EXON SKIPPING BY PEPTIDE NUCLEIC ACID DERIVATIVES
20190337987 ยท 2019-11-07
Inventors
- Shin Chung (Yongin-si, KR)
- Daram Jung (Flwaseong-Si, KR)
- Bongjun Cho (Yongin-Si, KR)
- Kangwon Jang (Yongin-Si, KR)
- Fleungsik Yoon (Seongnam-Si, KR)
Cpc classification
C07K7/02
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/1138
CHEMISTRY; METALLURGY
C12Y113/11052
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
C07K14/00
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Abstract
A peptide nucleic acid derivative of Formula I is provided to tightly bind to a splice site within a pre-mRNA in a sequence specific manner. Given with excellent cell membrane permeability and strong affinity for RNA, the said peptide nucleic acid derivative induces exon skipping in cells treated with the peptide nucleic acid at sub-femtomolar concentration as naked oligonucleotide. The said compound shows therapeutic activity in subjects upon systemic administration even at 1 g/Kg or less, and therefore is useful to treat a disease or symptom at affordable treatment cost.
Claims
1. A peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof: ##STR00007## wherein, n is an integer between 10 and 25; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer target splice site sequence that consists of 7-mer from intron and 7-mer from exon within a target pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido [D], hydrido [H], substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; X and Y independently represent hydrido, formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], aminothiocarbonyl [NH.sub.2C(S)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, substituted or non-substituted aryloxythiocarbonyl, substituted or non-substituted alkylsulfonyl, substituted or non-substituted arylsulfonyl, substituted or non-substituted alkylphosphonyl, or substituted or non-substituted arylphosphonyl radical; Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, non-substituted amino [NH.sub.2], substituted or non-substituted alkylamino, substituted or non-substituted arylamino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.
2. The peptide nucleic acid derivative according to claim 1, or a pharmaceutically acceptable salt thereof: wherein, n is an integer between 10 and 25; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer target splice site sequence that consists of 7-mer from intron and 7-mer from exon within a target pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido, hydrido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; X and Y independently represent hydrido, formyl, aminocarbonyl, aminothiocarbonyl, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, substituted or non-substituted aryloxythiocarbonyl, substituted or non-substituted alkylsulfonyl, substituted or non-substituted arylsulfonyl, substituted or non-substituted alkylphosphonyl radical, or substituted or non-substituted arylphosphonyl radical; Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, non-substituted amino, substituted or non-substituted alkylamino, substituted or non-substituted arylamino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV: ##STR00008## wherein, R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; L.sub.1, L.sub.2 and L.sub.3 are a covalent linker represented by Formula V covalently linking the basic amino group to the nucleobase moiety: ##STR00009## wherein, Q.sub.1 and Q.sub.m are substituted or non-substituted methylene (CH.sub.2) radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen (O), sulfur (S), and substituted or non-substituted amino radical [N(H), or N(substituent)-]; and m is an integer between 1 and 15.
3. The peptide nucleic acid derivative according to claim 1, or a pharmaceutically acceptable salt thereof: wherein, n is an integer between 11 and 23; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer target splice site sequence that consists of 7-mer from intron and 7-mer from exon within a target pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido, aminocarbonyl, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, or substituted or non-substituted arylsulfonyl radical; Z represents non-substituted amino, or substituted or non-substituted alkylamino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; Q.sub.1 and Q.sub.m are substituted or non-substituted methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen, and amino radical; and m is an integer between 1 and 11.
4. The peptide nucleic acid derivative according to claim 1, or a pharmaceutically acceptable salt thereof: wherein, n is an integer between 11 and 21; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer target splice site sequence that consists of 7-mer from intron and 7-mer from exon within a target pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, or substituted or non-substituted arylsulfonyl radical; Z represents non-substituted amino, or substituted or non-substituted alkylamino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, oxygen, and amino radical; and m is an integer between 1 and 11.
5. The peptide nucleic acid derivative according to claim 1, or a pharmaceutically acceptable salt thereof: wherein, n is an integer between 11 and 19; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer target splice site sequence that consists of 7-mer from intron and 7-mer from exon within a target pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent hydrido, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, or substituted or non-substituted arylsulfonyl radical; Z represents non-substituted amino, or substituted or non-substituted alkylamino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.3, and R.sub.5 are hydrido radical, and R.sub.2, R.sub.4, and R.sub.6 independently represent hydrido, or substituted or non-substituted alkyl radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene and oxygen radical; and m is an integer between 1 and 9.
6. The peptide nucleic acid derivative according to claim 1, or a pharmaceutically acceptable salt thereof: wherein, n is an integer between 12 and 19; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer target splice site sequence that consists of 7-mer from intron and 7-mer from exon within a target pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X and Y independently represent substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents non-substituted amino, or substituted or non-substituted alkylamino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from adenine, thymine, guanine, cytosine, and unnatural nucleobases; at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical; Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group; Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene and oxygen radical; and m is an integer between 1 and 9.
7. The peptide nucleic acid derivative according to claim 1, or a pharmaceutical salt thereof: wherein, n is an integer between 12 and 18; the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer target splice site sequence that consists of 7-mer from intron and 7-mer from exon within a target pre-mRNA; the compound of Formula I is fully complementary to the target pre-mRNA sequence; S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical; X is hydrido radical; Y represents substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical; Z represents non-substituted amino, or substituted or non-substituted alkylamino radical; B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from adenine, thymine, guanine, cytosine, and unnatural nucleobases; at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV; R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical; L.sub.1 represents (CH.sub.2).sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.3, CH.sub.2O(CH.sub.2).sub.4, CH.sub.2O(CH.sub.2).sub.5, CH.sub.2O(CH.sub.2).sub.6, or CH.sub.2O(CH.sub.2).sub.7 with the right end is directly linked to the basic amino group; and L.sub.2 and L.sub.3 are independently selected from (CH.sub.2).sub.2, (CH.sub.2).sub.3, (CH.sub.2).sub.4, (CH.sub.2).sub.5, (CH.sub.2).sub.6, (CH.sub.2).sub.7, (CH.sub.2).sub.8, (CH.sub.2).sub.2O(CH.sub.2).sub.2, (CH.sub.2).sub.3O(CH.sub.2).sub.2, and (CH.sub.2).sub.2O(CH.sub.2).sub.3 with the right end is directly linked to the basic amino group.
8. A method to induce in cells the skipping of the target exon within the target pre-mRNA of the peptide nucleic acid derivative according to claim 1 comprising using the said peptide nucleic acid derivative.
9. A method to induce in a subject the skipping of the target exon within the target pre-mRNA of the peptide nucleic acid derivative according to claim 1 comprising administering the said peptide nucleic acid derivative.
10. A method to treat a disease or condition involving the expression of the target gene of the peptide nucleic acid derivative according to claim 1 comprising administering the said peptide nucleic acid derivative.
11. A method to modulate in cells the functional activity of the target gene of the peptide nucleic acid derivative according to claim 1 comprising using the said peptide nucleic acid derivative.
12. A method to modulate in a subject the functional activity of the target gene of the peptide nucleic acid derivative according to claim 1 comprising administering the said peptide nucleic acid derivative.
13. The peptide nucleic acid derivative of claim 1, wherein the compound possesses at least a 10-mer complementary overlap with a 14-mer target splice site sequence that consists of 7-mer from intron and 7-mer from exon within a target pre-mRNA, wherein the target splice site sequence is not [(5.fwdarw.3) UUGCCUGGUAAGGA (SEQ ID NO: 3)] within the human androgen receptor pre-mRNA, [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 4)] within the human SCN9A pre-mRNA, [(5.fwdarw.3) UAAGUAGGAUAAGU (SEQ ID NO: 5)] within the human HIF-1 pre-mRNA, [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 6)] within the human SNAP25 pre-mRNA, [(5.fwdarw.3) UGUUUAGGUACACU (SEQ ID NO: 7)] within the human SCN9A pre-mRNA, or [(5.fwdarw.3) UGUACAGAUUGUCU (SEQ ID NO: 8)] within the human tyrosinase pre-mRNA.
14. The peptide nucleic acid derivative of claim 1, wherein the compound possesses at least a 10-mer complementary overlap with a target splice site within a target pre-mRNA, wherein the target splice site sequence does not comprise [(5.fwdarw.3) UUGCCUGGUAAGGA (SEQ ID NO: 3)] within the human androgen receptor pre-mRNA, [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 4)] within the human SCN9A pre-mRNA, [(5.fwdarw.3) UAAGUAGGAUAAGU (SEQ ID NO: 5)] within the human HIF-1 pre-mRNA, [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 6)] within the human SNAP25 pre-mRNA, [(5.fwdarw.3) UGUUUAGGUACACU (SEQ ID NO: 7)] within the human SCN9A pre-mRNA, or [(5.fwdarw.3) UGUACAGAUUGUCU (SEQ ID NO: 8)] within the human tyrosinase pre-mRNA.
Description
BRIEF DESCRIPTION OF FIGURES
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177]
[0178]
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
[0230]
[0231]
[0232]
[0233]
[0234]
[0235]
[0236]
[0237]
[0238]
[0239]
[0240]
[0241]
[0242]
[0243]
[0244]
[0245]
[0246]
[0247]
[0248]
[0249]
[0250]
[0251]
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259]
[0260]
[0261]
SUMMARY OF INVENTION
[0262] The present invention provides a peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof:
##STR00001##
[0263] wherein,
[0264] n is an integer between 10 and 25;
[0265] the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer target splice site sequence consisting of 7-mer from intron and 7-mer from exon within a target pre-mRNA;
[0266] the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches;
[0267] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido [D], hydrido [H], substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0268] X and Y independently represent hydrido, formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], aminothiocarbonyl [NH.sub.2C(S)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, substituted or non-substituted aryloxythiocarbonyl, substituted or non-substituted alkylsulfonyl, substituted or non-substituted arylsulfonyl, substituted or non-substituted alkylphosphonyl, or substituted or non-substituted arylphosphonyl radical;
[0269] Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, non-substituted amino [NH.sub.2], substituted or non-substituted alkylamino, substituted or non-substituted arylamino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0270] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and
[0271] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.
[0272] In some embodiments, the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer target splice site sequence that consists of 7-mer from intron and 7-mer from exon within a target pre-mRNA, wherein the target splice site sequence is not [(5.fwdarw.3) UUGCCUGGUAAGGA (SEQ ID NO: 3)] within the human androgen receptor pre-mRNA, [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 4)] within the human SCN9A pre-mRNA, [(5.fwdarw.3) UAAGUAGGAUAAGU (SEQ ID NO: 5)] within the human HIF-1 pre-mRNA, [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 6)] within the human SNAP25 pre-mRNA, [(5.fwdarw.3) UGUUUAGGUACACU (SEQ ID NO: 7)] within the human SCN9A pre-mRNA, or [(5.fwdarw.3) UGUACAGAUUGUCU (SEQ ID NO: 8)] within the human tyrosinase pre-mRNA.
[0273] In some embodiments, the compound of Formula I possesses at least a 10-mer complementary overlap with a target splice site within a target pre-mRNA, wherein the target splice site sequence does not comprise [(5.fwdarw.3) UUGCCUGGUAAGGA (SEQ ID NO: 3)] within the human androgen receptor pre-mRNA, [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 4)] within the human SCN9A pre-mRNA, [(5.fwdarw.3) UAAGUAGGAUAAGU (SEQ ID NO: 5)] within the human HIF-1 pre-mRNA, [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 6)] within the human SNAP25 pre-mRNA, [(5.fwdarw.3) UGUUUAGGUACACU (SEQ ID NO: 7)] within the human SCN9A pre-mRNA, or [(5.fwdarw.3) UGUACAGAUUGUCU (SEQ ID NO: 8)] within the human tyrosinase pre-mRNA.
[0274] The compound of Formula I potently induces the skipping of the target exon of the target pre-mRNA, yields mRNA splice variant(s) lacking the target exon, and therefore is useful to modulate the functional activity of the gene transcribing the target pre-mRNA.
DESCRIPTION OF INVENTION
[0275] The present invention provides a peptide nucleic acid derivative represented by Formula I, or a pharmaceutically acceptable salt thereof:
##STR00002##
[0276] wherein,
[0277] n is an integer between 10 and 25;
[0278] the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer target splice site sequence consisting of 7-mer from intron and 7-mer from exon within a target pre-mRNA;
[0279] the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches;
[0280] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido [D], hydrido [H], substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0281] X and Y independently represent hydrido, formyl [HC(O)], aminocarbonyl [NH.sub.2C(O)], aminothiocarbonyl [NH.sub.2C(S)], substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, substituted or non-substituted aryloxythiocarbonyl, substituted or non-substituted alkylsulfonyl, substituted or non-substituted arylsulfonyl, substituted or non-substituted alkylphosphonyl, or substituted or non-substituted arylphosphonyl radical;
[0282] Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, non-substituted amino [NH.sub.2], substituted or non-substituted alkylamino, substituted or non-substituted arylamino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0283] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases; and
[0284] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases with a substituted or non-substituted amino radical covalently linked to the nucleobase moiety.
[0285] In some embodiments, the compound of Formula I possesses at least a 10-mer complementary overlap with a 14-mer target splice site sequence that consists of 7-mer from intron and 7-mer from exon within a target pre-mRNA, wherein the target splice site sequence is not [(5.fwdarw.3) UUGCCUGGUAAGGA (SEQ ID NO: 3)] within the human androgen receptor pre-mRNA, [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 4)] within the human SCN9A pre-mRNA, [(5.fwdarw.3) UAAGUAGGAUAAGU (SEQ ID NO: 5)] within the human HIF-1 pre-mRNA, [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 6)] within the human SNAP25 pre-mRNA, [(5.fwdarw.3) UGUUUAGGUACACU (SEQ ID NO: 7)] within the human SCN9A pre-mRNA, or [(5.fwdarw.3) UGUACAGAUUGUCU (SEQ ID NO: 8)] within the human tyrosinase pre-mRNA.
[0286] In some embodiments, the compound of Formula I possesses at least a 10-mer complementary overlap with a target splice site within a target pre-mRNA, wherein the target splice site sequence does not comprise [(5.fwdarw.3) UUGCCUGGUAAGGA (SEQ ID NO: 3)] within the human androgen receptor pre-mRNA, [(5.fwdarw.3) UUUUUGCGUAAGUA (SEQ ID NO: 4)] within the human SCN9A pre-mRNA, [(5.fwdarw.3) UAAGUAGGAUAAGU (SEQ ID NO: 5)] within the human HIF-1 pre-mRNA, [(5.fwdarw.3) AUCCCAGGGUAACA (SEQ ID NO: 6)] within the human SNAP25 pre-mRNA, [(5.fwdarw.3) UGUUUAGGUACACU (SEQ ID NO: 7)] within the human SCN9A pre-mRNA, or [(5.fwdarw.3) UGUACAGAUUGUCU (SEQ ID NO: 8)] within the human tyrosinase pre-mRNA.
[0287] The compound of Formula I potently induces the skipping of the target exon of the target pre-mRNA, yields mRNA splice variant(s) lacking the target exon, and therefore is useful to modulate the functional activity of the gene transcribing the target pre-mRNA.
[0288] The condition adopted to describe the compound of Formula I that n is an integer between 10 and 25 literally states that n is an integer selected from 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, and 24.
[0289] It was estimated that there would be 26,564 genes in the whole human genome. [In Silico Biol. vol 4, 387-393 (2004)] Given that there are ca 8.8 exons and 7.8 introns per gene on average, there are 368,122 splice sites [{(8.22)2}25,564=368,122] possible in the human genome. Since there are 1,048,576 (i.e., 4.sup.10) possible sequences for 10-mer pre-mRNA, even 10-mer PNA derivatives would show a sufficient level of specificity for a target splice site. However, the 5-end and 3-end of each intron are highly conserved to possess the sequence starting with [(5.fwdarw.3)|GU-] and the sequence ending with [(5.fwdarw.3)-AG|], respectively, where | stands for the junction of intron-exon or exon-intron. Thus, the compound of Formula I with an oligomer length of 11-mer or longer (i.e., n is an integer larger than 10) is predicted to show a sufficient level of specificity for the target splice site.
[0290] The compound of Formula I tightly binds to complementary nucleic acid as exemplified in the prior art [PCT/KR2009/001256]. For example, incorporation of 4 to 5 modified (i.e., unnatural of naturally non-occurring) nucleobases onto 11- to 13-mer PNA derivatives of Formula I readily yields a T.sub.m gain of 20 C. or higher in duplex formation with complementary DNA. The compound of the present invention possesses strong affinity for complementary RNA as it does for complementary DNA. Thus it is preferred to have the compound of this invention as short as possible in order to avoid undesirable off-target effects originating from the binding of the said compound to other pre-mRNA sequences with a few number of mismatches. Thus the oligomer length of the said compound is limited to be shorter than 25-mer.
[0291] The compound of Formula I is highly sensitive to a single base mismatch as exemplified in the prior art [PCT/KR2009/001256]. For example, a single base mismatch resulted in a T.sub.m loss of 11 to 22 C. depending on the type of modified base as well as the PNA sequence. Owing to the strong affinity for RNA, however, the compound of this invention still tightly binds to the target splice site sequence possessing one or two mismatches, and potently induces the skipping of the target exon.
[0292] The compound of Formula I tightly binds to either a 3 splice site or a 5 splice site within a target pre-mRNA, depending on its sequence.
[0293] In case the compound binds to a 3 splice site, the said compound possesses at least a 10-mer complementary overlap with a 14-mer sequence in a target 3 splice site consisting of 7-mer from the target intron and 7-mer from the target exon. Thus the 3 splice site is unambiguously defined as the junction between the 3-end of the target intron and the 5-end of the target exon.
[0294] In case the compound binds to a 5 splice site, the said compound possesses at least a 10-mer complementary overlap with a 14-mer sequence in a target 5 splice site consisting of 7-mer from the target exon and 7-mer from the target intron. Thus the 5 splice site is unambiguously defined as the junction between the 3-end of the target exon and the 5-end of the target intron.
[0295] The 14-mer sequence describing the compound of Formula I targeting a 3 splice site is illustrated with the 3 splice site spanning the junction of intron 1 and exon 2 in the human HIF-1 (hypoxia-inducible factor 1 alpha) pre-mRNA read out from the human HIF1A gene [NCBI Reference Sequence: NG_029606.1]. A 40-mer sequence of the 3 splice site consisting of the 20-mer from intron 1 and the 20-mer from exon 2 reads [(5-3) uucuuguuguuguuaaguag|GAUAAGUUCUGAACGUCGAA (SEQ ID NO: 9)], in which the intron and exon sequences are denoted by samll and capital letters, respectively, and the junction between intron 1 and exon 2 is marked with |. Thus the 14-mer sequence of the 3 splice site consisting of the 7-mer from HIF-1 intron 1 and the 7-mer from HIF-1 exon 2 reads [(5.fwdarw.3) uaaguag|GAUAAGU (SEQ ID NO: 10)]. In this 3 splice site, the target intron and exon are HIF-1 intron 1 and exon 2, respectively.
[0296] The above 40-mer pre-mRNA sequence was provided to unequivocally identify the 3 splice site of exon 2 in the human HIF-1 pre-mRNA, since exon numbers often vary depending on mRNA transcripts. Throughout this invention, the target splice site of the said PNA comound is unequivocally identified wherever applicable by simultaneously specifying the target exon number and a pre-mRNA sequence comprising the target splice site.
[0297] The 14-mer sequence describing the compound of Formula I targeting a 5 splice site is illustrated with the 5 splice site spanning the junction of exon 2 and intron 2 in the human HIF-1 pre-mRNA. A 40-mer sequence of the 5 splice site consisting of the 20-mer from exon 2 and the 20-mer from intron 2 reads [(5-3) GAGGAAACUUCUGGAUGCUG|gugaguuauuuuacaagggu (SEQ ID NO: 11)], in which the exon and intron sequences are denoted by capital and small letters, respectively, and the junction between exon 2 and intron 2 is marked with |. Thus the 14-mer sequence of the 5 splice site consisting of the 7-mer from HIF-1 exon 2 and the 7-mer from HIF-1 intron 2 reads [(5.fwdarw.3) GAUGCUG|gugaguu (SEQ ID NO: 12)]. In this 5 splice site, the target exon and intron are HIF-1 exon 2 and intron 2, respectively.
[0298] The compound of Formula I tightly binds to the target splice site within the target pre-mRNA, and interferes with the formation of splicesome early complex involving the compound's target splice site. The said compound tightly binds to either a 3 splice site or a 5 splice site within the target pre-mRNA depending on the nucleotide sequence of the said compound. Since the compound of this invention sterically inhibits the formation of splicesome early complex, the target exon is spliced out to yield mRNA splice variant(s) lacking the target exon. Consequently the compound of the present invention potently induces the skipping of the target exon.
[0299] The chemical structures of natural (i.e., naturally occurring) or unnatural (i.e., naturally non-occurring) nucleobases adopted to describe the PNA derivative of Formula I are exemplified in
[0300] The substituents adopted to describe the PNA derivative of Formula I are exemplified in
[0301] The compound of Formula I possesses good cell permeability and can be readily delivered into cell as naked (i.e., without being formulated with adjuvant(s) to increase delivery into cell) oligonucleotide as exemplified in the prior art [PCT/KR2009/001256]. Thus the compound of this invention potently induces the skipping of the target exon in the target pre-mRNA to yield mRNA splice variant(s) lacking the target exon in cells treated with the compound of Formula I as naked oligonucleotide.
[0302] The compound of Formula I does not require any means or formulations for delivery into cell to potently induce the skipping of the target exon in cells. In this regard, the compound of the present invention is distinctively differentiated from other classes of oligonucleotide including DNA, RNA, PTO, 2-OMe PTO, 2-OMe RNA, 2-OMOE RNA, LNA, PMO, PNA, and so on.
[0303] Given with the strong affinity for RNA and good cell permeability, the compound of Formula I readily induces the skipping of the target exon in cells with a sub-femtomolar antisense potency. To date, sub-femtomolar antisense exon skipping potency has never been reported or realized with other classes of oligonucleotide including DNA, RNA, PTO, 2-OMe PTO, 2-OMe RNA, 2-OMOE RNA, LNA, PMO, PNA, and so on. Even sub-nanomolar antisense exon skipping potency has been rarely documented with other classes of oligonucleotide. Sub-nanomolar antisense exon skipping potency was reported with PNA ASOs designed to possess a varying number of phosphonate groups covalently conjugated to the N-terminus of the PNA sequence to facilitate lipofection for transfection into cell. [Nucl. Acids Res. vol 30(13), 4424-4432 (2008)] As cited earlier in this document, the in vitro potency of antisense exon skipping has been reported to be nanomolar to micromolar even under conditions of enforced delivery into cell such as lipofection, electroporation, and so on. In this regard, the compound of Formula I is distinctively differentiated from other classes of oligonucleotide including DNA, RNA, PTO, 2-OMe PTO, 2-OMe RNA, 2-OMOE RNA, LNA, PMO, PNA, and so on.
[0304] In order for an oligonucleotide molecule to bind to its complementary sequence within a pre-mRNA, the molecule needs to be stretched out or unfolded for complementary binding to the target pre-mRNA sequence. Oligonucleotide molecules tend to aggregate or to remain folded (e.g., like hair-pin) due to their high propensity of forming inter-molecular or intra-molecular hydrogen bondings between nucleobases. Thus there would be an additional energy barrier of unfolding against antisense exon skipping with popularly investigated oligonucleotides including DNA, RNA, PTO, 2-OMe PTO, 2-OMe RNA, 2-OMOE RNA, LNA, PMO, PNA, and so on. Oligonucleotides have been conventionally quantified by UV aborption following an incubation at >90 C. in aqueous buffer to unfold oligonucleotide molecules as much as possible.
[0305] The PNA derivative of Formula I possesses multiple positive charges distributed over the whole oligonucleotide strand at physiological pH due to several basic amino groups covalently attached to the modified nucleobases therein. The multiple positive charges allow the compound of Formula I to remain unfolded or streched-out due to electrostatic repulsion between neighboring positive charges on the same oligonucleotide strand. The derivative of Formula I has a low propensity to aggregate with other molecule(s) of Formula I. Thus the compound of Formula I tends to remain structurally ready (i.e., stretched out) for complementary binding to the target sequence within the target pre-mRNA. The structural readiness is also important for the oligonucleotide of Formula I to rapidly align with the target pre-mRNA sequence as the target pre-mRNA is being transcribed from the DNA. Thus, the structural readiness combined with the strong affinity is considered to add up to the strong binding affinity to yield the sub-femtomolar antisense exon skipping potency of the compound of Formula I. In these regards, the compound of Formula I is highly differentiated from other classes of oligonucleotide including DNA, RNA, PTO, 2-OMe PTO, 2-OMe RNA, 2-OMOE RNA, LNA, PMO, PNA, and so on.
[0306] Owing to the good cell permeability, the PNA derivative of Formula I may be systemically administered as naked oligonucleotide to potently induce exon skipping in target tissue(s). The compound of Formula I does not require a formulation or an adjuvant to increase delivery into target tissue to elicit the desired therapeutic activity. The compound of Formula I is dissolved simply in PBS (phosphate buffered saline) or saline, and systemically administered to effortlessly elicit the therapeutic activity in target tissue(s).
[0307] Given with the sub-femtomolar potency of exon skipping in cells treated as naked oligonucleotide, the PNA derivative of the present invention shows in vivo therapeutic activity frequently at a systemic dose of 1 g/Kg or less. Such a strong therapeutic potency has never been realized with other classes of oligonucleotide including DNA, RNA, PTO, 2-OMe PTO, 2-OMe RNA, 2-OMOE RNA, LNA, PMO, PNA, and so on. Since the manufacturing cost of oligonucleotide is generally very high, the ultra strong potency is a big advantage for realizing an affordable treatment cost especially for patients with a chronic disease. In this regard, the compound of Formula I is highly differentiated from other classes of oligonucleotide including DNA, RNA, PTO, 2-OMe PTO, 2-OMe RNA, 2-OMOE RNA, LNA, PMO, PNA, and so on.
[0308] Due to the good cell permeability, the PNA derivative of the current invention is readily delivered topically or transdermally to elicit the therapeutic activity at the administration site. The compound of this invention does not need to be heavily or invasively formulated to elicit the intended topical therapeutic activity. The PNA derivative of Formula I is readily delivered transdermally as naked oligonucleotide. Owing to the ultra strong exon skipping potency, the said compound shows therapeutic activity upon topical or transdermal administration of a sub-picomolar oligonucleotide solution. Topical or transdermal delivery as naked oligonucleotide has been extremely challenging with other classes of oligonucleotide including DNA, RNA, PTO, 2-OMe PTO, 2-OMe RNA, 2-OMOE RNA, LNA, PMO, PNA, and so on. In this regard, the compound of Formula I is distinctively differentiated from other classes of oligonucleotide including DNA, RNA, PTO, 2-OMe PTO, 2-OMe RNA, 2-OMOE RNA, LNA, PMO, PNA, and so on.
[0309] The compound of Formula I may be used as combined with a pharmaceutically acceptable acid or base including but not limited to sodium hydroxide, potassium hydroxide, hydrochloric acid, methanesulfonic acid, citric acid, trifluoroacetic acid, and so on.
[0310] The PNA derivative of Formula I or a pharmaceutically acceptable salt thereof may be administered to a subject in combination with a pharmaceutically acceptable adjuvant including but not limited to citric acid, hydrochloric acid, tartaric acid, stearic acid, polyethyleneglycol, polypropyleneglycol, ethanol, isopropanol, sodium bicarbonate, distilled water, preservative(s), and so on.
[0311] The compound of the present invention can be systemically administered to a subject at a therapeutically effective dose ranging from 1 fmole/Kg to higher than 1 nmole/Kg, which may vary depending on the dosing schedule, conditions or situations of subject, and so on.
