NON-HUMAN ANIMAL MODELS FOR AGING AND/OR NEURODEGENERATION
20230210096 · 2023-07-06
Inventors
- Diane L. Carlisle (Pittsburgh, PA, US)
- Robert Max Friedlander (Pittsburgh, PA, US)
- Abhishek Jauhari (Pittsburgh, PA, US)
- Sergei Victorovich Baranov (Pittsburgh, PA, US)
Cpc classification
A01K67/0275
HUMAN NECESSITIES
C12N9/1029
CHEMISTRY; METALLURGY
A61K49/0008
HUMAN NECESSITIES
International classification
Abstract
This document relates to non-human animal models (e.g., non-human mammalian models such as mouse models) for aging (e.g., neural aging). For example, non-human animal models having reduced or eliminated levels of aralkylamine N-acetyltransferase (AANAT) polypeptide expression are provided.
Claims
1. A non-human animal, wherein said non-human animal comprises a reduced or an undetectable level of aralkylamine N-acetyltransferase (AANAT) polypeptide expression, and wherein the genome of the somatic cells of said non-human animal comprises an heterologous or an homozygous disruption of a nucleic acid sequence encoding said AANAT polypeptide.
2. The non-human animal of claim 1, wherein said non-human animal is a mouse.
3-10. (canceled)
11. The non-human animal of claim 1, wherein said non-human animal comprises said reduced level of said AANAT polypeptide expression.
12. The non-human animal of claim 11, wherein said genome of said somatic cells comprises said heterologous disruption of said nucleic acid sequence encoding said AANAT polypeptide.
13. (canceled)
14. The non-human animal of claim 1, wherein said non-human animal comprises said undetectable level of said AANAT polypeptide expression.
15. The non-human animal of claim 14, wherein said genome of said somatic cells comprises said homozygous disruption of said nucleic acid sequence encoding said AANAT polypeptide.
16. A non-human animal, wherein said non-human animal comprises a reduced or an undetectable level of aralkylamine N-acetyltransferase (AANAT) polypeptide expression, and wherein the genome of the somatic cells of said non-human animal comprises an heterologous or an homozygous disruption of a regulatory nucleic acid sequence that regulates expression of said AANAT polypeptide.
17. The non-human animal of claim 16, wherein said non-human animal is a mouse.
18-25. (canceled)
26. The non-human animal of claim 16, wherein said non-human animal comprises said reduced level of said AANAT polypeptide expression.
27. The non-human animal of claim 26, wherein said genome of said somatic cells comprises said heterologous disruption of said regulatory nucleic acid sequence.
28. (canceled)
29. The non-human animal of claim 16, wherein said non-human animal comprises said undetectable level of said AANAT polypeptide expression.
30. The non-human animal of claim 29, wherein said genome of said somatic cells comprises said homozygous disruption of said regulatory nucleic acid sequence.
31. The non-human animal of claim 1, wherein said non-human animal exhibits accelerated aging as compared to a control animal of the same species as said non-human animal, wherein said control animal lacks said disruption.
32. A method for making a non-human animal of claim 1, wherein said method comprises: (a) introducing said disruption into the genome of a germ cell of a non-human animal lacking said disruption to generate a germ cell comprising said disruption, and (b) generating a non-human animal of claim 1 from said germ cell.
33. A method for making a non-human animal of claim 1, wherein said method comprises mating a first mating partner with a second mating partner of the opposite sex as compared to said first mating partner and of the same species as said first mating partner, wherein said first mating partner is a non-human animal of claim 1, and wherein said mating results in at least one offspring comprising said heterologous disruption or said homozygous disruption.
34. The method of claim 33, wherein said second mating partner is a non-human animal of claim 1.
35. The method of claim 34, wherein said at least one offspring comprises said homozygous disruption.
36. A method for identifying a molecule as having the ability to slow the progression of aging within a non-human animal of claim 1, wherein said method comprises: (a) administering a test molecule to said non-human animal, and (b) determining that said administering slows the progression of aging of said non-human animal.
37-40. (canceled)
41. A method for making a non-human animal of claim 16, wherein said method comprises: (a) introducing said disruption into the genome of a germ cell of a non-human animal lacking said disruption to generate a germ cell comprising said disruption, and (b) generating a non-human animal of claim 16 from said germ cell.
42. A method for making a non-human animal of claim 16, wherein said method comprises mating a first mating partner with a second mating partner of the opposite sex as compared to said first mating partner and of the same species as said first mating partner, wherein said first mating partner is a non-human animal of claim 16, and wherein said mating results in at least one offspring comprising said heterologous disruption or said homozygous disruption.
