwdarw.C) Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(5)-NH.sub.2; [0203] (N.fwdarw.C) Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)T-A(5)-NH.sub.2; [0204] (N.fwdarw.C) Fethoc-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-NH.sub.2; [0205] (N.fwdarw.C) Fethoc-Lys-Leu-TG(5)T-TA(5)C-CC(1O2)T-GG(5)G-A(2O2)T-Lys-NH.sub.2; [0206] (N.fwdarw.C) H-TG(5)T-TA(5)C-CC(1O2)T-GG(3)G-A(5)T-NH.sub.2; [0207] (N.fwdarw.C) Benzoyl-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-Val-Lys-NH.sub.2; [0208] (N.fwdarw.C) Benzoyl-TG(5)T-TA(5)C-CC(1O3)T-GG(5)G-A(5)T-NH.sub.2; [0209] (N.fwdarw.C) n-Hexanoyl-TG(5)T-TA(8)C-CC(1O2)T-GG(5)G-A(5)T-NH.sub.2; [0210] (N.fwdarw.C) n-Propyl-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-NH.sub.2; [0211] (N.fwdarw.C) Ac-TG(5)T-TA(6)C-C(1O3)CT-GG(5)G-A(5)-NH.sub.2; [0212] (N.fwdarw.C) [N-(2-Phenylethyl)amino]carbonyl-TG(5)T-TA(4)C-CC(1O2)T-GG(5)G-A(5)T-NH.sub.2; [0213] (N.fwdarw.C) n-Propyl-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T-NH.sub.2; [0214] (N.fwdarw.C) FAM-HEX-HEX-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T-NH.sub.2; [0215] (N.fwdarw.C) n-Propyl-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T-Arg-NH.sub.2; [0216] (N.fwdarw.C) n-Benzoyl-Gly-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T-NH.sub.2; [0217] (N.fwdarw.C) NMeN-Phenyl-TG(5)T-TA(5)C-CC(1O5)T-GG(5)G-A(5)T-NH.sub.2; [0218] (N.fwdarw.C) p-Toluenesulfonyl-TG(2O3)T-TA(5)C-CC(1O2)T-GG(5)G-A(5)T-Lys-NH.sub.2 [0219] (N.fwdarw.C) Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(6)T-NH.sub.2; [0220] (N.fwdarw.C) Bezenesulfonyl-TG(5)T-TA(2O3)C-CC(1O5)T-GG(5)G-A(6)T-NH.sub.2; [0221] (N.fwdarw.C) Phenyl-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(6)T-NH.sub.2; [0222] (N.fwdarw.C) Fethoc-TG(5)G-TA(5)C-C(1O2)CT-TG(5)G-A(5)T-NH.sub.2; [0223] (N.fwdarw.C) Fethoc-TG(5)T-AA(5)C-CC(1O2)T-GG(5)T-A(5)T-NH.sub.2; [0224] (N.fwdarw.C) Fethoc-TG(6)T-TA(3)C-CC(1O5)T-GG(6)G-A(3)T-NH.sub.2; [0225] (N.fwdarw.C) Fethoc-G(5)TT-A(5)CC(1O2)-CTG-G(5)GA(5)-TC(1O2)-NH.sub.2; [0226] (N.fwdarw.C) Benzyl-G(5)TT-A(5)CC(1O2)-CTG-G(5)GA(5)-TC(1O2)-NH.sub.2; [0227] (N.fwdarw.C) Fethoc-GTT-A(3)CC(1O5)-CTG(6)-GGA(3)-TC(1O5)-NH.sub.2; [0228] (N.fwdarw.C) Fethoc-TA(5)C-C(1O2)CT(1O5)-GG(5)G-A(5)TC-C(1O2)A-NH.sub.2; [0229] (N.fwdarw.C) Fmoc-Leu-TA(4)C-C(1O3)CT-GG(5)G-A(4)TC-C(1O3)A-NH.sub.2; [0230] (N.fwdarw.C) Fethoc-C(1O2)AT-TTG(6)-TTA(5)-CCC(1O2)-TG(6)-NH.sub.2; [0231] (N.fwdarw.C) Fethoc-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)-NH.sub.2; [0232] (N.fwdarw.C) Fethoc-A(6)TT-TG(5)T-TA(5)C-C(1O2)CT-G(5)-NH.sub.2; [0233] (N.fwdarw.C) Fethoc-CA(6)T-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)-NH.sub.2; [0234] (N.fwdarw.C) Fethoc-A(5)TT-TG(5)T-TA(5)C-CC(1O2)T-GG(5)G-A(5)-NH.sub.2; [0235] (N.fwdarw.C) Fethoc-A(6)TT-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(5)-NH.sub.2; and [0236] (N.fwdarw.C) Fethoc-A(6)TT-TG(5)T-TA(6)C-C(1O2)CT-G(5)G-NH.sub.2:
[0237] wherein,
[0238] A, G, T, and C are PNA monomers with a natural nucleobase of adenine, guanine, thymine, and cytosine, respectively;