[0312] The compound of the current invention can be topically administered to a subject at a therapeutically effective concentration ranging from 1 aM to higher than 1 nM, which may vary depending on the dosing schedule, conditions or situations of subject, and so on.
[0313] Preferred is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:
[0314] wherein,
[0315] n is an integer between 10 and 25;
[0316] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer target splice site sequence consisting of 7-mer from intron and 7-mer from exon within the target pre-mRNA;
[0317] the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches;
[0318] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n independently represent deuterido, hydrido, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0319] X and Y independently represent hydrido, formyl, aminocarbonyl, aminothiocarbonyl, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted aryloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, substituted or non-substituted arylaminocarbonyl, substituted or non-substituted alkylaminothiocarbonyl, substituted or non-substituted arylaminothiocarbonyl, substituted or non-substituted alkyloxythiocarbonyl, substituted or non-substituted aryloxythiocarbonyl, substituted or non-substituted alkylsulfonyl, substituted or non-substituted arylsulfonyl, substituted or non-substituted alkylphosphonyl radical, or substituted or non-substituted arylphosphonyl radical;
[0320] Z represents hydrido, hydroxy, substituted or non-substituted alkyloxy, substituted or non-substituted aryloxy, non-substituted amino, substituted or non-substituted alkylamino, substituted or non-substituted arylamino, substituted or non-substituted alkyl, or substituted or non-substituted aryl radical;
[0321] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases;
[0322] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV:
##STR00003##
[0323] wherein,
[0324] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical;
[0325] L.sub.1, L.sub.2 and L.sub.3 are a covalent linker represented by Formula V covalently linking the basic amino group to the nucleobase moiety:
##STR00004##
[0326] wherein,
[0327] Q.sub.1 and Q.sub.m are substituted or non-substituted methylene (CH.sub.2) radical, and Q.sub.m is directly linked to the basic amino group;
[0328] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen (O), sulfur (S), and substituted or non-substituted amino radical [N(H), or N(substituent)-]; and
[0329] m is an integer between 1 and 15.
[0330] The unnatural nucleobases of Formula II, Formula III and Formula IV are equivalent to cytosine, adenine, and guanine, respectively, for complementary base pairing with pre-mRNA as illustrated in the prior art [PCT/KR2009/001256].
[0331] The condition adopted to describe Formula V that m is an integer between 1 and 15 literally states that n is an integer selected from 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, and 14.
[0332] Of interest is a PNA oligomer of Formula I, or a pharmaceutically acceptable salt thereof:
[0333] wherein,
[0334] n is an integer between 11 and 23;
[0335] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer target splice site sequence consisting of 7-mer from intron and 7-mer from exon within the target pre-mRNA;
[0336] the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches;
[0337] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0338] X and Y independently represent hydrido, aminocarbonyl, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, or substituted or non-substituted arylsulfonyl radical;
[0339] Z represents non-substituted amino, or substituted or non-substituted alkylamino radical;
[0340] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases;
[0341] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0342] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical;
[0343] Q.sub.1 and Q.sub.m are substituted or non-substituted methylene radical, and Q.sub.m is directly linked to the basic amino group;
[0344] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from substituted or non-substituted methylene, oxygen, and amino radical; and
[0345] m is an integer between 1 and 11.
[0346] Of particular interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:
[0347] wherein,
[0348] n is an integer between 11 and 21;
[0349] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer target splice site sequence consisting of 7-mer from intron and 7-mer from exon within the target pre-mRNA;
[0350] the compound of Formula I is fully complementary to the target pre-mRNA sequence, or partially complementary to the target pre-mRNA sequence with one or two mismatches;
[0351] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0352] X and Y independently represent hydrido, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, or substituted or non-substituted arylsulfonyl radical;
[0353] Z represents non-substituted amino, or substituted or non-substituted alkylamino radical;
[0354] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases;
[0355] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0356] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5 and R.sub.6 are independently selected from hydrido, and substituted or non-substituted alkyl radical;
[0357] Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group;
[0358] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene, oxygen, and amino radical; and
[0359] m is an integer between 1 and 11.
[0360] Of high interest is a PNA oligomer of Formula I, or a pharmaceutically acceptable salt thereof:
[0361] wherein,
[0362] n is an integer between 11 and 19;
[0363] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer target splice site sequence consisting of 7-mer from intron and 7-mer from exon within the target pre-mRNA;
[0364] the compound of Formula I is fully complementary to the target pre-mRNA sequence;
[0365] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0366] X and Y independently represent hydrido, substituted or non-substituted alkyl, substituted or non-substituted aryl, substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, substituted or non-substituted alkyloxycarbonyl, substituted or non-substituted alkylaminocarbonyl, or substituted or non-substituted arylsulfonyl radical;
[0367] Z represents non-substituted amino, or substituted or non-substituted alkylamino radical;
[0368] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from natural nucleobases including adenine, thymine, guanine, cytosine and uracil, and unnatural nucleobases;
[0369] at least four of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0370] R.sub.1, R.sub.3, and R.sub.5 are hydrido radical, and R.sub.2, R.sub.4, and R.sub.6 independently represent hydrido, or substituted or non-substituted alkyl radical;
[0371] Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group;
[0372] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene and oxygen radical; and
[0373] m is an integer between 1 and 9.
[0374] Of higher interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:
[0375] wherein,
[0376] n is an integer between 12 and 19;
[0377] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer target splice site sequence consisting of 7-mer from intron and 7-mer from exon within the target pre-mRNA;
[0378] the compound of Formula I is fully complementary to the target pre-mRNA sequence;
[0379] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0380] X and Y independently represent substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical;
[0381] Z represents non-substituted amino, or substituted or non-substituted alkylamino radical;
[0382] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from adenine, thymine, guanine, cytosine, and unnatural nucleobases;
[0383] at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0384] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical;
[0385] Q.sub.1 and Q.sub.m are methylene radical, and Q.sub.m is directly linked to the basic amino group;
[0386] Q.sub.2, Q.sub.3, . . . , and Q.sub.m-1 are independently selected from methylene and oxygen radical; and
[0387] m is an integer between 1 and 9.
[0388] Of highest interest is a PNA derivative of Formula I, or a pharmaceutically acceptable salt thereof:
[0389] wherein,
[0390] n is an integer between 12 and 18;
[0391] the compound of Formula I possesses at least a 10-mer complementary overlap with the 14-mer target splice site sequence consisting of 7-mer from intron and 7-mer from exon within the target pre-mRNA;
[0392] the compound of Formula I is fully complementary to the target pre-mRNA sequence;
[0393] S.sub.1, S.sub.2, . . . , S.sub.n-1, S.sub.n, T.sub.1, T.sub.2, . . . , T.sub.n-1, and T.sub.n are hydrido radical;
[0394] X is hydrido radical;
[0395] Y represents substituted or non-substituted alkylacyl, substituted or non-substituted arylacyl, or substituted or non-substituted alkyloxycarbonyl radical;
[0396] Z represents non-substituted amino, or substituted or non-substituted alkylamino radical;
[0397] B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from adenine, thymine, guanine, cytosine, and unnatural nucleobases;
[0398] at least five of B.sub.1, B.sub.2, . . . , B.sub.n-1, and B.sub.n are independently selected from unnatural nucleobases represented by Formula II, Formula III, or Formula IV;
[0399] R.sub.1, R.sub.2, R.sub.3, R.sub.4, R.sub.5, and R.sub.6 are hydrido radical;
[0400] L.sub.1 represents (CH.sub.2).sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.2, CH.sub.2O(CH.sub.2).sub.3, CH.sub.2O(CH.sub.2).sub.4, CH.sub.2O(CH.sub.2).sub.5, CH.sub.2O(CH.sub.2).sub.6, or CH.sub.2O(CH.sub.2).sub.7 with the right end is directly linked to the basic amino group; and
[0401] L.sub.2 and L.sub.3 are independently selected from (CH.sub.2).sub.2, (CH.sub.2).sub.3, (CH.sub.2).sub.4, (CH.sub.2).sub.5, (CH.sub.2).sub.6, (CH.sub.2).sub.7, (CH.sub.2).sub.8, (CH.sub.2).sub.2O(CH.sub.2).sub.2, (CH.sub.2).sub.3O(CH.sub.2).sub.2, and (CH.sub.2).sub.2O(CH.sub.2).sub.3 with the right end is directly linked to the basic amino group.
[0402] The compound of Formula I may be abbreviated as described in the prior art [PCT/KR2009/001256; EP2268607; U.S. Pat. No. 8,680,253]. Provided below are examples of such abbreviations used to describe the PNA derivatives of Formula I targeting the 3 splice site spanning the junction of intron 1 and exon 2 in the human HIF-1 pre-mRNA read out from the human HIF1A gene (NCBI Reference Sequence: NG_029606.1):
TABLE-US-00001 (N.fwdarw. C)Fethoc-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)- TA(5)-NH.sub.2; (N.fwdarw. C)Fmoc-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)- NH.sub.2; (N.fwdarw. C)H-CA(5)G-AA(5)C-TTA(5)-TCC(1O3)-TA(5)-NH.sub.2; (N.fwdarw. C)Ac-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)-NH.sub.2; (N.fwdarw. C)Piv-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)- NH.sub.2; (N.fwdarw. C)Benzoyl-CA(5)G(2O3)-AA(5)C-TTA(4)-TCC(1O2)- TA(5)-NH.sub.2; (N.fwdarw. C)n-Propyl-CA(5)G-AA(5)C-TTA(5)-TCC(2O2)- TA(5)-NH.sub.2; (N.fwdarw. C)Benzyl-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)- NH.sub.2; (N.fwdarw. C)p-Toluenesulfonyl-CA(5)G-AA(5)C-TTA(2O2)- TCC(1O2)-TA(5)-NH.sub.2; (N.fwdarw. C)[N-(2-Phenylethyl)amino]carbonyl-CA(5)G(3)- AA(5)C-TTA(3)-TCC(1O2)-TA(5)-NH.sub.2; (N.fwdarw. C)Fethoc-Lys-Leu-CA(5)G(2O2)-AA(5)C-TTA(8)- TCC(1O2)-TA-Lys-NH.sub.2; (N.fwdarw. C)N-Phenyl-N-Me-CA(5)G-AA(5)C-TTA(5)- TCC(1O2)-TA(5)-Lys-NH.sub.2; (N.fwdarw. C)Piv-HEX-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)- TA(5)-Lys-NH.sub.2; (N.fwdarw. C)FAM-HEX-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)- TA(5)-Lys-NH.sub.2; (N.fwdarw. C)Fethoc-GA(5)A-C(1O2)TT-A(5)TC-CTA(5)- C(1O2)T-NH.sub.2; (N.fwdarw. C)Fethoc-Arg-GA(5)A-C(1O2)TT-A(5)TC-CTA(5)- C(1O2)T-Gly-NH.sub.2; (N.fwdarw. C)Fethoc-Val-GA(5)A-CTT-A(6)TC-CTA(5)- C(2O2)T-Gly-Lys-NH.sub.2; (N.fwdarw. C)Fethoc-C(1O5)TT-A(6)TC-CTA(6)-C(1O2)TT- AA(6)C-NH.sub.2; (N.fwdarw. C)Fmoc-Val-CTC(1O2)-A(5)TC-CTA(6)-C(1O3)TT- AA(2O2)C-NH.sub.2; and (N.fwdarw. C)Fethoc-TTC(1O5)-AG(5)A-A(4)CT-TA(5)T- CC(2O2)T-A(6)CT-TA(6)-NH.sub.2:
[0403] wherein,
[0404] A, G, T, and C are PNA monomers with a natural nucleobase of adenine, guanine, thymine, and cytosine, respectively;
[0405] C(pOq), A(p), A(pOq), G(p), and G(pOq) are PNA monomers with an unnatural nucleobase represented by Formula VI, Formula VII, Formula VIII, Formula IX, and Formula X, respectively:
##STR00005##
[0406] wherein,
[0407] p and q are integers; and
[0408] the abbreviations for the N- and C-terminus substituents are specifically defined as follows: Fmoc- is the abbreviation for [(9-fluorenyl)methyloxy]carbonyl-; Fethoc- for [2-(9-fluorenyl)ethyl-1-oxy]carbonyl; Ac- for acetyl-; Benzoyl- for benzenecabonyl-; Piv- for pivalyl-; n-Propyl- for l1-(n-propyl)-; H- for hydrido- group; p-Toluenesulfonyl for (4-methylbenzene)-1-sulfonyl-; -Lys- for amino acid residue lysine; -Val- for amino acid residue valine; -Leu- for amino acid residue leucine; -Arg- for amino acid residue arginine; -Gly- for amino acid residue glycine; [N-(2-Phenylethyl)amino]carbonyl- for [N1-(2-phenylethyl)amino]carbonyl-; Benzyl- for 1-(phenyl)methyl-; Phenyl- for phenyl-; Me- for methyl-; -HEX- for 6-amino-1-hexanoyl-; FAM- for 5, or 6-fluorescein-carbonyl- (isomeric mixture); and NH.sub.2 for non-substituted -amino group.
[0409]
[0410]
[0411] In order to illustrate the abbreviations adopted for such PNA derivatives, the chemical structure for a 14-mer PNA derivative abbreviated as (N.fwdarw.C) Fethoc-GA(5)A-C(1O2)TT-A(5)TC-CTA(5)-C(1O2)T-NH.sub.2 is provided in
[0412] As another illustration, the chemical structure for a 15-mer PNA derivative abbreviated as (N.fwdarw.C) Fmoc-Val-CTC(1O2)-A(5)TC-CTA(6)-C(1O3)TT-AA(2O2)CNH.sub.2 is provided in
[0413] The compound of Formula I should meet the requirement to possess at least a 10-mer complementary overlap with a 14-mer target splice site sequence consisting of 7-mer from intron and 7-mer from exon within a target pre-mRNA. If the compound of Formula I targets, for example, the 3 splice site spanning the junction of intron 1 and exon 2 in the human HIF-1 pre-mRNA, the 3 splice site is unequivocally defined by the 30-mer human HIF-1 pre-mRNA sequence of [(5-3) guuguuguuaaguag|GAUAAGUUCUGAACG (SEQ ID NO: 13)]. Then the 14-mer sequence of the target HIF-1 3 splice site reads [(5-3) uaaguag|GAUAAGU (SEQ ID NO: 14)].
[0414] A 15-mer HIF-1 ASO with a sequence of (N.fwdarw.C) Fethoc-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)CNH.sub.2 is equivalent to the DNA sequence of (5.fwdarw.3) CAG-AAC-TTA-TCC-TAC (SEQ ID NO: 15) for complementary binding to the human HIF-1 pre-mRNA. The 15-mer ASO has a 15-mer complementary overlap (i.e., fully complementary) with the 3 splice site spanning the junction of intron 1 and exon 2 in the HIF-1 pre-mRNA as marked bold and underlined in the 30-mer pre-mRNA sequence of
TABLE-US-00002 [(5 .fwdarw. 3)guuguuguuaaguag| GAUAAGUUCUGAACG(SEQ IDNO:16)].
The PNA ASO possesses an 11-mer complementary overlap (i.e., 4-mer from intron 1 and 7-mer from exon 2) with the 14-mer HIF-1 pre-mRNA sequence of [(5* 3) uaaguag|GAUAAGU (SEQ ID NO: 17)]. Thus the 15-mer HIF-1 PNA ASO meets the conditions of the complementary overlap required for the compound of Formula I.
[0415] Another 15-mer HIF-1 ASO with a sequence of (N.fwdarw.C) Fethoc-CTC(1O2)-A(6)TC-CTA(6)-C(1O2)TT-AA(6)CNH.sub.2 is equivalent to the DNA sequence of (5.fwdarw.3) CTC-ATC-CTA-CTT-AAC (SEQ ID NO: 18) for complementary binding to the HIF-1 pre-mRNA. The 15-mer PNA ASO possesses a single mismatch with the 3 splice site spanning the junction of intron 1 and exon 2 as marked bold and underlined in the 30-mer HIF-1 pre-mRNA sequence of
TABLE-US-00003 [(5 .fwdarw. 3)guuguuguuaaguag| GAUAAGUUCUGAACG (SEQIDNO:19)],
in which the single mismatch is marked with a quote ( ) sign. The 15-mer PNA possesses a 12-mer complementary overlap with the 14-mer 3 splice site sequence adopted to describe the compound of Formula I as marked bold and underlined in
TABLE-US-00004 [(5 .fwdarw. 3)uaaguag| GAUAAGU(SEQIDNO:20)],
in which the single mismatch is marked with a quote ( ) sign. Despite the single mismatch, the 15-mer HIF-1 ASO meets the conditions of the complementary overlap required for the compound of Formula I.
[0416] In case the compound of Formula I targets, for example, the 5 splice site spanning the junction of exon 4 and intron 4 in the human SCN9A pre-mRNA, the 5 splice site is unequivocally defined by the 30-mer human SCN9A pre-mRNA sequence of [(5.fwdarw.3) CGUCAUUGUUUUUGC|guaaguacuuucagc (SEQ ID NO: 21)] read out from the human SCN9A gene (accessed from NCBI Reference Sequence: NC_000002.12). Then the 14-mer sequence of the target SCN9A 5 splice site reads [(5.fwdarw.3) UUUUUGC|guaagua (SEQ ID NO: 22)].
[0417] A 16-mer SCN9A ASO with a sequence of (N.fwdarw.C) Fethoc-AC(1O2)T-TA(5)C-G(6)CA-A(5)AA(5)-AC(1O2)A-A(5)-NH.sub.2 is equivalent to the DNA sequence of (5.fwdarw.3) ACT-TAC-GCA-AAA-ACA-A (SEQ ID NO: 23) for complementary binding to the human SCN9A pre-mRNA. The 16-mer PNA possesses a 16-mer complementary (i.e., fully complementary) overlap with the 5 splice site spanning the junction of exon 4 and intron 4 in the human SCN9A pre-mRNA as marked bold and underlined in the 30-mer SCN9A pre-mRNA sequence of
TABLE-US-00005 [(5 .fwdarw. 3)CGUCAUUGUUUUUGC| guaaguacuuucagc(SEQ IDNO:24)].
The 16-mer SCN9A ASO possesses a 13-mer complementary overlap with the 14-mer 5 splice site sequence as marked bold and underlined in
TABLE-US-00006 [(5 .fwdarw. 3)UUUUUGC| guaagua(SEQIDNO:25)].
The 16-mer SCN9A ASO meets the conditions of the complementary overlap required for the compound of Formula I.
DETAILED DESCRIPTION OF INVENTION
General Procedures for Preparation of PNA Oligomers
[0418] PNA oligomers were synthesized by solid phase peptide synthesis (SPPS) based on Fmoc-chemistry according to the method described in the prior art [U.S. Pat. No. 6,133,444; WO 96/40685] or with minor modifications. The solid support used in this invention was H-Rink Amide-ChemMatrix purchased from PCAS BioMatrix Inc. (Quebec, Canada). Fmoc-PNA monomers with a modified nucleobase were synthesized as described in the prior art [PCT/KR 2009/001256] or with minor modifications.
[0419] The chemical structures of Fmoc-PNA monomers with a modified nucleobase used in this invention are provided in
[0420] PNA oligomers were purified by Cis-reverse phase HPLC (water/acetonitrile or water/methanol with 0.1% TFA) and characterized by mass spectrometry including MALDI-TOF/MS and ESI-TOF/MS.
[0421]
[0422] [Activation of H-Rink-ChemMatrix Resin] 0.01 mmol (ca 20 mg resin) of the ChemMatrix resin in 1.5 mL 20% piperidine/dimethylformamide (DMF) was vortexed in a libra tube for 20 min, and the reaction solution was filtered off. The resin was washed for 30 sec each in series with 1.5 mL methylene chloride (MC), 1.5 mL DMF, 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The resulting free amines on the solid support were subjected to coupling either with an Fmoc-PNA monomer or with an Fmoc-protected amino acid derivative.
[0423] [DeFmoc] The resin was vortexed in 1.5 mL 20% piperidine/DMF for 7 min, and the DeFmoc solution was filtered off. The resin was washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC. The resulting free amines on the solid support were immediately subjected to coupling with an Fmoc-PNA monomer.
[0424] [Coupling with Fmoc-PNA Monomer] The free amines on the solid support were coupled with an Fmoc-PNA monomer as follows. 0.04 mmol of an Fmoc-PNA monomer, 0.05 mmol HBTU [2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluoro-phosphate], and 10 mmol DIEA (N,N-diisopropylethylamine) were incubated for 2 min in 1 mL anhydrous DMF, and added to the resin with free amines. The resin solution was vortexed for 1 hour and the reaction medium was filtered off. Then the resin was washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC.
[0425] [Capping] Following the coupling reaction, the unreacted free amines were capped by shaking for 5 min in 1.5 mL capping solution (5% acetic anhydride and 6% 2,6-leutidine in DMF). Then the capping solution was filtered off and and the resin was washed for 30 sec each in series with 1.5 mL MC, 1.5 mL DMF, and 1.5 mL MC.
[0426] [Introduction of Fethoc- Radical in N-Terminus] Fethoc- radical was introduced to the N-terminus by reacting the free amines on the resin with Fethoc-OSu under usual basic coupling conditions. The chemical structure of Fethoc-OSu [CAS No. 179337-69-0, C.sub.20H.sub.17NO.sub.5, MW 351.36] is provided as follows.
##STR00006##
[0427] [Cleavage from Resin] PNA oligomers bound to the resin were cleaved off the resin by shaking the resin for 3 hours in 1.5 mL cleavage solution (2.5% tri-isopropylsilane and 2.5% water in trifluoroacetic acid). The resin was filtered off and the filtrate was concentrated under reduced pressure or by blowing nitrogen gas over the solution. The resulting residue was triturated with diethylether and the resulting precipitate was collected by filtration for purification by reverse phase HPLC.
[0428] [HPLC Analysis and Purification] Following the cleavage off the resin, the PNA crude product was purified by Cis-reverse phase HPLC eluting water/acetonitrile or water/methanol (gradient method) containing 0.1% TFA.
Synthetic Examples for PNA Derivatives of Formula I
[0429] PNA derivatives were prepared according to the above synthetic procedures with or without minor modifications. PNA derivatives of this invention were designed to target a splice site within a pre-mRNA including but not limited to the human or mouse HIF-1 pre-mRNA, the human or mouse androgen receptor (AR) pre-mRNA, the human or rat SCN9A pre-mRNA, the mouse dystrophin pre-mRNA, the human or mouse tyrosinase pre-mRNA, the human or mouse SNAP25 pre-mRNA, the human IDO1 pre-mRNA, the human or mouse PD-1 pre-mRNA, and so on. Provision of such PNA derivatives targeting a splice site for a number of pre-mRNAs is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention to those target splice sites cited as examples.
[0430] Table 1 provides PNA derivatives complementarily targeting the 3 splice site spanning the junction of intron 1 and exon 2 in the human HIF-1 pre-mRNA along with structural characterization data by mass spectrometry. Provision of the HIF-1 ASOs in Table 1 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention to the PNA derivatives specified in Table 1.
TABLE-US-00007 TABLE1 PNAderivativescomplementarilytargetingthe3 splicesitespanning thejunctionofintron1andexon2inthehumanHIF-1 pre-mRNA alongwithstructuralcharacterizationdatabymassspectrometry. ExactMass,m/z PNA PNASequence(N.fwdarw. C) Theor..sup.a Obs..sup.b HIF- Fethoc-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)-TA(5)-NH.sub.2 4486.05 4486.04 ASO1 HIF- Fethoc-GA(5)A-C(1O2)TT-A(5)TC-CTA(5)-C(1O2)T- 4473.99 4474.02 ASO2 NH.sub.2 HIF- Fethoc-G(5)AA(5)-CTT-A(5)TC-CTA(5)-C(1O2)T-NH.sub.2 4462.03 4462.07 ASO3 HIF- Fethoc-GA(5)A-C(1O2)TT-A(5)TC-CTA(5)-CT-NH.sub.2 4376.94 4376.99 ASO4 HIF- Fethoc-G(5)AA(6)-CTT-A(6)TC-CTA(6)-C(1O2)T-NH.sub.2 4504.07 4504.09 ASO5 HIF- Fethoc-A(6)GA-A(6)CT-TA(6)T-CC(1O2)T-A(6)CT- 5393.47 5393.44 ASO6 TA(6)-NH.sub.2 HIF- Fethoc-C(1O5)TT-A(6)TC-CTA(6)-C(1O2)TT-AA(6)C- 4784.18 4784.14 ASO7 NH.sub.2 HIF- Fethoc-CTC(1O2)-A(6)TC-CTA(6)-C(1O2)TT-AA(6)C- 4727.13 4727.79 ASO8 NH.sub.2 HIF- Piv-A(6)TC-CTA(6)-C(1O2)TT-A(5)AC-NH.sub.2 3695.73 3695.74 ASO9 HIF- Piv-Lys-AA(6)C-TTA(6)-TCC(1O2)-TA(6)C-TTA(5)- 4844.33 4844.33 ASO10 Val-NH.sub.2 HIF- Fethoc-A(6)GA-A(6)CT-CA(6)T-CC(1O2)T-A(6)CT- 5448.54 5448.50 ASO11 TA(6)-NH.sub.2 HIF- H-CA(5)G-AA(5)C-TTA(5)-TCC(1O3)-TA(5)-NH.sub.2 4263.98 4263.99 ASO12 HIF- Benzoyl-CA(5)G(2O3)-AA(5)C-TTA(4)-TCC(1O2)- 4441.06 4441.06 ASO13 TA(5)-NH.sub.2 HIF- n-Propyl-CA(5)G-AA(5)C-TTA(5)-TCC(2O2)-TA(5)- 4306.03 4306.05 ASO14 NH.sub.2 HIF- p-Toluenesulfonyl-CA(5)G-AA(5)C-TTA(2O2)- 4405.95 4405.90 ASO15 TCC(1O2)-TA(5)-NH2 HIF- [N-(2-Phenylethyl)amino]carbonyl-CA(5)G(3)-AA(5)C- 4426.06 4426.08 ASO16 TTA(3)-TCC(1O2)-TA(5)-NH2 HIF- Fethoc-Lys-Leu-CA(5)G(2O2)-AA(5)C-TTA(8)- 4984.44 4984.46 ASO17 TCC(1O2)-TA(5)-Lys-NH.sub.2 HIF- N-Phenyl-N-Me-CA(5)G-AA(5)C-TTA(5)-TCC(1O2)- 4468.11 4468.14 ASO18 TA(5)-Lys-NH.sub.2 .sup.a)theoretical exact mass; .sup.b)observed exact mass
[0431]
[0432] Table 2 provides PNA derivatives complementarily targeting the 3 splice site spanning the junction of intron 3 and exon 4 in the human HIF-1 pre-mRNA along with structural characterization data by mass spectrometry. Provision of the HIF-1 ASOs in Table 2 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention to the HIF-1 ASOs specified in Table 2.
TABLE-US-00008 TABLE2 PNAderivativescomplementarilytargeting the3 splicesitespanningthe junctionofintron3andexon4inthehuman HIF-1 pre-mRNAalongwithstructural characterizationdatabymassspectrometry. PNA ExactMass,m/z Example PNASequence(N.fwdarw. C) theor..sup.a obs..sup.b HIF- Fethoc-TA(5)G-TTC(1O2)- 4915.27 4915.26 ASO19 A(5)AA(5)-CTG(6)-TA(5)A- NH.sub.2 HIF- Fethoc-TA(5)G-TTC(1O2)- 4900.27 4900.29 ASO20 A(5)AA(5)-CTG(6)-CA(5)A- NH.sub.2 .sup.a)theoretical exact mass; .sup.b)observed exact mass
[0433] Table 3 provides PNA derivatives complementarily targeting the 5 splice site spanning the junction of exon 5 and intron 5 in the human androgen receptor (AR) pre-mRNA read out from the human AR gene (accessed from NCBI Reference Sequence: NC_000023.11) along with structural characterization data by mass spectrometry. Provision of the AR ASOs in Table 3 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention to the AR ASOs specified in Table 3.