43. A method for identifying a molecule as having the ability to slow the progression of aging within a non-human animal of claim 16, wherein said method comprises: (a) administering a test molecule to said non-human animal, and (b) determining that said administering slows the progression of aging of said non-human animal.
Description
DESCRIPTION OF THE DRAWINGS
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
DETAILED DESCRIPTION
[0046] This document provides non-human animal models (e.g., non-human mammalian models such as mouse models) for aging (e.g., neural aging). For example, non-human animal models for aging can be non-human animals having (e.g., engineered to have) reduced or eliminated levels of AANAT polypeptide expression. In some cases, non-human animal models for aging can be non-human animals whose genomes have (e.g., are genetically engineered to have) one or more disruptions in an endogenous nucleic acid sequence encoding an AANAT polypeptide (e.g., such that somatic cells of the non-human animals have reduced or eliminated levels of AANAT polypeptide expression). Also provided herein are methods and materials for making and using non-human animals described herein (e.g., non-human animals having reduced or eliminated levels of AANAT polypeptide expression).
[0047] The term “reduced level” as used herein with respect to a level of AANAT polypeptide expression refers to any level that is lower than a reference level of AANAT polypeptide expression. The term “reference level” as used herein with respect to AANAT polypeptide expression refers to the level of AANAT polypeptide expression typically observed in cells from one or more non-human animals not genetically modified to reduce or disrupt AANAT polypeptide expression as described herein. In some cases, a reduced level of AANAT polypeptide expression can be an undetectable level of AANAT polypeptides. In some cases, a reduced level of AANAT polypeptide expression can be a level where expression of AANAT polypeptides is eliminated. For example, non-human animals having reduced or eliminated levels of AANAT polypeptides can have at least 50 percent (e.g., at least 60 percent, at least 75 percent, at least 90 percent, or at least 97 percent) less AANAT polypeptide expression as compared to control non-human animals (e.g., non-human animals not genetically modified as described herein such as wild-type animals of the same species).
[0048] A level of AANAT polypeptide expression can be measured using any appropriate technique. In some cases, a level of AANAT polypeptide expression can be measured using immunoassays (e.g., immunohistochemistry (IHC) techniques and western blotting techniques), mass spectrometry techniques (e.g., proteomics-based mass spectrometry assays), transmission electron microscopy, and/or enzyme-linked immunosorbent assays (ELISAs). In some cases, a level of a nucleic acid (e.g., a messenger RNA (mRNA)) encoding an AANAT polypeptide can be measured using northern blotting techniques, in situ hybridization techniques (e.g., fluorescent in situ hybridization), and/or reverse transcription-polymerase chain reaction (RT-PCR) techniques. In some cases, a level of AANAT polypeptide expression can be measured as described in Example 1.
[0049] In some cases, a non-human animal model described herein (e.g., a non-human animal model having reduced or eliminated levels of AANAT polypeptide expression) can have reduced or eliminated melatonin levels. The term “reduced level” as used herein with respect to the level of melatonin refers to any level that is lower than a reference level of melatonin. The term “reference level” as used herein with respect to melatonin refers to the level of melatonin typically observed in cells from one or more non-human animals not genetically modified to reduce or disrupt AANAT polypeptide expression as described herein. In some cases, a reduced level of melatonin can be an undetectable level of melatonin. In some cases, non-human animals having reduced levels of melatonin can have at least 50 percent (e.g., at least 60 percent, at least 75 percent, at least 90 percent, at least 95 percent, at least 97 percent, or at least 99 percent) less melatonin as compared to control non-human animals (e.g., non-human animals not genetically modified as described herein). In some cases, non-human animals having reduced levels of melatonin can have less than about 200 picograms (pg) melatonin per pineal gland of the non-human animal. For example, non-human animals having reduced levels of melatonin can have from about 1 pg to about 200 pg melatonin per pineal gland of the non-human animal.
[0050] Melatonin can be measured using any appropriate technique. In some cases, melatonin can be measured using mass spectrometry techniques (e.g., ultra performance liquid chromatography (UPLC) tandem mass spectrometry (MS/MS)). In some cases, melatonin can be measured as described in Example 1.
[0051] In some cases, a non-human animal model described herein (e.g., a non-human animal model having reduced or eliminated levels of AANAT polypeptide expression) can have an increased level of cytosolic mitochondrial reactive oxygen species (ROS). The term “increased level” as used herein with respect to the level of mitochondrial ROS refers to any level that is higher than a reference level of the mitochondrial ROS. The term “reference level” as used herein with respect to mitochondrial ROS refers to the level of the mitochondrial ROS typically observed in cells from one or more non-human animals not genetically modified to reduce or disrupt AANAT polypeptide expression as described herein. For example, non-human animals having an increased level of mitochondrial ROS can have at least 1.2 fold (e.g., at least about 1.5 fold, at least about 2 fold, at least about 3 fold, at least about 4 fold, at least about 5 fold, or at least about 6 fold) more mitochondrial ROS as compared to control non-human animals (e.g., non-human animals not genetically modified as described herein).