[0239] C(pOq), A(p), A(pOq), G(p), and G(pOq) are PNA monomers with an unnatural nucleobase represented by Formula VI, Formula VII, Formula VIII, Formula IX, and Formula X, respectively;
##STR00005##
[0240] wherein,
[0241] p and q are integers; and,
[0242] the abbreviations for the N- and C-terminus substituents are specifically defined as follows: Fmoc- is the abbreviation for [(9-fluorenyl)methyloxy]carbonyl-; Fethoc- for [2-(9-fluorenyl)ethyl-1-oxy]carbonyl; Ac- for acetyl-; Benzoyl- for benzenecabonyl-; Piv- for pivalyl-; n-Propyl- for 1-(n-propyl)-; H- for hydrido- group; p-Toluenesulfonyl for (4-methylbenzene)-1-sulfonyl-; -Lys- for amino acid residue lysine; -Val- for amino acid residue valine; -Leu- for amino acid residue leucine; -Arg- for amino acid residue arginine; -Gly- for amino acid residue glycine; [N-(2-Phenylethyl)amino]carbonyl- for [N-1-(2-phenylethyl)amino]carbonyl-; Benzyl- for 1-(phenyl)methyl-; Phenyl- for phenyl-; Me- for methyl-; -HEX- for 6-amino-1-hexanoyl-, FAM- for 5, or 6-fluorescein-carbonyl-(isomeric mixture), and -NH2 for non-substituted -amino group.
[0243]
[0244]
[0245] In order to illustrate the abbreviations employed for such PNA derivatives, the chemical structure for a 14-mer PNA derivative abbreviated as (N.fwdarw.C) Fethoc-GA(5)A-C(1O2)TT-A(5)TC-CTA(5)-C(1O2)T-NH.sub.2 is provided in
[0246] A 16-mer PNA sequence of (N.fwdarw.C) Fethoc-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH.sub.2 is equivalent to the DNA sequence of (5.fwdarw.3) ATT-TGT-TAC-CCT-GGG-A (SEQ ID NO: 3) for complementary binding to pre-mRNA. The 16-mer PNA has a 16-mer complementary overlap with the human SNAP25 pre-mRNA as marked bold and underlined in the 30-mer pre-mRNA sequence of
TABLE-US-00001 [(5 .fwdarw. 3)cucuuuggaucccag| GGUAACAAAUGAUGC(SEQ IDNO:2)]
spanning the junction of intron 6 and exon 7 in the human SNAP25 pre-mRNA.
[0247] A 14-mer PNA sequence of (N.fwdarw.C) Fmoc-Leu-TA(4)C-C(1O3)CT-GG(5)G-A(4)TC-C(1O3)A-NH.sub.2 is equivalent to the DNA sequence of (5.fwdarw.3) TAC-CCT-GGG-ATC-CA (SEQ ID NO: 4) for complementary binding to pre-mRNA. The 14-mer PNA has a 14-mer complementary overlap with the human SNAP25 pre-mRNA as marked bold and underlined in the 30-mer pre-mRNA sequence of
TABLE-US-00002 [(5 .fwdarw. 3)cucuuuggaucccag| GGUAACAAAUGAUGC(SEQ IDNO:2)].
[0248] A 16-mer PNA sequence of (N.fwdarw.C) Fethoc-A(6)TC-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)-NH.sub.2 is equivalent to the DNA sequence of (5.fwdarw.3) ATC-TGT-TAC-CCT-GGG-A (SEQ ID NO: 5) for complementary binding to pre-mRNA. The 16-mer PNA has a 15-mer complementary overlap with the 16-mer sequence as marked in bold and underlined in the 30-mer pre-mRNA sequence of [(5.fwdarw.3) cucuuuggaucccag | GGUAACAAAUGAUGC (SEQ ID NO: 2)], in which the single mismatch is marked with a quote sign ( ). The 16-mer PNA is partially complementary to the 3 splice site of the SNAP25 exon 7 with a single mismatch with exon 7.
