Compositions and methods for screening and identifying clinically aggressive prostate cancer
11971411 ยท 2024-04-30
Assignee
- Dana-Farber Cancer Institute, Inc. (Boston, MA, US)
- President And Fellows Of Harvard College (Cambridge, MA)
Inventors
- Curtis Huttenhower (Boston, MA, US)
- TRAVIS GERKE (TAMPA, FL, US)
- CHRISTOPHER SWEENEY (WABAN, MA, US)
- LORELEI MUCCI (NEWTON, MA, US)
- GWO-SHO MARY LEE (NEWTON, MA, US)
- DANIELA BORNIGEN (TOSTEDT, DE)
- XIAODONG WANG (STOUGHTON, MA, US)
- SVITLANA TYEKUCHEVA (BOSTON, MA, US)
- Kristina Jordahl (Seattle, WA, US)
Cpc classification
G01N2800/56
PHYSICS
International classification
Abstract
The present invention provides methods for screening and diagnosing prostate cancer based on a correlation between cancer cell growth, cancer lethality or recurrence and the expression level of ZFP36 or NEDD9 and PTEN in conjunction with ZFP36. The disclosure also provides methods for screening and diagnosing prostate cancer based on a correlation between cancer lethality and the genotype of rs1910301 SNP. Also provided are methods for treating prostate cancer comprising providing a treatment or monitoring based on the expression level of ZFP36, the expression level of NEDD9, and the expression level of ZFP36 in conjunction with PTEN levels or the genotype of rs1910301 SNP.
Claims
1. A method of measuring the expression level of ZFP36 and PTEN in a subject having prostate cancer, the method consisting of: a. measuring the binding of a first probe in a first sample from the subject, wherein the first probe specifically hybridizes to a nucleic acid having the sequence set forth in SEQ ID NO: 2, thereby measuring expression of ZFP36 in the subject, and b. measuring the binding of a second probe in a second sample from the subject, wherein the second probe specifically hybridizes to a nucleic acid having the sequence set forth in SEQ ID NO: 15, 16, or 17, thereby measuring expression of PTEN in the subject.
2. The method of claim 1, wherein the prostate cancer is a primary prostate tumor or a metastatic prostate cancer.
3. The method of claim 1, wherein the subject is a human.
4. The method of claim 1, wherein the sample is from a tumor lesion or comprises circulating tumor cells.
5. The method of claim 1, wherein the first and second sample are the same sample.
6. The method of claim 1, wherein the expression levels of ZFP36 and PTEN are mRNA levels.
7. A method of treating prostate cancer in a subject, comprising: a) providing a biological sample from the subject, b) measuring the expression level of a set of biomarkers consisting of ZFP36 and PTEN in the sample, c) detecting decreased expression levels of the set of biomarkers consisting of ZFP36 and PTEN in the sample as compared to the expression level of ZFP36 and PTEN in control subjects without prostate cancer recurrence, and d) treating the subject from step c) with one or more therapies selected from surgical castration, androgen deprivation therapy, a radiation therapy, an ablation therapy, a chemotherapy, a targeted therapy, or an immunotherapy.
8. The method of claim 7, wherein the prostate cancer is a primary prostate tumor or a metastatic prostate cancer.
9. The method of claim 7, wherein the subject is a human.
10. The method of claim 7, wherein the sample is from a tumor lesion or comprises circulating tumor cells.
11. The method of claim 7, wherein the sample for measuring the expression level of ZFP36 and sample for measuring the expression level of PTEN are the same sample.
12. The method of claim 7, wherein the expression levels of ZFP36 and PTEN are mRNA levels.
Description
BRIEF DESCRIPTION OF FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
DETAILED DESCRIPTION
(19) The present disclosure identifies novel factors associated with prostate cancer progression. A systems biology approach was taken to integrate epidemiological, clinical, pathological and biological data that implicate Nuclear factor kappa B (NF-?B) activation in the development of lethal prostate cancer. A number of NF-?B related genes associated with prostate cancer progression were identified. Among them a lower expression of ZFP36 is strongly associated with a poorer prognosis, including faster cancer cell growth, cancer recurrence and lethality. ZFP36 interacts with NEDD9, another NF-?B related gene whose higher expression is associated with prostate cancer lethality. The expression levels of ZFP36 and NEDD9 are positively correlated. Higher NEDD9 expression is also associated with faster cancer cell growth and cancer recurrence. In addition, the risk allele A of a single nucleotide polymorphism (SNP) rs1910301 is associated with prostate cancer lethality.
(20) In certain embodiments, the expression level of ZFP36 is examined using a sample of prostate cancer that has been removed from a subject by surgery or biopsy. The expression level in the sample from the subject is compared to the level in a control sample. If the ZFP36 level is lower in the sample from the subject, the likelihood of increased tumor load, cancer recurrence and lethality is high, and more aggressive monitoring or treatment of the prostate cancer may be recommended. If the ZFP36 level is about the same or higher in the sample from the subject, the subject is identified to be at a low risk of increased tumor load, cancer recurrence and lethality, in which case no additional monitoring or treatment is needed.
(21) In certain embodiments, the sample is examined while it is scored according to the Gleason pathological grading. In one embodiment, the expression level of ZFP36 is measured by immunohistochemistry. In another embodiment, one or more other tumor antigens (e.g. prostate-specific antigen, PTEN) are examined simultaneously, either by a similar method or by a different method. In some embodiments, a plurality of markers is used to predict prostate cancer prognosis. In certain embodiments, a patient with low grade prostate cancer is identified as a candidate for surgery, radiation or adjuvant therapy such as androgen deprivation therapy rather than a candidate for active surveillance of the localized disease if the expression of ZFP36 is low in the cancer cells, wherein the cancer cells are collected directly from a tumor lesion, from a draining lymph node, or from a body fluid such as blood.
(22) In certain embodiments, the genotype of the SNP rs1910301 is examined using a sample of somatic or germline DNA that has been removed from a subject by swab of buccal mucosa or sample of blood. The genotype of rs1910301 in the sample is measured. If the risk allele A is present, the likelihood of cancer lethality is high and more aggressive monitoring or treatment of the prostate cancer may be recommended. In one embodiment, a man who should be screened for prostate cancer more frequently or starting at an earlier age is identified if he carries the risk allele A. In another embodiment, a patient with low grade prostate cancer is identified as a candidate for surgery, radiation or adjuvant therapy such as androgen deprivation therapy rather than a candidate for active surveillance of his localized disease if he carries the risk allele A. In another embodiment, a patient with low grade prostate cancer is treated with surgery, radiation or adjuvant therapy such as androgen deprivation therapy rather than receiving active surveillance of his localized disease if he carries the risk allele A. If the risk allele A is not detected, the subject is identified to be at a low risk of cancer lethality, in which case less intense monitoring or treatment is needed.