[0052] ROS can be measured using any appropriate technique. In some cases, ROS can be measured using DCFDA assays, MitoSOX™ assays, or both DCFDA assays and MitoSOX™ assays. In some cases, ROS can be measured as described in Example 1.
[0053] In some cases, a non-human animal model described herein (e.g., a non-human animal model having reduced or eliminated levels of AANAT polypeptide expression) can have an increased level of cytosolic mtDNA. The term “increased level” as used herein with respect to the level of cytosolic mtDNA refers to any level that is higher than a reference level of cytosolic mtDNA. The term “reference level” as used herein with respect to cytosolic mtDNA refers to the level of cytosolic mtDNA typically observed in cells from one or more non-human animals not genetically modified to reduce or disrupt AANAT polypeptide expression as described herein. For example, non-human animals having an increased level of cytosolic mtDNA can have at least 2.5 fold (e.g., at least about 2.7 fold, at least about 3 fold, at least about 3.2 fold, at least about 3.5 fold, at least about 3.8 fold, at least about 4 fold, at least about 4.3 fold, or at least about 4.5 fold) more mitochondrial ROS as compared to control non-human animals (e.g., non-human animals not genetically modified as described herein). A mtDNA that can have an increased cytosolic level in a non-human animal model described herein can be measured by measuring the cytosolic level of any appropriate gene encoded by mtDNA. Examples of mtDNA encoded genes that can have an increased cytosolic level and used as a proxy for mtDNA in the cytosol in a non-human animal model described herein include, without limitation, mt-CO1, mt-Dloop1, mt-Dloop3, and any of the additional 34 genes encoded by mtDNA. mtDNA can be measured using any appropriate technique. In some cases, mtDNA can be measured using quantitative real-time PCR. In some cases, mtDNA can be measured as described in Example 1.
[0054] In some cases, a non-human animal model described herein (e.g., a non-human animal model having reduced or eliminated levels of AANAT polypeptide expression) can have increased activation of the cyclic guanosine monophosphate-adenosine monophosphate synthase (cGAS) pathway. Activation of the cGAS pathway can be measured using any appropriate technique. In some cases, activation of the cGAS pathway can be measured by detecting expression and/or activation of a molecule downstream from cGAS in the cGAS pathway. For example, activation of the cGAS pathway can be measured by detecting expression and/or activation of stimulator of interferon genes (STING) polypeptides. In some cases, activation of the cGAS pathway can be measured by detecting expression and/or activation (e.g., phosphorylation) of interferon regulatory factor 3 (IRF3) polypeptides. In some cases, activation of the cGAS pathway can be measured by detecting expression and/or activation (e.g., phosphorylation) of nuclear factor kappa-light-chain-enhancer of activated B cells (NF-.sub.KB). In some cases, activation of the cGAS pathway can be measured as described in Example 1.
[0055] In some cases, a non-human animal model described herein (e.g., a non-human animal model having reduced or eliminated levels of AANAT polypeptide expression) can have an increased level of one or more pro-inflammatory cell signaling polypeptides (e.g., cytokines and interferons). The term “increased level” as used herein with respect to the level of one or more pro-inflammatory cell signaling polypeptides refers to any level that is higher than a reference level of the pro-inflammatory cell signaling polypeptide(s). The term “reference level” as used herein with respect to one or more pro-inflammatory cell signaling polypeptides refers to the level of the pro-inflammatory cell signaling polypeptide(s) typically observed in cells from one or more non-human animals not genetically modified to reduce or disrupt AANAT polypeptide expression as described herein. For example, non-human animals having an increased level of one or more pro-inflammatory cell signaling polypeptides can have at least 2 fold (e.g., at least about 3 fold, at least about 4 fold, at least about 5 fold, at least about 6 fold, at least about 7 fold, at least about 8 fold, at least about 9 fold, or at least about 10 fold) more pro-inflammatory cell signaling polypeptide(s) as compared to control non-human animals (e.g., non-human animals not genetically modified as described herein). A pro-inflammatory cell signaling polypeptide that can have an increased level in a non-human animal model described herein can be any appropriate pro-inflammatory cell signaling polypeptide. Examples of pro-inflammatory cell signaling polypeptides that can have an increased level in a non-human animal model described herein include, without limitation, interleukin (IL)-6, IL-18, IL-1β, interferon (IFN)-α, and IFN-β.