DETAILED DESCRIPTION OF INVENTION
General Procedures for Preparation of PNA Oligomers
[0249] PNA oligomers were synthesized by solid phase peptide synthesis (SPPS) based on Fmoc-chemistry according to the method disclosed in the prior art [U.S. Pat. No. 6,133,444; WO 96/40685] with minor modifications if needed. The solid support employe.d in this study was H-Rink Amide-ChemMatrix purchased from PCAS BioMatrix Inc. (Quebec, Canada). Fmoc-PNA monomers with a modified nucleobase were synthesized as described in the prior art [PCT/KR 2009/001256] or with minor modifications. Such Fmoc-PNA monomers with a modified nucleobase and Fmoc-PNA monomers with a natural nucleobase were used to synthesize the PNA derivatives of the present invention. The Fmoc-PNA monomers with a modified nucleobase are provided in
[0250]
[0251] [Activation of H-Rink-ChemMatrix Resin] 0.01 mmol (ca 20 mg resin) of the ChemMatrix resin in 1.5 mL 20% piperidine/DMF was vortexed in a libra tube for 20 min, and the DeFmoc solution was filtered off. The resin was washed for 30 sec each in series with 1.5 mL methylene chloride (MC), 1.5 mL dimethylformamide (DMF), 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The resulting free amines on the solid support were subjected to coupling either with an Fmoc-PNA monomer or with an Fmoc-protected amino acid derivative.
[0252] [DeFmoc] The resin was vortexed in 1.5 mL 20% piperidine/DMF for 7 min, and the DeFmoc solution was filtered off. The resin was washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The resulting free amines on the solid support were immediately subjected to coupling with an Fmoc-PNA monomer.
[0253] [Coupling with Fmoc-PNA Monomer] The free amines on the solid support were coupled with an Fmoc-PNA monomer as follows. 0.04 mmol of an Fmoc-PNA monomer, 0.05 mmol HBTU [2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluoro-phosphate], and 10 mmol DIEA (N,N-diisopropylethylamine) were incubated for 2 min in 1 mL anhydrous DMF, and added to the resin with free amines. The resin solution was vortexed for 1 hour and the reaction medium was filtered off. Then the resin was washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC.
[0254] [Capping] Following the coupling reaction, the unreacted free amines were capped by shaking for 5 min in 1.5 mL capping solution (5% acetic anhydride and 6% 2,6-leutidine in DMF). Then the capping solution was filtered off and washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC.
[0255] [Introduction of Fethoc- Radical in N-Terminus] Fethoc- radical was introduced to the N-terminus by reacting the free amines on the resin with Fethoc-OSu under usual basic coupling conditions. The chemical structure of Fethoc-OSu [CAS No. 179337-69-0, C.sub.20H.sub.17NO.sub.5, MW 351.36] is provided as follows.
##STR00006##
[0256] [Cleavage from Resin] PNA oligomers bound to the resin were cleaved from the resin by shaking for 3 hours in 1.5 mL cleavage solution (2.5% tri-isopropylsilane and 2.5% water in trifluoroacetic acid). The resin was filtered off and the filtrate was concentrated under reduced pressure. The resulting residue was triturated with diethylether and the resulting precipitate was collected by filtration for purification by reverse phase HPLC.
[0257] [HPLC Analysis and Purification] Following a cleavage from resin, the crude product of a PNA derivative was purified by C.sub.18-reverse phase HPLC eluting water/acetonitrile or water/methanol (gradient method) containing 0.1% TFA.
Synthetic Examples for PNA Derivative of Formula I
[0258] In order to complementarily target the 3 splice site of exon 7 in the human SNAP25 pre-mRNA, PNA derivatives of this invention were prepared according to the synthetic procedures provided above or with minor modifications. Provision of such PNA derivatives targeting the human SNAP25 pre-mRNA is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention.
[0259] Table 1 provides PNA derivatives complementarily targeting the 3 splice site of exon 7 in the human SNAP25 pre-mRNA along with structural characterization data by mass spectrometry. Provision of the SNAP25 ASOs in Table 1 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention.