(23) In certain embodiments, the risk assessment based on ZFP36 expression level and/or rs1910301 genotype is followed by a treatment. Where ZFP36 expression level of a sample from a subject is lower than the level of a control sample, and/or if the risk allele A of rs1910301 is present in a sample from a subject, the subject may be treated by an anti-cancer therapy, such as an immunotherapy, a chemotherapy, a targeted therapy, a radiation therapy, an ablation therapy and/or an androgen deprivation therapy rather than receiving an active surveillance of their localized disease even if they are otherwise a candidate for active surveillance by another diagnostic standard.
(24) As used herein, a subject within the context of the present invention encompasses, but is not limited to, a mammal, e g a human, a domestic animal or a livestock including a cat, a dog, a cattle and a horse.
(25) Prostate cancer encompasses, but is not limited to, a primary prostate tumor, metastatic prostate cancer, prostate adenocarcinoma, and neuroendocrine prostate cancer.
(26) A primary prostate tumor encompasses, but is not limited to, a tumor localized in the prostate gland and/or surrounding areas.
(27) Metastatic prostate cancer encompasses, but is not limited to, a cancer of prostate origin that spreads to one or more other parts of the body.
(28) Increased tumor load encompasses, but is not limited to, an increased number of cancer cells, an increased size of a tumor, and/or an increased amount of cancer in the body. The tumor load may be determined by measuring the tumor size and/or by measuring a tumor antigen. A commonly used tumor antigen for prostate cancer is prostate-specific antigen (PSA).
(29) Monitoring the cancer encompasses, but is not limited to, measuring the number of cancer cells, measuring the size of tumor, and/or measuring the amount of cancer in the subject at least once every three months, at least once every six months, at least once a year, or at least once every two years.
(30) Decreased survival of a subject encompasses, but is not limited to, shorter time of survival of a subject.
(31) Recurrence of prostate cancer means the return of prostate cancer after initial treatment and after a period of time during which the cancer cannot be detected. The initial treatment of prostate cancer encompasses, but is not limited to, an androgen deprivation therapy such as a prostatectomy.
(32) A sample encompasses, but is not limited to, a sample from a tumor lesion, a sample from a cancer draining lymph node, a body fluid such as blood, serum, plasma, urine, semen, lymph, and peritoneal fluid.
(33) Circulating tumor cells encompass, but are not limited to, cells with a tumor origin in the circulating blood stream. In certain embodiments, the circulating tumor cells are enriched from the blood.
(34) A tumor lesion encompasses, but is not limited to, a tissue, organ or structure wherein a prostate tumor or prostate cancer locates. It may be in or attached to a prostate, or at a metastatic site.
(35) A control sample encompasses, but is not limited to, a normal prostate tissue obtained from a subject that does not have prostate cancer, wherein the tissue is either fresh or has been preserved in a way that does not significantly affect the abundance of nucleic acids or proteins in the sample. A control sample also encompasses a sample that has been determined to have a similar expression level of ZFP36 and/or NEDD9 compared to a normal prostate tissue.
(36) The expression level of ZFP36 means the amount of ZFP36 mRNA or the amount of ZFP36 protein. The mRNA amount can be measured by polymerase chain reaction (PCR) following reverse transcription, nucleic acid hybridization methods such as microarray, and RNA sequencing methods. The protein amount can be measured by mass spectrometry or by antibody-based methods, such as immunohistochemistry, enzyme-linked immunosorbent assay (ELISA), Western blotting, flow cytometry, and immuno-electron microscopy.
(37) The expression level of ZFP36 in the sample from the subject is lower than the expression level of ZFP36 in the control sample means the amount of ZFP36 mRNA or protein is lower than 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10% of the expression level of ZFP36 in the control sample.
(38) The expression level of ZFP36 in the sample from the subject is about the same as or higher than the expression level of ZFP36 in the control sample means the amount of ZFP36 mRNA or protein is higher than 99%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, 300%, 500% or 1000% of the expression level of ZFP36 in the control sample.
(39) A non-lethal prostate cancer means a prostate cancer that does not lead to mortality of the subject who has the cancer within 1, 2, 5, 10, 20, 30, 40 or 50 years.
(40) Surgical castration encompasses, but is not limited to, orchiectomy i.e. surgical removal of testicles.
(41) Androgen deprivation therapy encompasses, but is not limited to, (1) surgical castration; (2) medical castration e.g. luteinizing hormone-releasing hormone (LHRH) agonists and antagonists, including degarelix, abiraterone, leuprolide, goserelin, triptorelin and histrelin; (3) androgen receptor antagonists including flutamide, bicalutamide, nilutamide, enzalutamide, apalutamide, cyproterone, abiraterone, topilutamide, galeterone, orteronel, BAY1841788, ORM-15341; (4) 5?-reductase inhibitors including finasteride, dutasteride, bexlosteride, izonsteride, turosteride and episteride; and (5) other androgen-suppressing drugs including estrogens, megestrol, chlormadinone, ketoconazole, dexamethasone and prednisone. These compounds can be used in their final non-salt form or in the form of a pharmaceutically acceptable salt, which can be derived from various organic and inorganic acids and bases by procedures known in the art.
(42) A radiation therapy encompasses, but is not limited to, localized therapy of prostate cancer by a certain level of radiation from an external beam and/or internal radioactive seeds placed into the prostate.
(43) An ablation therapy means a therapy that attacks a tumor by exposing the tumor to higher or lower local temperature than a normal body temperature using a probe. The probe is placed into the tumor and mediates the generation of heat or coldness. Ablation therapies encompass, but are not limited to, radiofrequency therapy, cryotherapy, microwave therapy and focused ultrasound therapy.
(44) A chemotherapy means one or more anti-cancer chemical substances. It encompasses, but is not limited to, (1) a mitotic inhibitor e.g. a taxane, an epothilone, a vinca alkaloid, an estramustine, (2) an alkylating agent e.g. a nitrogen mustard, a nitrosourea, an alkyl sulfonate, a triazine, an ethylenimine, (3) an antimetabolite, e.g. 5-fluorouracil, 6-mercaptopurine, capecitabine, cytarabine, floxuridine, fludarabine, gemcitabine, hydroxyurea, methotrexate, pemetrexed, (4) an anti-tumor antibiotic e.g. an anthracycline, actinomycin D, bleomycin, mitomycin C, (5) a topoisomerase inhibitor e.g. topotecan, irinotecan, etoposide, teniposide, mitoxantrone, (6) a corticosteroid e.g. prednisone, methylprednisolone, dexamethasone, and (7) other chemotherapy drugs e.g. L-asparaginase, bortezomib.