[0056] A level of a pro-inflammatory cell signaling polypeptide can be measured using any appropriate technique. In some cases, a level of a pro-inflammatory cell signaling polypeptide can be measured using immunoassays (e.g., immunohistochemistry (IHC) techniques and western blotting techniques), mass spectrometry techniques (e.g., proteomics-based mass spectrometry assays), transmission electron microscopy, and/or enzyme-linked immunosorbent assays (ELISAs). In some cases, a level of a nucleic acid (e.g., mRNA) encoding a pro-inflammatory cell signaling polypeptide can be measured using northern blotting techniques, in situ hybridization techniques (e.g., fluorescent in situ hybridization), and/or reverse transcription-polymerase chain reaction (RT-PCR) techniques. In some cases, a level of a pro-inflammatory cell signaling polypeptide can be measured as described in Example 1.
[0057] A non-human animal model provided herein can be a model for any type of aging. In some cases, a non-human animal model for aging can be a model for healthy (e.g., non-diseased) aging. In some cases, a non-human animal model provided herein can be a model that exhibits symptoms and/or phenotypes of healthy aging. Examples of symptoms and phenotypes of healthy aging include, without limitation, hair loss (e.g., alopecia such as full-body alopecia), graying of the hair, wrinkled skin, cognitive decline, memory deficits, and decreased muscle strength. In some cases, a non-human animal model for healthy aging can be a model that does not exhibit all the symptoms and/or phenotypes of a disease associated with aging (e.g., a progeria such as Hutchinson-Gilford syndrome and Werner syndrome)). Examples of symptoms and phenotypes of a disease associated with aging can include, without limitation, atherosclerosis, kidney failure, loss of eyesight, cardiovascular problems (e.g., atherosclerosis), scleroderma, cataracts (e.g., bilateral cataracts), atrophied skin, tight skin, soft tissue calcification, brain atrophy, skin ulcers, osteoporosis, diabetes mellitus (Type 2 diabetes), and cancers (e.g., skin cancers such as malignant melanomas, soft-tissue sarcomas, thyroid cancers, liver cancers, myelodysplastic syndrome, malignant fibrous histiocytoma, or non-Hodgkin lymphomas). In some cases, a non-human animal model provided herein can be a model for neural aging. For example, a non-human animal model for neural aging can be used as a model for a disease associated with neural aging (e.g., a neurodegenerative disease). Examples of neurodegenerative diseases include, without limitation, Huntington’s disease, Parkinson’s disease, Alzheimer’s disease, and amyotrophic lateral sclerosis.
[0058] A non-human animal model described herein (e.g., a non-human animal model having reduced or eliminated levels of AANAT polypeptide expression) can be any appropriate type of non-human animal. In some cases, a non-human animal model provided herein can be a non-human mammal. Examples of non-human animals that can be used as a non-human animal to generate a model described herein can include, without limitation, zebrafish, Drosophila melanogaster, mice, rats, rabbits, guinea pigs, dogs, cats, pigs, sheep, horses, bovine species, and non-human primates (e.g., monkeys). In some cases, a non-human animal having reduced or eliminated levels of AANAT polypeptide expression can be a mouse model (e.g., a mouse model for aging such as neural aging).
[0059] In cases where a non-human animal described herein (e.g., a non-human mammal having reduced or eliminated levels AANAT polypeptide expression) is a mouse, the mouse can be any appropriate type (e.g., strain) of mouse. Examples of strains of mice that can be used to make a non-human animal model described herein include, without limitation, CBA, DBA, B6CBA, C57BL/6, BALB/c, FVB/N, C3/He, and MSM/Ms. In some cases, a mouse that can be used as (or can be used to generate) a non-human animal model described herein can be an inbred strain of mouse. In some cases, a mouse that can be used as (or can be used to generate) a non-human animal model described herein can be a hybrid strain of mouse. For example, a hybrid strain of mouse that can be a progeny (e.g., an F1 progeny) from a cross between two different inbred strains of mice.
[0060] A non-human animal (e.g., a mouse) described herein (e.g., a non-human animal having reduced or eliminated levels of AANAT polypeptide expression) can have (e.g., can be engineered to have) a disruption in an endogenous nucleic acid sequence encoding an AANAT polypeptide (e.g., one or more exons (or portions thereof) that encode an amino acid sequence of an AANAT polypeptide) and/or a disruption in an endogenous nucleic acid sequence that regulates or drives the expression of an AANAT polypeptide (e.g., a promotor or enhancer sequence that regulates or drives expression of an AANAT polypeptide). The term “endogenous” as used herein with reference to nucleic acid sequences and a particular organism refers to a nucleic acid sequence that is normally present in the genome of members of the same species that includes that particular organism. An endogenous nucleic acid sequence can include exons, introns, one or more gene sequences, intergenic sequences, portions of gene sequences or intergenic sequences, regulatory sequences, or combinations thereof.