TABLE-US-00003 TABLE 1 PNA derivatives complementarily targeting the 3 splice site spanning the junction of intron 6 and exon 7 in the human SNAP25 pre-mRNA along with structural characterization data by mass spectrometry. PNA Exact Mass, m/z Example PNA Sequence (N .fwdarw. C) theor..sup.a obs..sup.b ASO 1 Fethoc-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)- 5190.39 5188.38 NH.sub.2 ASO 2 Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(5)-NH.sub.2 4266.93 4266.95 ASO 3 Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(6)T-NH.sub.2 4533.03 4533.04 ASO 4 Fethoc-TG(5)G-TA(5)C-C(1O2)CT-TG(5)G-A(5)T-NH.sub.2 4519.01 4518.95 ASO 5 Fethoc-TG(6)T-TA(3)C-CC(1O5)T-GG(6)G-A(3)T-NH.sub.2 4533.03 4533.04 ASO 6 Fethoc-G(5)TT-A(5)CC(1O2)-CTG-G(5)GA(5)-TC(1O2)- 4601.07 4601.08 NH.sub.2 ASO 7 Fethoc-C(1O2)AT-TTG(6)-TTA(5)-CCC(1O2)-TG(6)-NH.sub.2 4478.98 4478.99 ASO 8 Fethoc-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)-NH.sub.2 4468.02 4468.04 ASO 9 Fethoc-A(6)TT-TG(5)T-TA(5)C-C(1O2)CT-G(5)-NH.sub.2 4216.91 4216.93 ASO 10 Fethoc-CA(6)T-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)- 5374.45 5374.44 NH.sub.2 ASO 11 Fethoc-A(6)TT-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(5)- 5188.36 5188.35 NH.sub.2 ASO 12 Fethoc-A(6)TT-TG(5)T-TA(6)C-C(1O2)CT-G(5)G-NH.sub.2 4522.04 4522.05 ASO 13 Fethoc-A(5)TT-TG(5)T-TA(5)C-CC(1O2)T-GG(5)G-A(5)- 5160.33 5160.31 NH.sub.2 ASO 14 p-Toluenesulfonyl-TG(2O3)T-TA(5)C-CC(1O2)T-GG(5)G- 4581.03 4581.05 A(5)T-Lys-NH.sub.2 ASO 15 n-Hexanoyl-TG(5)T-TA(8)C-CC(1O2)T-GG(5)G-A(5)T- 4423.05 4423.03 NH.sub.2 ASO 16 Fethoc-Lys-Leu-TG(5)T-TA(5)C-CC(1O2)T-GG(5)G- 4890.27 4890.27 A(2O2)T-Lys-NH.sub.2 ASO 17 [N-(2-Phenylethyl)amino]carbonyl-TG(5)T-TA(4)C- 4415.98 4416.14 CC(1O2)T-GG(5)G-A(5)T-NH.sub.2 ASO 18 H-TG(5)T-TA(5)C-CC(1O2)T-GG(3)G-A(5)T-NH.sub.2 4254.90 4254.64 ASO 19 n-Propyl-TG(2O2)T-TA(5)C-CC(2O2)T-GG(5)G-A(5)T- 4340.97 4341.03 NH.sub.2 ASO 20 Fethoc-TG(5)T-AA(5)C-CC(1O2)T-GG(5)T-A(5)T-NH.sub.2 4503.02 4503.04 ASO 21 N-Me-N-Phenyl-TG(5)T-TA(5)C-CC(1O5)T-GG(5)G- 4415.03 4415.00 A(5)T-NH.sub.2 ASO 22 Benzoyl-TG(5)T-TA(5)C-CC(1O3)T-GG(5)G-A(5)T-NH.sub.2 4400.97 4401.44 .sup.atheoretical exact mass, .sup.bobserved exact mass
[0260]
Binding Affinity of Model PNA Derivatives for Complementary DNA
[0261] The PNA derivatives in Table 1 were evaluated for their binding affinity for 10-mer DNAs complementarily targeting either the N-terminal or C-terminal. The binding affinity was assessed by T.sub.m value for the duplex between PNA and 10-mer complementary DNA. The duplex between PNA derivatives in Table 1 and fully complementary DNAs showed T.sub.m values too high to be reliably determined in aqueous buffer solution, since the buffer solution tended to boil during the T.sub.m measurement.
[0262] T.sub.m values were determined on an UV/Vis spectrometer as follows. A mixed solution of 4 M PNA oligomer and 4 M complementary 10-mer DNA in 4 mL aqueous buffer (pH 7.16, 10 mM sodium phosphate, 100 mM Nal) in 15 mL polypropylene falcon tube was incubated at 90 C. for a minute and slowly cooled down to ambient temperature. Then the solution was transferred into a 3 mL quartz UV cuvette equipped with an air-tight cap, and subjected to a T.sub.m measurement at 260 nm on a UV/Visible spectrophotometer as described in the prior art [PCT/KR2009/001256] or with minor modifications. 10-mer complementary DNAs for T.sub.m measurement were purchased from Bioneer (www.bioneer.com, Dajeon, Republic of Korea) and used without further purification.