(45) A targeted therapy means a therapy designed to act on a specific molecular target associated with cancer to interfere with tumor growth and progression. In certain embodiments, the specific molecular target is expressed at a higher amount in cancer cells than in most non-cancer cells. In certain embodiments, the specific molecular target is expressed in a different form in cancer cells from the form expressed in most non-cancer cells. For instance, the target expressed in cancer cells may be a transcript variant or a mutation. Targeted therapies for prostate cancer encompass, but are not limited to, angiogenesis inhibitors e.g. thalidomide.
(46) An immunotherapy means a therapy designed to use a subject's immune system to treat cancer. It encompasses, but is not limited to, (1) a cancer vaccine e.g. a vaccine containing prostate-specific antigen (PSA), (2) a monoclonal antibody designed to have affinity to cancer cells, and (3) an immune checkpoint inhibitor e.g. an anti-CTLA-4 antibody, an anti-PD-1 antibody, an anti-PD-L1 antibody.
(47) A method not dependent on the expression level of ZFP36 encompasses, but is not limited to, examination of tumor load, examination of Gleason score, examination of one or more biomarkers. The biomarkers include but are not limited to PTEN.
(48) An increased frequency means a higher frequency of prostate cancer screening than the frequency at which a subject not identified to be at risk is screened. It also encompasses using one or more screening method different from the method by which a subject not identified to be at risk is screened.
(49) An earlier age means an earlier age than the age at which a subject not identified to be at risk starts to receive prostate cancer screening. In certain embodiments, the age at which a subject not identified to be at risk starts to receive prostate cancer screening is 40, 45, 50, 55, 60, 65, or 70 years of age.
(50) A method not dependent on the expression level of NEDD9 encompasses, but is not limited to, examination of tumor load, examination of Gleason score, examination of one or more biomarkers. The biomarkers include but are not limited to PTEN.
(51) A method not dependent on the genotype of rs1910301 encompasses, but is not limited to, examination of tumor load, examination of Gleason score, examination of one or more biomarkers. The biomarkers include but are not limited to PTEN.
(52) The expression level of NEDD9 means the amount of NEDD9 mRNA or the amount of NEDD9 protein. The mRNA amount can be measured by polymerase chain reaction (PCR) following reverse transcription, nucleic acid hybridization methods such as microarray, and RNA sequencing methods. The protein amount can be measured by mass spectrometry or by antibody-based methods, such as immunohistochemistry, enzyme-linked immunosorbent assay (ELISA), Western blotting, flow cytometry, and immuno-electron microscopy.
(53) The expression level of NEDD9 in the sample from the subject is lower than the expression level of NEDD9 in the control sample means the amount of NEDD9 mRNA or protein is lower than 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10% of the expression level of NEDD9 in the control sample.
(54) The expression level of NEDD9 in the sample from the subject is about the same as or higher than the expression level of NEDD9 in the control sample means the amount of NEDD9 mRNA or protein is higher than 99%, 100%, 110%, 120%, 130%, 140%, 150%, 200%, 300%, 500% or 1000% of the expression level of NEDD9 in the control sample.
(55) A reagent for reverse transcription of an RNA molecule encompasses, but is not limited to, a reverse transcriptase, an RNase inhibitor, a primer that hybridizes to an mRNA sequence, a primer that hybridizes to an adenosine oligonucleotide, and a buffer solution that provides a suitable chemical environment for optimum activity, binding kinetics, and stability of the reverse transcriptase. The reagents can be provided in the form of a solution, a concentrated solution, or powder.
(56) A primer refers to a short, single-stranded DNA sequence that binds to a target DNA sequence and enables addition of new deoxyribonucleotides by DNA polymerase at the 3 end. In certain embodiments, the forward primer is 18-35, 19-32 or 21-31 nt in length. The nucleotide sequence of the forward primer is not limited, so long as it specifically hybridizes with part of or an entire target site, and its Tm value may be within a range of 50? C. to 72? C., in particular may be within a range of 58? C. to 61? C., and may be within a range of 59? C. to 60? C. The nucleotide sequence of the primer may be manually designed to confirm the Tm value using a primer Tm prediction tool.
(57) A reagents for amplification of a DNA sequence includes, but is not limited to, (1) a heat-stable DNA polymerase, (2) deoxynucleotide triphosphates (dNTPs), (3) a buffer solution, providing a suitable chemical environment for optimum activity, binding kinetics, and stability of the DNA polymerase, (4) bivalent cations such as magnesium or manganese ions, and (5) and monovalent cations, such as potassium ions. The reagents can be provided in the form of a solution, a concentrated solution, or powder. The target DNA sequence can be amplified by polymerase chain reaction (PCR). PCR relies on thermal cycling, which consists of cycles of repeated heating and cooling of the reaction for DNA denaturation, annealing and enzymatic elongation of the amplified DNA. First, the strands of the DNA are separated at a high temperature in a process called DNA melting or denaturing. Next, the temperature is lowered, allowing the primers and the strands of DNA to selectively anneal, creating templates for the polymerase to amplify the target DNA. Next, at a working temperature of the DNA polymerase, template-dependent DNA synthesis occurs. These steps are repeated.
(58) A polynucleotide that hybridizes to the sense or antisense strand of the amplified DNA target, wherein the polynucleotide is conjugated to a detectable moiety encompasses, but is not limited to, a polynucleotide about 18-35, 19-32 or 21-31 nt in length that can hybridize to a PCR product of DNA target amplification. The detectable moiety encompasses, but is not limited to, a fluorescent agent, a catalyst that catalyzes a luminescent reaction, and a catalyst that catalyzes a colorimetric reaction. The detectable moiety is either exposed or masked upon the binding of the polynucleotide to the PCR product of DNA target amplification.
(59) A polynucleotide comprising the rs1910301 risk allele A encompasses, but is not limited to, a polynucleotide about 18-35, 19-32 or 21-31 nt in length that can hybridize to a DNA target comprising rs1910301, wherein the hybridization binding affinity is decreased where the DNA target comprises an allele other than the risk allele A.
(60) A detectable moiety encompasses, but is not limited to, a fluorescent agent, a catalyst that catalyzes a luminescent reaction, and a catalyst that catalyzes a colorimetric reaction. The detectable moiety is either exposed or masked upon the hybridization of the polynucleotide to the DNA target.