TABLE-US-00009 TABLE3 PNAderivativescomplementarilytargetingthe5 splicesitespanning thejunctionofexon5andintron5inthehumanARpre-mRNAalong withstructuralcharacterizationdatabymassspectrometry. PNA ExactMass,m/z Example PNASequence(N.fwdarw. C) theor..sup.a obs..sup.b AR-ASO Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G-NH.sub.2 4257.90 4257.92 1 AR-ASO Fethoc-TC(1O2)C-TTA(6)-CCA(6)-GGC(1O2)-AA(6)G- 5207.37 5207.42 2 G(6)-NH.sub.2 AR-ASO Fethoc-TC(1O2)C-TTA(5)-CCA(5)-GGC(1O2)-AA(5)G- 5165.32 5165.31 3 G(6)-NH.sub.2 AR-ASO Fethoc-TA(5)C-CAG(6)-GC(1O2)A-A(5)GG(6)-C-NH.sub.2 4283.97 4283.96 4 AR-ASO Fethoc-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.2 3968.85 3968.86 5 AR-ASO Fethoc-C(1O2)TT-A(5)CC-A(6)GG(6)-CA(5)A-NH.sub.2 3982.86 3982.88 6 AR-ASO Ac-C(1O2)TT-A(5)CC-A(5)GG(6)-CA(5)A-NH.sub.
[0434] Table 4 provides PNA derivatives complementarily targeting the 5 splice site spanning the junction of exon 4 and intron 4 in the human SCN9A (sodium channel subtype 9A) pre-mRNA read out from the human SCN9A gene (accessed from NCBI Reference Sequence: NC_000002.12) along with structural characterization data by mass spectrometry. Provision of the SCN9A ASOs in Table 4 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention to the ASOs specified in Table 4.
TABLE-US-00010 TABLE4 PNAderivativescomplementarilytargetingthe5 splicesitespanning thejunctionofexon4andintron4inthehumanSCN9Apre-mRNA alongwithstructualcharacterizationdatabymassspectrometry. PNA ExactMass,m/z Example PNASequence(N.fwdarw. C) theor..sup.a obs..sup.b SCN- Fmoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A- 4640.19 4640.88 ASO1 NH.sub.2 SCN- FAM-HEX-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A- 4887.24 4887.40 ASO2 A(5)A-NH.sub.2 SCN- Fethoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A- 4652.20 4652.24 ASO3 NH.sub.2 SCN- Fethoc-TG(6)T-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A- 5574.61 5574.57 ASO4 A(5)A-NH.sub.2 SCN- Fethoc-TA(5)C-GC(1O2)A-A(5)AA(5)-ACA(5)-A-NH.sub.2 4261.98 4262.00 ASO5 SCN- Fethoc-TA(6)C-GC(1O2)A-A(6)AA(6)-ACA(6)-A-NH.sub.2 4318.05 4318.17 ASO6 SCN- Fethoc-AC(1O2)T-TA(5)C-G(6)CA-A(5)AA(5)- 5250.53 5250.46 ASO7 AC(1O2)A-A(5)-NH.sub.2 SCN- Fmoc-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)AC- 5539.61 5539.57 ASO8 A(5)A-NH.sub.2 SCN- Piv-TA(5)A-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A-NH.sub.2 4500.17 4499.80 ASO9 SCN- FAM-HEX-A(5)TA(5)-CGC(1O2)-AA(5)A-A(5)A-NH.sub.2 3970.82 3974.17 ASO10 SCN- Fmoc-TA(6)A-A(5)TA(6)-CGC(1O2)-AA(6)A-AA(6)C- 5334.57 5335.59 ASO11 A(6)-NH.sub.2 SCN- Fethoc-CTT-A(5)CG(6)-C(1O2)AA(5)-AA(5)A- 4975.34 4975.34 ASO12 C(1O2)AA(5)-NH.sub.2 SCN- H-CTT-A(5)CG(3)-C(1O2)AA(5)-AA(5)A- 4711.22 4711.25 ASO13 C(1O3)AA(5)-NH.sub.2 SCN- Benzoyl-CTT-A(5)CG(2O2)-C(1O2)AA(5)-AA(5)A- 4873.30 4873.32 ASO14 C(1O5)AA(5)-NH.sub.2 SCN- n-Propyl-CTT-A(5)CG(2O3)-C(1O2)AA(3)-AA(5)A- 4769.27 4769.30 ASO15 C(2O2)AA(5)-NH.sub.2 SCN- p-Toluenesulfonyl-CTT-A(5)CG(6)-C(1O2)AA(8)- 4935.32 4935.29 ASO16 AA(5)A-C(1O2)AA(5)-NH.sub.2 SCN- [N-(2-Phenylethyl)amino]carbonyl-CTT-A(5)CG(6)- 4888.31 4888.32 ASO17 C(1O2)AA(2O2)-AA(5)A-C(1O2)AA(5)-NH.sub.2 SCN- Fethoc-CTT-A(5)CG(6)-C(1O2)TA(5)-AA(5)T- 4957.32 4957.32 ASO18 C(1O2)AA(5)-NH.sub.2 SCN- Fethoc-Lys-Leu-CTT-A(5)CG(6)-C(1O2)AA(4)-AA(5)A- 5330.60 5330.60 ASO19 C(1O2)AA(5)-Lys-NH.sub.2 SCN- N-Phenyl-N-Me-CTT-A(5)CG(6)-C(1O2)AA(5)-AA(5)A- 4957.40 4957.42 ASO20 C(1O2)AA(5)-Lys-NH.sub.2 .sup.a)theoretical exact mass; .sup.b)observed exact mass
[0435] Table 5 provides PNA derivatives complementarily targeting the 3 splice site spanning the junction of intron 3 and exon 4 in the human SCN9A pre-mRNA along with structural characterization data by mass spectrometry. Provision of the SCN9A ASOs in Table 5 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention to the SCN9A ASOs provided in Table 5.
TABLE-US-00011 TABLE5 PNAderivativescomplementarilytargetingthe3 splicesitespanning thejunctionofofintron3andexon4inthehumanSCN9Apre-mRNA alongwithstructuralcharacterizationdatabymassspectrometry. PNA ExactMass,m/z Example PNASequence(N.fwdarw. C) theor..sup.a obs..sup.b SCN- Fethoc-TA(5)A-A(5)AG(6)-TG(6)T-A(5)CC(1O2)- 5398.60 5398.58 ASO21 TA(5)A-A(5)-NH.sub.2 SCN- Fethoc-AA(5)G-TG(6)T-A(5)CC(1O2)-TAA(5)-A-NH.sub.2 4282.97 4283.00 ASO22 SCN- Fethoc-AA(5)G-TG(6)T-AC(1O2)C-TAA(5)-A-NH.sub.2 4182.87 4182.89 ASO23 SCN- Fethoc-A(5)AG-TG(6)T-A(5)CC(1O2)-TAA-A(5)-NH.sub.2 4282.97 4283.00 ASO24 SCN- Fethoc-AAG(6)-TG(6)T-A(5)CC(1O2)-TA(5)A-A-NH.sub.2 4281.98 4282.05 ASO25 SCN- Fethoc-AA(5)G-TG(5)T-A(5)CC(1O2)-TA(5)A-A(5)-NH.sub.2 4369.06 4369.08 ASO26 SCN- Fethoc-AA(5)G-TG(5)T-A(5)CC(1O2)-TA(5)A-A(5)C- 4620.16 4620.14 ASO27 NH.sub.2 SCN- Fethoc-A(5)GT-G(5)TA(5)-CC(1O2)T-A(5)AA(5)-C-NH.sub.2 4345.56 4345.08 ASO28 SCN- Fethoc-AA(6)G-TG(5)T-A(6)CC(1O2)-TA(6)A-A(6)C- 4676.22 4676.25 ASO29 NH.sub.2 SCN- Fethoc-AA(5)G-TG(5)T-A(5)CC(1O2)-TA(5)A-A(5)G- 4660.16 4660.15 ASO30 NH.sub.2 SCN- Fethoc-AA(5)G-TG(5)T-A(5)CC(1O2)-TA(5)A-A(5)CA- 4895.27 4895.20 ASO31 NH.sub.2 SCN- Fethoc-AA(5)G-TG(5)T-A(5)CC(1O2)-TA(5)A-A(5)GG- 4951.27 4951.26 ASO32 NH.sub.2 SCN- Fethoc-AA(5)G-TG(5)T-ACC(1O2)-TA(5)A-A(5)CA(5)- 5146.37 5146.35 ASO33 C-NH.sub.2 .sup.a)theoretical exact mass; .sup.b)observed exact mass
[0436] Table 6 provides PNA derivatives complementarily targeting a specific splice site in the human or rat SCN9A pre-mRNA along with structural characterization data by mass spectrometry. Provision of the SCN9A ASOs in Table 6 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention to the SCN9A ASOs specified in Table 6.
TABLE-US-00012 TABLE6 PNAderivativescomplementarilytargetingaspecificsplicesite(SS)in thehumanorratSCN9Apre-mRNAalongwithstructuralchacterization databymassspectrometry. PNA Target ExactMass,m/z Example Species Site.sup.a PNASequence(N.fwdarw. C) theor..sup.b obs..sup.c SCN- Human 5 SSof Fethoc-GA(5)T-A(5)TG-A(5)GT- 5346.49 5346.46 ASO34 Exon2 G(6)TA(5)-C(1O2)TA(5)-A-NH.sub.2 SCN- Rat 5 SSof Fethoc-GA(5)T-A(5)TG-A(5)GT- 5331.49 5331.52 ASO35 Exon2 G(6)CA(5)-C(1O2)TA(5)-A-NH.sub.2 SCN- Human 5 SSof Fethoc-A(5)TA(5)-CC(1O2)C- 4866.26 4866.29 ASO36 &Rat Exon7 TG(6)A-A(5)TC-TG(6)T-NH.sub.2 SCN- Human 3 SSor Fethoc-AA(5)G-A(5)C(12)T- 4772.23 4772.21 ASO37 &Rat Exon15 CG(6)G-A(5)GC(1O2)-TA(5)-NH.sub.2 .sup.a)SS denotes splice site; .sup.b)theoretical exact mass; and .sup.c)observed exact mass.
[0437] SCN-ASO 34 is a 16-mer ASO fully complementary to the 5 splice site spanning the junction of exon 2 and intron 2 in the human SCN9A pre-mRNA. SCN-ASO 34 possesses an 11-mer complementary overlap with exon 2 and a 5-mer complementary overlap with intron 2 as marked bold and underlined in the 25-mer human SCN9A pre-mRNA sequence of
TABLE-US-00013 [(5 .fwdarw. 3)GAUUUUAGUACACUC|auauccuuuu (SEQIDNO:26)].
[0438] SCN-ASO 35 is a 16-mer ASO complementarily targeting the 5 splice site spanning the junction of exon 2 and intron 2 in the rat SCN9A pre-mRNA. SCN-ASO 35 possesses an 11-mer complementary overlap with exon 2 and a 5-mer complementary overlap with intron 2 as marked bold and underlined in the 25-mer rat SCN9A pre-mRNA sequence of
TABLE-US-00014 [(5 .fwdarw. 3)GAUCUUAGUGCACUC|auauccuuuc (SEQIDNO:27)].
read out from the rat genomic DNA [accessed from NCBI Reference Sequnce: NC_005102.3]. SCN-ASO 35 possesses a single mismatch with the human SCN9A pre-mRNA as marked with a quote ( ) sign in the 25-mer pre-mRNA sequence of [(5.fwdarw.3) GAUUUUAGUACACUC|auauccuuuu (SEQ ID NO: 28)]
[0439] SCN-ASO 36 is a 15-mer ASO complementarily targeting the 5 splice site spanning the junction of exon 7 and intron 7 in the human SCN9A pre-mRNA. SCN-ASO 36 possesses an 11-mer complementary overlap with exon 7 and a 4-mer complementary overlap with intron 7 as marked bold and underlined in the 25-mer human SCN9A pre-mRNA sequence of
TABLE-US-00015 [(5 .fwdarw. 3)CAGCACAGAUUCAGG|guauguaaua (SEQIDNO:29)].
The target sequence of SCN-ASO 43 is conserved in the rat SCN9A pre-mRNA.
[0440] SCN-ASO 37 is a 14-mer ASO complementarily targeting the 3 splice site spanning the junction of intron 14 and exon 15 in the human SCN9A pre-mRNA. SCN-ASO 37 possesses a 3-mer complementary overlap with intron 14 and an 11-mer complementary overlap with exon 15 as marked bold and underlined in the 25-mer human SCN9A pre-mRNA sequence of
TABLE-US-00016 [(5 .fwdarw. 3)uugcuuuuag|CUCCGAGUCUUCAAG (SEQIDNO:30)].
The ASO's target sequence is conserved in the rat SCN9A pre-mRNA, and marked bold and underlined in the rat 25-mer pre-mRNA sequence of
TABLE-US-00017 [(5 .fwdarw. 3)uuauuucuag|CUCCGAGUCUUCAAG (SEQIDNO:31)].
[0441] Table 7 provides PNA derivatives complementarily targeting either the 3 or the 5 splice site of exon 23 in the mouse dystrophin pre-mRNA read out from the mouse genomic DNA [accessed from NCBI Reference Sequence: NC_000086.7] along with structural characterization data by mass spectrometry. Provision of the dystrophin ASOs in Table 7 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention the dystrophin ASOs specified in Table 7.
TABLE-US-00018 TABLE7 PNAderivativescomplementarilytargetingeitherthe3 orthe5 splicesiteofexon23inthemousedystrophinpre-mRNAalongwith stucturalcharacterizationdatabymassspectrometry. PNA Target ExactMass,m/z Example Site.sup.a PNASequence(N.fwdarw. C) theor..sup.b obs..sup.c DMD- 3 SS Fethoc-A(5)GA-G(6)CC(1O2)-TCA- 4267.97 4267.97 ASO1 A(5)AA(5)-T-NH.sub.2 DMD- 3 SS Fethoc-TTG(6)CA(5)G-AG(6)C-C(1O2)TC- 5441.49 5441.54 ASO2 AA(5)A-A(5)T-NH.sub.2 DMD- 3 SS Fethoc-TTG(6)-CA(6)G-AG(6)C-C(12)TC- 5483.54 5483.55 ASO3 AA(6)A-A(6)T-NH.sub.2 DMD- 3 SS Fethoc-A(6)CT-TTG(6)-CA(6)G- 5571.59 5571.59 ASO4 A(6)GC(1O2)-CTC(1O2)-AA(6)-NH.sub.2 DMD- 3 SS Fethoc-TG(6)C-A(5)GA-G(6)CC(1O2)- 4258.96 4258.98 ASO5 TCA(5)-A-NH.sub.2 DMD- 5 SS Fethoc-C(12)TC-GG(6)C-TTA(6)-CC(1O2)T- 5672.52 5672.51 ASO6 GA(6)A-A(6)TT-NH.sub.2 DMD- 5 SS Fethoc-C(1O2)TT-A(5)CC(1O2)-TG(6)A- 4488.00 4488.00 ASO7 AA(5)T-TT-NH.sub.2 .sup.a)SS denotes splice site; .sup.b)theoretical exact mass; and .sup.c)observed exact mass.
[0442] Table 8 provides PNA derivatives complementarily targeting a splice site in the human or mouse indoleamine 2,3-dioxygenase (IDO1) pre-mRNA along with structural characterization data by mass spectrometry. The human and mouse IDO 1 pre-mRNA sequences were read out from the human genomic DNA [accessed from NCBI Reference Sequence: NC_000008.11] and the mouse genomic DNA [accessed from NCBI Reference Sequence: NC_000074], respectively. Provision of the IDO1 ASOs in Table 8 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention to the IDO1 ASOs specified in Table 8.
TABLE-US-00019 TABLE8 PNAderivativescomplementarilytargetingaspecificsplicesite(SS)in thehumanormouseIDO1pre-mRNAalongwithstructuralcharacterization databymassspectrometry. PNA Target ExactMass,m/z Example Species Site.sup.a PNASequence(N.fwdarw. C) theor..sup.b obs..sup.c IDO- Human 3 SSof Fethoc-GG(6)A-A(5)TT- 4282.97 4283.00 ASO1 Exon7 A(5)CC(1O2)-TAA(5)-A-NH.sub.2 IDO- Human 3 SSof Fethoc-AA(5)T-TA(5)C-CTA(5)- 4503.08 4503.09 ASO2 Exon7 AA(5)A-C(1O2)A-NH.sub.2 IDO- Mouse 3 SSof Fethoc-GG(5)G-A(5)TT- 4918.24 4918.26 ASO3 Exon7 G(5)CC(1O2)-TTT-A(5)AA(5)-NH.sub.2 IDO- Mouse 3 SSof Fethoc-GG(5)G-A(5)TT- 4267.91 4267.93 ASO4 Exon7 G(5)CC(1O2)-TTT-A(5)-NH.sub.2 IDO- Human 5 SSof Fethoc-CA(5)A-A(5)CC(1O2)- 4243.96 4243.98 ASO5 Exon3 TTA(5)-CGG(6)-A-NH.sub.2 IDO- Human 3 SSof Fethoc-GG(6)C-AA(5)G- 4299.96 4299.97 ASO6 Exon4 A(5)CC(1O2)-TGA(5)-T-NH.sub.2 .sup.a)SS denotes splice site; .sup.b)theoretical exact mass; and .sup.c)observed exact mass.
[0443] Table 9 provides PNA derivatives complementarily targeting the 3 splice site of exon 7 in the human SNAP25 pre-mRNA read out from the human SNAP25 gene [NCBI Reference Sequence: NG_029626.1] along with structural characterization data by mass spectrometry. Provision of the SNAP25 ASOs in Table 9 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention to the SNAP25 ASOs specified in Table 9.
TABLE-US-00020 TABLE9 PNAderivativescomplementarilytargetingthe3 splicesitespanning thejunctionofintron6andexon7inthehumanSNAP25pre-mRNA alongwithstucturalcharacterizationdatabymassspectrometry. PNA ExactMass,m/z Example PNASequence(N.fwdarw. C) theor..sup.a obs..sup.b SNAP- Fethoc-A(6)TT-TG(6)T-TA(6)C-CC(1O2)T-GG(6)G-A(6)- 5188.36 5188.38 ASO1 NH.sub.2 SNAP- Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(5)-NH.sub.2 4266.93 4266.95 ASO2 SNAP- Fethoc-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G-A(5)T-NH.sub.2 4533.03 4533.04 ASO3 SNAP- Fethoc-TG(5)G-TA(5)C-C(1O2)CT-TG(5)G-A(5)T-NH.sub.2 4519.01 4518.95 ASO4 SNAP- Fethoc-TG(6)T-TA(3)C-CC(1O5)T-GG(6)G-A(3)T-NH.sub.2 4533.03 4533.04 ASO5 SNAP- Fethoc-G(5)TT-A(5)CC(1O2)-CTG-G(5)GA(5)-TC(1O2)- 4601.07 4601.08 ASO6 NH.sub.2 SNAP- Fethoc-C(1O2)AT-TTG(6)-TTA(5)-CCC(1O2)-TG(6)- 4478.98 4478.99 ASO7 NH.sub.2 SNAP- Fethoc-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)-TG(5)-NH.sub.2 4468.02 4468.04 ASO8 SNAP- Fethoc-A(6)TT-TG(G)T-TA(5)C-C(1O2)CT-G(5)-NH.sub.2 4216.91 4216.93 ASO9 SNAP- Fethoc-CA(6)T-CA(6)T-TTG(5)-TTA(5)-CCC(1O2)- 5374.45 5374.44 ASO10 TG(5)-NH.sub.2 SNAP- Fethoc-A(6)TT-TG(5)T-TA(6)C-C(1O2)CT-GG(5)G- 5188.36 5188.35 ASO11 A(5)-NH.sub.2 SNAP- Fethoc-A(6)TT-TG(5)T-TA(6)C-C(1O2)CT-G(5)G-NH.sub.2 4522.04 4522.05 ASO12 .sup.a)theoretical exact mass; and .sup.b)observed exact mass
[0444] Table 10 provides PNA derivatives complementarily targeting the 3 splice site spanning the junction of intron 1 and exon 2 in the human tyrosinase (TYR) pre-mRNA read out from the human TYR gene [NCBI Reference Sequence: NG_0008748], or the mouse TYR pre-mRNA read out from the mouse genomic DNA [accessed from NCBI Reference Sequence: NC_000073] Provision of the TYR ASOs in Table 10 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention to the TYR ASOs specified in Table 10.
TABLE-US-00021 TABLE10 PNAderivativescomplementarilytargetingthe3 splicesitespanningthe junctionofintron1andexon2inthehumanormouseTYRpre-mRNA alongwithstructuralcharacterizationdatabymassspectrometry. PNA ExactMass,m/z Example Species PNASequence(N.fwdarw. C) theor..sup.a obs..sup.b TYR- Human Fethoc-CA(5)G-ACA(5)-ATC(1O2)-TG(6)T- 4258.96 4260.99 ASO1 A(5)-NH.sub.2 TYR- Human Fethoc-AC(12)A-GA(5)C-AA(5)T-CTG(6)- 5532.55 5532.54 ASO2 TA(5)C(1O2)-AA(5)-NH.sub.2 TYR- Human Fethoc-AC(1O2)A(5)-GA(5)C-AA(5)T- 4592.11 4592.11 ASO3 CTG(6)-C(1O2)C-NH.sub.2 TYR- Mouse Fethoc-CA(5)A-A(5)TG-A(5)TC(1O2)-TG(6)T- 4289.95 4289.96 ASO4 G-NH.sub.2 .sup.a)theoretical exact mass; and .sup.b)observed exact mass
[0445] Table 11 provides PNA derivatives complementarily targeting either 3 or the 5 splice site of exon 2 in the human PD-1 pre-mRNA read out from the human PDCD1 gene [NCBI Reference Sequence: NG_012110], or the mouse PD-1 pre-mRNA read out from the mouse genomic DNA [accessed from NCBI Reference Sequence: NC_000067] Provision of the PD-1 ASOs in Table 11 is to exemplify the PNA derivatives of Formula I, and should not be interpreted to limit the scope of the present invention to the PD-1 ASOs specified in Table 11.
TABLE-US-00022 TABLE11 PNAderivativescomplementarilytargetingeither3 splicesiteorthe5 splicesiteofexon2inthehumanormousePD-1pre-mRNAalongwith structuralcharacterizationdatabymassspectrometry. PNA ExactMass,m/z Example Species PNASequence(N.fwdarw. C) theor..sup.a obs..sup.b PD- Human Fethoc-C(1O2)TG(6)-GG(6)G-AG(6)T-CTG- 4636.07 4636.08 ASO1 A(5)G-NH.sub.2 PD- Mouse Fethoc-CC(1O2)T-CA(5)C-CTG(5)-TTA(5)- 5022.27 5022.27 ASO2 C(1O2)CA(5)-C-NH.sub.2 PD- Human Fethoc-CG(6)C-A(5)CC-TG(6)T-CA(5)C- 4422.03 4422.05 ASO3 C(1O2)C-NH.sub.2 .sup.a)SS denotes splice site; .sup.b)theoretical exact mass; and .sup.c)observed exact mass.
Binding Affinity of Model PNA Derivatives for Complementary RNA or DNA
[0446] 10-mer PNA derivatives possessing modified nucleobases were prepared as model compounds to exemplify the strong affinity of the PNA compounds of Formula I for RNA as well as DNA. These model PNA compounds were prepared according to the synthetic procedures provided in the present invention or with minor modifications. The 10-mer PNA derivatives are provided in Table 12 along with structural identification data by mass spectrometry.
TABLE-US-00023 TABLE12 10-mer PNA derivatives as model compounds to exemplify the strong RNA or DNA affinity of the PNA compounds of Formula I. PNA ExactMass, Ex- m/z ample PNASequence(N.fwdarw. C) theor..sup.a obs..sup.b PNA Fmoc-GTA-GAT-CAC-T-NH.sub.2 2948.14 2949.05 10-1 PNA Fmoc-GTA-GA(5)T-CAC-T-NH.sub.2 3048.24 3050.41 10-2 PNA Fmoc-GTA(5)-GAT-CA(5)C-T- 3148.34 3150.65 10-3 NH.sub.2 PNA Fmoc-GTA(5)-GA(5)T-CA(5)C- 3248.44 3250.81 10-4 T-NH.sub.2 PNA Fmoc-GTA-G(5)AT-CAC-T-NH.sub.2 3032.25 3035.01 10-5 PNA Fmoc-GTA-GAT-C(1O2)AC-T-NH.sub.2 3044.21 3047.02 10-6 PNA Fmoc-GTA(5)-GA(5)T-C(1O2)AC- 3245.39 3248.10 10-7 T-NH.sub.2 .sup.a)theoretical exact mass; and .sup.b)observed exact mass
[0447] The 10-mer PNA oligomers in Table 12 were evaluated for their binding affinity for the complementary 10-mer RNA or DNA by measuring T.sub.m values as described below.
[0448] A mixed solution of 4 M 10-mer PNA oligomer and 4 M complementary 10-mer DNA or RNA in 4 mL aqueous buffer (pH 7.16, 10 mM sodium phosphate, 100 mM NaCl) in 15 mL polypropylene falcon tube was incubated at 90 C. for a minute and slowly cooled down to ambient temperature. Then the solution was transferred into a 4 mL quartz UV cuvette, and subjected to T.sub.m measurement at 260 nm on a UV/Visible spectrophotometer as described in the prior art [PCT/KR2009/001256] or with minor modifications. The DNA and RNA for T.sub.m measurement were purchased from Bioneer (www.bioneer.com, Dajeon, Republic of Korea) and used without further purification.
[0449] Table 13 provides T.sub.m values (as uncorrected) measured between the model PNA oligomers and the complementary DNA or RNA. PNA 10-1, the reference PNA oligomer without modified nucleobase, yielded T.sub.m values of 51 and 55 C. against the complementary DNA and RNA, respectively. The model PNA oligomers possessing modified nucleobase(s) tended to show higher T.sub.m value with more incorporation of modified nucleobases. PNA 10-7 showed a T.sub.m of 69 C. against the complementary DNA and RNA as well, suggesting that the model PNA oligomers bind to their complementary DNA and RNA with comparable binding affinity.
TABLE-US-00024 TABLE13 T.sub.mvaluesbetween10-merPNAandcomplementaryDNAorRNA. T.sub.m, T.sub.m.sup.a, PNA ComplementaryDNAorRNA C. C. PNA10-1 DNA(5.fwdarw.3)AGT-GAT-CTA-C(SEQID 51 PNA10-2 NO:192) 55 +4 PNA10-3 61 +10 PNA10-4 66 +15 PNA10-5 53 +2 PNA10-6 59 +8 PNA10-7 69 +18 PNA10-1 RNA(5.fwdarw.3)AGU-GAU-CUA-C(SEQID 55 PNA10-4 NO:193) 66 +11 PNA10-7 69 +18 .sup.a)T.sub.m value-T.sub.m value of PNA 10-1
Binding Affinity of PNA Derivatives for 10-Mer Complementary DNA
[0450] PNA derivatives of Formula I were evaluated for their binding affinity for 10-mer DNAs complementarily targeting either the N-terminal or C-terminal. The binding affinity was assessed by the T.sub.m value for the duplex between PNA and 10-mer complementary DNA. The duplex between PNA derivatives and DNAs of full complementarity usually show T.sub.m values too high to be reliably determined in aqueous buffer solution. The aqueous buffer solution tends to boil off during T.sub.m measurement.