[0263] Observed T.sub.m values of the PNA derivatives of Formula I were very high for a complementary binding to 10-mer DNA, and are provided in Table 2 as uncorrected. For example, ASO 3 showed a T.sub.m value of 77.3 C. for the duplex with the 10-mer complementary DNA targeting the N-terminal 10-mer in the PNA as marked bold and underlined in [(N.fwdarw.C) Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(6)T-NH.sub.2]. In the meantime, ASO 3 showed a T.sub.m of 88.7 C. for the duplex with the 10-mer complementary DNA targeting the C-terminal 10-mer in the PNA as marked bold and underlined in [(N.fwdarw.C) Fethoc-TG(5)T-TA(6)C- C(1O2)CT-GG(5)G-A(6)T-NH.sub.2].
TABLE-US-00004 TABLE 2 T.sub.m values between PNAs in Table and 10-mer complementary DNA targeting either the N-terminal or the C-terminal of PNA. T.sub.m Value, C. 10-mer PNA 10-mer DNA against N-Terminal DNA against C-Terminal ASO 2 76.0 87.6 ASO 3 77.3 88.7 ASO 4 83.0 77.0 ASO 5 73.0 85.8 ASO 6 84.0 91.8 ASO 8 58.0 68.0 ASO 9 62.0 76.0 ASO 10 61.0 68.0 ASO 12 62.0 74.0
Examples for Biological Activities of PNA Derivatives of Formula I
[0264] PNA derivatives of Formula I specified in Table 1 were evaluated for the SNAP25 antisense activity in PC12 cells of rat origin and SiMa cells of human origin, and for their ability to inhibit the SNAP25 expression in the skin of C57BL/6 mice upon topical administration. The biological examples were provided as examples to illustrate the antisense activity of the PNA derivatives of Formula I, and therefore should not be interpreted to limit the scope of the current invention to the compounds listed in Table 1.
EXAMPLE 1
Exon Skipping Induced by ASO 3
[0265] ASO 3 specified in is a 14-mer ASO fully complementary to a 14-mer sequence in the 3 splice site spanning the junction of intron 6 and exon 7 in the human SNAP25 pre-mRNA. ASO 3 complementarily overlaps with the 14-mer pre-mRNA sequence as marked bold and underlined in the 30-mer pre-mRNA sequence of
TABLE-US-00005 [(5 .fwdarw. 3)cucuuuggaucccag| GGUAACAAAUGAUGC(SEQ IDNO:2)].
ASO 3 possesses a 7-mer overlap with intron 6, and another 7-mer overlap with exon 7.
[0266] In the meantime, the 14-mer ASO possesses a 13-mer complementary overlap with the rat SNAP25 pre-mRNA read out from the rat genomic DNA [accessed from NCBI Reference Sequence: NC_005012] as marked bold and underlined in the 25-mer pre-mRNA sequence of
TABLE-US-00006 [(5 .fwdarw. 3)uggcucccag| GGUAACAAACGAUGC(SEQID NO:6)],
in which the single mismatch marked with a quote ( ) sign.
[0267] ASO 3 was evaluated for its ability to induce exon skipping in PC12 cells (Cat. Number CRL-1721, ATCC) as provided below.
[0268] [Cell Culture & ASO Treatment] PC12 cells were maintained in RPMI 1640 medium supplemented with 5% FBS, 10% horse serum, 1% streptomycin/penicillin, 1% L-glutamine, and 1% sodium pyruvate under 5% CO.sub.2 atmosphere at 37 C. Cells grown in 60 mm culture dish containing 5 mL culture medium were treated with ASO 3 at 0 (negative control), 10, 100 or 1,000 zM.
[0269] [RNA Extraction & cDNA Synthesis by One-step PCR] Following an incubation with ASO 3 for 42 hours, the cells were treated with 100 g/mL cycloheximide for another 6 hours in order to freeze the ribosomal translation. Then total RNA was extracted using Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions. 200 ng of RNA template was subjected to a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) against a set of exon-specific primers of [exon 1_forward: (5.fwdarw.3) ATGGCCGAGGACGCAGACA (SEQ ID NO: 7); and exon 14_reverse: (5.fwdarw.3) AGCATCTTTGTTGCACGTTG (SEQ ID NO: 8)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 40 cycles of 30 sec at 94 C., 30 sec at 50 C., and 1 min at 72 C.
