TRANSGENIC ANIMALS AND METHOD FOR BIOPRODUCTION

20190335729 ยท 2019-11-07

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided is a genetically modified non-human mammal that comprises an anchor DNA sequence inserted at an endogenous locus of a secretory milk protein gene, wherein the anchor DNA sequence comprises a site-specific recombinase recognition site. Also provided is a genetically modified non-human mammal that comprises a transgene inserted at an endogenous locus of a secretory milk protein gene, wherein the transgene encodes a secretory protein and is operably linked to the endogenous promoter of said secretory milk protein gene, and wherein the transgene is flanked by a pair of site-specific recombinase resulting sites. The genetically modified non-human mammals provided can be used for producing the secreted recombinant protein encoded by the transgene from the milk produced by the genetically modified non-human mammals.

    Claims

    1. A genetically modified non-human mammal comprising an anchor DNA sequence inserted at an endogenous locus of a secretory milk protein gene, wherein said anchor sequence comprises a first site-specific recombinase recognition site.

    2. The non-human mammal of claim 1, wherein the secretory milk protein gene is selected from the group consisting of S1-Casein (CSN1), S2-Casein, -Casein (CSN2), -Casein, whey acid gene, and -lactalbumin.

    3. The non-human mammal of claim 1, wherein the secretory milk protein gene is -Casein.

    4. The non-human mammal of claim 3, wherein the anchor DNA sequence is inserted in intron 1 of the endogenous locus of -Casein.

    5. The non-human mammal of claim 1, wherein the first site-specific recombinase recognition site is recognized by a site-specific recombinase selected from the group consisting of Cre, Flp, the lambda invertase, gamma-delta resolvase, Tn3 resolvase, Sin resolvase, Gin invertase, Hin invertase, Tn5044 resolvase, IS607 transposase, Bxb1 wBeta, BL3, phiR4, A118, TG1, MR11, phi370, SPBc, TP901-1, phiRV, FC1, K38, phiBT1 and phiC31.

    6. The non-human mammal of claim 1, wherein the anchor DNA sequence further comprises a reporter gene operably linked to the endogenous promoter of said secretory milk protein gene.

    7. The non-human mammal of claim 6, wherein the anchor DNA sequence further comprises a second site-specific recombinase recognition site, wherein the reporter gene is flanked by the first and the second site-specific recombinase recognition site.

    8. The non-human mammal of claim 7, wherein the first site-specific recombinase recognition site is phiC31-attP and the second site-specific recombinase recognition site is Bxb1-attP, or vice versa.

    9. The non-human mammal of claim 1, wherein the non-human mammal is a rodent or a lagomorpha.

    10. The non-human mammal of claim 9, wherein the lagomorpha is a rabbit.

    11. A genetically modified non-human mammal comprising a transgene inserted at an endogenous locus of a secretory milk protein gene, wherein said transgene encodes a secretory protein and is operably linked to the endogenous promoter of said secretory milk protein gene, and wherein said transgene is flanked by a first site-specific recombinase resulting site and a second site-specific recombinase resulting site.

    12. The non-human mammal of claim 11, wherein the first site-specific recombinase resulting site is attR.

    13. The non-human mammal of claim 11, wherein the second site-specific recombinase resulting site is attL.

    14. The non-human mammal of claim 11, wherein the transgene comprises a signal-peptide encoding sequence at its 5 end.

    15. The non-human mammal of claim of 11, wherein the transgene comprises a polyA sequence at its 3 end.

    16. The non-human mammal of claim of 11, wherein the transgene encodes a therapeutic protein selected from the group consisting of antigen binding proteins, antibodies, vaccines, fusion proteins, enzymes, co-enzymes, and lysosomal proteins.

    17. The non-human mammal of claim 11, wherein the transgene is human FVII or LL37.

    18. A method for making a genetically modified non-human mammal, comprising inserting an anchor DNA sequence into an endogenous locus of a secretory milk protein gene in an embryo, wherein the anchor DNA sequence comprises a first site-specific recombinase recognition site; transferring the embryo to a female mammal of the same species; and allowing said embryo to develop into an animal.

    19. The method of claim 18, wherein the insertion step comprises introducing to the embryo a gene-editing enzyme selected from the group consisting of a ZFN, a TALEN, and a CRISPR/Cas.

    20. The method of claim 18, wherein the gene-editing enzyme is a CRISPR/Cas and wherein the inserting step further comprises introducing to the embryo a sgRNA having a sequence of: GGATATCATGTTAGAGTGCCTGG (SEQ ID NO:1).

    21. The method of claim 18, wherein the inserting step comprises treating the embryo with a homology directed repair (HDR) enhancer.

    22. The method of claim 21, wherein the homology directed repair (HDR) enhancer is RS-1.

    23. A method for making a genetically modified non-human mammal, comprising obtaining an embryo derived from a non-human mammal, wherein the embryo comprises an anchor DNA sequence inserted at an endogenous locus of a secretory milk protein gene, wherein said anchor DNA sequence comprises a first site-specific recombinase recognition site recognized by a site-specific recombinase; introducing to the embryo a construct which comprises a transgene encoding a secretory protein and a second site-specific recombinase recognition site recognized by the site-specific recombinase, and the site-specific recombinase, wherein the site-specific recombinase mediates the recombination between the first and the second site-specific recombinase recognition sites, thereby inserting the transgene at the endogenous locus of the secretory milk protein gene, wherein the transgene is operably linked to the promoter of the secretory milk protein gene; transferring the embryo carrying the transgene to a female mammal of the same species; and allowing said embryo to develop into an animal.