[0061] The term “disruption” as used herein with reference to a nucleic acid sequence encoding a AANAT polypeptide refers to any genetic modification (e.g., nucleotide deletions, additions, insertions and deletions (indels), inversions, and/or substitutions) of a nucleic acid sequence encoding a AANAT polypeptide (e.g., one or more exons (or portion thereof) of a nucleic acid sequence encoding an AANAT polypeptide) that results in a reduced or eliminated level of expression of a functional AANAT polypeptide. The term “disruption” as used herein with reference to a regulatory sequence that regulates or drives expression of a nucleic acid sequence encoding an AANAT polypeptide refers to any genetic modification (e.g., nucleotide deletions, additions, indels, inversions, and/or substitutions) of such a regulatory sequence (e.g., a promotor or enhancer) that results in a reduced or eliminated level of expression of a functional AANAT polypeptide.
[0062] In some cases, a disruption can be an homozygous disruption (e.g., present in both copies of a nucleic acid sequence encoding an AANAT polypeptide (or of a regulatory sequence) in a diploid non-human animal). In some cases, a disruption can be an heterozygous disruption (e.g., present in one copy of a nucleic acid sequence encoding an AANAT polypeptide (or of a regulatory sequence) in a diploid non-human animal).
[0063] In some cases, a non-human animal (e.g., mouse) described herein (e.g., non-human animal having reduced or eliminated levels of AANAT polypeptide expression) can be a knockout animal (e.g., a knockout mouse). The terms “knockout,” “knock-out,” and “KO” as used herein with reference to a non-human animal having undetectable levels of AANAT polypeptide expression refers to a particular non-human animal (e.g., a mouse) that contains a genetic modification that disrupts a nucleic acid sequence encoding the AANAT polypeptide (e.g., one or more exons of a nucleic acid sequence encoding an AANAT polypeptide) and/or that contains a genetic modification that disrupts one or more regulatory sequences of nucleic acid encoding an AANAT polypeptide) normally endogenous to members of the same species as that particular non-human animal (e.g., via deletion or replacement of a nucleic acid sequence or via insertion of a nucleic acid sequence that disrupts AANAT polypeptide expression), thereby inactivating that nucleic acid sequence (e.g., such that a functional AANAT polypeptide is not expressed). For example, a non-human animal having a genetic modification that disrupts a nucleic acid sequence encoding an AANAT polypeptide, thereby inactivating that nucleic acid sequence (e.g., such that cells containing the inactivated nucleic acid have an undetectable level of expression of a functional AANAT polypeptide) can be referred to as an AANAT knockout mouse.
[0064] Any suitable method can be used to generate a non-human animal (e.g., mouse) described herein (e.g., non-human animal having reduced or eliminated levels of AANAT polypeptide expression). For example, any suitable method can be used to generate a disruption in (a) the endogenous nucleic acid sequence encoding an AANAT polypeptide (e.g., one or more exons of a nucleic acid sequence encoding an AANAT polypeptide) and/or (b) one or more endogenous regulatory sequences of nucleic acid encoding an AANAT polypeptide, in a genetically modified non-human animal described herein. Examples of methods that can be used to generate a disruption in the endogenous nucleic acid sequence encoding an AANAT polypeptide (and/or an endogenous regulatory sequence) can include, without limitation, gene editing technologies, site-specific recombinase technologies, and homologous recombination technologies. Methods used to generate a disruption in the endogenous nucleic acid sequence encoding an AANAT polypeptide (and/or an endogenous regulatory sequence) can be designed based on any appropriate nucleic acid sequence encoding an AANAT polypeptide (and/or any appropriate regulatory sequence of the AANAT polypeptide-encoding sequences). Examples of nucleic acid sequences encoding an AANAT polypeptide include, without limitation, those set forth in National Center for Biotechnology Information (NCBI) accession no. EDL34585, version EDL34585.1; accession no. AAI19140, version AAI19140.1; accession no. AAI16968, version AAI16968.1; accession no. BC116967, version BC116967.1; accession no. NC_000077, version NC_000077.6; accession no. NM_009591, version NM_009591.3; accession no. U83462, version U83462.1; accession no. AF004108, version AF004108.1; accession no. BC119139, version BC119139.1; accession no. AB013358, version AB013358.1; accession no. CH466558, version CH466558.1; and accession no. CM000219, version CM000219.2. Examples of regulatory sequences having the ability to regulate expression of an AANAT polypeptide include, without limitation, promotors and enhancers such as those set forth in GeneHancer (GH) identifiers GH17J076452, GH17J076465, GH17J076480, GH17J076352, GH17J076489, GH17J076527, or GH17J076238.