[0451] Observed T.sub.m values (as uncorrected) of the PNA derivatives of Formula I were very high for a complementary binding to 10-mer DNA, and are provided in Table 14. For example, AR-ASO 1 showed a T.sub.m value of 86.1 C. for the duplex with the 10-mer complementary DNA targeting the N-terminal 10-mer within the PNA as marked bold and underlined in
TABLE-US-00025 [(N.fwdarw.C)Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G- NH.sub.2].
In the meantime, AR-ASO 1 showed a T.sub.m value of 81.3 C. for the duplex with the 10-mer complementary DNA targeting the C-terminal 10-mer within the PNA as marked bold and underlined in
TABLE-US-00026 [N.fwdarw.C)Fethoc-C(1O2)TT-A(5)CC-A(5)GG-C(1O2)AA(5)-G- NH.sub.2].
TABLE-US-00027 TABLE 14 T.sub.m values between PNAs and 10-mer complementary DNA targeting either the N-terminal or the C-terminal of PNA. T.sub.m Value, C. 10-mer DNA against 10-mer DNA against PNA N-Terminal C-Terminal AR-ASO 1 86.1 81.3 AR-ASO 4 84.3 84.5 AR-ASO 5 84.4 78.4 HIF-ASO 1 66.0 60.0 HIF-ASO 4 66.0 53.4 HIF-ASO 5 62.0 58.0 HIF-ASO 7 69.0 61.0 HIF-ASO 8 73.0 61.0 HIF-ASO 9 60.9 59.0 HIF-ASO 10 61.0 60.0 HIF-ASO 11 73.4 61.0 SCN-ASO 4 63.5 71.6 SCN-ASO 7 65.0 64.6 SCN-ASO 8 74.0 68.6 SCN-ASO 12 76.0 77.0 SCN-ASO 22 74.0 65.0 SCN-ASO 24 77.0 66.0 SCN-ASO 25 78.0 66.0 SCN-ASO 26 75.0 72.0 SCN-ASO 27 77.0 69.0 SCN-ASO 28 78.1 70.0 SCN-ASO 30 79.0 74.0 SNAP-ASO 2 76.0 87.6 SNAP-ASO 3 77.3 88.7 SNAP-ASO 8 58.0 68.0 SNAP-ASO 9 62.0 76.0 SNAP-ASO 10 61.0 68.0 SNAP-ASO 12 62.0 74.0 TYR-ASO 1 78.0 73.0 TYR-ASO 4 72.0 72.0
Examples for In Vitro Activity of HIF-1 ASOs
[0452] PNA derivatives of Formula I complementarily targeting the 3 splice site of either exon 2 or exon 4 in the human HIF-1 (hypoxia-inducible factor 1) pre-mRNA were evaluated for their HIF-1 antisense exon skipping activity in HeLa cells. Biological examples for these HIF-1 ASOs are provided as examples to illustrate that exon skipping is potently induced by the compound of Formula I targeting a splice site in a target pre-mRNA, and therefore should not be interpreted to limit the scope of the current invention to HIF-1 ASOs.
HIF-1 Example 1. Exon Skipping Induced by HIF-ASO 2
[0453] HIF-ASO 2 specified in Table 1 is a 14-mer ASO fully complementary to a region in the 3 splice site of exon 2 in the human HIF-1 pre-mRNA as marked bold and underlined in the 20-mer pre-mRNA sequence of
TABLE-US-00028 [(5.fwdarw.3)uguuaaguag|GAUAAGUUCU (SEQIDNO:32)],
where the symbol | stands for the intron-exon junction. HIF-ASO 2 possesses a 5-mer complementary overlap with intron 1 and a 9-mer complementary overlap with exon 2.
[0454] HIF-ASO 2 was evaluated by HIF-1 nested PCR for its ability to induce the skipping of exon 2 of the human HIF-1 mRNA in HeLa cells. The employed procedures are provided below.
[0455] [Cell Culture & ASO Treatment] HeLa cells (Cat. Number CCL-2, ATCC) were grown in 60 mm culture dish containing 5 mL of EMEM medium supplemented with 10% FBS (fetal bovine serum), 1% streptomycin/penicillin, 1% L-glutamine, and 1% sodium pyruvate under 5% CO.sub.2 atmosphere at 37 C. The cells were treated with HIF-ASO 2 at 0 (negative control), 10, 100 or 1,000 zM. The ASO was serially diluted to a proper concentration in DDW and aliquoted into culture dish.
[0456] [RNA Extraction] 5 hours later, total RNA was extracted using Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions.
[0457] [cDNA Synthesis by One Step RT-PCR] 200 ng of RNA template was subjected to a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) against a set of exon-specific primers [HIF-exon 1_forward: (5.fwdarw.3) CTTGCCTTTCCTTCTCTTCT (SEQ ID NO: 33); HIF-exon 8_reverse: (5.fwdarw.3) AACCCAGACATATCCACC (SEQ ID NO: 34)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 15 cycles of 30 sec at 94 C., 30 sec at 55 C., and 1 min at 72 C.
[0458] [Nested PCR Amplification] 1 L of cDNA was subjected to a 20 L nested PCR reaction (Cat. Number K2612, Bioneer) against a set of exon-primers [HIF-exon 1n_forward: (5.fwdarw.3) TGAAGACATCGCGGGGAC (SEQ ID NO: 35); HIF-exon 5n_reverse: (5.fwdarw.3) TTTTTCACAAGG-CCATTTCT (SEQ ID NO: 36)] according to the following cycle conditions: 95 C. for 5 min followed by 39 cycles of 30 sec at 95 C., 40 sec at 50 C., and 50 sec at 72 C.
[0459] The sets of exon-specific primers for the one step RT-PCR and nested PCR amplification are schematically summarized in
[0460] [Identification of Exon 2 Skipping Product] The PCR products were subjected to electrophoretic separation on a 2% agarose gel along with a size marker cocktail. The bands of target size were collected and analyzed by Sanger Sequencing. The observed PCR bands corresponded to the full-length mRNA (i.e., without exon skipping), and the splice variant lacking exon 2 as assigned in
[0461] [Number of Cells Influenced by a Single ASO Molecule] HIF-ASO 2 induced exon 2 skipping even at 10 zM. There are ca 30 ASO molecules at 10 zM (i.e., 10.sup.21M) concentration in 5 mL of the culture medium in 60 mm culture dish. Given that ca 30 ASO molecules induced the skipping in ca 100,000 HeLa cells in 60 mm culture dish, each ASO molecule is estimated to have affected or controlled the exon skipping in ca 3,000 HeLa cells on average. Thus each ASO molecule is considered to have rapidly shuttled around a large number of cells to execute its destined role for the exon skipping.
HIF-1 Example 2. Inhibition of HIF-1 Protein Expression in HeLa Cells by HIF-ASO 2
[0462] HIF-ASO 2 was evaluated for its ability to inhibit the expression of HIF-1 protein in HeLa cells as described below.
[0463] [Cell Culture & ASO Treatment] HeLa cells grown in 60 mm culture dish containing 5 mL culture medium were treated with HIF-ASO 2 at 0 zM (negative control), 10 zM, 100 zM, 1 aM, or 10 aM.
[0464] [CoCl.sub.2 Treatment and Cell Lysis] 24 hours after the ASO treatment, the culture dishes except for the one without ASO treatment were treated with 200 M CoCl.sub.2 for another 3 hours to upregulate the HIF-1 protein level by suppressing the activity of prolylhydroxylases (PHDs). Then the cells were washed 2 with 1 mL cold PBS, and subjected to lysis on ice with 200 L 1RIPA buffer (Cat. Number 9806, Cell Signaling Tech) supplemented with 1% SDS and 1 proteinase inhibitor cocktail (cOmplete Mini, Roche). Each lysate was collected in 1.5 mL e-tube, mixed with 100 L 5 sample buffer, and boiled for 5 min at 100 C. The lysates were subjected to electrophoretic separation on an 8% SDS-PAGE gel, and transferred onto a 0.45 m PVDF membrane. The membrane was probed with an anti-HIF-1 antibody (Cat. Number 610958, BD Biosciences) and an anti--actin antibody (Cat. Number sc4778, Santa Cruz).
[0465] [Inhibition of HIF-1 Protein Expression]
HIF-1 Example 3. qPCR by SYBR Green for HIF-1 mRNA in HeLa Cells Treated with HIF-ASO 2
[0466] HIF-ASO 2 was evaluated by nested qPCR for its ability to inhibit the expression of the full-length HIF-1 mRNA in HeLa cells as follows.
[0467] [Cell Culture & ASO Treatment] HeLa cells grown in 60 mm culture dish containing 5 mL medium were treated with ASO 2 at 0 (negative control), 10, 100 or 1,000 zM (2 culture dishes per each ASO concentration).
[0468] [RNA Extraction] 3 hours after the ASO treatment, total RNA was extracted with MiniBEST Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions.
[0469] [cDNA Synthesis by One Step RT-PCR] 200 ng of RNA template was subjected to a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) against a set of exon-specific primers [HIF-exon 1_forward: (5.fwdarw.3) CTTGCCTTTCCTTCTCTTCT (SEQ ID NO: 37); HIF-exon 8_reverse: (5.fwdarw.3) AACCCAGACATATCCACC (SEQ ID NO: 38)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 15 cycles of 30 sec at 94 C., 30 sec at 55 C., and 1 min at 72 C.
[0470] [Nested qPCR] 1 L of cDNA diluted by 100 times was subjected to a 20 L Real-Time PCR reaction against the following sets of exon-specific primers: [HIF-exon 2n_forward (5.fwdarw.3) CTTGCTCATCAGTTGCCACTTC (SEQ ID NO: 39); HIF-exon 2n_reverse (5.fwdarw.3) AAGTTTCCT-CACACGCAAATAG (SEQ ID NO: 40); HIF-exon 3n_forward (5.fwdarw.3) GAAAGCACAGATGAATTGC (SEQ ID NO: 41); HIF-exon 3n_reverse (5.fwdarw.3) TCATGTCACCATCATCTGT (SEQ ID NO: 42); HIF-exon 4n_forward (5.fwdarw.3) CTAACTGGACACAGTGTGTTTG (SEQ ID NO: 43); HIF-exon 4n_reverse (5.fwdarw.3) TCTGTGTGTAAGC-ATTTCTCTC (SEQ ID NO: 44); HIF-exon 5n_forward (5.fwdarw.3) GCCTTGTGAAAAAGGGTAAAG (SEQ ID NO: 45); HIF-exon 5n_reverse (5.fwdarw.3) CCATGTTGCAGACTTTATGT] (SEQ ID NO: 46). The PCR reactions were probed with SYBR Green (Takara, Japan) according to the following cycle conditions: 95 C. for 3 min followed by 40 cycles for 5 sec at 95 C. and 30 sec at 60 C.
[0471] [Changes in HIF-1 mRNA Exon Levels] The individual exon levels of ASO treated samples were normalized against each individual exon level without ASO treatment. The observed relative individual exon levels are provided in
HIF-1 Example 4. qPCR by TaqMan Probe for HIF-1 mRNA in HeLa Cells Treated with HIF-ASO 2
[0472] HIF-ASO 2 was evaluated by nested qPCR for its ability to inhibit the expression of the full-length HIF-1 mRNA in HeLa cells as described in HIF-1 Example 3 unless noted otherwise.
[0473] [cDNA Synthesis by One Step RT-PCR] 200 ng of RNA template subjected to a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) against a set of exon-specific primers [HIF-exon 1_forward(2): (5.fwdarw.3) CGCGAACGACAAGAAAAA (SEQ ID NO: 47); HIF-exon 8_reverse(2): (5.fwdarw.3) CTGTGGTGACTTGTCCTTT (SEQ ID NO: 48)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 20 cycles of 30 sec at 94 C., 40 sec at 51 C., and 50 sec at 72 C.
[0474] [Nested qPCR] 1 L of cDNA diluted by 100 times was subjected to a 20 L Real-Time PCR reaction using a TaqMan probe (Hs00936371_m1, Thermo Fisher) designed to detect the junction of the human HIF-1 exon 1 and exon 2 according to the following cycle conditions: 95 C. for 3 min followed by 40 cycles 10 sec at 95 C., and 30 sec at 60 C.
[0475] [Changes in HIF-1 mRNA Level] The full-length mRNA level of ASO treated samples were normalized against the mRNA level without ASO treatment. The observed normalized mRNA levels are provided in
HIF-1 Example 5. Exon Skipping Induced by HIF-ASO 6
[0476] HIF-ASO 6 specified in Table 1 is a 17-merASO fully complementary to the 3 splice site spanning the junction of intron 1 and exon 2 in the human HIF-1 pre-mRNA as marked bold and underlined in the 20-mer pre-mRNA sequence of
TABLE-US-00029 [(5.fwdarw.3)uguuaaguag|GAUAAGUUCU (SEQIDNO:49)],
HIF-ASO 6 possesses a 7-mer complementary overlap with intron 1 and a 10-mer complementary overlap with exon 2.
[0477] HIF-ASO 6 was evaluated by HIF-1 nested PCR for its ability to induce the skipping of exon 2 of the human HIF-1 mRNA in HeLa cells according to the procedures described in HIF-1 Example 1 unless noted otherwise.
[0478] The PCR products were subjected to electrophoretic separation on a 2% agarose gel, and the electrophoresis results are provided in
[0479] HIF-ASO 6 possesses more complementary overlap with the 3 splice site of exon 2 than HIF-ASO 2, which would be responsible for the higher exon skipping efficacy observed with HIF-ASO 6. Tighter binding of ASO to the target splice site appears to induce more effectively the skipping of the target exon.
HIF-1 Example 6. Inhibition of HIF-1 Protein Expression in HeLa Cells by HIF-ASO 6
[0480] HIF-ASO 6 was evaluated for its ability to down-regulate the HIF-1 expression in HeLa cells according to the procedures described in HIF-1 Example 2 unless noted otherwise.
HIF-1 Example 7. qPCR by SYBR Green for HIF-1 mRNA in HeLa Cells Treated with HIF-ASO 6
[0481] HIF-ASO 6 was evaluated for its ability to induce a change in HIF-1 mRNA in HeLa cells by nested qPCR according to the procedures in HIF-1 Example 4 unless noted otherwise.
[0482] [cDNA Synthesis by One Step RT-PCR] 200 ng of RNA template was subjected to a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) against a set of exon-specific primers [HIF-exon 1_forward(2): (5.fwdarw.3) CGCGAACGACAAGAAAAA (SEQ ID NO: 50); HIF-exon 8(2) reverse: (5.fwdarw.3) CTGTGGTGACTTGTCCTTT (SEQ ID NO: 51)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 15 cycles of 30 sec at 94 C., 40 sec at 51 C., and 50 sec at 72 C.
[0483] [Changes in HIF-1 mRNA Exon Levels] The individual exon levels normalized against the individual exon levels without ASO treatment are provided in
HIF-1 Example 8. qPCR by TaqMan Probe for HIF-1 mRNA in HeLa Cells Treated with ASO 6
[0484] HIF ASO 6 was evaluated by nested qPCR for its ability to inhibit the expression of the full-length HIF-1 mRNA in HeLa cells as described in HIF-1 Example 4 unless noted otherwise.
[0485] [Changes in Full-length HIF-1 mRNA Level] The full-length mRNA level of ASO treated samples was normalized against the mRNA level without ASO treatment. The observed relative mRNA levels are provided in
HIF-1 Example 9. Exon Skipping Induced by HIF-ASO 1
[0486] HIF-ASO 1 is a 14-mer ASO fully complementary to a region in the 3 splice site spanning the junction of intron 1 and exon 2 in the human HIF-1 pre-mRNA as marked bold and underlined in the 23-mer pre-mRNA sequence of
TABLE-US-00030 [(5.fwdarw.3)uguuaaguag|GAUAAGUUCUGAA (SEQIDNO:52)],
HIF-ASO 1 possesses a 3-mer overlap with intron 1 and an 11-mer overlap with exon 2.
[0487] HIF-ASO 1 was evaluated for its ability to induce exon skipping in the HIF-1 mRNA as described in HIF-1 Example 1, unless nested otherwise. HeLa cells were treated with HIF-ASO 1 at 0 (negative control), 1, 3, 10, 30 or 100 aM. 24 hours later, total RNA was extracted and subjected to HIF-1 nested PCR to detect exon skipping.
[0488] [Exon Skipping Data]
HIF-1 Example 10. Inhibition of HIF-1 Protein Expression in HeLa Cells by HIF-ASO 1
[0489] HIF-ASO 1 was evaluated for its ability to inhibit the HIF-1 protein expression in HeLa cells according to the procedures described in HIF-1 Example 2 unless noted otherwise. In this example, HeLa cells were treated with HIF-ASO 1 at 0 zM (negative control), 100 zM, 300 zM, 1 aM, 3 aM, 10 aM, 30 aM, 100 aM or 300 aM for 72 hours prior to suppressing the activity of PHDs by an incubation with 200 M CoCl.sub.2 for 3 hours. There were 4 culture dishes of the negative control, i.e., 0 zM HIF-ASO 1.
[0490]
HIF-1 Example 11. Exon Skipping Induced by HIF-ASO 12
[0491] HIF-ASO 12 specified in Table 2 is a 15-mer ASO fully complementary to a region in the 3 splice site spanning the junction of intron 3 and exon 4 in the human HIF-1 pre-mRNA as marked bold and underlined in the 20-mer pre-mRNA sequence of
TABLE-US-00031 [(5.fwdarw.3)uguuuacag|UUUGAACTAAC (SEQIDNO:53)],
HIF-ASO 12 possesses a 6-mer overlap with intron 3 and a 9-mer overlap with exon 4.
[0492] HIF-ASO 12 was evaluated by HIF-1 nested PCR for its ability to induce the skipping of exon 4 of the human HIF-1 mRNA in HeLa. HeLa cells were incubated with HIF-ASO 12 for 6 hours, and then subjected to total RNA extraction according to the protocol described in HIF-1 Example 1, unless noted otherwise.
[0493]
HIF-1 Example 12. Inhibition of HIF-1 Protein Expression in HeLa Cells by HIF-ASO 12
[0494] HIF-ASO 12 was evaluated for its ability to inhibit the expression of HIF-1 in HeLa cells as described in HIF-1 Example 2 unless noted otherwise.
[0495] [ASO Treatment] HeLa cells were treated with HIF-ASO 12 at 0 zM (negative control), 10 zM, 100 zM or 1 aM. 3 culture dishes for the negative control. 21 hours later, cells were treated with 200 M CoCl.sub.2 except for one dish of the negative control. 3 hours later, all the cells were subjected to lysis on ice as follows. Cells were washed 2 with 1 mL cold PBS, and then subjected to lysis with 200 L 2 Lammeli sample buffer (24 mM Tris-HCl, 20% glycerol, 0.8% SDS, 0.04% bromophenol blue, 2% -mercaptoethanol) to minimize the degradation of HIF-1. Each lysate was collected in 1.5 mL e-tube, and boiled for 5 min. Then the lysates were subjected to western blot on an 8% SDS-PAGE gel.
[0496]
HIF-1 Example 13. qPCR by SYBR Green for HIF-1 mRNA in HeLa Cells Treated with HIF-ASO 12
[0497] HIF-ASO 12 was evaluated by HIF-1 nested qPCR for its ability to induce a change in the HIF-1a mRNA in HeLa cells as described in HIF-1a Example 3, unless noted otherwise. HeLa cells were treated with HIF-ASO 12 for 6 hours, and then subjected to total RNA extraction.
[0498]
Examples for In Vitro & In Vivo Activity of AR ASOs
[0499] PNA derivatives of Formula I complementarily targeting the 5 splice site spanning the junction of exon 5 and intron 5 in the human androgen receptor (AR) pre-mRNA were evaluated for their AR antisense exon skipping activity in cells and in mice as well. Biological examples for these AR ASOs are provided as examples to illustrate that exon skipping is potently induced by the compound of Formula I targeting a splice site in a target pre-mRNA, and therefore should not be interpreted to limit the scope of the current invention to AR ASOs.
AR Example 1. Exon Skipping Induced by AR-ASO 1
[0500] AR-ASO 1 specified in Table 3 is a 13-mer ASO fully complementary to a region in the 5 splice site spanning the junction of exon 5 and intron 5 in the human androgen receptor (AR) pre-mRNA. AR-ASO 1 complementarily binds to the 13-mer sequence as marked bold and underlined in the 20-mer pre-mRNA sequence of
TABLE-US-00032 [(5.fwdarw.3)GCCUUGCCUG| guaaggaaaa(SEQIDNO:54)].
AR-ASO 1 possesses an 8-mer overlap with exon 5 and a 5-mer overlap with intron 5.
[0501] AR-ASO 1 was evaluated by AR nested PCR for its ability to induce the skipping of exon 5 of the human AR mRNA in MCF7 cells as follows.
[0502] [Cell Culture & ASO Treatment] MCF7 cells (Cat. Number: HTB-22, ATCC) were maintained in EMEM medium supplemented with 10% FBS, 1% streptomycin/penicillin, and 0.01 mg/mL bovine insulin under 5% CO2 atmosphere at 37 C. Cells grown in 60 mm culture dish were treated with AR-ASO 1 for 3 hours at 0 (negative control), 3, 30, 300 or 3,000 aM (i.e., 3 fM).
[0503] [RNA Extraction] Total RNA was extracted using Universal RNA Extraction Kit (Cat. No. 9767, Takara) according to the manufacturer's instructions [cDNA Synthesis by One Step RT-PCR] 100 ng of RNA template was used in a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. No. 10928-042, Invitrogen) and a set of exon-specific primers [AR-exon 3_forward: (5.fwdarw.3) TGGGTGTCACTATGGAGC (SEQ ID NO: 55); and AR-exon 9_reverse: (5.fwdarw.3) GGGT-GTGGAAATAGATGGG (SEQ ID NO: 56)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 39 cycles of 30 sec at 94 C., 30 sec at 55 C., and 1 min at 72 C.
[0504] [Nested PCR Amplification] Throughout the amplification process, was used a unique amplification technique (touch up as increasing annealing temperature per cycle) that worked efficiently and specifically over a temperature range, rather than at one specific annealing temperature (i.e., conventional PCR method). 1 L of cDNA was further amplified in a 20 L nested PCR reaction using a set of exon-specific primers [AR-exon 3_forward: (5.fwdarw.3) TGGGTGTCACTATGGAGC (SEQ ID NO: 57); and AR-exon 7n_reverse: (5.fwdarw.3) GGGGTGATTTGGAGC-CAT (SEQ ID NO: 58)] according to the following cycle conditions: initial 10 cycles [94 C. for 30 sec, 47 C. for 40 sec (+0.5 C. every cycle), 72 C. for 40 sec], followed by 20 cycles [94 C. for 30 sec, 50 C. for 30 sec, and 72 C. for 40 sec].
[0505] [Identification of Exon Skipping Products] The PCR products were subjected to electrophoretic separation on a 2% agarose gel. The bands of target size were collected and analyzed by Sanger Sequencing. In
AR Example 2. Inhibition of AR Protein Expression in MCF7 Cells by AR-ASO 1
[0506] MCF7 cells in 60 mm culture dish containing 5 mL culture medium were treated with AR-ASO 1 at 0 zM (negative control) or 10 zM to 30 aM. 4 culture dishes for the negative control. 48 hours later, cells were washed 2 with cold PBS, and then subjected to lysis with 200 L 1 cell lysis buffer (Cat. No. 9803, Cell Signaling Tech) supplemented with 1 protease inhibitors (Cat. No. P8340, Sigma). The lysates were collected in 1.5 mL e-tube. 200 L of each lysate was mixed with 100 L 3 sample buffer, and boiled for 5 min. 20 L of each lysate (4 negative controls and 8 ASO treatment samples) was subjected to electrophoretic separation on a 8% SDS-PAGE gel, and transferred onto a PVDF membrane. The membrane was probed with an anti-AR antibody (Cat. Number 5153, Cell Signaling Tech) and an anti-3-actin antibody (Cat. Number sc4778, Santa Cruz).
AR Example 3. qPCR by SYBR Green for AR mRNA in MCF7 Cells Treated with AR-ASO 1
[0507] [ASO Treatment and RNA Extraction] MCF7 cells in 5 mL culture medium were treated with AR-ASO 1 at 0 zM (negative control) or 1 zM to 1 aM. (2 culture dishes per concentration) 5 hours later, total RNA was extracted using MiniBEST Universal RNA Extraction Kit according to the manufacturer's instructions (Cat. Number 9767, Takara).
[0508] [cDNA Synthesis with OligodT] 500 ng of RNA template was subjected to a cDNA synthesis against oligo-dT according to the manufacturer's instructions (Cat. Number 6110A, Takara).
[0509] [First PCR] cDNA was then subjected to the 1.sup.st PCR against a set of exon-specific primers [AR-exon 3_forward: (5.fwdarw.3) TGGGTGTCACTATGGAGC (SEQ ID NO: 59); and AR-exon 9 reverse: (5.fwdarw.3) GGGTGTGGAAATAGATGGG (SEQ ID NO: 60)] according to the following cycle conditions: 94 C. for 2 min followed by 15 cycles of 15 sec at 94 C., 30 sec at 55 C., and 2 min at 72 C.
[0510] [Nested PCR] The 1.sup.st PCR products were diluted by 2,000 times, and 1 L of each diluted PCR product was subjected to a 20 L Real-Time PCR reaction against sets of exon-specific primers [AR-exon 4_forward(q): (5.fwdarw.3) GACCATGTTTTGCCCATTG (SEQ ID NO: 61); AR-exon 4_reverse(q): (5.fwdarw.3) GGCTCTTTTGAAGAAGACC (SEQ ID NO: 62); AR-exon 5_forward(q): (5.fwdarw.3) GAAACAGAAGTACCTGTGC (SEQ ID NO: 63); AR-exon 5_reverse(q): (5.fwdarw.3) GTCATCCCTGCTTC-ATAAC (SEQ ID NO: 64); AR-exon 6_forward(q): (5.fwdarw.3) CGGAAGCTGAAGAAACTTG (SEQ ID NO: 65); AR-exon 6_reverse(q): (5.fwdarw.3) CACTTGACCACGTGTACAAG (SEQ ID NO: 66)]. The PCR reactions were probed by SYBR Green (Takara, Japan). Cycle Conditions: 95 C. for 3 min followed by 40 cycles for 5 sec at 95 C., and 30 sec at 60 C. The exon levels gradually but significantly decreased as the dose was increased from 1 zM to 100 zM. The decreases were 40-50% in the cells treated with AR-ASO 1 at 100 zM. [cf.
AR Example 4. qPCR by SYBR Green for AR mRNA in MCF7 Cells Treated with AR-ASO 5
[0511] AR-ASO 5 specified in Table 3 is a 12-mer ASO fully complementary to a region in the 5 splice site spanning the junction of exon 5 and intron 5 in the human AR pre-mRNA. AR-ASO 5 complementarily binds to the 12-mer sequence as marked bold and underlined in the 20-mer pre-mRNA sequence of
TABLE-US-00033 [(5.fwdarw.3)GCCUUGCCUG|guaaggaaaa (SEQIDNO:67)].
AR-ASO 5 possesses a 7-mer overlap with exon 5 and a 5-mer overlap with intron 5.
[0512] AR-ASO 5 was evaluated for its ability to induce changes in the AR mRNA exon levels by qPCR according to the methods decribed in AR Example 3. As provided in
[0513] Unlike the case of AR-ASO 1 (cf. AR Example 3), there was no rebound in the exon message levels at 1,000 zM AR-ASO 5.
AR Example 5. qPCR by TaqMan Probe for AR mRNA in MCF7 Cells Treated with AR-ASO 5
[0514] AR-ASO 5 was evaluated for its ability to down-regulate the human AR mRNA by qPCR adopting a TaqMan probe.
[0515] MCF7 cells were treated with AR-ASO 5 at 0 zM (negative control) to 1 aM. (2 dishes per concentration) 24 hours later, total RNA was extracted by MiniBEST Universal RNA Extraction Kit according to the manufacturer's instructions (Cat. No. 9767, Takara).