[0270] [Nested PCR Amplification] 1 L of cDNA was subjected to a 20 L nested PCR reaction (Cat. Number K2612, Bioneer) against a set of exon specific primers of [exon 1_forward: (5.fwdarw.3) ATGGCCGAGGACGCAGACA (SEQ ID NO: 7); exon 14n_reverse: (5.fwdarw.3) TTGTTGGAGTCAGCGCCT (SEQ ID NO: 9)] according to the following cycle conditions: 95 C. for 2 min followed by 34 cycles of 30 sec at 95 C., 30 sec at 55 C., and 1 min at 72 C.
[0271] [Identification of Exon Skipping Products] The PCR products were subjected to electrophoretic separation on a 2% agarose gel. The bands of target size were collected and analyzed by Sanger Sequencing.
[0272]
[0273] The intensity of the full-length SNAP25 mRNA decreased most in the cells treated with 10 zM ASO 3. The full-length mRNA intensity gradually increased to that of the negative control (i.e., without ASO treatment), as the ASO concentration was increased from 10 to 1,000 zM. The inverted dose response pattern in the nested PCR data could be due to a transcription upregulation by the exon intron circular RNA (EIciRNA) accumulated during the exon skipping with ASO 3. [Nature Struc. Mol. Biol. vol 22(3), 256-264 (2015)]
EXAMPLE 2
qPCR for SNAP25 mRNA in PC12 Cells Treated with ASO 3
[0274] ASO 3 was evaluated by SNAP25 nested qPCR for its ability to induce changes in the rat SNAP25 mRNA level in PC12 cells as follows.
[0275] [Cell Culture & ASO Treatment] PC12 cells grown in 60 mm culture dish containing 5 mL culture medium were treated with ASO 3 at 0 (negative control), 10, 100 or 1,000 zM. (2 culture dishes per ASO concentration)
[0276] [RNA Extraction & cDNA Synthesis by One-step RT-PCR] Following an incubation with SNAP-ASO 3 for 42 hours, the cells were treated 100g/mL cycloheximide for another 6 hours to freeze the ribosomal translation. Then total RNA was extracted from cells using Universal RNA Extraction Kit (Cat. Number 9767, Takara), and 200 ng of RNA template was subjected to a 25 L reverse transcription reaction using One Step RT-PCR kit (Invitrogen, USA) against a set of exon-specific primers of [exon 1_forward: (5.fwdarw.3) ATGGCCGAGGACGCAGACA (SEQ ID NO: 7); and exon 14_reverse: (5.fwdarw.3) AGCATCTTTGTTGCACGTTG (SEQ ID NO: 8)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 20 cycles of 30 sec at 94 C., 30 sec at 55 C., and 1 min at 72 C.
[0277] [Nested qPCR Amplification] 1 L of each cDNA solution diluted by 100 was subjected to a 20 L Real-Time PCR reaction against a set of exon-specific primers of [exon 7q_forward: (5.fwdarw.3) ATGGATGAAAACCTAGAGC (SEQ ID NO: 10); and exon 8q_reverse: (5.fwdarw.3) CTTCCCAGCA-TCTTTGTT (SEQ ID NO: 11)] according to the following cycle conditions: 95 C. for 3 min followed by 40 cycles 10 sec at 95 C., and 30 sec at 60 C. The qPCR reaction was followed with a Taqman probe of [(5.fwdarw.3) 5,6-FAM-CAGCCTTCT-ZEN-CCATGATCCT-3IABkFQ (SEQ ID NO: 12)] targeting the junction of exon 7 and exon 8 to quantify specifically the full-length SNAP25 mRNA.
[0278]
EXAMPLE 3
qPCR for SNAP25 mRNA in PC12 Cells Treated with ASO 1
[0279] ASO 1 specified in Table 1 is a 16-mer ASO fully complementary to a 16-mer sequence of the 3 splice site spanning the junction of intron 6 and exon 7 in the human SNAP25 pre-mRNA. ASO 1 complementarily overlaps with the 16-mer target sequence as marked bold and underlined in the 30-mer human pre-mRNA sequence of
TABLE-US-00007 [(5 .fwdarw. 3)cucuuuggaucccag| GGUAACAAAUGAUGC(SEQ IDNO:2)].