    24. The method of claim 23, wherein the non-human mammal is capable of producing the secretory protein in milk.

    25. A method for making a secretory protein, comprising inducing lactation in the genetically modified non-human mammal of claim 11, or genetically modified progeny of said non-human mammal, wherein the progeny's genome comprises said gene modification; collecting said secretory protein from said collected milk.

    26. A method for making a secretory protein, comprising inducing lactation in the genetically modified non-human mammal generated by the method of claim 23, or genetically modified progeny of said non-human mammal, wherein the progeny's genome comprises said gene modification; collecting said secretory protein from said collected milk.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0019] FIG. 1 shows a schematic of the rabbit CSN2 (-Casein) gene (not to scale) locus which consists of 9 exons (E1-E9), while the first coding Exon is E2. The sgRNA targeting sequence in the CSN2 (-Casein) gene for CRISPR/Cas9 mediated gene targeting is also illustrated.

    [0020] FIG. 2 illustrates the working mechanism for CRISPR/Cas9 in targeting the -casein gene

    [0021] FIG. 3 illustrates the scheme for in vitro validation and in vivo production process of transgenic animal bioproduction.

    [0022] FIG. 4 illustrates the gene targeting strategy and primers for genotyping knockout and knock-in events. Primer set LF1/RR1 is used for confirming knockout events, and for in vitro detection of presumptive knock-in events. Primer sets LF1/LR1 and RF1/RR1 are to be used to confirm accurate knock-in events in founders and their offspring animals.

    [0023] FIG. 5 illustrates the gene targeting construct with the 5 and 3 arms of casein gene sequence flanking the anchor gene (e.g., tdTomato) and integrase-recognition sites of phiC31 attP and Bxb 1 attP. The lower panel shows the transgene after knock-in at the endogenous rabbit -Casein locus.

    [0024] FIG. 6 illustrates the improvement of Cas9 or TALEN mediated HR efficiency in rabbit embryos with treatment of HDR enhancer. Effects of SCR7, RS-1, or RAD51 mRNA in improving Cas9 mediated HR efficiency at rabbit Rosa26 like locus (RLL).

    [0025] FIG. 7 illustrates the high yield of recombinant protein in the milk of pharming rabbit. In the founder rabbits, a recombinant tdTomato as a reporter expression cassette is driven by the endogenous beta-casein promoter. The founder rabbits were bred to generate female heterozygous MRP1.0-DSR rabbit. And the tdTomato concentration in the milk from this animal was determined. The tdTomato concentration was measured to be 6.3 g/L. The tdTomato concentration in a homozygous MRP1.0-DSR female reached 12.5 g/L.

    [0026] FIG. 8 illustrates the integrase mediated production of LL37 knock-in embryos.

    DESCRIPTION OF THE INVENTION

    [0027] We have developed several kinds of genetically modified non-human mammals for bioproduction. In one aspect, the mammal comprises an anchor DNA sequence inserted at an endogenous locus of a secretory milk protein gene, wherein the anchor DNA sequence comprises a site-specific recombinase recognition site. The mammal can be used as a founder animal for genetic engineering to introduce target transgene to the endogenous locus of the secretory milk protein gene. Hence in another aspect, the mammal comprises a transgene inserted at an endogenous locus of a secretory milk protein gene, wherein the transgene encodes a secretory protein and is operably linked to the endogenous promoter of said secretory milk protein gene, and wherein the transgene is flanked by a pair of site-specific recombinase resulting sites. The genetically modified non-human mammals provided can be used for producing the secreted recombinant protein encoded by the transgene from the milk produced by the genetically modified non-human mammals. These and other aspects of the disclosure are discussed below.

    Definition

    [0028] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed. In this application, the use of the singular includes the plural unless specifically stated otherwise. In this application, the use of or means and/or unless stated otherwise. Furthermore, the use of the term including, as well as other forms, such as includes and included, is not limiting. Also, terms such as element or component encompass both elements and components comprising one unit and elements and components that comprise more than one subunit unless specifically stated otherwise. Also, the use of the term portion can include part of a moiety or the entire moiety.

    [0029] The term anchor gene or anchor DNA sequence as used herein refers to a nucleotide sequence that, when being inserted into the genome of an animal, can be used to facilitate the insertion of a transgene of interest. In certain embodiments, an anchor gene comprises a site-specific recombinase recognition site. In certain embodiments, an anchor gene can further comprises a reporter gene. In certain embodiments, the anchor gene can be introduced into the genome via homologous recombination.

    [0030] The term introduce in the context of inserting a nucleic acid sequence into a cell, means transfection, or transformation, or transduction and includes reference to the incorporation of a nucleic acid sequence into a eukaryotic or prokaryotic cell wherein the nucleic acid sequence may be present in the cell transiently or may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon. The vector of the present disclosure may be introduced into a cell using any method known in the art. Various techniques for transforming animal cells may be employed, including, for example: microinjection, retrovirus mediated gene transfer, electroporation, transfection, or the like (see, e.g., Keown et al., Methods in Enzymology 1990, 185:527-537). In one embodiment, the vector is introduced to the cell via a virus.

    [0031] The term non-human mammal as used herein refers to a mammal, except human being, at any stage of development. In certain embodiments, the non-human mammal is a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig. In some embodiments, the non-human mammal may be a transgenic mammal, genetically-engineered mammal, and/or a clone. In certain embodiments, the non-human mammal is highly efficient in inducing a process of involution and cessation of milk production in a mammary gland of a lactating mammal, including a lactating livestock animal.