[0516] 400 ng of RNA template was subjected to a cDNA synthesis with One-Step RT-PCR kit (Invitrogen) against a set of exon-specific primers [AR-exon 3_forward: (5.fwdarw.3) TGGGT-GTCACTATGGAGC (SEQ ID NO: 68); and AR-exon 9_reverse: (5.fwdarw.3) GGGTGTGGAAATAGATGGG (SEQ ID NO: 69)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 15 cycles of 30 sec at 94 C., 30 sec at 50 C., and 1 min at 72 C.
[0517] 1 L of each cDNA solution diluted by 50 was subjected to a 20 L Real-Time PCR reaction against a set of exon-specific primers of [AR-exon 4_forward(q2): (5.fwdarw.3) TTGTCCATCTTGTCGTCTT (SEQ ID NO: 70); and AR-exon 5_reverse(q2): (5.fwdarw.3) CCTCTCCTTCCTC-CTGTA (SEQ ID NO: 71)] according to the following cycle conditions: 95 C. for 3 min followed by 40 cycles 15 sec at 95 C., and 30 sec at 60 C. The qPCR reaction was monitored with a TaqMan probe of [(5.fwdarw.3) TTTCTTCAG-ZEN-CTTCCGGGCTC-3IABkFQ (SEQ ID NO: 72)]. The TaqMan probe was designed to probe the junction of exon 4 and exon 5 in the full-length AR mRNA.
[0518]
AR Example 6. Inhibition of AR Protein Expression in Skin of Mice Subcutaneously Treated with AR-ASO-5
[0519] AR-ASO 5 targets the AR pre-mRNA sequence conserved in humans and mice. AR-ASO 5 was evaluated for its ability to inhibit the AR protein expression in the skin of mice following a single subcutaneous administration as follows.
[0520] [Hair Removal and Grouping] In Day 0, 7 weeks old male C57BL/6 mice were anesthetized with zoletil/rompun, and the hair in the back was cut with a clipper and removed by carbo-waxing. In Day 5, mice with flawless (i.e., spotless) hair removal were selected and randomly assigned into five groups of 0 pmole/Kg (vehicle only, negative control), 1 pmole/Kg, 10 pmole/Kg, 100 pmole/Kg, and 1,000 pmole/Kg AR-ASO 5. (6 animals per group).
[0521] [ASO Injection Solution & Administration] An aqueous mother stock soluion of AR-ASO 5 was serially diluted in PBS supplemented with 0.1% Tween 80 to prepare AR-ASO 5 solutions of 0 nM (vehicle only, negative control), 0.5 nM, 5 nM, 50 nM, or 500 nM. In Day 5, individual mice in each dose group were subcutaneously administered in the nape (i.e., near neck) with a single injection of the test article at 2 mL/Kg.
[0522] [Extraction of Skin Samples] In Day 10, the animals were sacrificed to obtain skin samples from the injection site and the hip as a non-injection site. The skin samples were frozen in liquid nitrogen immediately after the sampling. Each skin sample was micronized while maintaining the sample frozen with liquid nitrogen. The micronized samples were subjected to lysis with RIPA buffer supplemented with 1% SDS. The lysates were mixed with 5 sample buffer and boiled for 5 min.
[0523] [AR Western Blot] The lysates were subjected to AR western blot on a PVDF membrane. A total of 10 lysates were loaded on each 10% PAGE gel with two individual lysates from each group. AR protein (120K daltons) was probed with a polyclonal AR antibody (N-20, sc-816, Santa Cruz).
[0524] [Quantification of AR Protein Expression] Each AR band on a single PVDF membrane was normalized against individual -actin band. The average AR band intensity (normalized against -actin) of the two samples of the negative control group (i.e., no ASO treatment) was used to normalize the AR band intensities of the other 8 samples on the same PVDF membrane. Such double normalization was applied to the other two PVDF membranes to quantify the AR protein expression of individual samples by densitometry. All the AR expression levels after the double normalization of individual samples were pooled for statistical analysis by student's t-test against the expression level without the ASO treatment.
[0525] [Inhibition of AR Protein Expression]
[0526]
[0527]
[0528] The inhibition of AR protein expression observed in the skin distal to the injection site demonstrates that the ASO may readily distribute to tissues distal to the administration site through the systemic circulation following a subcutaneous injection. The ex vivo findings were provided to illustrate the systemic target engagement following a subcutaneous injection of the PNA derivative of Formula I, and therefore should not be interpreted to limit the scope of the present invention.
AR Example 7. Exon Skipping Induced by AR-ASO 1 (2)
[0529] Depending on passage, cell density and culture conditions, the morphology of MCF7 cells varied. MCF cells at early passages tended to grow relatively fast and show colonies of cumulus shape. MCF7 cells at later passages are likely to grow slow and form flat epithelial colonies. However, maintaining MCF7 cells to show the morphology of cumulus shape was challenging.
[0530] AR-ASO 1 was evaluated for its exon skipping ability in MCF7 cells grossly showing the morphology of cumulus shape as described in AR Example 1, unless noted otherwise.
[0531] [ASO Treatment] MCF7 cells were treated with AR-ASO 1 for 3 hours at 0 (negative control), 30, 100 or 1,000 aM (i.e., 1 fM). (2 culture dishes per ASO concentration)
[0532] [RNA Extraction] Total RNA was extracted using RNeasy mini prep kit (Cat. Number 74104, Qiagen) according to the manufacturer's instructions. 500 ng of RNA template was subjected to a 25 L reverse transcription reaction.
[0533] [Exon Skipping Results]
[0534]
Examples for In Vitro & In Vivo Activity of SCN9A ASOs
[0535] PNA derivatives of Formula I complementarily targeting multiple splice sites in the human SCN9A (sodium channel subtype 9A) pre-mRNA were evaluated for their SCN9A antisense and exon skipping activity in cells and animals as well. Biological examples for these SCN9A ASOs are provided as examples to illustrate that exon skipping is potently induced by the compound of Formula I targeting a splice site in a target pre-mRNA, and therefore should not be interpreted to limit the scope of the current invention to SCN9A ASOs.
SCN9A Example 1. Exon Skipping Induced by SCN-ASO 7
[0536] SCN-ASO 7 specified in Table 4 is a 16-mer ASO fully complementary to a region in the 5 splice site spanning the junction of exon 4 and intron 4 in the human SCN9A pre-mRNA read out from the human SCN9A gene (accessed from NCBI Reference Sequence: NC_000002.12). SCN-ASO 7 complementarily binds to the 16-mer sequence as marked bold and underlined in the 20-mer pre-mRNA sequence of
TABLE-US-00034 [(5.fwdarw.3)UUGUUUUUGC| guaaguacuu(SEQIDNO:73)].
SCN-ASO 7 possesses a 10-mer overlap with exon 4 and a 6-mer overlap with intron 4.
[0537] Given that PC3 cells are known to abundantly express the humman SCN9A pre-mRNA [Br. J. Pharmacol. vol 156, 420-431 (2009)], SCN-ASO 7 was evaluated by SCN9A nested PCR for its ability to induce the skipping of exon 4 in the human SCN9A pre-mRNA in PC3 cells as follows.
[0538] [Cell Culture & ASO Treatment] PC3 cells (Cat. No. CRL-1435, ATCC) were maintained in Ham's F-12K medium supplemented with 10% FBS, 1% streptomycin/penicillin, 1% L-glutamine, and 1% sodium pyruvate under 5% CO.sub.2 atmosphere at 37 C.
[0539] PC3 cells grown in 60 mm culture dish containing 5 mL medium were treated with SCN-ASO 7 at 0 (negative control), 10, 100 or 1,000 zM.
[0540] [RNA Extraction] Following an 18 hour incubation, the PC3 cells were treated with 100 g/mL cycloheximide for another 6 hours in order to freeze the ribosomal translation. Then total RNA was extracted from cells using Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions.
[0541] [cDNA Synthesis by One Step RT-PCR] 200 ng of RNA template was used for a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) and a set of exon-specific primers [SCN-exon 2_forward: (5.fwdarw.3) CTTTCTCCTTTCAGTCCTCT (SEQ ID NO: 74), and SCN-exon 9_reverse: (5.fwdarw.3) CGTCTGTTGGTAAAGGTTTT (SEQ ID NO: 75)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 40 cycles of 30 sec at 94 C., 30 sec at 55 C., and 2 min at 72 C.
[0542] [Nested PCR Amplification] 1 L of cDNA solution (diluted by 100) was subjected to a 20 l PCR amplification by nested PCR (Cat. Number K2612, Bioneer) against a set of exon-specific primers [SCN-exon 3n_forward: (5.fwdarw.3) GGACCA-AAAATGTCGAGTATTT (SEQ ID NO: 76); and SCN-exon 8_reverse: (5.fwdarw.3) GCTAAGAAGGCCCAGC-TGAA (SEQ ID NO: 77)] according to the following cycle conditions: 95 C. for 5 min followed by 35 cycles of 30 sec at 95 C., 30 sec at 50 C., and 1 min at 72 C.
[0543] It is noted that the primer of SCN-exon 3n_forward targets the junction of exon 3 and exon 5 to effectively probe the deletion of exon 4, although the 22-mer primer still possesses an 18-mer complementary overlap with the junction of exon 3 and exon 4. Thus SCN-exon 3n_forward recognizes the junction of exon 3 and exon 5 more selectively than the junction of exon 3 and exon 4 found in the full length SCN9A mRNA. The primer sequence was designed to detect SCN9A splice variants lacking exon 4 more sensitively than the full length SCN9A mRNA. Such an exon skipping primer would be useful to detect mRNA splice variants having poor metabolic stability, since the full-length mRNA tends to show good metabolic stability gained through the evolution over billions years.
[0544] [Identification of Exon Skipping Products] The nested PCR products were subjected to electrophoretic separation on a 2% agarose gel. The bands of target size were collected and analyzed by Sanger sequencing. The skipping of exon 4 was conspicuously strong in PC3 cells treated with 1 aM SCN ASO 7, although the skipping of exon 4 was visible too at 10 and 100 zM as shown in
SCN9A Example 2. qPCR by SYBR Green for SCN9A mRNA in PC3 Cells Treated with SCN-ASO 7
[0545] SCN-ASO 7 was evaluated for its ability to inhibit the expression of the human SCN9A mRNA in PC3 cells by qPCR against a set of exon-specific primers as follows.
[0546] [Cell Culture & ASO Treatment] PC3 cells grown in 60 mm culture dish containing 5 mL culture medium were incubated with SCN-ASO 7 for 24 hours at 0 (negative control), 10, 100 or 1,000 zM. (2 culture dishes per concentration)
[0547] [RNA Extraction] Total RNA was extracted using MiniBEST Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions.
[0548] [cDNA Synthesis by One Step RT-PCR] 200 ng of RNA template was subjected to a 20 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) and against a set of exon-specific primers [SCN-exon 2_forward: (5.fwdarw.3) CTTTCTCCTTTCAGTCCTCT (SEQ ID NO: 78); and SCN-exon 9_reverse: (5.fwdarw.3) TTGCCTGGTTCTGTTCTT (SEQ ID NO: 79)]. Cycle Conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 15 cycles of 15 sec at 94 C., 30 sec at 55 C., and 2 min at 72 C.
[0549] [Nested qPCR Amplification] 1 L of each cDNA solution diluted by 50 was subjected to a 20 L Real-Time PCR reaction against a set of exon specific primers sets [SCN-exon 4_forward: (5.fwdarw.3) GTACACTTTTACTGGAATATATAC (SEQ ID NO: 80); SCN-exon 4_reverse: (5.fwdarw.3) AATGACGACAAAATCCAGC (SEQ ID NO: 81); SCN-exon 5_forward: (5.fwdarw.3) GTATTTAACAGAAT-TTGTAAACCT (SEQ ID NO: 82); SCN-exon 5_reverse: (5.fwdarw.3) CTGGGATTA-CAGAAATAGTTTTCA (SEQ ID NO: 83); SCN-exon 6_forward: (5.fwdarw.3) GAAGACAATTGTAGGGGC (SEQ ID NO: 84); SCN-exon 6_reverse: (5.fwdarw.3) GTCTTCTTCACTCTCTAGGG (SEQ ID NO: 85)]. The PCR reactions were probed with SYBR Green (Takara, Japan). Cycle conditions: 95 C. for 30 sec followed by 40 cycles 5 sec at 95 C., and 30 sec at 60 C.
[0550] [qPCR Results] Individual exon level of the ASO treated cells was normalized against the exon level of the negative control cells (i.e., without ASO treatment).
SCN9A Example 3. qPCR by SYBR Green for SCN9A mRNA in PC3 Cells Treated with SCN-ASO 3
[0551] SCN-ASO 3 specified in Table 4 is a 14-mer ASO targeting the 5 splice site spanning the junction of exon 4 and intron 4 in the human SCN9A pre-mRNA. SCN-ASO 3 complementarily binds to the 12-mer sequence marked bold and underlined in the 20-mer pre-mRNA sequence of
TABLE-US-00035 [(5.fwdarw.3)UUGUUUUUGC|guaaguacuu (SEQIDNO:86)],
in which the two mismatches are marked with a quote ( ) sign. SCN-ASO 3 possesses a 7-mer complementary overlap with exon 4 and a 5-mer complementary overlap with intron 4.
[0552] SCN-ASO 3 was evaluated for its ability to inhibit the expression of the full-length SCN9A mRNA in PC3 cells according to the protocol described in SCN9A Example 2, unless noted otherwise.
[0553] The qPCR results are provided as summarized in
SCN9A Example 4. qPCR by SYBR Green for SCN9A mRNA in PC3 Cells Treated with SCN-ASO 8
[0554] SCN-ASO 8 specified in Table 4 is a 17-mer ASO targeting a region in the 5 splice site spanning the junction of exon 4 and intron 4 in the human SCN9A pre-mRNA. SCN-ASO 8 complementarily binds to the 15-mer sequence marked bold and underlined in the 20-mer pre-mRNA sequence of
TABLE-US-00036 [(5.fwdarw.3)UUGUUUUUGC|guaaguacuu (SEQIDNO:87)],
in which the mismatch is marked with a quote sign ( ). SCN-ASO 8 possesses a 10-mer complementary overlap with exon 4 and a 5-mer complementary overlap with intron 4 in the human SCN9A pre-mRNA.
[0555] SCN-ASO 8 was evaluated for its ability to inhibit the expression of the full-length SCN9A mRNA in PC3 cells according to the protocol described in SCN9A Example 2, unless noted otherwise.
[0556] The qPCR results are provided as summarized in
SCN9A Example 5. Inhibition of Sodium Current by CoroNa Assay in PC3 Cells Treated with SCN-ASO 7
[0557] Cellular sodium current is measured by patch clamp. As sodium ions enter cell, the intra-cellular sodium ion level increases. The intra-celluar sodium level can be probed using a sodium ion sensitive dye. CoroNa Green is a dye with a sodium ion chelator of crown ether type. Upon chelation with a sodium ion, CoroNa Green emits green fluorescence. CoroNa Green has been used to indirectly measure the intra-cellular sodium level. The sodium level measured by CoroNa Green was found to correlate well with the sodium ion current measured by sodium ion patch clamp. [Proc. Natl. Acad. Sci. USA vol 106(38), 16145-16150 (2009)]
[0558] PC3 cells are known to abundantly express the human SCN9A mRNA, although there are other SCN subtypes concommitantly expressed. [Br J. Pharmacol. vol 156, 420-431 (2009)] Thus an inhibition of SCN9A mRNA expression may lead to a considerable reduction of the sodium current in PC3 cells, if the sodium ion current by the Na.sub.v1.7 sodium channel subtype occupies a marked portion of the total sodium ion current in PC3 cells. It is note that the SCN9A mRNA encodes the Na.sub.v1.7 sodium channel subtype.
[0559] SCN-ASO 7 was evaluated for its ability to inhibit the sodium ion current in PC3 cells using CoroNa Green as follows.
[0560] [ASO Treatment] PC3 cells grown in 35 mm culture dish containing 2 mL F-12K medium were treated with SCN-ASO 7 at 0 zM (negative control), 100 zM or 1 aM. [CoroNa Assay] 30 hours later, the cells were washed with 2 mL HBSS (Hank's Balanced Salt Solution, Cat. Number 14025-092, Life Technologies), and then charged with 2 mL fresh HBSS. Then the cells were treated with 5 M CoroNa Green (Cat. Number C36676, Life Technologies) at 37 C. 30 min later, the cells were washed 2 with 2 mL HBSS, and charged with 2 mL fresh HBSS. The culture dish was mounted on an Olympus fluorescence microscope equipped with a digital video camera to continuously capture the green fluorescence images of the cells. The cells were acutely treated with 100 mM NaCl, and then the changes in fluorescence cellular images were digitally recorded over a period of 3 min. There were about 4 cells per frame on average. The fluorescence intensities from each individual cell were traced at the resolution of a second. The traces of the intracellular fluorescence intensities from individual cells were overlaid and averaged at each time point. The average of the traces from the individual cells of each ASO concentration were plotted as provided in
[0561] [CoroNa Assay Results] The observed traces of intracellular fluorescence intensity are summarized in
SCN9A Example 6. Inhibition of Sodium Current by Corona Assay in PC3 Cells Treated with SCN-ASO 3
[0562] SCN-ASO 3 was evaluated for its ability to inhibit the sodium current in PC3 cells using CoroNa Green according to the protocol described in SCN9A Example 5, unless noted otherwise.
[0563] The observed traces of cellular fluorescence intensity are provided in
SCN9A Example 7. Inhibition of Sodium Current in PC3 Cells Treated with SCN-ASO 8
[0564] SCN-ASO 8 was evaluated for its ability to inhibit the sodium current in PC3 cells using CoroNa Green according to the protocol described in SCN9A Example 3, unless noted otherwise.
[0565] The observed traces of cellular fluorescence intensity are provided in
SCN9A Example 8. Exon Skipping Induced by SCN-ASO 27 in PC3 Cells (A)
[0566] SCN-ASO 27 specified in Table 5 is a 14-mer ASO fully complementary to the 3 splice site spanning the junction of intron 3 and exon 4 in the human SCN9A pre-mRNA. The 14-mer target sequence within the 3 splice site is marked bold and underlined in the 20-mer SCN9A pre-mRNA sequence of
TABLE-US-00037 [(5.fwdarw.3)uuguguuuag|GUACACUUUU (SEQIDNO:88)].
SCN-ASO 27 possesses a 6-mer overlap with intron 3, and an 8-mer overlap with exon 4.
[0567] SCN-ASO 27 was evaluated for its ability to induce the skipping of exon 4 in PC3 cells as described in SCN9A Example 1, unless noted otherwise.
[0568] [Cell Culture & ASO Treatment] PC3 cells grown in 60 mm culture dish containing 5 mL culture medium were treated with SCN-ASO 27 at 0 (negative control), 1, 10 or 100 zM.
[0569] [Nested PCR Amplification] 1 L of cDNA was further amplified in a 20 L nested PCR reaction (Cat. Number K2612, Bioneer) against a set of exon-specific primers of [SCN-exon 2n_forward: (5.fwdarw.3) CCACCGGACTGGACCAAAAA (SEQ ID NO: 89); and SCN-exon 9n_reverse: (5.fwdarw.3) GCTAAGAAGGCCCAGCTGAA (SEQ ID NO: 90)] according to the following cycle conditions: 95 C. for 2 min followed by 34 cycles of 30 sec at 95 C., 30 sec at 55 C., and 1 min at 72 C.
[0570] [Identification of Exon Skipping Products]
SCN9A Example 9. Exon Skipping Induced by SCN-ASO 27 in PC3 Cells (B)
[0571] SCN-ASO 27 was evaluated for its ability to induce the skipping of exon 4 in PC3 cells as described in SCN9A Example 8, unless noted otherwise. In this experiment, PC3 cells were treated with SCN-ASO 27 at 0 (negative control), 1, 10, 100 and 1,000 aM for 24 hours.
[0572] [Nested PCR Amplification] The nested PCR reaction was carried out against a set of primers of [SCN-exon 3/6_forward: (5.fwdarw.3) GGACCAAAAATGTCGAGCCT (SEQ ID NO: 91); and SCN-exon 9n_reverse: (5.fwdarw.3) GCTAAGAAGGCCCAGCTGAA (SEQ ID NO: 92)] designed to selectively amplify the product possessing the junction sequence of exon 3 and exon 6.
[0573] It is noted that the primer sequence of SCN-exon 3/6_forward targets the junction of exon 3 and exon 6 to probe the skipping of exons 4-5, although the 20-mer primer still retains a 17-mer complementary overlap with the junction of exon 3 and exon 4. Thus the primer sequence of SCN-exon 3/6_forward recognizes the junction of exon 3 and exon 6 more selectively than the junction of exon 3 and exon 4 found in the full length SCN9A mRNA. The primer sequence was designed to detect the SCN9A splice variant lacking exons 4-5 more sensitively than the full length SCN9A mRNA. Such an exon skipping primer would be useful to detect mRNA splice variants with poor metabolic stability, since full-length mRNAs tend to show good metabolic stability gained through the evolution over billions years.
[0574]
SCN9A Example 10. qPCR by One Step cDNA Synthesis for SCN9A mRNA in PC3 Cells Treated with SCN-ASO 27
[0575] SCN-ASO 27 was evaluated by SCN9A nested qPCR for its ability to induce changes in the human SCN9A mRNA level in PC3 cells as described in SCN9A Example 2 unless noted otherwise.
[0576] [ASO Treatment] PC3 cells were treated with SCN-ASO 27 at 0 (negative control), 0.1, 1 or 10 aM for 24 hours. (2 culture dishes per ASO concentration)
[0577] [cDNA Synthesis by One-step PCR] 200 ng of RNA template was subjected to a 25 L reverse transcription reaction using One Step RT-PCR kit (Invitrogen, USA) against a set of exon-specific primers of [SCN-exon 2_forward: (5.fwdarw.3) CTTTCTCCTTTCAGTCCTCT (SEQ ID NO: 93); and SCN-exon 8/9_reverse: (5.fwdarw.3) CGTCTGTTGGTAAAGGTTTT (SEQ ID NO: 94)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 15 cycles of 30 sec at 94 C., 30 sec at 55 C., and 2 min at 72 C.
[0578] [Nested qPCR Amplification] 1 L of each cDNA solution diluted by 100 was subjected to a 20 L Real-Time PCR reaction against a set of exon-specific primers of [SCN-exon 3_forward: (5.fwdarw.3) TGACCATGAATAACCCAC (SEQ ID NO: 95); and SCN-exon 4_reverse(2): (5.fwdarw.3) GCAAGGATTTTTACAAGT (SEQ ID NO: 96)] according to the following cycle conditions: 95 C. for 30 sec followed by 40 cycles 5 sec at 95 C., and 30 sec at 60 C. The qPCR reaction was monitored with a TaqMan probe of [(5.fwdarw.3) 5,6-FAM-GGACCAAAA-Zen-ATGTCGAGTACAC-3IABkFQ (SEQ ID NO: 97)] targeting the junction of exon 3 and exon 4 in the full-length SCN9A mRNA.
[0579] The full-length SCN9A mRNA level significantly decreased (by student's t-test) in the cells treated with SCN-ASO 27 by ca 35 to 45% as provided in
SCN9A Example 11. qPCR by cDNA Synthesis with Random Hexamers for SCN9A mRNA in PC3 Cells Treated with SCN-ASO 27
[0580] SCN-ASO 27 was evaluated by SCN9A qPCR for its ability to induce changes in the human SCN9A mRNA level in PC3 cells as described in SCN9A Example 10, unless noted otherwise. cDNA was synthesized using random hexamers, and subjected to SCN9A qPCR reaction using the TaqMan probe.
[0581] The full-length SCN9A mRNA level significantly decreased (student's t-test) in the cells treated with SCN-ASO 27 by ca 50 to 60% as provided in
SCN9A Example 12. Inhibition of Sodium Current by CoroNa Assay in SNL-Activated Rat L5 DRG Cells by SCN-ASO 27
[0582] SCN-ASO 27 is a 14-mer SCN9A ASO fully complementary to the human SCN9A pre-mRNA, but possesses a single mismatch the rat SCN9A pre-mRNA read out from the rat genomic DNA [NCBI Reference Sequence: NC_000002.12]. SCN-ASO 27 possesses a 13-mer complementary overlap and a single mismatch with the rat SCN9A pre-mRNA as marked bold and underlined in the 20-mer rat pre-mRNA sequence of
TABLE-US-00038 [(5.fwdarw.3)uuuccuuuag|GUACACUUUU (SEQIDNO:98)],
in which the single mismatch is marked with a quote ( ) sign.
[0583] SCN-ASO 27 was evaluated for its ability to inhibit the sodium ion current in rat DRG (dorsal root ganglion) cells using CoroNa Green as follows.
[0584] [Spinal Nerve Ligation] Spinal nerve ligation (SNL) induces neuropathy in the dorsal root ganglia (DRG) and spinal cord, and has been widely used as a model for neuropathic pains. [Pain vol 50(3), 355-363 (1992)] Depending on how spinal nerve(s) is ligated, however, there can be several variations of SNL. The degree and duration of neuropathy in DRG appears to vary depending on how spinal nerve(s) is ligated. [Pain vol 43(2), 205-218 (1990)] The dual ligation of the L5 and L6 spinal nerve (i.e., L5/L6 ligation) induces neuropathy more severe and persisting longer than the ligation of the L5 spinal nerve alone (i.e., L5 ligation).
[0585] [SNL Surgery by L5/L6 Ligation] In Day 0, 6 weeks old male SD rats were anesthetized with zoletil/rompun. Then the L5 and L6 spinal nerve (left side) were exposed and tightly ligated. The muscle and skin were closed and clipped by due aseptic procedures. The rats were sporadically sensitized by von Frey scoring over a period of 4 weeks.
[0586] [Preparation of DRG Neuronal Cells] In Day 31, a rat showing a low von Frey score was sacrificed to extract both the left (ligated side) and the right (non-ligated side) DRG. The DRGs were immersed in 0.5 mL PBS immediately after the extraction. DRG cells were prepared as follows according to the procedures disclosed in the literature. [Methods Mol Biol. vol 846, 179-187 (2012); PLOS One vol 8(4); e60558 (2013)]
[0587] {circle around (1)} DRG was immersed in a 1.5 mL e-tube containing 0.2 mL 0.125% collagenase (Collagenase Type IV, Cat. No. C5138-100MG, Sigma) in HBSS (Hank's Balanced Salt Solution, Cat. Number 14025-092, Life Technologies), chopped with scissors into small pieces, and incubated for 20 min in a CO.sub.2 incubator at 37 C. under 5% CO.sub.2 and 95% RH; {circle around (2)} 50 L 0.25% trypsin/EDTA was added to the e-tube, which was kept in the incubator for another 10 min; {circle around (3)} the e-tube was charged with 1 mL complete DMEM medium, and subjected to centrifugal sedimentation at 600 g for 5 min; {circle around (4)} the resulting pellet was suspended in 4 mL Neurobasal-A medium (Neurobasal Medium, Cat. No. 21103-049, Gibco) supplemented with 2 B-27 (B-27 Serum-Free Supplement, Cat. No. 17504-044, Gibco), 1 penicillin-streptomycin, 1 L-glutamine, and 1 mL of the cell suspension was carefully seeded onto a laminin-coated cover glass (Cat. No. GG-25-1.5-laminin, Neuvitro) placed in a 35 mm culture dish; {circle around (5)} one day after the seeding, the dish was carefully charged with another 1 mL fresh Neurobasal-A medium; {circle around (6)} two days after the seeding, the medium was replaced with 2 mL fresh Neurobasal-A medium supplemented with 1 aM Ara-C(Cat. No. C1768-100MG, Sigma) to selectively suppress the growth of cells other than DRG neuronal cells; {circle around (7)} four days after the seeding, the medium was replaced again with 2 mL fresh Neurobasal-A medium supplemented with 1 M Ara-C; and {circle around (8)} five or six days after the seeding, DRG neuronal cells were treated with SCN-ASO 27.