[0065] In some cases, a non-human animal (e.g., mouse) described herein (e.g., non-human animal having reduced or eliminated levels of AANAT polypeptide expression) can be generated using a gene editing technology. For example, a non-human animal described herein can be generated using a gene editing technology that includes one or more engineered nucleases. Examples of gene editing technologies that can be used to generate a non-human animal described herein include, without limitation, clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR-associated nucleases (Cas) systems, transcription activator-like effector nucleases (TALENs) systems, zinc finger nucleases, and meganucleases. In some cases, a non-human animal having reduced or eliminated levels of AANAT polypeptide expression can be generated as described in Example 1.
[0066] In some cases, a non-human animal having reduced or eliminated levels of AANAT polypeptide expression can be generated using a gene editing technique as described elsewhere (see, e.g., Pelletier et al., Immunity, 42(1): 18-27 (2015); Mani et al., Biochemical and Biophysical Research Communications, 335:447-457 (2005); Campbell et al., Circulation Research, 113:571-587 (2013); Navabpour et al., Neurosci Biobehav Rev., 108:732-748 (2020); Wassef et al., Methods, 121-122:45-54 (2017); and Channabasavaiah et al., Disease Models & Mechanisms, 12:dmm029462 (2019)).
[0067] This document also provides methods and materials for using a non-human animal (e.g., a mouse) described herein (e.g., a non-human animal having reduced or eliminated levels of AANAT polypeptide expression). In some cases, a non-human animal (e.g., a mouse) described herein (e.g., a non-human mammal having reduced or eliminated levels of AANAT polypeptide expression) can be used to identify, evaluate, and/or validate a therapeutic intervention for aging (e.g., neural aging). For example, a candidate therapeutic intervention (e.g., a test molecule) can be administered to a non-human animal described herein, and the non-human animal can be monitored for the severity or rate of aging and/or the severity of one or more symptoms of aging. Examples of test molecules that can be assessed for the ability to reduce the severity or rate of aging and/or the severity of one or more symptoms of aging as described herein include, without limitation, polypeptides, nucleic acid molecules encoding a polypeptide, and small molecules. In some cases, the members of a library of different test molecules (e.g., a library of different small molecules) can be assessed for the ability to reduce the severity or rate of aging and/or the severity of one or more symptoms of aging as described herein. In some cases, one or more positive control molecules can be used to confirm the ability of a test molecule to reduce the severity or rate of aging and/or the severity of one or more symptoms of aging using a non-human animal model described herein. Examples of positive control molecules that can be used to confirm the ability of a test molecule to reduce the severity or rate of aging and/or the severity of one or more symptoms of aging include, without limitation, polypeptides (e.g., FOXO4 peptides), nucleic acid molecules encoding a polypeptide (e.g., FOXO4 peptides), and senolytic molecules (e.g., dasatinib and/or quercetin, or fisetin).
[0068] A candidate therapeutic intervention (e.g., a test molecule) can be administered to a non-human animal described herein using in any appropriate technique. In some cases, a therapeutic intervention can be administered orally (e.g., by direct oral administration or by providing a therapeutic intervention in the non-human animal’s feed and/or water). In some cases, a therapeutic intervention can be administered parenterally (e.g., by subcutaneous injection, intramuscular injection, intravenous injection, intradermal injection, intrathecal injection, intra-arterial injection, and intracranial injection or pump infusion). Any appropriate method can be used to monitor the severity or rate of aging and/or the severity of one or more symptoms of aging. For example, assessment of cognitive function, assessment of strength, and/or assessment of motor function can be used to monitor the severity or rate of aging. In some cases, lifespan can be used to assess the ability of a test molecule to slow the progression of aging within a non-human animal described herein.
[0069] The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Example 1: Melatonin Inhibits Cytosolic Mitochondrial DNA Induced Neuroinflammation in Accelerated Ageing and Neurodegeneration
[0070] This Example demonstrates that neurodegeneration and ageing exhibit increased cytosolic mitochondrial DNA release, a process modulated by melatonin, which activates the inflammatory response, and demonstrates that AANAT-KO knockout mice lacking melatonin also exhibit increased cytosolic mitochondrial DNA release and an activated inflammatory response. As such, AANAT-KO knockout mice can be used as a model of accelerated ageing.