(61) An antibody that is capable of binding to ZFP36 encompasses, but is not limited to, an anti-ZFP36 antiserum, an anti-ZFP36 polyclonal antibody, an anti-ZFP36 monoclonal antibody, an antigen-binding fragment of an anti-ZFP36 antibody, a variable fragment of an anti-ZFP36 antibody, and a protein that binds to ZFP36 specifically.
(62) An antibody that is capable of binding to NEDD9 encompasses, but is not limited to, an anti-NEDD9 antiserum, an anti-NEDD9 polyclonal antibody, an anti-NEDD9 monoclonal antibody, an antigen-binding fragment of an anti-NEDD9 antibody, a variable fragment of an anti-NEDD9 antibody, and a protein that binds to NEDD9 specifically.
(63) A reagent for the detection of an antibody encompasses, but is not limited to, a fluorescent agent, a catalyst that catalyzes a luminescent reaction, a catalyst that catalyzes a colorimetric reaction, and an electron-dense agent. The reagents may be linked to the antibody covalently or associated with the antibody noncovalently through an intermolecular interaction or through one or more intermediates. The intermediate includes an agent comprising a moiety that binds to the antibody.
(64) By RNA is meant a sequence of two or more covalently bonded, naturally occurring or modified ribonucleotides. One example of a modified RNA included within this term is phosphorothioate RNA.
(65) By DNA is meant a sequence of two or more covalently bonded, naturally occurring or modified deoxyribonucleotides.
(66) By a nucleic acid is meant any two or more covalently bonded nucleotides or nucleotide analogs or derivatives. As used herein, this term includes, without limitation, DNA, RNA, and PNA. The term nucleic acid may include a modified nucleic acid, and, accordingly, nucleic acid and modified nucleic acid may be used interchangeably.
(67) Genomic DNA encompasses, but is not limited to, a chromosomal DNA or a fragment thereof, and a nucleic acid (e.g., DNA) amplified from (e.g., by polymerase chain reaction) a chromosomal DNA or a fragment thereof.
(68) Furthermore, in accordance with the present disclosure there may be employed conventional molecular biology, microbiology, and recombinant DNA techniques within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Sambrook, Fritsch & Maniatis, Molecular Cloning: A Laboratory Manual, Second Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York (herein Sambrook et al., 1989); DNA Cloning: A Practical Approach, Volumes I and II (D. N. Glover ed. 1985); Oligonucleotide Synthesis (M. J. Gait ed. 1984); Nucleic Acid Hybridization [B. D. Hames & S. J. Higgins eds. (1985)]; Transcription And Translation [B. D. Hames & S. J. Higgins, eds. (1984)]; Animal Cell Culture [R. I. Freshney, ed. (1986)]; Immobilized Cells And Enzymes [IRL Press, (1986)]; B. Perbal, A Practical Guide To Molecular Cloning (1984); F. M. Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (1994).
(69) The present disclosure also provides recombinant expression vectors which include the synthetic, genomic, or cDNA-derived nucleic acid fragments of the invention, i.e. polynucleotides encoding the proteins of the invention. The nucleotide sequence coding for any of the sequences provided herein can be inserted into an appropriate expression vector, i.e., a vector that contains the necessary elements for the transcription and translation of the inserted protein-coding sequence. The necessary transcriptional and translational signals can also be supplied by the native or source gene and/or its flanking regions.
(70) A variety of host vector systems may be utilized to express the recombinant expression vectors of the invention. These include, but are not limited to, mammalian cell systems infected with recombinant virus (e.g., vaccinia virus, adenovirus, retroviruses, etc.); mammalian cell systems transfected with recombinant plasmids; insect cell systems infected with recombinant virus (e.g., baculovirus); microorganisms such as yeast containing yeast expression vectors, or bacteria transformed with recombinant bacteriophage DNA, recombinant plasmid DNA, or cosmid DNA (see, for example, Goeddel, 1990).
(71) Mammalian expression vectors may comprise non-transcribed elements such as origin of replication, a suitable promoter and enhancer linked to the recombinant nucleic acid to be expressed, and other 5 or 3 flanking sequences such as ribosome binding sites, a polyadenylation sequence, splice donor and acceptor sites, and transcriptional termination sequences.
(72) The transcriptional and translational control sequences in mammalian expression vector systems to be used in transforming vertebrate cells may be provided by viral sources. For example, commonly used promoters and enhancers are derived from Polyoma virus, Adenovirus, Simian Virus 40 (SV40), and human cytomegalovirus, including the cytomegalovirus immediate-early gene 1 promoter and enhancer (CMV).
(73) The following examples are provided to further elucidate the advantages and features of the present application, but are not intended to limit the scope of the application. The examples are for illustrative purposes only.
EXAMPLES
Example 1: Gene Expression Data Revealed NF-?B Networks in Multiple Biological Contexts
(74) To determine whether a set of genes and/or proteins indicative of NF-?B activation were associated with lethal prostate cancer, whole genome expression profiling and analysis of lethal versus non-lethal prostate cancer was performed. Datasets from 18 curated prostate cancer expression datasets, GEO (Barrett et al., 2009), ArrayExpress (Parkinson et al., 2009) and non-condition-specific genomic data such as physical and genetic interactions from BioGRID (Breitkreutz et al., 2008) and IntAct (Kerrien et al., 2007), transcriptional regulatory relationships from Transfac (Matys et al., 2006) and cisRED (Robertson et al., 2006), and miRNA data from miRBase (Griffiths-Jones, 2006) were integrated. NF-?B related genes were enriched and networks were built. This data-mining process is illustrated in
(75) NF-?B networks were also generated for distinct biological processes. 11 networks were developed and analyzed, among which four are shown in
(76) The ability of the NF-?B context specific networks to predict biomolecular mechanisms in pathway-specific functional relationship networks in prostate cancer was assessed using receiver operating characteristic (ROC) curves. 7 of 8 predictions achieved areas under curve (AUCs) over 0.7 for all specific mechanistic interaction types and over 0.75 for general functional associations, both using 10-fold gene-holdout-based cross-validations. The cell death network included several highest-confidence links between NF-?B and characterized examples such as CCL217 (regulatory), HDAC118 (phosphorylation) and IKBKB19 (physical). This computational method can integrate thousands of experimental results and to identify those data most informative regarding specific putative mechanisms of interaction in pathways surrounding genes of interest in cancer.