[0588] [ASO Treatment & CoroNa Assay] L5 DRG neuronal cells either with L5/L6 ligation or without L5/L6 ligation were treated with SCN-ASO 27 at 0 (negative control), 100 or 1,000 zM. 30 hours later, the cells were washed with 2 mL HBSS, and then charged with 2 mL fresh HBSS. Then the cells were treated with 5 M CoroNa Green at 37 C. 30 min later, the cells were washed 2 with 2 mL HBSS, and charged with 2 mL fresh HBSS. The culture dish was mounted on a fluorescence microscope equipped with a CCD camera to continuously capture the green fluorescent images of the cells. The cells were acutely treated with 10 mM NaCl, and then the changes in the cellular fluorescent intensity were digitally recorded over a peroid of 300 sec. There were 4 to 5 cells per frame for image capturing. The fluorescence intensities from each individual cell were traced at a resolution of a second. The traces of the intracellular fluorescence intensities from individual cells were averaged using ImageJ program (version 1.50i, NIH), and the average traces are provided in
[0589] [CoroNa Assay Results] In the cells stimulated with L5/L6 ligation (cf.
[0590] In the cells without L5/L6 ligation (cf.
[0591] DRG neuronal cells without neuropathic stimulation are known to express various subtypes of VGSC including Na.sub.v1.7, Na.sub.v1.8, Na.sub.v1.2 and so on. Na.sub.v1.7 subtype shows a limited contribution to the whole sodium current in DRG neuronal cells without stimulation. [Nature Comm. vol 3, Article Number 791: DOI:10.1038/ncomms1795 (2012)] The DRG neuronal cells without L5/L6 ligation may show a limited contribution of the sodium current from Na.sub.v1.7 subtype.
[0592] In the meantime, neuronal cells are known to upregulate Na.sub.v1.7 expression in response to persisting neuropathy. [J Biol Chem. vol 279(28), 29341-29350 (2004); J Neurosci. vol 28(26), 6652-6658 (2008)] SCN-ASO 27 at both 100 zM and 1 aM inhibited the sodium current by 80 to 85% in the neuronal cells stimulated by L5/L6 ligation. The higher inhibition of the sodium current by SCN-ASO 27 in the DRG cells with L5/L6 ligation is consistent with the upregulation of Na.sub.v1.7 in neuronal cells due to chronic neuropathy.
SCN9A Example 13. Inhibition of Na.SUB.v.1.7 Protein Expression in L5 DRG Neuronal Cells by SCN-ASO 30
[0593] SCN-ASO 30 is a 14-mer ASO fully complementary to the rat SCN9A pre-mRNA, whilst SCN-ASO 27 is a 14-mer ASO fully complementary to the human SCN9A pre-mRNA. SCN-ASO 30 possesses a single mismatch with SCN-ASO 27 in the C-terminal end. SCN-ASO 30 against the rat SCN9A pre-mRNA may serve as a good model ASO for SCN-ASO 27 against the human SCN9A pre-mRNA.
[0594] SCN-ASO 30 was evaluated for its ability to inhibit the expression of Na.sub.v1.7 protein in rat DRG neuronal cells as described below.
[0595] [Preparation of DRG Neuronal Cells] Male SD rats (7 weeks old) were subjected to tight L5/L6 ligation. 7 days later, 4 rats were anesthetized with zoletil/rompun to sample the L5 DRG of the ligated side. The DRGs were pooled and processed to prepare DRG neuronal cells as described in SCN9A Example 12.
[0596] [ASO Treatment] DRG neuronal cells were treated with SCN-ASO 30 at 0 (negative control), 10, 100 or 1,000 zM for 24 hours, and then subjected to lysis for western blot against a Na.sub.v1.7 antibody (Cat. No. ab85015, Abcam) probing the C-terminal of the Na.sub.v1.7 protein. -actin was probed for reference.
[0597] [Inhibition of Na.sub.v1.7 Expression]
SCN9A Example 14. Inhibition of Sodium Current in Rat L5 DRG Neuronal Cells by SCN-ASO 30
[0598] SCN-ASO 30 was evaluated for its ability to inhibit the sodium current in rat L5 DRG neuronal cells stimulated with L5/L6 ligation as provided below.
[0599] [Preparation of DRG Neuronal Cells] Male SD rats (6 weeks old) were subjected to tight L5/L6 ligation. 7 days later, rats were anesthetized with zoletil/rompun for the extraction of L5 DRG of the ligated side. L5 DRG neuronal cells were prepared as follows: {circle around (1)} DRG was immersed in a 1.5 mL e-tube containing 0.2 mL 0.125% collagenase in HBSS, chopped with scissors into small pieces, and incubated for 20 min in a CO.sub.2 incubator at 37 C. under 5% CO.sub.2 and 95% RH; {circle around (2)} 50 L 0.25% trypsin/EDTA was added to the e-tube and the e-tube was kept in the incubator for another 10 min; {circle around (3)} the e-tube was charged with 1 mL complete DMEM medium, and subjected to centrifugal sedimentation at 600 g for 5 min; {circle around (4)} then the resulting pellet was suspended in 4 mL Neurobasal-A medium (Neurobasal Medium, Cat. No. 21103-049, Gibco) supplemented with 2 B-27 (B-27 Serum-Free Supplement, Cat. No. 17504-044, Gibco), 1 penicillin-streptomycin, 1 L-glutamine; {circle around (5)} the suspension of DRG cells was transported for about an hour as sealed in a 15 mL falcon tube containing ca 15 mL Neurobasal-A medium; {circle around (6)} 0.5 mL of the cell suspension was carefully seeded onto a laminin-coated cover glass placed in a well of 24-well plate culture dish; {circle around (7)} the cells seeded in the culture plate were incubated in a CO.sub.2 incubator at 37 C. for 2 hours to attach cells onto the cover glass, and then treated with SCN-ASO 30 at 0 (negative control) or 100 zM for 4 hours in the incubator; and {circle around (8)} the DRG neuronal cells were subjected to sodium current measurement by manual patch clamp assay on a sodium patch clamp apparatus (Axopatch 200B Amplifier, Axon Instruments).
[0600] [Patch Clamp Assay Results]
SCN9A Example 15. qPCR by One Step cDNA Synthesis for SCN9A mRNA in Rat DRG Cells Treated with SCN-ASO 30
[0601] SCN-ASO 30 was evaluated by SCN9A nested qPCR for its ability to inhibit the expression of the SCN9A mRNA in rat DRG cells as follows.
[0602] [Preparation of L5 DRG Cells] A 4 weeks old male SD rat was anesthetized with zoletil/rompun to extract the L5 DRGs. The DRG samples were pooled and processed to prepare L5 DRG cells as described in SCN9A Example 12.
[0603] [ASO Treatment] Rat DRG cells were treated with SCN-ASO 30 at 0 (negative control), 10, 30, 100, 300, or 1,000 zM. (1 culture dish per ASO concentration)
[0604] [RNA Extraction & cDNA Synthesis by One Step PCR] 24 hours later, total RNA was extracted from cells using Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions. 200 ng of RNA template was used for a 25 L reverse transcription reaction using One Step RT-PCR kit (Invitrogen, USA) against a set of exon-specific primers [SCN-exon 2(3)_forward: (5.fwdarw.3) CAATCTTCCGTTTCAACGCC (SEQ ID NO: 99); and SCN-exon 10_reverse: (5.fwdarw.3) ACCACAGCCAGGATCAAGTT (SEQ ID NO: 100)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 15 cycles of 30 sec at 94 C., 30 sec at 55 C., and 2 min at 72 C.
[0605] [Nested qPCR Amplification] 1 L of each cDNA solution (duplicate per concentration) diluted by 100 was subjected to a 20 L Real-Time PCR reaction with a TaqMan probe (Cat. No. Rn01514993_mH, ThermoFisher) targeting the junction of SCN9A exon 3 and exon 4 according to the following cycle conditions: 95 C. for 30 sec followed by 40 cycles 5 sec at 95 C., and 30 sec at 60 C.
[0606]
SCN9A Example 16. qPCR by cDNA Synthesis Random Hexamers for SCN9A mRNA in Rat DRG Cells Treated with SCN-ASO 30
[0607] SCN-ASO 30 was evaluated by SCN9A qPCR for its ability to inhibit the expression of the SCN9A mRNA in rat L5 DRG cells. Total RNA was prepared as described in SCN9A Example 15, and subjected to cDNA synthesis using random hexamers. The cDNA solutions (duplicate per ASO concentration) were diluted by 100 times, and 1 L of each diluted PCR product was subjected to a 20 L Real-Time PCR reaction with the TaqMan probe targeting the junction of SCN9A exon 3 and exon 4 according to the following cycle conditions: 95 C. for 30 sec followed by 40 cycles 5 sec at 95 C., and 30 sec at 60 C.
[0608] The cDNA solutions were also subjected to qPCR amplification for the GAPDH mRNA. The Ct values of the SCN9A mRNA were normalized against the Ct values of GAPDH mRNA.
[0609]
SCN9A Example 17. Reversal of Allodynia by SCN9A ASOs in Rats with Diabetes-Induced Peripheral Neuropathic Pain
[0610] The SCN9A gene encodes the -subunit of VGSC subtype Na.sub.v1.7. There are an extremely small number of individuals who do not feel severe pains but are normal in other sensory functions. Such individuals were found to have the SCN9A gene mutated to encode nonfunctional Na.sub.v1.7 subtype. [Nature vol 444, 894-898 (2006)] This has been termed as SCN9A channelopathy. The behavioral phenotypes of human SCN9A channelopathy were reproduced fairly much in SCN9A knockout mice. [PLOS One 9(9): e105895 (2014)] Thus the SCN9A ASOs of Formula I may show analgesic activity in animal pain models accompanying Na.sub.v1.7 upregulation.
[0611] SCN-ASO 7, SCN-ASO 8, SCN-ASO 21, SCN-ASO 35, SCN-ASO 36 and SCN-ASO 37 were evaluated for their ability to reverse the allodynia in rats with diabetes-induced peripheral neuropathic pain (DPNP). In this example, the six SCN9A ASOs targeting a total of five splice sites were evaluated for their ability to reverse the allodynia induced by diabetic neuropathy in rats.
[0612] [Induction of DPNP and Grouping] Diabetes was induced in rats by an intraperitoneal injection of sterptozotocin at 60 mg/Kg in Day 0. In Day 10, rats with DPNP were randomly assigned to 6 groups of negative control (vehicle only), SCN-ASO 7 100 pmole/Kg, SCN-ASO 8 100 pmole/Kg, SCN-ASO 21 100 pmole/Kg, SCN-ASO 35 100 pmole/Kg, SCN-ASO 36 100 pmole/Kg, and SCN-ASO 37 100 pmole/Kg. The animals were grouped based on the von Frey scores of individual animals in Day 10. (N=8-9 per group) Allodynia was scored using a set of microfilaments (Touch Test) according to the Up & Down method. [J Neurosci. Methods vol 53(1), 55-63 (1994)]
[0613] [ASO Treatment and von Frey Scoring] ASO solutions for injection were prepared by serially diluting aqueous mother stock solutions of the SCN9A ASOs to 100 nM in PBS (phosphate buffered saline). Animals were subcutaneously administered with ASO at 1 mL/Kg in Days 11, 13, 15, 17 and 19. Von Frey scoring was carried out 2 hours post dose in Days 11, 13, 15, 17 and 19. Von Frey scoring was additionally performed in Days 21 and 23 in order to assess the duration of the therapeutic activity after the final dosing. Daily von Frey scores were evaluated for statistical significance by student's t-test against the negative control group (vehicle only, i.e., PBS).
[0614] [Therapeutic Activity] The observed von Frey scores are summarized in
[0615] SCN-ASO 7, SCN-ASO 8, SCN-ASO 21 and SCN-ASO 35 possess a 5-mer complementary overlap with their target intron. In the meantime, SCN-ASO 36 and SCN-ASO 37 possess a 4-mer and 3-mer complementary overlap with their target intron, respectively. Although there are a number of factors affecting the therapeutic efficacy, the number of the complementary overlap with the target intron appears to affect the therapeutic efficacy.
[0616] In this example, the in vivo antisense activity was observed with SCN9A ASOs targeting 4 out of 5 splice sites. The hit ratio of 80% is considered to be very high, given that in vivo therapeutic activity depends on various factors including cellular antisense activity, the enrichment of drug molecules in the target tissue, pharmacokinetic half-life, and so on. Thus the compound of Formula I predictably modulates the expression of its target gene.
[0617] Given with the molecular weight of SCN-ASO 7 (cf. Table 4), 100 pmole/Kg is translated into a therapeutic dose of ca 0.53 g/Kg. The sub-attomolar in vitro exon skipping potency of SCN-ASO 7 is considered to be largely responsible for the ultra-strong in vivo therapeutic potency of ca 0.53 g/Kg in rats with diabetic neuropathy. Even more surprisingly, the ASO was administered as naked oligonucleotide. Such a strong in vivo therapeutic potency has never been realized with other classes of oligonucleotide including DNA, RNA, PTO, 2-OMe PTO, 2-OMe RNA, 2-OMOE RNA, LNA, PMO, PNA, and so on.
Examples for In Vivo & Ex Vivo Activity of DMD ASOs
[0618] Duchenne muscular dystrophy (DMD) is a life-threatening mono-genic rare disease with muscular degeneration. DMD patients do not encode the full-length dystrophin protein due to a PTC (premature termination codon) resulting from a point mutation or deletion of exon(s).
[0619] Mdx mouse (C57BL/10ScSn-Dmd.sup.mdx/J, Jackson Lab) is a mutant mouse with a point mutation in exon 23 of the dystrophin gene, which yields a PTC. Mdx mice encode a truncated form of dystrophin lacking the C-terminal portion. Since the C-terminal portion binds to the extracelluar matrix (ECM), the truncated form loses its destined role to tightly link muscle fibers to the ECM. Consequently, mdx mice gradually lose the muscular integrity and strength with age.
[0620] Mdx mice have been widely adopted as an animal model for human DMD. Dystrophin ASOs targeting the mouse dystrophin exon 23 have been investigated to eliminate the PTC through the skipping of exon 23.
[0621] PNA derivatives of Formula I complementarily targeting either the 3 or the 5 splice site of exon 23 in the mouse dystrophin pre-mRNA were evaluated for their ability to induce the skipping of dystrophin exon 23 in mdx mice. Biological examples provided herein are to illustrate the exon skipping capability of dystrophin ASOs as examples for the compound of Formula I, and therefore should not be interpreted to limit the scope of the current invention to dystrophin ASOs.
DMD Example 1. Exon Skipping Induced by DMD-ASO 1 and DMD-ASO 4 in Mdx Mice (Nested PCR Method A)
[0622] DMD-ASO 1 specified in Table 7 is a 13-mer ASO fully complementary to a region in the 3 splice site spanning the junction of intron 22 and exon 23 in the mouse dystrophin pre-mRNA. DMD-ASO 1 complementarily binds to the 13-mer sequence as marked bold and underlined in the 25-mer sequence of
TABLE-US-00039 [(5.fwdarw.3)uaauuuugag|GCUCUGCAAAGTTCT (SEQIDNO:101)].
[0623] DMD-ASO 1 possesses an 8-mer overlap with intron 22 and a 5-mer overlap with exon 23.
[0624] DMD-ASO 4 specified in Table 7 is a 17-mer ASO fully complementary to a region in the 3 splice spanning the junction of intron 22 and exon 23 in the mouse dystrophin pre-mRNA. DMD-ASO 4 complementarily binds to the 17-mer sequence as marked bold and underlined in the 25-mer sequence of
TABLE-US-00040 [(5.fwdarw.3)uaauuuugag|GCUCUGCAAAGTTCT (SEQIDNO:102)].
DMD-ASO 4 possesses a 5-mer overlap with intron 22 and a 12-mer overlap with exon 23.
[0625] DMD-ASO 1 and DMD-ASO 4 were evaluated for their ability to induce exon skipping in muscles of mdx mice by subcutaneous administration as follows.
[0626] [ASO Treatment & Sampling Muscle Tissues] The injection solutions were prepared by diluting an aqueous mother stock solution of DMD-ASO 1 or DMD-ASO 4 in PBS to 500 nM. Male mdx mice were subcutaneously administered with vehicle only (negative control), DMD-ASO 1 or DMD-ASO 4 at 2 mL/Kg, 2 per day (BID) for 3 days. One day after the final dose, the animals were anesthetized with zoletil/rompun, and sacrificed to sample muscle tissues including the heart, diaphragm, gatrocnemius, quadriceps, and triceps.
[0627] [RNA Extraction] Muscle samples were homogenized by grinding in a tube kept on ice, and subjected to total RNA extraction with 1 mL trizol reagent (Invitrogen) per ca 100 mg muscle tissue.
[0628] [cDNA Synthesis by One-Step RT-PCR] 500 ng of RNA template was used in a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) and a set of exon-specific primers [DMD-exon 21_forward: (5.fwdarw.3) CAAAGAGAAAGAGCTACAGACA (SEQ ID NO: 103); and DMD-exon 25_reverse: (5.fwdarw.3) CTGGGCTGAATTGTTTGAAT (SEQ ID NO: 104)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 40 cycles of 30 sec at 94 C., 1 min at 58 C., and 2 min at 72 C.
[0629] [Nested PCR Amplification] 1 L of cDNA was further amplified in a 20 L nested PCR (Cat. Number K2612, Bioneer) reaction against a set of primers [DMD-exon 22n_forward: (5.fwdarw.3) ATCCAGCAGTCAGAAAGCAAA (SEQ ID NO: 105); and DMD-exon 25n_reverse: (5.fwdarw.3) ACTAAAAGTCTGCATTGT (SEQ ID NO: 106)] according to the following cycle conditions: 95 C. for 5 min followed by 39 cycles of 30 sec at 95 C., 40 sec at 50 C., and 50 sec at 72 C.
[0630] [Identification of Exon Skipping Product] The PCR products were subjected to electrophoretic separation on a 2% agarose gel as provided in
[0631] The subject of the negative control (i.e., no ASO treatment) yielded a PCR band assigned to the skipping of exons 22-23 in the quadriceps. The skipping of exons 22-23 yields a frame shift, and the dystrophin mRNA splice variant lacking exons 22-23 is doomed to encode a truncated dystrophin with the C-terminal portion missing.
[0632] The bands of target size were collected and analyzed by Sanger Sequencing, and confirmed the skipping of exon 23 induced by DMD-ASO 1 and DMD-ASO 4. (cf.
DMD Example 2. Exon Skipping Induced by DMD-ASO 1 and DMD-ASO 4 in Mdx Mice (Nested PCR Method B)
[0633] The RNA samples obtained in DMD Example 1 were subjected to a one-step cDNA synthesis using a set of exon-specific primers of [DMD-exon 20_forward: (5.fwdarw.3) CAGAATTCTGCCAATTGCTGAG (SEQ ID NO: 107); and DMD-exon 26_reverse: (5.fwdarw.3) TTCTTCAGCTT-GTGTCATCC (SEQ ID NO: 108)]. The cDNA samples were then analyzed by nested PCR against another set of exon-specific primers of [DMD-exon 20n_forward: (5.fwdarw.3) CCCAGTCTACCACCCTAT-CAGAGC (SEQ ID NO: 109); and DMD-exon 26n_reverse: (5.fwdarw.3) CCTGCCTTTAAGGCTTCCTT (SEQ ID NO: 110)].
[0634] The nested RT-PCR outcomes are provided as summarized in
[0635] The exon skipping profiles varied depending on the PCR method as provided above. Thus exon skipping profiles should be interpreted with discretion.
DMD Example 3. Exon Skipping Induced by DMD-ASO 1 in Mdx Mice (Nested PCR Method A)
[0636] Mdx mice subcutaneously received DMD-ASO 1 at 0 (negative control) or 10 pmole/Kg, 2 per day for 5 days. (2 animals per group) One day after the final dose, the animals were sacrificed for tissue sampling. The triceps samples were evaluated for the skipping of exon 23 according to the nested RT-PCR method described in DMD Example 1.
[0637] The nested RT-PCR outcomes are summarized in
DMD Example 4. Improvement of Muscle Function by Rotarod Test in Mdx Mice Subcutaneously Administered with DMD-ASO 1
[0638] Exon 23 skipping in mdx mice removes the PTC in exon 23, and the mRNA splice variant lacking exon 23 is in frame and therefore encodes a variant protein with the C-terminal portion binding to the ECM. Thus, the full-length variant dystrophin protein partially restores the physiological functions of the original or wild type full-length dystrophin.
[0639] Given with the exon skipping potential, DMD-ASO 1 was evaluated in mdx mice for its ability to improve muscle function by rotarod test as described below.
[0640] [Grouping] 6 weeks old male mdx mice were trained for rotarod test over a period of 2 weeks, and then randomly assigned into 3 groups of 0 (negative control), 100 and 1,000 pmole/Kg DMD-ASO 1 based on individual scores by rotarod test in Day 0, i.e., the day of grouping. (N=10 per group)
[0641] [ASO Treatment] The injection solutions were prepared by serially diluting the ASO to 20 nM and 200 nM in PBS. Animals were subcutaneously administered with vehicle (PBS, negative control), 20 nM DMD-ASO 1 (100 pmole/Kg), or 200 nM DMD-ASO 1 (1,000 pmole/Kg) at 5 mL/Kg, 3 per week over a period of Day 0 to Day 21.
[0642] [Rotarod Test and Statistical Analysis] Mice were subjected to rotarod test on a rotarod apparatus (Model #47650, Ugo Basile) with an acceleration schedule of 4 rpm to 45 rpm over 60 seconds. The latency to fall (i.e., the duration that animal remained on the rotarod) was scored for each individual animal. Statistical significance was evaluated by student's t-test against the negative control group.
[0643] [Improvement of Muscle Function]
DMD Example 5. Improvement of Muscle Function by Grip Test and Muscular Integrity in Mdx Mice Chronically Administered with DMD-ASO 1
[0644] DMD-ASO 1 was evaluated by chronically administering to mdx mice for its ability to improve muscle function by grip test, to induce exon skipping, to upregulate the expression of the full-length dystrophin (i.e., dystrophin protein with the C-terminus encoded) by IHC, and to improve the muscular integrity by histopathology with H&E staining as described below.
[0645] [Grouping & ASO Treatment] Male mdx mice (7 weeks old) were randomly assigned to 4 groups of 0 (mdx negative control), 10, 50, and 200 pmole/Kg DMD-ASO 1 based on individual grip strength scores by grip test. (N=12 per group) A satellite group of 12 male C57BL/6 mice (7 weeks old) was included in this study as the wild type negative control group for the full-length dystrophin expression level.
[0646] The 50 and 200 pmole/Kg group subcutaneously received DMD-ASO 1 as dissolved in PBS, 2 per week until the final sacrifice in Week 43. In the meantime, the 10 pmole/Kg group subcutaneously received DMD-ASO 1 initially 2 per week during Week 0 to 8, and 3 per week afterwards to increase the ASO exposure.
[0647] [Muscle Function by Grip Test] Muscle function was evaluated on a weekly basis by grip strength on a grip strength-meter (Cat. Number 47,200, Ugo Basile) according to the literature. [J. Appl. Physiol. vol 106(4), 1311-1324 (2009)] The grip strength scores by group were evaluated for statistical significance by student's t-test against the mdx negative control group.
[0648]
[0649] It is noted that 2 to 3 animals per group were randomly selected and sacrificed in Weeks 7, 13, 21 and 30 for IHC or nested PCR evaluation. (see below)
[0650] [IHC Evaluation of Skeletal Muscles against Full-length Dystrophin] In Weeks 7, 13 and 21, two animals per group were randomly selected and sacrificed to extract muscle tissues. In Week 30, 3 animals were sacrificed per group.
[0651] The muscle tissues sampled in Week 7 were subjected to IHC against the full-length dystrophin by cryosection. The muscle tissues sampled in Weeks 13, 21 and 30 were immunostained by paraffin block. IHC by paraffin block yielded images of better quality than IHC by cryosection.
[0652] Muscle samples were subjected to immunostaining in series with a primary antibody targeting the C-terminal of mouse dystrophin (Cat. Number sc-816, Santa Cruz) at 1:100 dilution, with a secondary anti-IgG antibody (Cat Number BA-1100, Vector) at 1:200 dilution, and then with Dylight 594-steptavidin (Cat Number SA-5594, Vector, CA, USA) at 1:200 dilution for red fluoresence tagging. The IHC images were captured on a Zeiss slide scanner (in Weeks 13, 21 and 30) or an Olympus fluorescence microscope (in Week 7). DAPI staining was additionally carried out.
[0653]
[0654] The dystrophin IHC images were subjected to quantification for the full-length dystrophin expression by digitally scoring the intensity of red fluorescence in each individual IHC image using the ImageJ program (NIH). Individual fluorescence scores were combined by group and muscle type for statistical evaluation against the wild type negative control group.
[0655]
[0656] [Nested PCR for Exon Skipping (Method B)] Muscle samples were homogenized by grinding in a tube kept on ice, and subjected to total RNA extraction with 1 mL trizol reagent (Invitrogen) per ca 100 mg muscle tissue. The total RNAs were evaluated for exon skipping by nested PCR as described in DMD Example 2.
[0657]
[0658] [Histopathology by H&E Staining] Muscular inflammation and degeneration are the hallmark of DMD symptoms. Skeletal muscle samples were subjected to histopathology evaluation by H&E staining.
[0659] In the WT negative control group, the muscle structure was dense at all the time points of sampling. There were no suggestions of muscular inflammation in the muscles of the wild type mice at all the time points.
[0660] In the mdx negative control, the muscle structure showed a clear pattern of gradual degeneration with age. Most notably in Week 30, muscle bundles were not inter-connected and tended to degenerate to round shape. Also there was massive infiltration of inflammatory cells as suggested by blue dot stains, most notably in Weeks 13 and 21.
[0661] In the 200 pmole/Kg group, the loose muscle structure in Week 7 gradually recovered to a dense structure. The marked infiltration of inflammatory cells in Week 7 gradually disappeared with age. Thus muscular degeneration and inflammation in mdx mice were reversed upon chronic administrations of the ASO at 200 pmole/Kg, which would be consistent with the upregulation of the full-length dystrophin in the 200 pmole/Kg group.
[0662] The severity of the histopathology findings in the 10 and 50 pmole/Kg groups was weaker than the severity in the mdx negative control, but stronger than that in the 200 pmole/Kg group. Thus the upregulation of the full-length dystrophin induced by the ASO exposure is largely consistent with the histopathological findings.
[0663] [Miscellaneous Findings] There were three cases of unscheduled sacrifice or death (Weeks 26, 39 and 43) in the mdx negative control group due to a large mass of muscular lymphoma developed most likely by chronic muscular inflammation. There were no cases of lymphoma in all the ASO treatment groups.
[0664] [Comparison with Other Dystrophin ASO] Eteplirsen (exondys 51) is a PMO antisense oligonucleotide designed to induce the skipping of exon 51 in the human dystrophin pre-mRNA.
[0665] Recently, the US FDA issued an accelerated approval of eteplirsen for use in a population of DMD patients requiring the skipping of exon 51. The recommended dose of eteplirsen is an intravenous injection of 30 mg/Kg per week.
[0666] The subcutaneous dose of 200 pmole/Kg DMD-ASO 1 corresponds to ca 1 g/Kg. The dystrophin ASO of Formula I is more potent than the PMO ASO by ca 30,000 times, although there are differences in species and exon between the two types of ASO. The unprecedentedly ultra-strong exon skipping potency of the PNA derivative of Formula I was translated again into an ultra-strong in vivo therapeutic potency for this hard-to-treat rare disease.