Results
AANAT Deletion Results in mtDNA Mediated Inflammation
[0071] To explore the role of melatonin in brain, AANAT.sup.-/- (AANAT-KO) mice were created in a CBA/J genetic background, a strain that produces melatonin. AANAT is the penultimate enzyme in melatonin synthesis and is located in the mitochondrial matrix. Melatonin concentration measured in pineal during peak production (4 am) is reduced to background in AANAT-KO mice as compared to wild type (WT) mice (
[0072] Given the role of melatonin in mitochondrial homeostasis, it was evaluated whether AANAT-KO mice have elevated levels of cytosolic mtDNA. By 20-weeks but not at 8-weeks of age, a 3.6 ± .8-fold increase of cytosolic mtDNA was identified in AANAT-KO as compared to WT mice (
Melatonin Mitigates mtDNA-Mediated Inflammatory Response in AANAT-KO Primary Cerebrocortical Neurons (PCNs)
[0073] To complement in vivo studies with neuron-specific data, AANAT-KO and WT PCNs were cultured for 21 days and MMP and mitochondrial ROS accumulation were measured. MMP decreased and ROS increased in AANAT-KO PCN; both parameters were restored by exogenous melatonin (
Neuroinflammation and Neurodegeneration are Increased in Differentiated N2a AANAT-KO Cells; Effects Attenuated by Melatonin
[0074] To further investigate AANAT-KO effects on neurons, AANAT KO N2a neuroblastoma cells were generated (
[0075] Consistent with AANAT-KO PCNs, mtDNA release was increased in differentiated AANAT-KO N2a neurons, and the increase was prevented by melatonin (
Inhibition of Hyper-Inflammatory Response in mtDNA Depleted AANAT-KO Differentiated Neurons
[0076] To evaluate the role of cytosolic mtDNA in the inflammatory phenotype of N2a cells, the mtDNA was depleted. WT and AANAT-KO N2a cells were cultured with ethidium bromide (EtBr) to generate mtDNA deficient N2a cells (ρ0). Chronic EtBr exposure results in reduction of mtDNA. An EtBr dose dependent depletion of mtDNA in N2a cells was confirmed (
[0077] Given the impact of mtDNA reduction on activation of inflammatory pathways and the connection between inflammatory signaling and synaptic pruning, the role of mtDNA on synaptic dynamics was evaluated. mtDNA depleted AANAT-KO neurons demonstrated synaptic preservation, as measured by PSD95 and Synaptophysin (protein and mRNA), similar to what was observed with exogenous melatonin (
DNAse1 Inhibits the Inflammatory Response in HD
[0078] To identify whether cytosolic mtDNA contributes to the inflammatory response in HD, STHdh.sup.Q7/Q7 (Q7) and STHdh.sup.Q111/Q111 (Q111 cells) were evaluated for a mutant huntingtin (mHTT)-dependent inflammatory phenotype. Q7 and Q111 are immortalized striatal cells from mice that had an expanded CAG repeat knocked-in the huntingtin gene. These cell express mHTT with 111 glutamine repeats and are used as a cellular HD model. Q7 and Q111 cells were differentiated to mature striatal neurons and evaluated for mtDNA-mediated inflammation. Q111 cells had higher cytosolic mtDNA concentration compared to Q7 cells (
Inflammatory Response in HD is Mediated by cGAS
[0079] To confirm that inflammatory response is mediated by cGAS, differentiated Q7 and Q111 neurons were treated with RU.521 (cGAS pharmacological inhibitor). RU.521 did not affect cGAS level; however, it reduced STING and IRF3 level in differentiated Q7 and Q111 neurons (
Melatonin Regulates mtDNA Mediated Inflammation in HD
[0080] The relationship between mHTT and mtDNA signaling was examined in vivo. To evaluate whether cytosolic mtDNA induces neuroinflammation in HD, a human HD patient’s striatum (grade 2) was analyzed and cGAS/STING/IRF3 signaling activation was found (
[0081] Since melatonin is protective in R6/2 mice and melatonin is deficient in humans with HD, it was evaluated whether exogenous melatonin reduces mtDNA release and consequent inflammation. Six-week old R6/2 mice were injected with melatonin daily for 3 weeks. Melatonin inhibited mtDNA release and ameliorated cGAS/STING/IRF3 upregulation in cortex and striatum in 9-week R6/2 mice (
Methods
Materials
[0082] Commercially available materials used are as shown in Table 1.