    [0032] The term operably linked refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, a given signal peptide that is operably linked to a polypeptide directs the secretion of the polypeptide from a cell. In the case of a promoter, a promoter that is operably linked to a coding sequence will direct the expression of the coding sequence. The promoter or other control elements need not be contiguous with the coding sequence, so long as they function to direct the expression thereof. For example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence and the promoter sequence can still be considered operably linked to the coding sequence.

    [0033] As used herein, a promoter is an array of nucleic acid control sequences which direct transcription of a nucleic acid. A promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription.

    [0034] The term recombination refers to a process of exchange of genetic information between two polynucleotides. Homologous recombination (HR) refers to the specialized form of an exchange that takes place, for example, during repair of double-strand breaks in cells. Nucleotide sequence homology is utilized in recombination, for example using a donor molecule to template repair of a target molecule (i.e., the one that experienced the double-strand break) and is variously known as non-crossover gene conversion or short tract gene conversion, because it leads to the transfer of genetic information from the donor to the target.

    [0035] A secretory milk protein gene or milk protein gene refers to the genes encoding caseins (see U.S. Pat. No. 5,304,489), beta-lactoglobulin, alpha-lactalbumin, and whey acidic protein. In certain embodiments, the casein gene is preferred, for example, S1-Casein (CSN1), S2-Casein, -Casein (CSN2), or -Casein. The transcription promoter from a milk protein gene is used to obtain expression in the mammary gland the protein of interest. In certain embodiments, the anchor gene is operably linked to the promoter of a milk protein gene at the endogenous locus of said milk protein gene, or at a different site in the genome other than the endogenous locus, such as a safe harbor locus, e.g. Hipp11 (H11) locus, ROSA26 locus, Rosa26 like locus (LLC), HPRT, AAVS1 or multiple antibiotic resistance (mar) locus.

    [0036] As used herein, a selectable marker refers a gene whose expression in cells allows the cells to be enriched or depleted under particular culture conditions. A selectable marker may be a foreign gene or a cellular gene which is not naturally expressed or such a gene which is naturally expressed, but at an inappropriate level, in the target cell populations.

    [0037] Site-specific recombinase as used herein refers to a family of enzymes that mediate the site-specific recombination between specific DNA sequences recognized by the enzymes. Examples of site-specific recombinase include, without limitation, Cre recombinase, Flp recombinase, the lambda integrase, gamma-delta resolvase, Tn3 resolvase, Sin resolvase, Gin invertase, Hin invertase, Tn5044 resolvase, Tn3 transposase, sleeping beauty transposase, IS607 transposase, Bxb1 integrase, wBeta integrase, BL3 integrase, phiR4 integrase, A118 integrase, TG1 integrase, MR11 integrase, phi370 integrase, SPBc integrase, SV1 integrase, TP901-1 integrase, phiRV integrase, FC1 integrase, K38 integrase, phiBT1 integrase and phiC31 integrase.

    [0038] In certain embodiments, the site-specific recombinase is a uni-directional recombinase. As used herein, uni-directional recombinases refer to recombinase enzymes whose recognition sites are destroyed after recombination has taken place. In other words, the sequence recognized by the recombinase is changed into one that is not recognized by the recombinase upon recombination mediated by the recombinase, and the continued presence of the recombinase cannot reverse the previous recombination event.

    [0039] In certain embodiments, the expression of the integrase/site-specific recombinase can be achieved by inserting the integrase/recombinase gene into the genome of a cell, such as introducing an integrase/site-specific recombinase gene-containing vector (including promoters and other elements for expression) into the host cell so that integrase/recombinase can be expressed in the cell. Alternatively, the expression of the integrase/site-specific recombinase can be achieved by introducing into the cell the integrase/recombinase protein, mRNA or a plasmid containing the integrase/recombinase gene.

    [0040] The term vector as used herein refers to a nucleic acid molecule as introduced into a host cell, thereby producing a transformed host cell. A vector may include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication. A vector may also include one or more therapeutic genes and/or selectable marker genes and other genetic elements known in the art. A vector can transduce, transform or infect a cell, thereby causing the cell to express nucleic acids and/or proteins other than those native to the cell. A vector optionally includes materials to aid in achieving entry of the nucleic acid into the cell, such as a viral particle, liposome, nanoparticles, protein coating or the like.

    DNA Construct and Vector

    [0041] In one aspect, the present disclosure provides a DNA construct or vector, e.g., a donor plasmid or an oligodeoxyribonucleotides (ODN), that comprises an anchor gene for the purposes of gene integration in animal genome. In certain embodiments, the anchor gene is flanked by 5 and 3homology arms of a secretory milk protein gene sequence, e.g. -Casein (CSN2). The 5 and 3homology arms are cloned, e.g. by PCR, from the milk protein gene sequence, or by de novo DNA synthesis based on the location of insertion.

    [0042] In certain embodiments, the anchor gene comprises a single site-specific recombinase recognition site. In certain embodiments, the anchor gene comprises two site-specific recombinase recognition sites. The two site-specific recombinase recognition sites can be the same or different. In certain embodiments, the anchor gene comprises a reporter gene that is flanked by said two site-specific recombinase recognition sites, e.g., PhiC31 attP site at the 5 and Bxb attP site at the 3 to facilitate uni-directional cassette exchange of transgenes. In certain embodiments, the recombination sites are selected from the group consisting of wild-type attB, wild-type attP, pseudo-site thereof, and tandem repeats thereof

    [0043] In certain embodiments, the anchor gene further comprises a splicing acceptor (SA) signal after the first attP site to make the reporter gene spliced in fusion to exon1 of a milk protein mRNA. This will also leave the first attP site in the intron therefore spliced out and will not be in the fusion mRNA. In certain embodiments, the reporter gene with a signal peptide sequence at its 5 and a polyA signal at its 3 to make secreted protein encoded by the reporter gene. In certain embodiments, the reporter gene is not operably linked to a polyA signal at its 3.