DMD Example 6. Improvement of Muscle Function by Walking Distance in MDX Mice Chronically Administered with DMD-ASO 2
[0667] DMD ASO 2 specified in Table 7 is a 17-mer ASO fully complementary to a region in the 3 splice site spanning the junction of intron 22 and exon 23 in the mouse dystrophin pre-mRNA. DMD-ASO 2 complementarily binds to the 17-mer sequence marked bold and underlined as in the 20-mer mouse dystrophin pre-mRNA sequence of
TABLE-US-00041 [(5.fwdarw.3)uaauuuugag|GCUCUGCAAA (SEQIDNO:111)].
DMD-ASO 2 possesses an 8-mer overlap with intron 22 and a 9-mer complementary overlap with exon 23.
[0668] DMD-ASO 2 was chronically administered to mdx mice to evaluate its ability to improve muscle function by the walking distance on tread mill, and to inhibit the muscle degradation by the serum levels of creatine kinase (CK) and myoglobin.
[0669] [Animals & Grouping] Male mdx mice (6 weeks old) were randomly assigned to three groups of the mdx negative control (no ASO treatment), DMD-ASO 2 10 pmole/Kg, and DMD-ASO 2 30 mg/Kg based on the body weight. (N=16 per group) 12 male C57BL/6 mice (6 weeks old) were adopted as the wild type (WT) negative control group.
[0670] [Injection Solutions & ASO Treatment] An aqueous mother stock solution of DMD-ASO 2 was diluted either in PBS or in PBS supplemented with 0.1% Tween 80 to prepare injection solutions of 20 and 60 nM DMD-ASO 2 for 10 pmole/Kg and 30 pmole/Kg DMD-ASO 2, respectively. Supplementation of PBS injection solution with 0.1% Tween 80 was considered to be necessary to prevent the ASO molecules from sticking to plastic injection vials, pipette tips, and syringes.
[0671] [Walking Distance on Tread Mill] During the first 30 weeks post grouping, the animals were administered with the injection solutions without Tween 80 2 per week at 2 mL/Kg. Starting from Week 7, the animals were subjected to walking on a tread mill (Model #LE8710, PanLab) on a weekly basis. During the first 30 weeks, however, the ASO treatment groups failed to show any significant improvements in the walking distance compared to the mdx negative control group.
[0672] In order to effectively increase the ASO dose, animals were administered with the injection solutions supplemented with Tween 80, 2 per week from Week 36. There was a washout (i.e., no ASO dosing) period of 5 weeks in between.
[0673]
[0674] During Weeks 46 to 48, the 10 pmole/Kg group showed the average walking distances of 240 to 280 meters, which were significantly longer than the distances of the mdx negative control group. In the meantime, the 30 pmole/Kg group showed walking distances of ca 180 to 230 meters during Weeks 46 to 48. There was a tendency of longer walking distance with the 10 pmole/Kg group than the 30 pmole/Kg group. The inverted dose response of the walking distance would suggest natural a selection of different exon(s) at higher ASO dose as observed in HIF-1 Example 9. Interestingly, the WT negative control group and the 30 pmole/Kg group showed comparable walking distances during Weeks 44 to 47.
[0675] [Terminal Sacrifice] In Week 48, the animals were subjected to terminal sacrifice for blood sampling. The blood samples were analyzed for the serum level of CK (Creatine Kinase Activity Assay Kit, Cat. Number ab155901, Abcam) and myoglobin (Myoglobin ELISA Kit, Cat. Number ab210965, Abcam) to assess the degree of muscle degradation according to the manufacturer's instructions. Muscle tissues were analyzed by western blot for the full-length dystrophin.
[0676] [Serum Levels of CK and Myoglobin]
[0677]
[0678] The observed data of the serum biomarkers for muscular degradation are grossly consistent with the dose dependency of the walking distance provided in
[0679] [Full-length Dystrophin Expression in Triceps by Western Blot] Following homogenization at liquid nitrogen temperature, muscle (triceps) samples were subjected to lysis in RIPA buffer supplemented with 1% SDS. The protein concentration in each lysate was quantified by BCA assay against the BSA standard. 50 mg of protein of each lysate was subjected to electrophoretic separation on an 8% PAGE gel. Then the PVDF membrane was probed with a C-terminal targeting dystrophin antibody (Cat. Number ab154168, Abcam).
[0680]
[0681] In case of the mdx groups, the three dystrophin bands were detected. The 10 and 30 pmole/Kg treatment groups yielded the 117K band markedly stronger than the mdx negative control group as well as the WT control group. The 130K band intensity was considerably stronger in the 10 pmole/Kg group than in the mdx negative control group, too.
DMD Example 7. Long Term Evaluation of MDX Mice Administered with DMD-ASO 1, DMD-ASO 2 or DMD-ASO 6
[0682] DMD ASO 6 specified in Table 7 is an 18-mer ASO fully complementary to a region in the 5 splice site spanning the junction of exon 23 and intron 23 in the mouse dystrophin pre-mRNA. DMD-ASO 6 complementarily overlaps with the 18-mer sequence as marked bold and underlined in the 25-mer mouse dystrophin pre-mRNA sequence of
TABLE-US-00042 [(5.fwdarw.3)AAAAUUUCAG|guaagccgagguuug (SEQIDNO:112)].
DMD-ASO 6 possesses an 8-mer overlap with exon 23 and a 10-mer overlap with intron 23.
[0683] DMD-ASO 1, DMD-ASO 2 and DMD-ASO 6 were evaluated for their physiological effects in male mdx mice by long term subcutaneous administration. In this evaluation the animals were not subjeccted to physical tests requiring muscular stress in order to keep the transcription of the dystrophin gene undisturbed by excessive muscular stimulation.
[0684] [Animals & Grouping] Male mdx mice (6 weeks old) were randomly assigned to 4 groups of the mdx negative control (no ASO treatment), DMD-ASO 1 50 pmole/Kg, DMD-ASO 2 10 mg/Kg, and DMD-ASO 6 10 mg/Kg based on the body weight. (N=12-13 per group) 12 male C57BL/6 mice (6 weeks old) were adopted as the wild type (WT) negative control group.
[0685] [Injection Solutions & ASO Treatment] Aqueous mother stock solutions of the ASOs were serially diluted in PBS to prepare the injection solutions of 25 nM DMD-ASO 1 for 50 pmole/Kg DMD-ASO 1, 5 nM DMD-ASO 2 for DMD-ASO 2 10 pmole/Kg, and 5 nM DMD-ASO 6 for DMD-ASO 6 10 pmole/Kg. The animals were subcutaneously administered with the injection solutions at 2 mL/Kg, 2 per week.
[0686] [Unscheduled Death or Sacrifice] The mdx mice treated with the ASOs tended to show longer life sapns than the mdx negative control group, suggesting the therapeutic activity of the ASOs.
[0687] In the mdx negative control group, there were three cases of unscheduled death or sacrifice: one at a time in Weeks 42, 58 and 61. The DMD-ASO 1 treatment group showed two premature deaths, one in Week 38 and another in Week 61. In case of the DMD-ASO 2 treatment group, one death in Week 56 and another in Week 62. There were three premature deaths in the DMD-ASO 6 treatment group: one at a time in Weeks 55, 65 and 66.
[0688] [Terminal Sacrifice] All the survived animals were sacrificed for blood sampling in Week 66 post the grouping. The blood samples were subjected to ELISA assays for serum creatine kinase (CK) and serum myoglobin as described in DMD Example 6.
[0689] [Serum Levels of CK and Myoglobin]
[0690]
Examples for In Vitro Activities of IDO1 ASOs
[0691] PNA derivatives of Formula I in Table 8 were designed to complementarily target various splice sites in the human IDO1 pre-mRNA. IDO1 ASOs were evaluated for the exon skipping activity in SKOV3 cells. Given that IDO1 catalyzes the degradation of L-tryptophan to N-formylkynurenine, IDO1 ASOs were evaluated for their functional ability to inhibit the production of kynurenine. Biological examples provided herein are to illustrate the exon skipping activity of the IDO1 ASOs as examples for the compound of Formula I, and therefore should not be interpreted to limit the scope of the current invention to IDO1 ASOs.
IDO1 Example 1. Exon Skipping Induced by IDO-ASO 1
[0692] IDO-ASO 1 specified in Table 8 is a 13-mer ASO fully complementary to a region in the 3 splice site spanning the junction of intron 6 and exon 7 in the human IDO1 pre-mRNA. IDO-ASO 1 complementarily targets the 13-mer sequence as marked bold and underlined in the 20-mer human IDO1 pre-mRNA sequence of
TABLE-US-00043 [(5.fwdarw.3)uuuguuuuag|GUAAUUCCUA (SEQIDNO:113)].
IDO-ASO 1 possesses a 5-mer overlap with intron 6 and an 8-mer overlap with exon 7.
[0693] IDO-ASO 1 was evaluated for its ability to induce exon skipping in SKOV3 cells (Cat. Number HTB-77, ATCC) by IDO1 nested PCR as follows.
[0694] [Cell Culture & ASO Treatment] SKOV3 (human ovary adenocarcinoma) cells were subcultured in 60 mm culture dish containing 5 mL McCoy's 5A modified medium supplemented with 10% FBS, 1% streptomycin/penicillin, 1% L-glutamine, and 1% sodium pyruvate under 5% CO.sub.2 at 37 C., and treated with IDO-ASO 1 for 48 hours at 0 zM (negative control), 10 zM, 100 zM or 1 aM.
[0695] [RNA Extraction & cDNA Synthesis by One-Step RT-PCR] Total RNA was extracted from the cells using Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions. 200 ng of RNA template was subjected to a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) against a set of exon-specific primers [IDO-exon 2_forward: (5.fwdarw.3) TTCATTGCTAAACATCTGCC (SEQ ID NO: 114); and IDO-exon 10_reverse: (5.fwdarw.3) TGAAAGGACAAACTCACGGA (SEQ ID NO: 115)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 40 cycles of 30 sec at 94 C., 30 sec at 50 C., and 1 min at 72 C.
[0696] [Nested PCR Amplification] 1 L of cDNA was further amplified in a 20 L nested PCR reaction (Cat. No. K2612, Bioneer) against a set of exon-specific primers [IDO-exon 4_forward: (5.fwdarw.3) CCTTACTGCCAACTCTCC (SEQ ID NO: 116); and IDO-exon 9_reverse: (5.fwdarw.3) CTGCTTTGGCCTGCACTG (SEQ ID NO: 117)] according to the following cycle conditions: 95 C. for 5 min followed by 30 cycles of 30 sec at 95 C., 30 sec at 50 C., and 1 min at 72 C.
[0697] [Identification of Exon Skipping Product] The PCR products were subjected to electrophoretic separation on a 2% agarose gel. The bands of target size were collected and analyzed by Sanger sequencing.
[0698]
[0699] The skipping of exons 6-7 was detected in the RNA extract of the cells treated with 100 zM IDO-ASO 1. The exon skipping band was not detected in the RNA extracts of the cells treated with the ASO at 10 zM or 1 aM most likely due to poor stability of the IDO1 mRNA splice variant lacking exons 6-7. Although the intensity of the full-length IDO-1 mRNA decreased in the cells treated with the ASO at 10 or 100 zM, the intensity of the full-length mRNA PCR increased in the cells treated with the ASO at 1 aM treatment. The observed increase of the full-length mRNA level at 1 aM has yet to be elucidated. It could be an artifact during the PCR reactions, or could be due to a (transient) transcription upregulation by the exon intron circular RNA (EIciRNA) accumulated during the exon skipping by IDO-ASO 1. [Nature Struct. Mol. Biol. vol 22(3), 256-264 (2015)] The Sanger sequencing data (right diagram) unequivocally demonstrated the skipping of exons 6-7 induced by IDO-ASO 1 in SKOV3 cells.
IDO1 Example 2. Antisense Functional Activity of IDO-ASO 1
[0700] The functional activity of IDO-ASO 1 was evaluated for its ability to inhibit the secretion of kynurenine in SKOV3 cells as follows.
[0701] [Kynurenine Secretion Assay] SKOV3 cells grown in 60 mm culture dish containing 5 mL culture medium were treated with IDO-ASO 1 at 0 zM (negative control) or 10 zM to 1 fM. (3 dishes per concentration) Cells were treated with the ASO along with 10 ng/mL -interferon to increase the kynurenine secretion. 24 hours later, 200 L of the culture medium was sampled from each culture dish and mixed with 100 L 30% trichloroacetic acid. The mixture was vortexed and subjected to centrifugation at 8,000 g for 5 min. 75 L of the resulting supernatant was mixed with 75 L Ehrlich reagent (0.8% p-dimethylamino-benzaldehyde in acetic acid), and the mixture was subjected to a quantification for kynurenine at 490 nm on an ELISA reader. [PLOS One 5(8): e63301 (2013)]
[0702]
IDO1 Example 3. Exon Skipping Induced by IDO-ASO 5
[0703] IDO-ASO 5 specified in Table 8 is a 13-mer ASO fully complementary to a region in the 5 splice site apanning the junction of exon 3 and intron 3 in the human IDO1 pre-mRNA. IDO-ASO 5 complementarily overlaps with the 13-mer sequence as marked bold and underlined in the 20-mer human IDO1 pre-mRNA sequence of
TABLE-US-00044 [(5.fwdarw.3)UGUCCGUAAG|guuuggagau (SEQIDNO:118)].
IDO-ASO 5 has an 8-mer complementary overlap with exon 3 and a 5-mer complementary overlap with intron 3.
[0704] IDO-ASO 5 was evaluated for its ability to induce exon skipping in SKOV3 cells by IDO1 nested RT-PCR as described in IDO1 Example 1 unless noted otherwise.
[0705] [ASO Treatment] SKOV3 cells grown in 60 mm culture dish were treated with IDO-ASO 5 at 0 (negative control), 1, 3, 10, 30 or 100 aM for 48 hours.
[0706] [cDNA Synthesis by One-step PCR] 200 ng of RNA template was subjected to a 25 l reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. No. 10928-042, Invitrogen) against a set of exon-specific primers [IDO-exon 1_forward: (5.fwdarw.3) AAAACTCCTGGACAATCAGT (SEQ ID NO: 119); and IDO-exon 8_reverse: (5.fwdarw.3) ACTTGAAGGGCTTTCTCC (SEQ ID NO: 120)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 40 cycles of 30 sec at 94 C., 30 sec at 52 C., and 40 sec at 72 C.
[0707] [Nested PCR Amplification] 1 L of cDNA was further amplified in a 20 L nested PCR (Cat. No. K2612, Bioneer) reaction using a set of exon-specific primers [IDO-exon 1n_forward: (5.fwdarw.3) TATTGATGAAGAAGTGGG (SEQ ID NO: 121); and IDO-exon 8n_reverse: (5.fwdarw.3) GTTCACATGATCGTGGATTTG (SEQ ID NO: 122)] according to the following cycle conditions: 95 C. for 5 min followed by 30 cycles of 30 sec at 95 C., 40 sec at 52 C., and 40 sec at 72 C.
[0708] [Nested PCR Products Data]
IDO1 Example 4. Exon Skipping Induced by IDO-ASO 6
[0709] IDO-ASO 6 specified in Table 8 is a 13-mer ASO fully complementary to a region in the 3 splice site spanning the junction of intron 3 and exon 4 in the human IDO1 pre-mRNA. IDO-ASO 6 complementarily targets the 13-mer sequence as marked bold and underlined in the 20-mer human IDO1 pre-mRNA sequence of
TABLE-US-00045 [(5.fwdarw.3)uuuuaaucag|GUCUUGCCAA (SEQIDNO:123)].
IDO-ASO 6 possesses a 5-mer complementary overlap with intron 3 and 8-mer complementary overlap with exon 4.
[0710] IDO-ASO 6 was evaluated for its ability to induce exon skipping in SKOV3 cells by IDO1 nested PCR as described in IDO1 Example 3 unless noted otherwise.
[0711] [Nested PCR Products Data]
Examples for In Vitro and Ex Vivo Activities of SNAP25 ASOs
[0712] SNAP25 (synaptosome-associated protein of 25 kDa) is a SNARE protein involved in the exocytosis of neurotransmitters in motor neuronal cells. Botullinum toxin A (Botox) cleaves SNAP25 for its famous anti-wrinkle activity. PNA derivatives of Formula I in Table 9 were designed to complementarily target the 3 splice site of exon 7 in the human SNAP25 pre-mRNA. SNAP25 ASOs were evaluated for the SNAP25 antisense activity in SiMa (human neuroblastoma) cells and PC12 cells of rat origin, as well as for their ability to inhibit the SNAP25 expression in the skin of mice upon topical administration. Biological examples provided herein are to illustrate the exon skipping activity of the SNAP25 ASOs as examples for the compound of Formula I, and therefore should not be interpreted to limit the scope of the current invention to SNAP25 ASOs.
SNAP25 Example 1. Exon Skipping in PC12 Cells Treated with SNAP-ASO 3
[0713] SNAP-ASO 3 specified in Table 9 is a 14-mer ASO fully complementary to a 14-mer sequence in the 3 splice site spanning the junction of intron 6 and exon 7 in the human SNAP25 pre-mRNA. SNAP-ASO 3 complementarily overlaps with the 14-mer pre-mRNA sequence as marked bold and underlined in the 30-mer pre-mRNA sequence of
TABLE-US-00046 [(5.fwdarw.3)cucuuuggaucccag|GGUAACAAAUGAUGC (SEQIDNO:124)].
SNAP-ASO 3 possesses a 7-mer overlap with intron 6, and another 7-mer overlap with exon 7.
[0714] SNAP-ASO 3 was evaluated for its ability to induce exon skipping in PC12 cells (Cat. Number CRL-1721, ATCC), although SNAP-ASO 3 possesses a single mismatch with the 3 splice site of exon 7 in the rat SNAP25 pre-mRNA read out from the rat genomic DNA [accessed from NCBI Reference Sequence: NC_005012]. The 14-mer ASO possesses a 13-mer complementary overlap with the rat SNAP25 pre-mRNA as marked bold and underlined in the 25-mer pre-mRNA sequence of
TABLE-US-00047 [(5.fwdarw.3)uggcucccag|GGUAACAAACGAUGC (SEQIDNO:125)],
in which the single mismatch marked with a quote ( ) sign.
[0715] [Cell Culture & ASO Treatment] PC12 cells were maintained in RPMI 1640 medium supplemented with 5% FBS, 10% horse serum, 1% streptomycin/penicillin, 1% L-glutamine, and 1% sodium pyruvate under 5% CO.sub.2 atmosphere at 37 C. Cells grown in 60 mm culture dish containing 5 mL culture medium were treated with SNAP-ASO 3 at 0 (negative control), 10, 100 or 1,000 zM.
[0716] [RNA Extraction & cDNA Synthesis by One-step PCR] Following an incubation with SNAP-ASO 3 for 42 hours, the cells were treated with 100 g/mL cycloheximide for another 6 hours in order to freeze the ribosomal translation. Then total RNA was extracted using Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions. 200 ng of RNA template was subjected to a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) against a set of exon-specific primers of [SNAP-exon 1_forward: (5.fwdarw.3) ATGGCCGAGGACGCAGACA (SEQ ID NO: 126); and SNAP-exon 14_reverse: (5.fwdarw.3) AGCATCTTT-GTTGCACGTTG (SEQ ID NO: 127)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 40 cycles of 30 sec at 94 C., 30 sec at 50 C., and 1 min at 72 C.
[0717] [Nested PCR Amplification] 1 L of cDNA was subjected to a 20 L nested PCR reaction (Cat. Number K2612, Bioneer) against a set of exon specific primers of [SNAP-exon 1_forward: (5.fwdarw.3) ATGGCCGAGGACGCAGACA (SEQ ID NO: 128); SNAP-exon 14n_reverse: (5.fwdarw.3) TTGTTGGAGTCAGCGCCT (SEQ ID NO: 129)] according to the following cycle conditions: 95 C. for 2 min followed by 34 cycles of 30 sec at 95 C., 30 sec at 55 C., and 1 min at 72 C.
[0718] [Identification of Exon Skipping Products] The PCR products were subjected to electrophoretic separation on a 2% agarose gel. The bands of target size were collected and analyzed by Sanger Sequencing.
[0719]
[0720] The intensity of the full-length SNAP25 mRNA decreased most in the cells treated with 10 zM SNAP-ASO 3. The full-length mRNA intensity gradually increased to that of the negative control (i.e., without ASO treatment), as the ASO concentration was increased from 10 to 1,000 zM. The inverted dose response pattern in the nested PCR data could be due to a transcription upregulation by the exon intron circular RNA (EIciRNA) accumulated during the exon skipping with SNAP-ASO 3. [Nature Struc. Mol. Biol. vol 22(3), 256-264 (2015)]
SNAP25 Example 2. qPCR for SNAP25 mRNA in PC12 Cells Treated with SNAP-ASO 3
[0721] SNAP-ASO 3 was evaluated by SNAP25 nested qPCR for its ability to induce changes in the rat SNAP25 mRNA level in PC12 cells as follows.
[0722] [Cell Culture & ASO Treatment] PC12 cells grown in 60 mm culture dish containing 5 mL culture medium were treated with SNAP-ASO 3 at 0 (negative control), 10, 100 or 1,000 zM. (2 culture dishes per ASO concentration)
[0723] [RNA Extraction & cDNA Synthesis by One-step RT-PCR] Following an incubation with SNAP-ASO 3 for 42 hours, the cells were treated 100 g/mL cycloheximide for another 6 hours to freeze the ribosomal translation. Then total RNA was extracted from cells using Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions. 200 ng of RNA template was subjected to a 25 L reverse transcription reaction using One Step RT-PCR kit (Invitrogen, USA) against a set of exon-specific primers of [SNAP-exon 1_forward: (5.fwdarw.3) ATGGCCGAGGACGCAGACA (SEQ ID NO: 130); and SNAP-exon 14_reverse: (5.fwdarw.3) AGCATCTTTGTTGCACGTTG (SEQ ID NO: 131)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 20 cycles of 30 sec at 94 C., 30 sec at 55 C., and 1 min at 72 C.
[0724] [Nested qPCR Amplification] 1 L of each cDNA solution diluted by 100 was subjected to a 20 L Real-Time PCR reaction against a set of exon-specific primers of [SNAP-exon 7q_forward: (5.fwdarw.3) ATGGATGAAAACCTAGAGC (SEQ ID NO: 132); and SNAP-exon 8q_reverse: (5.fwdarw.3) CTTCCCAGCATCTTTGTT (SEQ ID NO: 133)] according to the following cycle conditions: 95 C. for 3 min followed by 40 cycles 10 sec at 95 C., and 30 sec at 60 C. The qPCR reaction was followed with a Taqman probe of [(5.fwdarw.3) 5,6-FAM-CAGCCTTCT-ZEN-CCATGATCCT-3IABkFQ (SEQ ID NO: 134)] targeting the junction of exon 7 and exon 8 in order to quantify the full-length SNAP25 mRNA.
[0725]
[0726] The inverted dose response pattern of the qPCR data is consistent fairly much with the dose response pattern of the full-length mRNA level during the exon skipping described in SNAP25 Example 1, suggesting a transcription upregulation as the ASO dose was increased from 10 to 1,000 zM. Thus the 13-mer complementary overlap with the rat SNAP25 pre-mRNA would not be sufficient enough to knock down the transcription upregulation induced by the EIciRNA(s) accumulating during the exon skipping.
SNAP25 Example 3. qPCR for SNAP25 mRNA in PC12 Cells Treated with SNAP-ASO 1
[0727] SNAP-ASO 1 specified in Table 8 is a 16-mer ASO fully complementary to a 16-mer sequence of the 3 splice site spanning the junction of intron 6 and exon 7 in the human SNAP25 pre-mRNA. SNAP-ASO 1 complementarily overlaps with the 16-mer target sequence as marked bold and underlined in the 30-mer human pre-mRNA sequence
TABLE-US-00048 [(5.fwdarw.3)cucuuuggaucccag|GGUAACAAAUGAUGC (SEQIDNO:135)].
SNAP-ASO 1 possesses a 6-mer overlap with intron 6 and a 10-mer overlap with exon 7. However, the ASO possesses a single mismatch with the rat SNAP25 pre-mRNA as marked bold and underlined in the 25-mer pre-mRNA sequence of
TABLE-US-00049 [(5.fwdarw.3)uggcucccag|GGUAACAAACGAUGC (SEQIDNO:136)],
in which with the single mismatch is marked with a quote ( ) sign.
[0728] SNAP-ASO 1 was evaluated by SNAP25 nested qPCR for its ability to induce changes in the rat SNAP25 mRNA level in PC12 cells as described in SNAP25 Example 2, unless noted otherwise.
[0729]
[0730] Like in the case of SNAP-ASO 3, the inverted dose response pattern was partly reproduced with SNAP-ASO 1 as the dose was increased from 10 to 100 zM. Given that the full-length mRNA level decreased further as the ASO concentration was increased to 1,000 zM, however, the exon skipping efficacy of SNAP-ASO 1 appears to be stronger than that of SNAP-ASO 3. The 15-mer complementary overlap of SNAP-ASO 1 with the rat pre-mRNA would be responsible for the higher exon skipping efficacy.
SNAP25 Example 4. Inhibition of SNAP25 Protein Expression in PC12 Cells by SNAP-ASO 3
[0731] SNAP-ASO 3 was evaluated for its ability to inhibit the expression of the SNAP25 protein in PC12 cells as follows.
[0732] PC12 cells were grown in 60 mm culture dish containing 5 mL culture medium, and treated with SNAP-ASO 3 at 0 zM (negative control), 1 zM, 10 zM, 30 zM, 100 zM, 300 zM, 1 aM, 3 aM or 10 aM for 48 hours. There were 4 culture dishes of the negative control to compensate for potential technical artifacts during the western blot analysis.
[0733] [Cell Lysis] Then the cells were subjected to lysis on ice with 200 L 1RIPA buffer (Cat. Number 9806, Cell Signaling Tech) supplemented with 1% SDS and 1 proteinase inhibitors cocktail (cOmplete Mini, Roche). The lysates were collected in 1.5 mL e-tube, mixed with 100 L 5 sample buffer, and boiled for 5 min.
[0734] [Western Blot] The lysates were subjected to electrophoretic separation on a 4-15% TGX-PAGE gradient gel (Cat. Number 456-1086, Bio-Rad) and then transferred onto a 0.45 m PVDF membrane. The membrane was probed with an anti-SNAP25 antibody (Cat. Number S9684, Sigma) and an anti--actin antibody (Cat. Number A3845, Sigma).
[0735]
SNAP25 Example 5. Inhibition of SNAP25 Protein Expression in PC12 Cells by SNAP-ASO 1
[0736] SNAP-ASO 1 was evaluated for its ability to inhibit the SNAP25 protein expression in PC12 cells as described in SNAP25 Example 4, unless noted otherwise. PC12 cells were treated with SNAP-ASO 1 at 0 (negative control), 100 or 1,000 zM either for 48 hours or for 72 hours. (One culture dish for each ASO concentration)
SNAP25 Example 6. Inhibition of SNAP25 Protein Expression in SiMa Cells by SNAP-ASO 3
[0737] SNAP-ASO 3 was evaluated for its ability to inhibit the expression of the SNAP25 protein in SiMa human neuroblastoma cells as follows.
[0738] [Cell Culture and ASO Treatment] SiMa cells (Cat. Number ACC164, DSMZ) were maintained in RPMI 1640 medium supplemented with 10% FBS, 1% streptomycin/penicillin, 1% L-glutamine, and 1% sodium pyruvate under 5% CO.sub.2 atmosphere at 37 C. SiMa cells were grown in 60 mm culture dish containing 5 mL culture medium, and were treated for 48 hours with SNAP-ASO 3 at 0 zM (negative control), 1 zM to 100 aM. There were 3 culture dishes for the negative control to compensate for potential technical artifacts during the western blot analysis.