ASO 1 possesses a 6-mer overlap with intron 6 and a 10-mer overlap with exon 7. However, the ASO possesses a single mismatch with the rat SNAP25 pre-mRNA as marked bold and underlined in the 25-mer pre-MRNA sequence of
TABLE-US-00008 [(5 .fwdarw. 3)uggcucccag| GGUAACAAACGAUGC(SEQID NO:6)],
in which the single mismatch is marked with a quote ( ) sign.
[0280] ASO 1 was evaluated by SNAP25 nested qPCR for its ability to induce changes in the rat SNAP25 mRNA level in PC12 cells as described in Example 2, unless noted otherwise.
[0281]
EXAMPLE 4
Inhibition of SNAP25 Protein Expression in PC12 Cells by ASO 3
[0282] ASO 3 was evaluated for its ability to inhibit the expression of the SNAP25 protein in PC12 cells as follows.
[0283] PC12 cells were grown in 60 mm culture dish containing 5 mL culture medium, and treated with ASO 3 at 0 zM (negative control), 1 zM, 10 zM, 30 zM, 100 zM, 300 zM, 1 aM, 3 aM or 10 aM for 48 hours. There were 4 culture dishes of the negative control to compensate for potential technical artifacts during the western blot analysis.
[0284] [Cell Lysis] Then the cells were subjected to lysis on ice with 200 L 1 RIPA buffer (Cat. Number 9806, Cell Signaling Tech) supplemented with 1% SDS and 1 proteinase inhibitors cocktail (cOmplete Mini, Roche). The lysates were collected in 1.5 mL e-tube, mixed with 100 L 5 sample buffer, and boiled for 5 min.
[0285] [Western Blot] The lysates were subjected to electrophoretic separation on a 4-15% TGX-PAGE gradient gel (Cat. Number 456-1086, Bio-Rad) and then transferred onto a 0.45 m PVDF membrane. The membrane was probed with an anti-SNAP25 antibody (Cat. Number S9684, Sigma) and an anti--actin antibody (Cat. Number A3845, Sigma).
[0286]
EXAMPLE 5
Inhibition of SNAP25 Protein Expression in PC12 Cells by ASO 1
[0287] ASO 1 was evaluated for its ability to inhibit the SNAP25 protein expression in PC12 cells as described in Example 4, unless noted otherwise. PC12 cells were treated with ASO 1 at 0 (negative control), 100 or 1,000 zM either for 48 hours or for 72 hours. (one culture dish for each ASO concentration)
[0288]
EXAMPLE 6
Inhibition of SNAP25 Protein Expression in Skin Topically Administered with ASO 1 in Mice
[0289] ASO 1 is fully complementary to the 3 splice site of exon 7 in the mouse SNAP25 pre-mRNA. ASO 1 was evaluated for its ability to inhibit the expression of the SNAP25 protein in the skin upon topical administration as described below.
[0290] [Hair Cut and Grouping] In Day 0, 8 female C57BL/6 mice (5 weeks old) were anesthetized with zoletil/rompun, and the hair in the back (ca 3 cm4 cm) was cut with a clipper. Mice were randomly assigned into four groups, i.e., no ASO treatment group (negative control) and 3 treatment groups of 1 fM, 10 fM and 100 fM ASO 1. (2 animals per group)
[0291] [Topical Administration] Topical solutions of ASO 1 were prepared by diluting a mother aqueous stock solution in 30% (v/v) aqueous ethanol supplemented with 3% (v/v) glycerin to 0 (negative control), 1, 10 and 100 fM ASO 1. Each animal was topically administered with ca 100 L of a topical solution 2 times per day (morning & late in the afternoon) during Days 0 to 4 in the back skin of hair cut using a cotton ball.
[0292] [Skin Sampling] In the afternoon of Day 4, the animals were sacrificed after anesthetizing with zoletil/rompun in order to sample the portion of the skin topically treated with the ASO. The skin samples were then subjected to immunohistochemistry (IHC) analysis against the SNAP25 protein as described below.
[0293] [SNAP25 IHC] The skin samples were cryosectioned and immunostained in series with a primary anti-SNAP25 antibody (Cat. Number ab41455, Abcam) at 1:200 dilution, with a secondary anti-IgG (Cat Number BA-1100, Vector) at 1:200 dilution, and then with Dylight 594-streptavidin (Cat Number SA-5594, Vector, CA, USA) at 1:200 dilution for red fluorescence tagging. The anti-SNAP25 antibody probes the C-terminal of the SNAP25 protein. IHC images were captured on a Zeiss slide scanner to evaluate changes in the expression of the full-length SANP25 level. DAPI staining was additionally performed to localize the dermis microstructure.