    [0044] In certain embodiments, the vector further comprises a selectable marker. As used herein, a selectable marker refers a gene whose expression in cells allows the cells to be enriched or depleted under particular culture conditions. A selectable marker may be a foreign gene or a cellular gene which is not naturally expressed or such a gene which is naturally expressed, but at an inappropriate level, in the target cell populations.

    [0045] If the expression of the gene allows the cells to be enriched under particular conditions, the selectable marker is a positive selectable marker. Typically, a positive selectable marker is a gene that encodes for antibiotic resistance and selecting for those cells that express the selection marker comprises introducing antibiotic into the culture. In use, application of the antibiotic selectively kills or ablates cells that do not express the marker, leaving behind a population of cells purified or enriched in respect of those expressing the antibiotic resistance. Examples of a positive selectable marker include aminoglycoside phosphotransferase (neomycin resistance gene), puromycin-N-acetyl transferase (puromycin resistance gene), hygromycin resistance gene, and blasticidin S deaminase (blasticidin S resistance gene). Other examples of positive selectable marker include genes that can be used to select through cell sorting, e.g., fluorescent proteins and cell surface markers.

    [0046] Conversely, if the expression of the gene allows the cells to be depleted under particular culture condition, the selectable marker is a negative selectable marker.Examples of a negative selectable marker include thymidine kinase gene. In use, application of ganciclovir kills the cells with expression of thymidine kinase. Other examples of negative selectable markers include DT toxin, cell death genes, such as TRAIL, caspases and BCL2 family genes.

    Master Transgenic Mammals

    [0047] In another aspect, the present disclosure provides a master or parental non-human transgenic mammal that comprises in its germline the anchor gene described herein. In certain embodiments, the non-human transgenic mammal can be generated by introducing the construct containing the anchor gene into the genome of a pluripotent cell or an embryo of a non-human mammal. In certain embodiments, the introduction of anchor gene can be introduced into an animal by any method known to those skilled in the art. The sequence of the desired anchor gene can be introduced into pluripotent cells, such as zygotes or embryonic stem (ES) cells, by any method that will permit the introduced molecule to undergo recombination at its regions of homology. Techniques that can be used include, but are not limited to, calcium phosphate/DNA co-precipitates, microinjection of DNA into the pronucleus or cytoplasm of one-cell embryos, electroporation, bacterial protoplast fusion with intact cells, transfection, retroviral infection, and polycations, (e.g., polybrene, polyornithine, etc.), retrovirus mediated gene transfer into germ lines (Van der Putten et al., Proc. Natl. Acad. Sci. USA 82:6148-6152 (1985)), gene targeting in embryonic stem cells (Thompson et al., Cell 56:313-321 (1989)), electroporation of embryos (Lo, Mol. Cell. Biol. 3:1803-1814 (1983)), and sperm-mediated gene transfer (Lavitrano et al., Cell 57:717-723 (1989)). In certain embodiments, the DNA is single or double stranded DNA, linear or circular. (See for example, U.S. Pat. No. 4,873,191; Geurts et al., Knockout Rats via Embryo Microinjection of Zinc-Finger Nucleases, Science, vol. 325, p. 433 (Jul. 24, 2009); Tesson et al., Knockout rats generated by embryo microinjection of TALENs, Nature Biotechnology, vol. 29, No. 8, pp. 695-696 (Aug. 2011); Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual Cold Spring Harbor Laboratory (1986); Casas et al. (2004) Am J Pathol 165, 1289-1300; Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual, second ed., Cold Spring Harbor Laboratory (1994); U.S. Pat. Nos. 5,602,299; 5,175,384; 6,066,778; 4,873,191 and 6,037,521).

    [0048] The standard microinjection involves isolating fertilized ova, visualizing the embryos, injecting the DNA into either the pronucleus or the cytoplasm while holding the ova at a blunt holding pipette (a diameter of about 50 m), injecting a mixture of gene modification components including DNA, RNA, mRNA, or protein, or ribonucleoprotein (RNP), small molecule, buffer, and etc. into the pronucleus or cytoplasm using a sharply pointed pipette with a diameter of about 1.5 m.

    [0049] Embryonic cells at various developmental stages, such as embryonic stem (ES) cells, can also be used to introduce genes for generating transgenic animals. Different methods are utilized depending on the stage of development of the embryonic cell. Those transfected embryonic cells can then colonize an embryo after their introduction into the blastocoele of a blastocyst-stage embryo and contribute to the germ line of the resulting chimeric animal (see in detail: Jaenisch, Science 240:1468-1474 (1988)). Together with the transgene construct, in certain embodiments, a Cas9 mRNA and sgRNA targeting the milk protein gene, e.g. -casein (CSN2), are also transfected into the above embryonic cells to allowing site-specific insertion of the transgene into the endogenous locus of the milk protein gene. The sequence of sgRNA is designed according to the recombination sites, for example, Intron 1 or Exon 2 of (3-casein gene. A skilled artisan will appreciate, in addition to CRISPR/Cas system, other systems facilitating the knock-in process can be used, such as ZFN and TALEN. In certain embodiments, a homology directed repair (HDR) enhancer, such as RS-1, is added to the embryonic cells to increase the knock-in efficiency of nuclease mediated gene targeting system, e.g. CRISPR/Cas or TALEN.