Example 2: NF-?B Related Genes were Identified to be Associated with Lethal Prostate Cancer
(77) Genes associated with lethal prostate cancer were identified in a database of patients from the Physicians Health Study with clinical annotation connected to gene expression profile data developed from a 6,096 gene DASL platform. 217 of the 351 genes from the context specific networks were on the 6,096 gene DASL. An assessment of the differential gene expression was done of the 217 NF-?B related genes to identify genes associated with lethal prostate cancer. There were 115 PHS patients (83 indolent, 32 lethal). The DASL data was presented as difference between the mean log expression in the lethal group and in the indolent group, and a minus result indicated a lower expression level in the lethal group than in the indolent group. Differential gene expression was inferred using the limma software package linear model for microarray data. An analysis was performed with or without Gleason grade as an additional covariate.
(78) The PHS subset without Gleason grade as a covariate was analyzed first. 186 of the 6096 genes on the DASL platform were differentially expressed between men who underwent a prostatectomy and relapsed and died of prostate cancer (N=32 lethal disease) compared with those who did not relapse after a prostatectomy or had an indolent disease that did not require a prostatectomy (N=83 non-lethal disease). FDR correction was performed using Benjamini-Hochberg method. 19 of these genes were associated with the NF-?B network (Table 1).
(79) TABLE-US-00001 TABLE 1 NF-?B related genes differentially expressed in lethal versus indolent prostate cancer identified from the PHS subset when analyzed without Gleason score as a covariate. logFC t adj P Val rank observed score FOSB ?1.22 ?5.53 0.00 11.00 ?1.00 ZFP36 ?1.07 ?5.46 0.00 12.00 ?1.00 ATF3 ?0.96 ?5.22 0.00 15.00 ?1.00 EGR2 ?1.11 ?5.13 0.00 18.00 ?1.00 JUNB ?0.81 ?4.98 0.00 25.00 ?1.00 NR4A3 ?1.19 ?4.65 0.00 35.00 ?1.00 SELE ?0.83 ?4.41 0.00 46.00 ?1.00 FOSL2 ?0.39 ?4.25 0.00 52.00 ?1.00 BTG2 ?0.39 ?4.20 0.01 58.00 ?1.00 HBEGF ?0.65 ?4.11 0.01 66.00 ?1.00 SFRP1 ?0.79 ?4.01 0.01 73.00 ?1.00 NEDD9 ?0.48 ?3.85 0.01 85.00 ?1.00 CXCL2 ?0.81 ?3.80 0.01 96.00 ?1.00 DUSP5 ?0.76 ?3.72 0.02 112.00 ?1.00 TRIB1 ?0.35 ?3.64 0.02 124.00 ?1.00 CX3CL1 ?0.60 ?3.61 0.02 127.00 ?1.00 IL1B ?0.57 ?3.48 0.03 143.00 ?1.00 NPR3 ?0.80 ?3.47 0.03 145.00 ?1.00 CEBPD ?0.53 ?3.46 0.03 148.00 ?1.00
(80) The Swedish subset without Gleason grade as a covariate was also analyzed. 129 genes were differentially expressed at 0.05 FDR level between lethal and indolent subgroups. FDR correction was performed using Benjamini-Hochberg method. 3 genes were found significant in our analysis of the 271 NF-?B gene set (Table 2). Of note, the tissues analyzed from this analysis were obtained by transurethral resection of the prostate (TURP). The patients had a disease arising from the central gland with a different biology to a disease from peripheral portions of the prostate gland. Patients in this data-set were also managed with watchful waiting and did not undergo a prostatectomy.
(81) TABLE-US-00002 TABLE 2 NF-?B related genes differentially expressed in lethal versus indolent prostate cancer identified from the Swedish subset when analyzed without Gleason Grade as a covariate. logFC t adj P Val rank observed score SLC39A8 ?0.35 ?4.20 0.01 28.00 ?1.00 SLCO2A1 0.30 4.13 0.01 30.00 1.00 KLF10 0.22 3.96 0.01 41.00 1.00
(82) The PHS cohort for discovery of a set of cancer-promoting NF-?B related genes was selected for focus because the PHS cohort represented the more commonly ascertained tissue of prostatectomy and transrectal ultrasonography of the prostate (TRUS) biopsy. On account of trying to improve on the prognostic ability of Gleason Score, analysis with Gleason Grade as a covariate in the PHS prostatectomy series was performed. Gleason scores were recoded as low (<7), med (=7), and high (>7). 0 out of 6096 genes represented on a DASL platform were differentially expressed at 0.05 FDR level between lethal and indolent subgroups in this analysis. FDR correction was performed using Benjamini-Hochberg method. When no multiple testing correction was applied, there were 384 differentially expressed genes with p-values below 0.05. 31 of these genes belonged to the NF-?B 271 gene set (Table 3). Of the 19 genes differentially expressed with FDR correction and identified without Gleason as a covariate, 18 overlapped with the 31 differentially expressed genes. The following tumor suppressors to be lost in lethal prostate cancer were identified: CCAAT/enhancer-binding protein delta (CEBPD), dual specificity protein phosphatase 5 (DUSPS), secreted frizzled-related protein 1 (SFRP1), neuron-derived orphan receptor 1 (NOR1, also known as NR4A3) and tristetraprolin (TTP, also known as zinc finger protein 36 homolog or ZFP36).