[0294]
[0295] Given that BTX has been widely used to treat facial wrinkles (for anti-aging) by injection, the inhibition of the SNAP25 protein expression in the muscle layer underneath the dermis is of pharmacological and therapeutic importance. A BTX injection is associated with a risk that a certain fraction of the injection potentially distributes to muscle tissues of safety concern. If BTX distributes to pulmonary smooth muscle tissues, for example, the subject is at a high risk of pulmonary insufficiency.
[0296] The SNAP25 inhibitory activity depends on the ASO concentration in target tissue. Upon topical administration, the ASO concentration rapidly decreases in tissues distal to the dermal layer of ASO administration. It is unlikely that target tissues of safety concern are exposed to the ASO at a concentration sufficiently high enough to raise safety concern. Thus the PNA derivative of Formula I for topical use is distinctively advantageous over BTX injection for safety as well as subject compliance.
EXAMPLE 7
Inhibition of SNAP25 Protein Expression in SiMa Cells by ASO 3
[0297] ASO 3 was evaluated for its ability to inhibit the expression of the SNAP25 protein in SiMa human neuroblastoma cells as follows.
[0298] [Cell Culture and ASO Treatment] SiMa cells (Cat. Number ACC164, DSMZ) were maintained in RPMI 1640 medium supplemented with 10% FBS, 1% streptomycin/penicillin, 1% L-glutamine, and 1% sodium pyruvate under 5% CO.sub.2 atmosphere at 37 C. SiMa cells were grown in 60 mm culture dish containing 5 mL culture medium, and were treated for 48 hours with ASO 3 at 0 zM (negative control), 1 zM to 100 aM. There were 3 culture dishes for the negative control to compensate for potential technical artifacts during the western blot analysis.
[0299] [Lysis] The cells were subjected to lysis on ice with 200 L 1 RIPA buffer (Cat. Number 9806, Cell Signaling Tech) supplemented with 0.1% SDS and 1 proteinase inhibitors cocktail (cOmplete Mini, Roche). Then the lysates were collected in 1.5 mL e-tube, mixed with 100 L 5 sample buffer, and boiled for 5 min.
[0300] [Western Blot] The lysates were subjected to electrophoretic separation on a 12% SDS-PAGE gel, and transferred onto a 0.2 m polyvinylidene difluoride (PVDF) membrane. The membrane was probed with an anti-SNAP25 antibody (Cat. Number ab41455, Sigma) and an anti--actin antibody (Cat. Number A3845, Sigma).
[0301]
SNAP25 EXAMPLE 8
qPCR for SNAP25 mRNA in SiMa Cells Treated with ASO 3
[0302] ASO 3 was evaluated by SNAP25 nested qPCR for its ability to induce changes in the human SNAP25 mRNA level in SiMa cells as follows.
[0303] [Cell Culture & ASO Treatment] SiMa cells were grown in 60 mm culture dish containing 5 mL culture medium, and were treated with ASO 3 at 0 zM (negative control), 1 zM, 10 zM, 100 zM or 1 aM, 10 aM, or 100 aM. (2 culture dishes per ASO concentration)
[0304] [RNA Extraction & cDNA Synthesis] Total RNA was extracted from cells using RNeasy Mini Kit (Cat. Number 74106, Qiagen) according to the manufacturer's instructions. 200 ng of RNA template was subjected to a 25 l reverse transcription reaction using PrimeScript 1.sup.st strand cDNA synthesis Kit (Cat. No. 6110B, Takara) against random hexamers.
[0305] [qPCR Amplification] The PCR reactions were monitored with a Taqman probe [(5.fwdarw.3) 56-FAM-CGGCTTCAT-ZEN-CCGCAGGGTAACAA-3IABkFQ (SEQ ID NO: 13)] targeting the junction of exon 6 and exon 7 against a set of exon-specific primers [exon 6_forward: (5.fwdarw.3) GACGAAC-GGGAGCAGATG (SEQ ID NO: 14); and exon 8_reverse(2): (5.fwdarw.3) ATCTCATTGCCCATATCCAGG (SEQ ID NO: 15)]. Cycle Conditions: 95 C. for 3 min followed by 40 cycles 15 sec at 95 C., and 30 sec at 60 C.
[0306]