    [0050] Prior to the introduction of transfected embryonic cells into the blastocyst, the transfected embryonic cells can be subjected to various selection protocols to enrich the proportion of embryonic cells that have integrated the knock-in gene if the knock-in gene provides a means for such selection. In certain embodiments, the donor plasmid/ODN contains negative selection marker, such as diptheria toxin A (DTA) or HSV-TK, to reduce the non-specific random insertion of the DNA fragment of the anchor gene. Alternatively, PCR can be used to screen for embryonic cells that have integrated the knock-in.

    [0051] Other pluripotent cells include a mammalian zygote or a stem cell which include an embryonic stem cell, a fetal stem cell, an induced pluripotent stem cell, and an adult stem cell. A stem cell is a cell that is capable of undergoing cycles of cell division while maintaining an undifferentiated state and differentiating into specialized cell types. A stem cell can be an omnipotent stem cell, a pluripotent stem cell, a multipotent stem cell, an oligopotent stem cell and a unipotent stem cell, any of which may be induced from a somatic cell. A stem cell may also include a cancer stem cell.

    [0052] A mammalian cell can be a livestock cell, such as a cow, a sheep, a goat or a pig cell. A mammalian cell can also be a rodent cell, e.g., a mouse, rat, hamster cell. In certain embodiments, a mammalian cell can be a lagomorpha cell, e.g., a rabbit cell. A mammalian cell can also be a non-human primate cell, e.g., simians, monkeys, apes, and prosimians.

    [0053] The embryo carrying the transgenes are then transferred into a female host mammal of the same species to allow said embryo to develop into an animal. The resulting animal are screened and evaluated to select those animals having the transgenes in their genome. The transgenic animal carrying the transgene in their genome can be used as the master animal for further gene replacement with gene of interest.

    [0054] The transgenic animals can be bred, inbred, outbred, or crossbred to produce animals with the transgene. Examples of such breeding strategies include, but are not limited to: breeding of transgenic animals with more than one integration site to establish separate lines; breeding of separate lines in order to produce compound transgenics that express the transgene at higher levels because of the effects of additive expression of each transgene; crossing of heterozygous transgenic mice to produce homozygous animals for a given integration site in order to both augment expression and eliminate the need for screening of animals by DNA analysis; crossing of separate homozygous lines to produce compound heterozygous or homozygous lines; breeding animals to different genetic strain backgrounds so as to examine effects of modifying alleles on expression of the transgene and the effects of expression.

    [0055] Transgenic animals having transgenes at different sites can also be cross bred to generate lines with different transgenes. For example, a transgenic animal carrying a transgene at the endogenous locus of -Casein can be bred with a transgenic animal carrying a transgene at the endogenous locus of S1-Casein (CSN1), so that offspring carrying transgenes at both the endogenous loci of (3-Casein and S1-Casein can be produced.

    Gene Replacement and Pharming Mammals

    [0056] In yet another aspect, the present disclosure provides a pharming non-human transgenic mammal for purposes of bioproduction that comprises in its germline a target transgene inserted to the endogenous secretory milk protein gene. In certain embodiments, pharming transgenic mammal is generated by replacing the anchor gene in the germline of the master mammal with the target tansgene. In certain embodiments, the anchor gene inserted at the endogenous locus of a secretory milk protein gene can be replaced with the transgene of interest, so that the gene of interest can be operably linked to the promotor of the secreted milk protein gene. To integrate said transgene of interest at the anchoring site, a targeting construct is introduced into the cells, such as an embryo of the master animal. The targeting construct contains the transgene of interest flanked by one or two attB (or attP) sites, when the anchor gene comprises one or two attP (or attB) sites, respectively.

    [0057] In certain embodiments, site-specific recombinase, such as serine integrase is introduced into said cells as plasmid vector, or mRNA or protein. The serine integrase mediates the recombination between the attP and attB sites. In one possibility, the recombination occurs between one attP and one attB site. In such case, the transgene is inserted at one anchoring site. In a second possibility, the recombination occurs between two pairs of attP and attB sites, resulting in the swap of the sequence in between the two attP (or attB) sites with the gene of interest. In a third possibility, the recombination between two pairs of attP and attB sites results in the swap of the sequence in between the two attP (or attB) sites with the backbone of the target construct.

    [0058] In certain embodiments, the targeting construct contains the transgene of interest flanked by two different attB (or attP) sites, each recognized by a different site-specific recombinase, and the anchor gene comprises two different attP (or attB) sites, respectively. To mediate the recombination, the two site-specific recombinases are introduced into the cell. Each site-specific recombinase mediates the recombination between one pair of attP and attB. As a result, the anchor gene is replaced through recombination by the transgene of interest in a directional manner, eliminating the possibility that the backbone of the targeting construct is inserted to the target locus.

    [0059] Following the gene replacement at the endogenous locus of the secreted milk protein gene, the embryos are transferred into recipient female animal of the same species to develop into an animal.

    [0060] In certain embodiments, an integrase-resulting site is the sequence resulting from the recombination of two corresponding integrase-specific sites. For example, an integrase-resulting site is attL or attR. The attL and attR sites are results of recombination of the attP and attB sites.