(83) TABLE-US-00003 TABLE 3 NF-?B related genes differentially expressed in lethal versus indolent prostate cancer identified from the PHS subset when analyzed with Gleason Grade as a covariate without applying multiple testing correction. P adj observed logFC t Value P Val rank sec ZFP36 ?0.82 ?3.36 0.00 0.31 20.00 ?1.00 JUNB ?0.68 ?3.34 0.00 0.31 22.00 ?1.00 IL1B ?0.68 ?3.31 0.00 0.33 23.00 ?1.00 FOSB ?0.88 ?3.23 0.00 0.38 24.00 ?1.00 ATF3 ?0.74 ?3.20 0.00 0.38 26.00 ?1.00 KLF6 ?0.76 ?3.17 0.00 0.38 31.00 ?1.00 GPX2 0.54 3.11 0.00 0.44 33.00 1.00 EGR2 ?0.82 ?3.06 0.00 0.45 37.00 ?1.00 NR4A3 ?0.95 ?2.96 0.00 0.48 46.00 ?1.00 OAS2 0.62 2.93 0.00 0.50 49.00 1.00 CEBPD ?0.54 ?2.78 0.01 0.55 70.00 ?1.00 ENPP1 ?0.54 ?2.74 0.01 0.57 76.00 ?1.00 HBEGF ?0.52 ?2.64 0.01 0.61 89.00 ?1.00 CDC42EP4 ?0.53 ?2.58 0.01 0.61 104.00 ?1.00 DUSP6 ?0.55 ?2.57 0.01 0.61 110.00 ?1.00 ITGA5 ?0.69 ?2.55 0.01 0.61 115.00 ?1.00 BTG2 ?0.30 ?2.54 0.01 0.61 122.00 ?1.00 SFRP1 ?0.61 ?2.50 0.01 0.62 134.00 ?1.00 DUSP5 ?0.64 ?2.50 0.01 0.62 136.00 ?1.00 FOSL2 ?0.28 ?2.48 0.01 0.62 144.00 ?1.00 SELE ?0.57 ?2.46 0.02 0.62 149.00 ?1.00 MKNK1 0.53 2.43 0.02 0.64 156.00 1.00 CX3CL1 ?0.50 ?2.43 0.02 0.65 157.00 ?1.00 ARHGEF7 ?0.38 ?2.30 0.02 0.68 209.00 ?1.00 BCL6 0.62 2.29 0.02 0.68 216.00 1.00 TRIB1 ?0.26 ?2.22 0.03 0.70 245.00 ?1.00 IER3 ?0.42 ?2.11 0.04 0.72 314.00 ?1.00 BDKRB2 0.43 2.05 0.04 0.74 346.00 1.00 NEDD9 ?0.32 ?2.04 0.04 0.76 352.00 ?1.00 CXCL2 ?0.53 ?2.00 0.05 0.77 376.00 ?1.00 FOXJ1 0.56 1.98 0.05 0.79 384.00 1.00
(84) Principal Component Analysis (PCA) was performed on PHS cases using significant genes from the NF-?B set. PCA 1, 2, 3 and 4 were developed. Logistic regression of the 4 different PCAs suggested that PCA1 and PCA3 were significantly associated with lethal cancer (
(85) TABLE-US-00004 TABLE 4 Principal Component Analysis (PCA) on PHS cases using significant genes from the NF-?B datasets. Logistics Regression Deviance Residuals Min 1Q Median 3Q Max ?2.30 ?0.41 ?0.20 0.31 2.77 Coefficients Std z Pr Estimate Error value (>IzI) Intercept 0.47 0.48 0.97 0.32 PC1 0.41 0.12 3.55 0.0004 PC2 ?0.26 0.17 ?1.51 0.13 PC3 0.64 0.25 2.56 0.01 Gl Low ?18.77 1511 ?0.01 0.99 Gl Med ?2.92 0.71 ?.41 4.22e?05
(86) Eight novel genes were identified to be significantly downregulated in lethal prostate cancer versus indolent in publically available databases (Sboner et al., 2010; Setlur et al., 2008) that were highly functionally associated with NF-?B in multiple biological contexts (Table 5). All these eight genes were also identified in the PHS study (Table 1).
(87) TABLE-US-00005 TABLE 5 List of genes that are significantly downregulated in lethal prostate cancer compared to indolent prostate cancer. Gene logFC FDR Biological contexts ATF3 ?0.96 0 Regulation of cell cycle, Cytokine metabolic process CXCL2 ?0.81 0.01 Vasculature development, Cytokine metabolic process DUSP5 ?0.76 0.02 Positive regulation of NF?B transcription factor activity, Cytokine metabolic process JUNB ?0.81 0 Regulation of cell cycle, Positive regulation of NF?B transcription factor activity, Regulation of cell motion NEDD9 ?0.48 0.01 Vasculature development, Cell migration, Cytokine metabolic process SELE ?0.83 0 Cell death, Regulation of cell proliferation TRIB1 ?0.35 0.02 Vasculature development, Cell migration, Regulation of cell motion, Cytokine metabolic process ZFP36 ?1.07 0 Regulation of cell cycle, Regulation of cell motion, Cytokine metabolic process
Example 3: Interactions Between NF-?B Related Genes in a Prostate Cancer Network
(88) Datasets from 18 curated prostate cancer expression datasets, GEO (Barrett et al., 2009), ArrayExpress (Parkinson et al., 2009) and non-condition-specific genomic data such as physical and genetic interactions from BioGRID (Breitkreutz et al., 2008) and IntAct (Kerrien et al., 2007), transcriptional regulatory relationships from Transfac (Matys et al., 2006) and cisRED (Robertson et al., 2006), and miRNA data from miRBase (Griffiths-Jones, 2006) were integrated to generate an NF-?B related gene interaction map (
Example 4: Association Between NF-?B Related Genes (ZFP36, NEDD9, Etc.) and Prostate Cancer Progression
(89) To interrogate the functions of ZFP36 and NEDD9 in prostate cancer cells, knock down of the genes and examination of the increase of cell number, which indicates a combinational effect of cell proliferation and cell death was performed. An shRNA targeting ZFP36 promoted cell growth (
(90) ZFP36 and NEDD9 were examined in human samples from the Health Professionals Follow-up Study and the Physician Health Study (HPFS/PHS). As shown in
(91) TABLE-US-00006 TABLE 6 Logistic regression of ZFP36 (denoted as X802862) and NEDD9 (denoted as X8123936) expression in indolent versus lethal prostate cancer in the HPFS/PHS datasets adjusted for age at diagnosis, Gleason score, and stage. Coefficients: Estimates Std. Error z value Pr(>|z|) (Intercept) ?2.51078 2.24381 ?1.119 0.263147 gleasoncat3 + 4 1.70750 1.05475 1.619 0.105478 gleasoncat4 + 3 2.97110 1.03981 2.857 0.004272 ** gleasoncat > 7 3.87305 1.03688 3.735 0.000187 *** as. factor(cTNM)2 0.53529 0.46130 1.160 0.245882 as. factor(cTNM)3 3.02168 1.05457 2.865 0.004166 ** agedx 0.02198 0.02230 0.985 0.324384 X8028652 ?0.45368 0.16945 ?2.677 0.007421 ** X8123936 0.00812 0.39913 0.020 0.983769 --- Signif. codes: 0 *** 0.001 ** 0.01 * 0.05 . 0.1 1
(92) Another gene expression profiling dataset (Taylor et al., 2010) was examined using 131 primary tumor samples with mRNA. We observed similar correlation between the two genes (r=0.60). ZFP36 was significantly associated with recurrence in the univariate setting (p<0.001, low expression associated with recurrence), while NEDD9 was not (p=0.65, though in the same negative direction) (
(93) TABLE-US-00007 TABLE 7 Logistic regression of ZFP36 (X802862) and NEDD9 (X8123936) expression in relapsed versus non-relapsed prostate cancer in the Taylor datasets adjusted for Gleason score. Variable Odds Ratio P value ZFP36 0.31 (0.12-0.75) 0.012 NEDD9 3.65 (1.05-14.0) 0.047 Gleason7 4.45 (1.10-30.25) 0.066 Gleason8 36.46 (4.84-446.84) 0.001 Gleason9 40.87 (5.36-501.87) <0.001
(94) Expression levels across different types or stages of prostate cancer were analyzed. Lower expression levels of ZFP36 were found in more aggressive types of prostate cancer, such as metastatic castration-resistant prostate cancer (CRPC) and metastastic neuroendocrine prostate cancer (NEPC), than in clinically localized hormone naive prostate cancer (PCa) (
Example 5: Association Between SNP Rs1910301 and Lethality of Prostate Cancer
(95) Using the network approach detailed in
(96) As a brief summary, the DMS method then iteratively proceeded through four searching steps to identify modules that had genes with low p-values as compared to other modules. Each gene in the PPI was initially assigned as a seed gene and then genes that interacted with the current module gene(s), with an interaction path less than or equal to 2, were identified. For each neighborhood interactor, Zm+1 was calculated after including it in the seed module and it was permanently added to the seed module if Zm+1>1.1*Zm, where Zm was defined as (?zi)/k, k was the number of genes in the module, and zi=??1 (1?Pi). These steps were repeated until no more neighborhood nodes could be added to the module. Normalized Zm values, called values, were then calculated by comparing the module to 100,000 modules of the same size that were created by randomly selecting genes. After conducting dense module selection, the modules were ranked and the top 40 modules with the highest ZN values were selected for the subnetwork. The selected subnetwork included 68 genes with 185 interactions, where each gene was weighted by a single SNP in the GWAS study. Of the 68 SNPs used to represent the genes in the selected subnetwork, the top 40 SNPs with a minor allele frequency >0.1 were carried forward for subsequent validation.