[0739] [Lysis] The cells were subjected to lysis on ice with 200 L 1RIPA buffer (Cat. Number 9806, Cell Signaling Tech) supplemented with 0.1% SDS and 1 proteinase inhibitors cocktail (cOmplete Mini, Roche). Then the lysates were collected in 1.5 mL e-tube, mixed with 100 L 5 sample buffer, and boiled for 5 min.
[0740] [Western Blot] The lysates were subjected to electrophoretic separation on a 12% SDS-PAGE gel, and transferred onto a 0.2 m polyvinylidene difluoride (PVDF) membrane. The membrane was probed with an anti-SNAP25 antibody (Cat. Number ab41455, Sigma) and an anti--actin antibody (Cat. Number A3845, Sigma).
[0741]
SNAP25 Example 7. qPCR for SNAP25 mRNA in SiMa Cells Treated with SNAP-ASO 3
[0742] SNAP-ASO 3 was evaluated by SNAP25 nested qPCR for its ability to induce changes in the human SNAP25 mRNA level in SiMa cells as follows.
[0743] [Cell Culture & ASO Treatment] SiMa cells were grown in 60 mm culture dish containing 5 mL culture medium, and were treated with SNAP-ASO 3 at 0 zM (negative control), 1 zM, 10 zM, 100 zM or 1 aM, 10 aM, or 100 aM. (2 culture dishes per ASO concentration)
[0744] [RNA Extraction & cDNA Synthesis] Total RNA was extracted from cells using RNeasy Mini Kit (Cat. Number 74106, Qiagen) according to the manufacturer's instructions. 200 ng of RNA template was subjected to a 25 l reverse transcription reaction using PrimeScript 1.sup.st strand cDNA synthesis Kit (Cat. No. 6110B, Takara) against random hexamers.
[0745] [qPCR Amplification] The PCR reactions were monitored with a Taqman probe [(5 3) 56-FAM-CGGCTTCAT-ZEN-CCGCAGGGTAACAA-3IABkFQ (SEQ ID NO: 137)] targeting the junction of exon 6 and exon 7 against a set of exon-specific primers [SNAP-exon 6_forward: (5.fwdarw.3) GACGAACGGGAGCAGATG (SEQ ID NO: 138); and SNAP-exon 8_reverse(2): (5.fwdarw.3) ATCTCATTGCCC-ATATCCAGG (SEQ ID NO: 139)]. Cycle Conditions: 95 C. for 3 min followed by 40 cycles 15 sec at 95 C., and 30 sec at 60 C.
[0746]
SNAP25 Example 8. Inhibition of SNAP25 Protein Expression in the Skin of Mouse Topically Administered with SNAP-ASO 1
[0747] SNAP-ASO 1 is a 16-mer ASO fully complementary to the 3 splice site spanning the junction of intron 6 and exon 7 in the mouse SNAP25 pre-mRNA read out from the mouse genomic DNA [accessed from NCBI Reference Sequence: NC_000068]. SNAP-ASO 1 was evaluated for its ability to inhibit the expression of SNAP25 protein in the skin upon topical administration as follows.
[0748] [Hair Cut and Grouping] In Day 0, 8 female C57BL/6 mice (5 weeks old) were anesthetized with zoletil/rompun, and the hair in the back (ca 3 cm4 cm) was cut with a clipper. The mice were randomly assigned into 4 groups, i.e., no ASO treatment group (negative control) and 3 treatment groups of 1 fM, 10 fM and 100 fM SNAP-ASO 1. (2 animals per group)
[0749] [Topical Administration] Topical solutions were prepared by serially diluting an aqueous stock solution of SNAP-ASO 1 in 30% (v/v) aqueous ethanol supplemented with 3% (v/v) glycerin to 0, 1, 10 and 100 fM SNAP-ASO 1. Each animal was topically administered with ca 100 L of topical solution in the back skin with hair removal using a cotton ball twice per day during Days 0 to 4.
[0750] [Skin Sampling] In the afternoon of Day 4, the animals were anesthetized with zoletil/rompun in order to sample the skin part topically treated with the ASO. The skin samples were then subjected to IHC against the SNAP25 protein as described below.
[0751] [SNAP25 IHC] Skin samples were cryo-sectioned and immunostained in series with a primary anti-SNAP25 antibody (Cat. Number ab41455, Abcam) at 1:200 dilution, with a secondary anti-IgG (Cat Number BA-1100, Vector) at 1:200 dilution, and then with Dylight 594-steptavidin (Cat Number SA-5594, Vector, CA, USA) at 1:200 dilution for red fluoresence tagging. The anti-SNAP25 antibody probes the C-terminal of the SNAP25 protein. IHC images were captured on a Zeiss slide scanner to evaluate the expression of SANP25 protein. DAPI staining was performed to visualize the skin microstructure.
[0752]
[0753] The inhibition of the full-length SNAP25 protein expression in the skin by IHC appears to be stronger than the inhibition by western blot observed in PC12 cells (cf. SNAP25 Example 5). The transcriptional upregulation by the EIciRNA(s) in primary cells, if there is any, dosen't appear to be as marked as the upregulation implicated in cancer cells including PC12 and SiMa cells.
Examples for In Vitro Activity of TYR ASOs
[0754] Tyrosinase (TYR) is an enzyme involved in the melanogenesis or skin pigmentation. PNA derivatives of Formula I in Table 10 were designed to complementarily target the 3 splice site of exon 2 in the human or mouse TYR pre-mRNA. TYR ASOs were evaluated for the TYR antisnese exon skipping activity in human melanocytes as well as in B16F10 (mouse melanoma) cells. Biological examples provided herein are to illustrate the exon skipping activity of TYR ASOs as examples for the compound of Formula I, and therefore should not be interpreted to limit the scope of the current invention to TYR ASOs.
TYR Example 1. Exon Skipping Induced by TYR-ASO 4 in B16F10 Cells
[0755] TYR-ASO 4 specified in Table 10 is a 13-mer TYR ASO fully complementary to the 3 splice site spanning the junction of intron 1 and exon 2 in the mouse TYR as marked bold and underlined in the 30-mer mouse TYR pre-mRNA sequence of
TABLE-US-00050 [(5.fwdarw.3)aauuguuuuucacag|AUCAUUUGUAGCAGA (SEQIDNO:140)].
In the meantime, TYR-ASO 4 possesses 4 mismatches with the 3 splice site spanning the junction of intron 1 and exon 2 in the human TYR pre-mRNA as marked with quote ( ) sign in the 30-mer pre-mRNA sequence of [(5.fwdarw.3) ggguguuuuguacag|AUUGUCUGUAGCCGA (SEQ ID NO: 141)].
[0756] TYR-ASO 4 was evaluated for its ability to induce the skipping of the mouse TYR exon 2 in B.sub.16F10 melanoma cells as follows. TYR-ASO 4 may serve as a good surrogate compound for TYR-ASO 1 which is fully complementary to the human TYR pre-mRNA.
[0757] [Cell Culture & ASO Treatment] B16F10 mouse melanoma cells (Cat. Number CRL-6475, ATCC) were maintained in DMEM (Dulbecco's modified Eagle's essential minimum medium) supplemented with 10% FBS, 1% streptomycin/penicillin, and 0.01 mg/ml bovine insulin. B16F10 cells grown in 60 mm culture dish containing 5 mL DMEM were incubated for 5 hours with TYR-ASO 4 at 0 (negative control), 1, 10, 100 or 1000 aM.
[0758] [RNA Extraction & cDNA Synthesis by One-step PCR] Total RNA was extracted using Universal RNA Extraction Kit (Cat. Number 9767, Takara) according to the manufacturer's instructions. 200 ng of RNA template was used for a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. Number 10928-042, Invitrogen) against a set of exon-specific primers of [TYR-exon 1_forward: (5.fwdarw.3) GTAAGTTTGGATTTGGGG (SEQ ID NO: 142); and TYR-exon 4_reverse: (5.fwdarw.3) AGAGCGGTATGAAAGGAA (SEQ ID NO: 143)] according to the following cycle conditions: 50 C. for 30 min and 94 C. for 2 min, which was followed by 15 cycles of 30 sec at 94 C., 30 sec at 52 C., and 40 sec at 72 C.
[0759] [Nested PCR Amplification] 1 L of cDNA was further amplified in a 20 L nested PCR reaction (Cat. Number K2612, Bioneer) against a set of exon-specific primers of [TYR-exon 1n_forward: (5.fwdarw.3) GAGAACTAACTGGGGATGA (SEQ ID NO: 144); and TYR-exon 4n_reverse: (5.fwdarw.3) CGATAGGTGCATTGGCTT (SEQ ID NO: 145)] according to the following cycle conditions: 95 C. for 5 min followed by 30 cycles of 30 sec at 95 C., 30 sec at 52 C., and 40 sec at 72 C.
[0760] [Identification of Exon Skipping Products] The PCR products were subjected to electrophoretic separation on a 2% agarose gel. The bands of target size were collected and analyzed by Sanger Sequencing.
[0761]
[0762] The PCR product for the exon skipping was sequenced to be the mRNA splice variant lacking exons 2-3 as shown in
TYR Example 2. qPCR for TYR mRNA in B16F10 Cells Treated with TYR-ASO 4
[0763] TYR-ASO 4 was evaluated by TYR nested qPCR for its ability to induce changes in the mouse TYR mRNA level in B16F10 cells as follows.
[0764] [Cell Culture & ASO Treatment] B16F10 cells grown in 60 mm culture dish containing 5 mL culture medium were treated with TYR-ASO 4 at 0 (negative control), 1, 10, 100 or 1000 aM. (2 culture dishes per dose)
[0765] [RNA Extraction & cDNA Synthesis by One-step PCR] Total RNA was extracted and subjected to cDNA synthesis as described in TYR Example 1.
[0766] [Nested qPCR Amplification] 1 L of each cDNA solution diluted by 100 was subjected to a 20 L Real-Time PCR reaction against a Taqman probe set targeting the junction of exon 2 and exon 3 (Cat. No. Mm00495818_m1, Thermo Fisher Scientific) according to the following cycle conditions: 95 C. for 3 min followed by 30 cycles 10 sec at 95 C., and 30 sec at 60 C.
[0767] [Statistical Analysis] The nested qPCR experiment was repeated independently four times, and individual mRNA levels from each experiment were normalized against the mRNA level without ASO treatment. The mRNA levels obtained from all the 4 separate experiments were pooled for statistical analysis by student's t-test. Thus the number of RNA samples is 8 per ASO concentration.
[0768]
TYR Example 3. Inhibition of TYR Protein Expression by TYR-ASO 4 in B.SUB.16.F10 Cells
[0769] TYR-ASO 4 was evaluated for its ability to inhibit the expression of TYR protein inB16F10 cells as described below.
[0770] B16F10 cells grown in 60 mm culture dish containing 5 mL culture medium were treated with TYR-ASO 4 for 24 hours at 0 zM (negative control), 10 zM, 100 zM, 1 aM or 10 aM, and subjected to lysis with 200 L 1 cell lysis buffer (Cat. No. 9803, Cell Signaling Tech) supplemented with 1 protease inhibitors cocktail (Cat. No. P8340, Sigma). 200 L of each lysate was mixed with 100 L 5 sample buffer, and boiled at 100 C. for 5 min. 20 L of each lysate was subjected to electrophoretic separation on a 4-15% gradient TGX gel (Cat No. 456-1086, Bio-Rad), and protein transfer onto a 0.45 m PVDF membrane. The membrane was probed with an anti-TYR antibody (Cat. No. 9319, Cell Signaling Tech) and an anti-3-actin antibody (Cat. No. a3845, Sigma).
[0771]
TYR Example 4. Inhibition of Melanogenesis by TYR-ASO 4 in B16F10 Cells
[0772] TYR-ASO 4 was evaluated for its ability to inhibit the melanogenesis in B16F10 cells as described below.
[0773] B16F10 cells grown in 60 mm culture dish containing 5 mL culture medium were treated either with TYR-ASO 4 at 0 (negative control) or 1 to 1,000 aM, or with 10 or 100 g/mL arbutin as a positive control. (2 culture dishes per dose) 24 hours later, the cells were subjected to lysis with 200 L 1N NaOH. Each lysate was collected in 1.5 mL e-tube, and kept overnight at room temperature. The melanin content in each lysate was determined by absorbance at 475 nm on an ELISA reader. The experiment was repeated four times using cells at different passage. The four sets of the melanin content data were pooled for statistical analysis by student's t-test against the melanin content without treatment (negative control).
[0774]
TYR Example 5. qPCR for TYR mRNA in Human Melanocytes Treated with TYR-ASO 1
[0775] TYR-ASO 1 specified in Table 10 is a 13-mer TYR ASO fully complementary to the 3 splice site spanning the junction of intron 1 and exon 2 in the human TYR as marked bold and underlined in the 30-mer human TYR pre-mRNA sequence of
TABLE-US-00051 [(5.fwdarw.3)ggguguuuuguacag|AUUGUCUGUAGCCGA (SEQIDNO:146)].
[0776] TYR-ASO 1 was evaluated by TYR nested qPCR for its ability to induce changes in the TYR mRNA level in human primary epidermal melanocytes as follows.
[0777] [Cell Culture & ASO Treatment] Primary epidermal melanocytes (Cat. Number PCS-200-013, ATCC) cells were maintained in Dermal Cell Basal Medium (Cat Number PCS-200-030, ATCC) supplemented with Adult Melanocyte Growth Kit Component (Cat. Number PCS-200-042, ATCC). Melanocytes grown in 60 mm culture dish containing 5 mL culture medium were treated with TYR-ASO 1 at 0 zM (negative control), 1 zM, 100 zM, or 10 aM. (3 culture dishes per concentration)
[0778] [RNA Extraction & cDNA Synthesis by One-step PCR] Following an incubation with TYR-ASO 1 for 5 hours, total RNA was extracted using RNeasy Mini Kit (Cat. Number 74106, Qiagen) according to the manufacturer's instructions. 200 ng of RNA template was subjected to a 25 L reverse transcription reaction using Super Script One-Step RT-PCR kit with Platinum Taq polymerase (Cat. No. 10928-042, Invitrogen) against a set of exon-specific primers of [TYR-exon 1_forward(2): (5.fwdarw.3) CTCTTTGTCTGGATGCATT (SEQ ID NO: 147); and TYR-exon 5_reverse: (5.fwdarw.3) CTGTGGTAATCCTCTTTCT (SEQ ID NO: 148)] according to the following cycle conditions specified: 50 C. for 30 min and 94 C. for 2 min, which was followed by 15 cycles of 30 sec at 94 C., 30 sec at 50 C., and 1 min at 72 C.
[0779] [Nested PCR Amplification] 1 L of cDNA was further amplified in a 20 L nested PCR reaction (Cat. No. K2612, Bioneer) against a set of exon-specific primers of [TYR-exon 2n_forward: (5.fwdarw.3) GATAAAGCTGCCAATTTC (SEQ ID NO: 149); and TYR-exon 3n_reverse: (5.fwdarw.3) TTGTGCATGCTGCTTTGA (SEQ ID NO: 150)] against a Taqman probe [(5.fwdarw.3) 5,6-FAM-CACTGG-ZEN-AAGGATTTGCTAGTCCAC-3IABkFQ (SEQ ID NO: 151)]. Cycle Conditions: 95 C. for 3 min followed by 40 cycles 10 sec at 95 C., and 30 sec at 60 C.
[0780]
Examples for Biological Activities of PD-1 ASOs
[0781] PD-1, also known as programmed cell death protein 1 or CD279, is a cell surface receptor expressed in immune cells. PD-1 is an immune check-point protein involved in the down-regulation of the immune response. PD-1 monoclonal antibodies such as nivolumab and pembrolizumab have been used to treat solid tumors by increasing the immune response.
[0782] PD-1 ASOs of Formula I in Table 11 were designed to complementarily target either the 3 splice site or the 5 splice site of exon 2 in the human or mouse PD-1 pre-mRNA. PD-1 ASOs were evaluated for the antisnese exon skipping activity in Jurkat cells, and also for the antitumor activity in wild type mice loaded with syngenic tumor. Biological examples provided herein are to illustrate the exon skipping activity of PD-1 ASOs as examples for the compound of Formula I, and therefore should not be interpreted to limit the scope of the current invention to PD-1 ASOs.
PD-1 Example 1. Exon Skipping Induced by PD-ASO 3 in Jurkat Cells
[0783] PD-ASO 3 specified in Table 11 is a 14-mer PD-1 ASO fully complementary to the 5 splice site spanning the junction of exon 2 and intron 2 in the human PD-1 pre-mRNA as marked bold and underlined in the 30-mer human PD-1 pre-mRNA sequence of
TABLE-US-00052 [(5.fwdarw.3)AGCUCAGGGUGACAG|gugcggccucggagg (SEQIDNO:152)].
PD-ASO 3 possesses a 9-mer overlap with exon 2 and a 5-mer overlap with intron 2.
[0784] PD-ASO 3 was evaluated for its ability to induce the skipping of the human PD-1 exon 2 in Jurkat cells as follows.
[0785] [Cell Culture & ASO Treatment] Jurkat cells (Cat. Number TIB-152, ATCC) were maintained in RPMI-1640 supplemented with 10% FBS and 1% streptomycin/penicillin. Jurkat cells grown in 60 mm culture dish containing 5 mL culture medium were treated for 5 hours with PD-ASO 5 at 0 (negative control), 10, 100 or 1,000 aM.
[0786] [RNA Extraction and cDNA Synthesis by One Step RT-PCR] Total RNA was extracted using RNAeasy mini prep kit (Qiagen, USA) according to the manufacturer's protocol. 500 ng of RNA template was subjected to a 25 L reverse transcription reaction using One Step RT-PCR kit (Invitrogen, USA) against a set of exon-specific primers [PD-exon 1_forward: (5.fwdarw.3) GTCGTCTGGGCGGTGCTACAAC (SEQ ID NO: 153); and PD-exon 5_reverse: (5.fwdarw.3) GGGTGTGGAA-ATAGATGGG (SEQ ID NO: 154)]. Cycle conditions: 50 C. for 30 minutes and 94 C. for 2 minutes, which was followed by 30 cycles of 30 seconds at 94 C., 30 seconds at 53 C., and 1 minutes at 72 C.
[0787] [Nested PCR Amplification] 1 L of cDNA diluted by 100 was further amplified in a 20 L nested PCR (Invitrogen, USA) using the following cycle conditions: 20 seconds at 95 C., 30 seconds at 56 C., and 40 seconds at 72 C. for 40 cylces against a set of exon-specific primers [PD-exon 1n_forward: (5.fwdarw.3) GGCTGGCGGCCAGGATGGTTC (SEQ ID NO: 155); and PD-exon 5n_reverse: (5.fwdarw.3) GAAAGACAATGGTGGCATACTCC (SEQ ID NO: 156)].
[0788] [Identification of Exon Skipping Products] The resulting nested PCR products were subjected to electrophoretic separation on a 2% agarose gel. The bands of target size were collected and analyzed by Sanger sequencing.
[0789]
[0790] The cells treated with PD-ASO 3 at 10 and 100 aM yielded a PCR product band corresponding to the skipping of exon 2 by Sanger sequencing. In the cells treated with 1,000 aM PD-ASO 3, however, the PCR product of exon 2 skipping disappeared and the full-length mRNA level was higher than the full-length level in the cells treated at the lower ASO concentrations. The two PCR products assigned to the skipping of exon 2 and exon 3 were confirmed by Sanger sequencing. (cf.
PD-1 Example 2. qPCR for PD-1 mRNA in Jurkat Cells Treated with PD-ASO 3
[0791] PD-ASO 3 was evaluated by PD-1 nested qPCR for its ability to induce changes in the human PD-1 mRNA level in Jurkat cells as follows.
[0792] [Cell Culture & ASO Treatment] Jurkat cells grown in 60 mm culture dish were activated with an anti-CD3 antibody (Cat. Number 16-0037, eBioscience) at 1 g/mL and an anti-CD28 antiobody (Cat. No. 16-0289, eBioscience) at 0.5 g/mL for 48 hours. Then the culture medium was replaced with fresh medium, and treated with PD-ASO 3 at 0 (negative control), 10, 100 or 1,000 aM for 24 hours. (4 culture dishes per ASO concentration)
[0793] [RNA Extraction and cDNA Synthesis by One Step RT-PCR] Total RNA was extracted using RNAeasy mini prep kit (Qiagen, USA) according to the manufacturer's protocol. 500 ng of RNA template was subjected to a 25 L reverse transcription reaction using One Step RT-PCR kit (Invitrogen, USA) against a set of exon-specific primers [PD-exon 1_forward: (5.fwdarw.3) GTCGTCTGGGCGGTGCTACAAC (SEQ ID NO: 157); and PD-exon 5_reverse: (5.fwdarw.3) GGGTGTGGAA-ATAGATGGG (SEQ ID NO: 158)]. Cycle conditions: 50 C. for 30 minutes and 94 C. for 2 minutes, which was followed by 30 cycles of 30 seconds at 94 C., 30 seconds at 53 C., and 1 minutes at 72 C.
[0794] [Nested qPCR by SYBR] 1 L of each cDNA solution diluted by 100 was subjected to a 20 L nested qPCR amplifications against a set of exon-specific primers [PD-exon 2_forward: (5.fwdarw.3) ACAACGCCACCTTCACCTGC (SEQ ID NO: 159); and PD-exon 2_reverse: (5.fwdarw.3) GCCAGCTTGTCCGTCTGGTTG (SEQ ID NO: 160)] according to the following cycle conditions: 20 seconds at 95 C., 30 seconds at 56 C., and 40 seconds at 72 C. for 40 cycles. The qPCR reaction was probed with SYBR (Bio-Rad, USA).
[0795]
PD-1 Example 3. qPCR for IL-2 mRNA in Jurkat Cells Treated with PD-ASO 3
[0796] Down-regulation of the PD-1 activity has been known to upregulate the expression of interleukin 2 (IL-2). [Am. J. Clin. Oncol. Vol 39(1), 98-106 (2016)] PD-ASO 3 was evaluated by IL-2 nested qPCR for its ability to induce changes in the human IL-2 mRNA level in Jurkat cells as follows.
[0797] [Cell Culture & ASO Treatment] Jurkat cells grown in 60 mm culture dish were activated with an anti-CD3 antibody (Cat. Number 16-0037, eBioscience) at 1 g/mL and an anti-CD28 antiobody (Cat. No. 16-0289, eBioscience) at 0.5 g/mL for 48 hours. Then the culture medium was replaced with fresh medium, and treated with PD-ASO 3 at 0 (negative control), 10, 100 or 1,000 aM for 24 hours. (4 culture dishes per ASO concentration)
[0798] [RNA Extraction and cDNA Synthesis] Total RNA was extracted using RNeasy mini prep kit (Qiagen, USA) according to the manufacturer's protocol. 500 ng of RNA template was subjected to a 25 L reverse transcription reaction using PrimeScript 1.sup.st strand cDNA synthesis kit (Takara, Japan) according to the manufacturer's protocol.
[0799] [qPCR by SYBR] 1 L of each cDNA solution was subjected to a 20 L qPCR amplifications against a set of primers targeting the IL-2 mRNA [IL-2_forward: (5.fwdarw.3) GTCACAAACAGTGCACCTAC (SEQ ID NO: 161); and IL-2_reverse: (5.fwdarw.3) GGTGAGTTTGGGATT-CTTGTA (SEQ ID NO: 162)] according to the following cycle conditions: 20 seconds at 95 C., 30 seconds at 56 C., and 40 seconds at 72 C. for 40 cylces. The qPCR reaction was probed with SYBR (Bio-Rad, USA).
[0800]
PD-1 Example 4. qPCR for PD-1 mRNA in Jurkat Cells Treated with PD-ASO 1
[0801] PD-ASO 1 specified in Table 11 is a 14-mer PD-1 ASO fully complementary to the 3 splice site spanning the junction of intron 1 and exon 2 in the human PD-1 pre-mRNA as marked bold and underlined in the 30-mer human PD-1 pre-mRNA sequence of
TABLE-US-00053 [(5.fwdarw.3)cucuccaucucucag|ACUCCCCAGACAGGC (SEQIDNO:163)].
PD-ASO 1 possesses a 5-mer overlap with intron 1 and a 9-mer overlap with exon 2.
[0802] PD-ASO 1 was evaluated by PD-1 nested qPCR for its ability to induce changes in the human PD-1 mRNA level in Jurkat cells as described in PD-1 Example 2, unless noted otherwise.
[0803]
PD-1 Example 5. Antitumor Activity of PD-ASO 2 Against B16F10 Melanoma in C57BL/6 Mice
[0804] PD-ASO 2 specified in Table 11 is a 16-mer PD-1 ASO fully complementary to the 5 splice site spanning the junction of exon 2 and intron 2 in the mouse PD-1 pre-mRNA as marked bold and underlined in the 30-mer mouse PD-1 pre-mRNA sequence of
TABLE-US-00054 [(5.fwdarw.3)AGCUCGUGGUAACAG|gugaggcuaguagaa (SEQIDNO:164)].
PD-ASO 2 possesses a 10-mer overlap with exon 2 and a 6-mer overlap with intron 2.
[0805] In the meantime, PD-ASO 2 possesses four mismatches with the human PD-1 pre-mRNA as marked bold and underlined in the 30-mer human PD-1 pre-mRNA sequence of [(5.fwdarw.3) AGCUCAGGGUGACAG|gugcggccucggagg (SEQ ID NO: 165)], where the four mismatches were marked with the quote ( ) sign. PD-ASO 2 may be taken as surrogate ASO of PD-ASO 3 for the human PD-1 pre-mRNA.
[0806] PD-ASO 2 was evaluated for its antibumor activity in male C57BL/6 mice (4 weeks old) injected with B16F10 melanoma cells as provided below.
[0807] [Innoculation of B16F10 Melanoma Cells] B.sub.16FO1 mouse melanoma cells (Cat. Number CRL-6475, ATCC) were maintained in 150 mm culture dish containing DMEM supplemented with 10% FBS, 1% streptomycin/penicillin, and 0.01 mg/ml bovine insulin. In Day 0, ca 110.sup.5 B.sub.16FO1 cells dissolved in 50 L PBS were injected to each animal at the right rear flank.
[0808] [Grouping & ASO Treatment] In Day 3, the animals were randomly assigned by weight to 4 groups of 0 (negative control), 2, 10 and 50 pmole/Kg PD-ASO 2. (N=15 per group)
[0809] Injection solutions were prepared by serially diluting an aqueous mother stock solution of PD-ASO 2 in PBS to 0 nM (PBS only), 0.4 nM, 2 nM and 12.5 nM PD-ASO 2 for the negative control, 2, 10 and 50 pmole/Kg PD-ASO 2 group, respectively.
[0810] The animals were subcutaneously administered with an injection solution at 5 mL/Kg, 2 per week during Day 3 to Day 17.
[0811] [Anti-tumor Activity] The anti-tumor activity was assessed by changes in the tumor volume between each ASO treatment group and the negative control group.
[0812]
[0813] The strange dose response pattern could be due to a transcription upregulation by the exon intron circular RNA (EIciRNA) accumulated during the exon skipping with PD-ASO 2. [Nature Struc. Mol. Biol. vol 22(3), 256-264 (2015)] Given that nivolumab, a PD-1 monoclonal antibody drug approved by the US FDA, showed a dose response pattern of bell shape in tumor patients [J. Clin. Oncol. Vol 33(18), 2013-2020 (2015)], however, the strange dose response pattern of PD-ASO 2 could be due to the intrinsic pharmacology of PD-1 inhibition.
[0814] In Day 19, the animals were sacrificed to measure the tumor weight by group. The average tumor weights were ca 0.35 g and 1.20 g for the 2 pmole/Kg group and the negative control group, respectively. Thus the tumor growth by weight was significantly inhibited in the 2 pmole/Kg group by ca 70%. (p<0.01 by student's t-test).