    [0061] In certain embodiments, the replaced gene encodes a non-native polypeptide. In certain embodiments, the replaced gene encodes a recombinant protein that usually is not secreted into the milk. In certain embodiments, the replaced gene encodes a therapeutic protein selected from the group consisting of antigen binding proteins, antibodies, vaccines, fusion proteins, enzymes, co-enzymes, polycistronic, and multiple peptides connected by 2A or IRES sequences, or the homologous thereof. Examples of the therapeutic proteins include, but not limited to, proteins selected from the group consisting of: LL37, alpha-1 antitrypsin, angiostatin, antihemolytic factor, antibody, antibody fragments, apolipoprotein, apoprotein, atrial natriuretic factor, atrial natriuretic polypeptide, atrial peptide, C-X-C chemokine, T39765, NAP-2, ENA-78, gro-a, gro-b, gro-c, IP-10, GCP-2, NAP-4, SDF-1, PF4, MIG, calcitonin, c-kit ligand, cytokine, CC chemokine, monocyte chemoattractant protein-1, monocyte chemoattractant protein-2, monocyte chemoattractant protein-3, monocyte inflammatory protein-1 alpha, monocyte inflammatory protein-i beta, RANTES, 1309, R83915, R91733, HCC1, T58847, D31065, T64262, CD40, CD40 ligand, c-kit ligand, collagen, colony stimulating factor (CSF), complement factor 5a, complement inhibitor, complement receptor 1, cytokine, epithelial neutrophil activating peptide-78, MIP-16, MCP-1, epidermal growth factor (EGF), epithelial neutrophil activating peptide, erythropoietin (EPO), exfoliating toxin, clotting Factor IX, Factor VII, Factor VIII, Factor X, Von Willebrand factor, fibroblast growth factor (FGF), fibrinogen, fibronectin, four-helical bundle protein, G-CSF, glp-1, GM-CSF, glucocerebrosidase, gonadotropin, growth factor, growth factor receptor, grf, hedgehog protein, hemoglobin, hepatocyte growth factor (hGF), hirudin, human growth hormone (hGH), human serum albumin, ICAM-1, ICAM-1 receptor, LFA-1, LFA-1 receptor, insulin, insulin-like growth factor (IGF), IGF-I, IGF-II, interferon (IFN), IFN-alpha, IFN-beta, IFN-gamma, interleukin (IL), IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, keratinocyte growth factor (KGF), lactoferrin, leukemia inhibitory factor, luciferase, neurturin, neutrophil inhibitory factor (NIF), oncostatin M, osteogenic protein, oncogene product, paracitonin, parathyroid hormone, PD-ECSF, PDGF, peptide hormone, pleiotropin, protein A, protein G, pth, pyrogenic exotoxin A, pyrogenic exotoxin B, pyrogenic exotoxin C, pyy, relaxin, renin, SCF, small biosynthetic protein, soluble complement receptor 1, soluble I-CAM 1, soluble interleukin receptor, soluble TNF receptor, somatomedin, somatostatin, somatotropin, streptokinase, superantigens, staphylococcal enterotoxin, SEA, SEB, SEC1, SEC2, SEC3, SED, SEE, steroid hormone receptor, superoxide dismutase, toxic shock syndrome toxin, thymosin alpha 1, tissue plasminogen activator, tumor growth factor (TGF), tumor necrosis factor, tumor necrosis factor alpha, tumor necrosis factor beta, tumor necrosis factor receptor (TNFR), VLA-4 protein, VCAM-1 protein, vascular endothelial growth factor (VEGF), urokinase, mos, ras, raf, met, p53, tat, fos, myc, jun, myb, rel, estrogen receptor, progesterone receptor, testosterone receptor, aldosterone receptor, LDL receptor, and corticosterone, lysosomal proteins such as soluble acid hydrolases (e.g., glycosidases, proteases, lipases, nucleases, phosphatases, and sulfatases) and lysosomal membrane proteins, as described in detail by T. Braulke and J. S. Bonifacino, Sorting of lysosomal proteins Biochimica et Biophysica Acta, Volume 1793, Issue 4, Pages 605-614 (April, 2009).

    [0062] Upon obtaining the genetically modified mammal carrying the transgene that is operably linked to the endogenous promoter of secreted milk protein gene in the mammary glands, the female transgenic mammals, or their progenies having the modified genome are induced lactation. The genetically modified mammals can produce secreted recombinant protein into the milk, which can be collected and purified from the milk.

    EXAMPLES

    [0063] The following examples are included to demonstrate preferred embodiments. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of embodiments, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the disclosure.

    [0064] Example 1: Design of sgRNAs for CRISPR/Cas

    [0065] Effective sgRNAs are designed for targeting the rabbit CSN2 (i.e. -Casein) gene. Rabbit CSN2 (rbCSN2) gene is located on Chromosome 15, consisting of 9 exons. The first coding Exon is Exon 2. The gene organization is illustrated in FIG. 1

    [0066] To conserve endogenous control elements of CSN2, with the goal to achieve high expression level of the transgene, we designed sgRNAs targeting the intron 1 sequence. The particular sequence selected from intron 1 on the sense strand is shown as SEQ ID NO:2.

    [0067] We next subjected the selected sequence to the online CRISPR design site (crispr.mit.edu). Four possible guide sequences were selected based on its predicted activity and safety profiles.

    [0068] Example 2: In Vitro Validation of sgRNAs

    [0069] We next performed in vitro experiments to validate the effectiveness of designed sgRNAs. The possible guide sequences were tested for activity by surveyer assay and gRNA #3 was finally chosen based on its activity and safety profile (FIG. 2).

    [0070] The overall process and decision points are illustrated in FIG. 3. sgRNA #3 was used for in vivo production of transgenic animals.