(97) Samples were pulled and DNA isolated from 256 Gelb Center patients (low risk/non-lethal prostate cancer cohort) and compared with samples from patients with metastatic disease(254 ECOG patients). Only one of 40 SNPs was nominally significantly associated with lethal disease in the same direction. In the original HSPH GWAS, the rs1910301 SNP with the risk allele being A had an odd ratio (OR) of 1.40 (p-value=0.02) for lethal disease. In the GC/ECOG cohorts, the rs1910301 risk allele A had an OR of 1.35 (p-value=0.04) for lethal disease. There was a chance of false discovery given only 1 of 40 SNPs tested was nominally significant. However, the likelihood was low because it was reproduced in two independent cohorts with the same ethnic background (Caucasians only). It was also identified via the dense module selection process using NF-?B pathway as the underlying biology.
Example 6: Association Between ZFP36 and PTEN Expression and Prostate Cancer Progression
(98) The previous examples show that certain biomarkers, such as the expression levels of NF-?B-related genes and the rs1910301 SNP, are associated with the progression of prostate cancer. This example provides a combination of specific biomarkers that is associated with prostate cancer progression with high accuracy.
(99) Gene expression data was obtained from the Taylor cohort. Gene expression for ZFP36 was quantified from archival surgical tumor tissue using Affymetrix Human Gene 1.0 ST microarrays. Cases (n=113) were men who died of prostate cancer or developed metastatic disease, and controls (n=291) were men who lived at least 8 years after diagnosis and remained metastasis free. A genetically validated PTEN immunohistochemistry (IHC) assay was performed on tissue microarrays (TMAs) for a subset of the men (n=257).
(100) Mean ZFP36 expression was significantly lower in the cases compared to the controls (p<0.001), and the crude odds ratio (OR) for lethal disease comparing those with low ZFP36 expression (below the lower quartile) to those with high ZFP36 expression (greater than or equal to the lower quartile) was 3.52 (95% CI: 2.18-5.69; p<0.001). The association persisted with adjustment for Gleason category, age at diagnosis, and clinical stage, with an adjusted OR of 1.93 (95% CI: 1.07-3.49; p=0.03). When modeled as a continuous variable in a logistic regression for prognosis, ZFP36 improved the AUC of the clinical factor model (Gleason, age, and clinical stage) from 0.83 (95% CI: 0.79-0.88) to 0.85 (95% CI: 0.81-0.89; p=0.10 for improvement).
(101) Among the patients with available PTEN staining, independent effects of ZFP36 and PTEN loss were observed. In the logistic regression on lethal disease with both variables included, PTEN negativity conferred an OR of 2.10 (95% CI: 1.11-3.93; p=0.02) and low ZFP36 produced an OR of 2.34 (95% CI: 1.24-4.36; p=0.01). An OR of 4.90 (95% CI: 2.05-11.72) was observed comparing patients with PTEN negativity and low ZFP36 to those with PTEN staining present and high ZFP36. As shown in
(102) Among the patients with available PTEN expression levels, an OR of 6.78 (95% CI: 3.04-15.15) was observed comparing patients with low PTEN and low ZFP36 to those with high PTEN and high ZFP36 (Table 8).
(103) TABLE-US-00008 TABLE 8 Logistic regression of ZFP36 expression (from gene expression profile data) and PTEN expression (from immunohistochemistry data) in indolent versus lethal prostate cancer in the HPFS/PHS datasets. $data indolent lethal Total High ZFP36.High 126 26 152 PTEN Low ZFP36.High 28 15 43 PTEN High ZFP36.Low 29 14 43 PTEN Low ZFP36.Low 10 9 19 PTEN Total 193 64 257 $measure odds ratio with NA 95% C.I. estimate lower upper High ZFP36.High 1.000000 NA NA PTEN Low ZFP36.High 2.596154 1.219006 5.529105 PTEN High ZFP36.Low 2.339523 1.088755 5.027178 PTEN Low ZFP36.Low 4.361538 1.613223 11.791933 PTEN $p.value NA two-sided midp.exact fisher.exact chi.square High ZFP36.High NA NA NA PTEN Low ZFP36.High 0.016697174 0.018527222 0.011540429 PTEN High ZFP36.Low 0.035116396 0.033257632 0.026720498 PTEN Low ZFP36.Low 0.005724298 0.004791046 0.002052485 PTEN
(104) The same conclusion is drawn from gene expression data of PTEN. Among the patients with available PTEN gene expression profile data, an OR of 6.78 (95% CI: 3.04-15.15) was observed comparing patients with low PTEN and low ZFP36 to those with high PTEN and high ZFP36 (Table 9).