    TABLE-US-00002 TABLE1 sgRNAstargetingrabbit-Casein Sequence Targeted SEQIDNO:2 sequence sgRNA#1 GGTCCTCATTCTCGCCTGCCTGG(SEQIDNO:3) sgRNA#2 GGTGGCTCTCGCTCTTGCAAGGG(SEQIDNO:4) sgRNA#3 GGATATCATGTTAGAGTGCCTGG(SEQIDNO:1) sgRNA#4 GGGGTTAGGGAGTAGGCAAGAGG(SEQIDNO:5) sgRNA#7 CCTCATTCTCGCCTGCCTGGTGG(SEQIDNO:18)

    [0071] All animal maintenance, care and use procedures were reviewed and approved by the University Committee on the Use and Care of Animals (UCUCA) of the University of Michigan. Embryos were harvested from superovulated embryo donor female rabbits as previously described. Microinjection was performed on embryos 19-21 h post insemination using a micromanipulator under the inverted microscope equipped with a differential interference contrast (DIC) device. A mixture containing 100 ng/l Cas9 mRNA and 6 ng/l sgRNA were used for cytoplasmic microinjection. The injected embryos were washed and cultured in vitro for 3-4 days until they reached blastocyst stage.

    [0072] Blastocyst stage embryos were lysed individually and genomic DNA extracted. To get better PCR reaction, the whole genome was replicated using a REPLI-g Mini Kit (Qiagen, Germantown, Md.) following the manufacturer's protocol with slight modification. PCR products using primer set LF1/RR1 were purified and sequenced for detection of indel mutations proximate to the sgRNA target sequence (FIG. 4). On the chromatographic curves, peaks on peaks approximate the targeting site indicate an indel event. Mutation Surveyor (Softgenetics, State College, Pa.) was used to analyze sequencing results.

    TABLE-US-00003 TABLE 2 In vitro validation of sgRNAs No. Bi- embryos No. Genotyped allelic Target micro- Blastocyst by #mutated mutations gene injected (%) sequencing (%) (%) -casein 102 59 (58) 56 35 (63) 12 (36) s1-casein 88 37 (42) 37 22 (59) 5 (23)

    [0073] In total, we performed microinjection to 102 pronuclear stage embryos with sgRNA#3 targeting -casein (rbCSN2) (see Table 1). Satisfactorily, 63% of all blastocysts (n=56) that were PCR and sequenced contained insertions or deletions at or proximate the targeted cleavage site; 36% (n=12) contained biallelic mutations. These results confirmed that sgRNA#3 is effective in targeting rbCSN2.

    [0074] Because s1-casein (rbCSN1) represents another potential knock-in locus for mammary gland production of biotherapeutic agents, we designed sgRNAs targeting rbCSN1. 59% indel and 23% bi-allelic mutation rates were achieved, again confirming the high efficiency of this sgRNA.

    TABLE-US-00004 TABLE3 sgRNAstargetingrabbits1-Casein sequence Targeted CCATCGCCTAGATCATCAACCCAACTTGCCTCTTTTCAGT sequence CGAGTTTAAGG(SEQIDNO:6) Guide#1 TCGACTGAAAAGAGGCAAGTTGG(SEQIDNO:7) Guide#2 GCAAGTTGGGTTGATGATCTAGG(SEQIDNO:8) Guide#3 CGACTGAAAAGAGGCAAGTTGGG(SEQIDNO:9)

    [0075] Example 3: Construction of Donor DNA

    [0076] The goal of the present study is to modernize the existing animal pharming process. In particular, we proposed to generate master transgenic rabbits that: (i) can produce pharmaceutical proteins at a level of >10 g/L by utilizing the endogenous major milk protein (e.g., -casein, s1-casein) expression elements; (ii) can be efficiently (>40%) converted to express another pharmaceutical protein product in a cassette exchange manner taking advantage of the pre-deposited integrase sequences.

    [0077] Towards these features, we designed the donor DNA vector as illustrated in FIG. 5. The transgene (i.e., tdTomato) is immediately flanked by PhiC31 and Bxb1 integrase sequences (e.g., phiC31-attP and bxb1-attP) and next by homology arms to the rbCSN2 sequences.

    [0078] The transgene are expressed under beta-casein promoter. Based on the location of gRNA3, the 1.5 kb 5 arm and 3 arms were cloned by PCR of rabbit genomic DNA. The insert DNA fragment between 5 and 3 arms includes following components: [0079] i. PhC31 attP site at the 5 and Bxb1 attP site at the 3 to facilitate uni-directional transgene replacement. [0080] ii. A splicing acceptor (SA) signal after the 1st attP site to make the transgene spliced in fusion to exon1 in the mRNA. This will also leave the 1st attP site in the intron and will not be in the mRNA. [0081] iii. The td-tomato reporter gene with a signal peptide sequence at its 5 and a polyA signal at its 3 to make secreted td-tomato protein.

    [0082] The donor plasmid also contains DTA selectable marker to reduce the non-specific random insertion of the trans DNA fragment.

    [0083] Example 4: Improvement of Nuclease Mediated Knock-In Efficiency in Rabbit Embryos

    [0084] A major technical challenge in achieving the proposed goals is the low knock-in efficiency in rabbits, even with the use of CRISPR/Cas9. Non-homologous end joining (NHEJ) and homology directed repair (HDR) are the two main DNA repair mechanisms after Cas9/TALEN/ZFN cleaves the DNA at the target site, where NHEJ would lead to knock-out (KO) characterized by unpredictable indels and HDR favors the knock-in events when a donor template vector is co-introduced. To test whether inhibiting NHEJ or enhancing HDR will increase the chance of knock-in events in the nuclease mediated gene targeting system, we conducted experiments to examine the effects of a potent NHEJ inhibitor, SCR7 (Srivastava Metal., Cell (2012) 151(7):1474-87), and an HDR enhancer, RS-1, i.e., 3-[(benzylamino)sulfonyl]-4-bromo-N-(4-bromophenyl)benzamide (Jayathilaka K et al., Proc Natl Acad Sci USA (2008) 105(41):15848-53) on improving the efficiency of Cas9 or TALEN mediated HDR in rabbit embryos.

    [0085] We first tested the effects of SCR7 and RS-1 on Cas9 mediated HDR at a ROSA26 like locus (RLL) in the rabbit genome (FIG. 6). Donor template DNAs were co-microinjected with Cas9 mRNA and sgRNA for RLL locus. After injection, the embryos were treated for 20 h in a serial concentration of SCR7: 0 M (control), 20 M, 40 M, and 80 M, or in RS-1 at 0 M (control), 7.5 M, and 15 M. Treating embryos with SCR7 at these conditions had no significant effects on the overall knock-in efficiency (7.1% in the control vs. 7.7-9.4% in the treatment groups). Treating embryos with RS-1 at 7.5 M, surprisingly, resulted in 26.1% (12 out of 46) knock-in rate, significantly higher than those of control (4.8%) and at 15 M (5.4%). Interestingly, microinjecting RAD51 mRNA mimicked the beneficial effects of RS-1, further confirming that RAD51 is the target of RS-1 for improving nuclease mediated HDR efficiency.

    [0086] Example 5: In Vitro Knock-In Efficiencies to the Beta-Casein Locus

    [0087] After confirming the in vitro efficacy of the sgRNA (Example 2), and the improvement of the knock-in efficiency (Example 4), we evaluated the efficiencies of generating td-Tomato knock-in embryos. A mixture containing 100 ng/l donor DNA, 100 ng/l Cas9 mRNA and 6 ng/l sgRNA were used for cytoplasm microinjection. Embryos were subsequently cultured to blastocyst stages, genomic DNA extracted, and subjected to PCR using primer sets described in FIG. 4. Embryos that are positive containing the desired band size for both primer sets LF1/LR1 and RF1/RR1 are considered putative knock-in.

    [0088] Consistent with data presented in Example 4, application of RS-1 at 7.5 M significantly increased the knock-in rates, from 8.3% to 28.9% (P<0.05) (see Table 2).

    TABLE-US-00005 TABLE 4 Knock-in rates in rabbit embryos. Embryo Blastocysts Putative injected (%) Sequenced KI % KI Control 60 24 24 2 8.3 RS-1 135 69 69 20 28.9

    [0089] Example 6: Embryo Transfer Results

    [0090] After in vitro validation of the knock-in rates as described in Example 5, embryo transfer step was conducted with the goal to produce knock-in founder rabbits.

    [0091] After microinjection, embryos were cultured overnight (20 hours) with RS-1 treatment, before surgically transferred into the oviduct of a synchronized recipient doe. Approximately fifteen to twenty embryos were transferred to one recipient doe. The results were summarized in Table 3 below. In short, we transferred 45 embryos into 3 recipients. Two out the three recipients were pregnant and gave rise to 9 kits total. Among these kits, two were found to have knock-in of the transgene.

    TABLE-US-00006 TABLE 5 Production of Founder Rabbits Containing Anchor Transgene No. of No of embryos No of knock- No of No of trans- recip- No of No of in kits male female ferred ients pregnant kits born (%) founder founder 45 3 2 9 2 (22) 1 1

    [0092] The knock-in kits were bred to generate offspring with homozygous knock-in, as shown in Table 4.

    TABLE-US-00007 TABLE 6 Germline transmission and herd establishment of master rabbits No of kits No of heterozygous No of homozygous Generation bom knock-in kits knock-in kits F1 8 2 0 F2 7 23 3

    [0093] Example 7. Production of Recombinant Protein in Master Transgenic Rabbits

    [0094] We then measured the yield of recombinant tdTomato (as a reporter) in the milk of master rabbits. In the master rabbits, a recombinant tdTomato expression cassette is driven by the endogenous beta-casein promoter. After we bred the female heterozygous MRP1.0-DSR rabbit, we were able to determine the tdTomato concentration in the milk from this animal. Milk collected from the MRP1.0-DSR female was brightly red as observed by naked eye, in contrast to the milk from a WT female. We calculated the tdTomato concentration to be 6.3g/L. Later, we measured the tdTomato concentration to be 12.5g/L in a homozygous MRP1.0-DSR female.

    [0095] Example 8. Integrase Mediated Production of Knock-In Embryos

    [0096] We next used the master rabbits to generate knock-in embryos with target transgene. FIG. 8 illustrates the scheme of integrase mediated knock-in of LL37. As shown in FIG. 8, to generate knock-in embryos with target transgene, e.g., LL37, a donor construct that comprises the target transgene flanked by recombinase recognition sites, e.g., PhiC31-attB and Bxb1-attB, were introduced to the embryos of master rabbits. Also introduced to the embryos were integrases, e.g., PhiC31 and Bxb1, which mediate the recombination between the recombinase recognition sites. As a result, the tdTomato gene was replaced by the target transgene, generating the new pharming rabbit.

    [0097] The results of integrase mediated production of knock-in embryos are shown in Tables 7 and 8.

    TABLE-US-00008 TABLE 7 Integrase mediated production of LL37 knock-in embryo Genotype of Embryos Embryos LL37 knock-in embryos injected sequenced embryos (%) Master rabbit 9 9 1(11) (heterozygous) WT 12 11 0(0)

    TABLE-US-00009 TABLE 8 Integrase mediated production of rhRVIIa knock-in embryo Genotype of Embryos Embryos FVIIa knock-in embryos injected sequenced embryos (%) Master rabbit 17 16 3(18) (heterozygous) WT 14 14 0(0)