(105) TABLE-US-00009 TABLE 9 Logistic regression of ZFP36 and PTEN expression (both from gene expression profile data) in indolent versus lethal prostate cancer in the HPFS/PHS datasets. $data indolent lethal Total High ZFP36.High 190 42 232 PTEN Low ZFP36.High 40 31 71 PTEN High ZFP36.Low 49 22 71 PTEN Low ZFP36.Low 12 18 30 PTEN Total 291 113 404 $measure odds ratio with NA 95% C.I. estimate lower upper High ZFP36.High 1.000000 NA NA PTEN Low ZFP36.High 3.505952 1.971084 6.236011 PTEN High ZFP36.Low 2.031098 1.110356 3.715349 PTEN Low ZFP36.Low 6.785714 3.039112 15.151111 PTEN $p.value NA two-sided midp.exact fisher.exact chi.square High ZFP36.High NA NA NA PTEN Low ZFP36.High 2.756779e?05 2.733570e?05 1.049996e?05 PTEN High ZFP36.Low 2.497034e?02 2.979737e?02 1.996293e?02 PTEN Low ZFP36.Low 3.534299e?06 3.112126e?06 2.761415e?07 PTEN
(106) In conclusion, loss of the tumor suppressor ZFP36 is prognostic for metastatic or lethal prostate cancer, and a combination of ZFP36 and PTEN expression confers a highly accurate model for predicting cancer prognosis.
(107) TABLE-US-00010 SequenceListing SEQIDNO:1-humanZFP36genomicsequence SEQIDNO:2-humanZFP36mRNAsequence SEQIDNO:3-humanZFP36proteinsequence SEQIDNO:4-humanNEDD9genomicsequence SEQIDNO:5-humanNEDD9mRNAsequence, transcriptvariant1 SEQIDNO:6-humanNEDD9mRNAsequence, transcriptvariant2 SEQIDNO:7-humanNEDD9mRNAsequence, transcriptvariant3 SEQIDNO:8-humanNEDD9mRNAsequence, transcriptvariant4 SEQIDNO:9-humanNEDD9proteinsequence, isoform1 SEQIDNO:10-humanNEDD9proteinsequence, isoform2 SEQIDNO:11-humanNEDD9proteinsequence, isoform3 SEQIDNO:12-humanNEDD9proteinsequence, isoform4 SEQIDNO:13-DNAsequenceflankinghumanSNP rs1910301,alleleA(SNPsiteunderlined) TATCTCCTTGGATCAGCCCTGCTGTCATCTCTTCACAACT CCCTGTCCTTGTTGCTGCCCATTTTGGGGAATTTATTTAT CAACTCCTGCTGTAAACGATAATAATAACAATGATAACAC ATATTGAATATTTTGTGCCTAACACTGTACACTTTCTCAT GTAATCCTCCAATAACCACGTGAGATAGGTGCTATTATTA TTTCCATTGACAGGTGAAATAACAGATGTTCAGAGAGTTA AGTAATCTATCCAAAGTCAGACAGCTAGTACCTGACAACG CATATCAGAGCAAGAAATTCTAGCTCTCATAACAGGCAAA CTCCCAAATCACAGTATCTTAACACAAAAAGAGTTTATTT CATGATCACATCTTGGCCCCTGGGAATTGGTGACTCCTTC TAGTCAGGCCATCATGAAACATATGACACCCATGGCTTCT GCATGGGGTAATGAAAGAGGCATTGCAAACTTTAAGGGCC TCAGCCCTTCCTGTCACAGTTCAATGACAAGAATGAGTATT GTGACCCCTATCTACTTACAAGGGAGGATAGGACACATAG GGGAAGACATATCTATTTAGTGAGCACTAACTGTACTGCT TTACCCTAGCACCCATGCTCTTATCTAGCTTAACTGTCCT TAGTTATCTATCTATCTATCTATCTATCTATCTATCTATC TATCTATCTATCATCTATCTGCCTACAGTTAACTATCTTA ACTGTCCTTACCAAGGCCCCAGTTGCACATTCCCTGATGC CACCAGGGCTCTGCTGACCTTTATTACAACTCCTCTACAG ATTCAACAGTCTGCCTTTGCTCTGCTTTCCTGCTCATCTG CTTTCCTGCTCATCTGCTTTGCTCTTTTTACTCTTTCTCC CTCCCATCTCCCTTTCCTCTGCTTCTCACTGTCTTTCTTC TGCATAACCCTACTCTGTGTGTTGAGTCTTCTATCACATC TTTCTCCTGTACGTGCCTTCTCTGATCTTCTTTCAGTTGC SEQIDNO:14-DNAsequenceflankinghuman SNPrs1910301,alleleG(SNPsiteunderlined) TATCTCCTTGGATCAGCCCTGCTGTCATCTCTTCACAACT CCCTGTCCTTGTTGCTGCCCATTTTGGGGAATTTATTTAT CAACTCCTGCTGTAAACGATAATAATAACAATGATAACAC ATATTGAATATTTTGTGCCTAACACTGTACACTTTCTCAT GTAATCCTCCAATAACCACGTGAGATAGGTGCTATTATTA TTTCCATTGACAGGTGAAATAACAGATGTTCAGAGAGTTA AGTAATCTATCCAAAGTCAGACAGCTAGTACCTGACAACG CATATCAGAGCAAGAAATTCTAGCTCTCATAACAGGCAAA CTCCCAAATCACAGTATCTTAACACAAAAAGAGTTTATTT CATGATCACATCTTGGCCCCTGGGAATTGGTGACTCCTTC TAGTCAGGCCATCATGAAACATATGACACCCATGGCTTCT GCATGGGGTAATGAAAGAGGCATTGCAAACTTTAAGGGCC TCAGCCCTTCCTGTCACAGTCCAATGACAAGAATGAGTATT GTGACCCCTATCTACTTACAAGGGAGGATAGGACACATAG GGGAAGACATATCTATTTAGTGAGCACTAACTGTACTGCT TTACCCTAGCACCCATGCTCTTATCTAGCTTAACTGTCCT TAGTTATCTATCTATCTATCTATCTATCTATCTATCTATC TATCTATCTATCATCTATCTGCCTACAGTTAACTATCTTA ACTGTCCTTACCAAGGCCCCAGTTGCACATTCCCTGATGC CACCAGGGCTCTGCTGACCTTTATTACAACTCCTCTACAG ATTCAACAGTCTGCCTTTGCTCTGCTTTCCTGCTCATCTG CTTTCCTGCTCATCTGCTTTGCTCTTTTTACTCTTTCTCC CTCCCATCTCCCTTTCCTCTGCTTCTCACTGTCTTTCTTC TGCATAACCCTACTCTGTGTGTTGAGTCTTCTATCACATC TTTCTCCTGTACGTGCCTTCTCTGATCTTCTTTCAGTTGC SEQIDNO:15-humanPTENmRNAsequence, splicevariant1 SEQIDNO:16-humanPTENmRNAsequence, splicevariant2 SEQIDNO:17-humanPTENmRNAsequence, splicevariant3