TABLE-US-00001 Reagent or Resource Source Identifier Antibodies Mouse monoclonal anti-β-Actin Millipore-Sigma Cat#A5441;RRID Rabbit monoclonal anti-cGAS Cell signaling Technology Cat#31659;RRID Rabbit monoclonal anti-STING Cell signaling Technology Cat#50494;RRID Rabbit monoclonal anti-caspase-3 Cell signaling Technology Cat#4790;RRID Mouse monoclonal anti-caspase-9 Cell signaling Technology Cat#9508S;RRID Rabbit monoclonal anti-pNF-kB Cell signaling Technology Cat#3033 S;RRID Rabbit polyclonal anti-IRF3 Proteintech Cat#11312-1-AP;RRID Rabbit polyclonal anti-TOM20 Proteintech Cat#11802-1-AP;RRID Rabbit polyclonal anti-caspase-1 Proteintech Cat#22915-1-AP;RRID Rabbit polyclonal anti-PSD95 Abcam Cat#ab18258;RRID Mouse monoclonal anti-Cytochrome C Abcam Cat#ab110325 Mouse monoclonal anti-mt-CO1 Abcam Cat# ab14705;RRID Mouse monoclonal anti-Synaptophysin Santacruz biotechnology Cat# sc-17750;RRID Goat polyclonal anti-BID R&D Systems Cat# AF860-SP;RRID Mouse monoclonal anti-8′-OHDG Stressmarq Biosceinces Cat# SMC-155;RRID Mouse monoclonal anti-βIII-tubulin Millipore-Sigma Cat#T8660 Rabbit polyclonal anti-Map2 Santacruz Biotechnology Cat#sc-20172 Chemicals, Peptides, and Recombinant Proteins Melatonin Millipore-Sigma Cat#M5250 Retinoic Acid Millipore-Sigma Cat#R2625 Ethidium bromide Millipore-Sigma Cat#E7637 Sodium pyruvate ThermoFisher Cat#11360070 Uridine Millipore-Sigma Cat# U3003 TMRM ThermoFisher Cat#T668 Mitosox ThermoFisher Cat#M36008 Poly-D-Lysine Millipore-Sigma Cat#P6407 DCFDA Millipore-Sigma Cat# D6883 JC-1 Iodide Santacruz biotechnology Cat#CAS47729-63-5 DNase 1 ThermoFisher Cat# 18047019 IBMX abcam Cat#ab 120840 Forskolin abcam Cat#ab120058 Recombinant Human FGF-acidic Peprotech Cat3 100-17A Hoechst stain Millipore-Sigma Cat#B2883 PowerUP Sybr Geen ThermoFisher Cat# A25742 Bolt™ 4-12% Bis-Tris Plus Gels ThermoFisher Cat#NW04120BOX Commercial Assays Reagent Protein Delivery Pulsin Polyplus Cat#89129-956 Mitoprobe transition pore assay Kit ThermoFisher Cat# M34153 Protein Carbonyl Content Assay Kit Millipore-Sigma Cat# MAK094 Lipid Peroxidation (Mda) Assay Kit Millipore-Sigma Cat#MAK085 RNeasy Kit Qiagen Cat#74104 DNeasy blood and Tissue Kit Qiagen Cat#69504 High Capacity Reverse Transcription Kit ThermoFisher Cat#4368814 Cell Fractionation Kit - Standard Abcam Cat#ab109719 IL-6 ELISA Kit ThermoFisher Cat#BMS603-2 IL-18 ELISA Kit ThermoFisher Cat#BMS618-3 IL-1β ELISA Kit ThermoFisher Cat#BMS6002 IFN-α ELISA Kit ThermoFisher Cat#BMS6027 IFN-β ELISA Kit ThermoFisher Cat#424001 DNA Damage (8-OHdG) ELISA Kit Stressmarq Cat#SKT-120-96S Experimental Models and Cell Lines Neuro-2a Cells ATCC ATCC® CCL-131 STHdh.sup.Q7/Q7 (Q7) Coriell Institute CHDI-90000073 STHdh.sup.Q111/Q111 (Q111) Coriell Institute CHDI-90000072
Human Tissues
[0083] Striatum samples of grade 2 HD patients, and control patients’ samples were obtained. Clinical information of the patients and subjects is indicated in Table 2.
TABLE-US-00002 Human brain tissue information. Type Grade Specimen Age Gender CAG repeats Standard brain block (SBB).sup.1 Postmortem interval before frozen Control n.a. T-110 62 M N.E. SBB7.1 N.E. Control n.a. T-133 33 F N.E. SBB7.1 11:25 Control n.a. T-169 69 M N.E. SBB6.2 49:20 Control n.a. T-180 53 F N.E. SBB7.2 6:07 Control n.a. T-638 78 M N.E. SBB7.1 8:00 Control n.a. T-3925 79 F N.E. SBB6.1 18:50 Control n.a. T-5404 54 F N.E. SBB7.1 16:36 HD2 2 T-461 77 M 41/15 SBB7.2 19:28 HD2 2 T-3221 58 M 42/15 SBB7.2 85:11 HD2 2 T-4394 75 F 41/17 SBB7.2 22:50 HD2 2 T-4498 59 M 43/17 SBB6.2 32:45 HD2 2 T-4964 89 M 40/17 SBB6.0 10:35 HD2 2 T-4989 75 F 42/15 SBB6.1 37:35 HD2 2 T-5263 55 F 54/30 SBB6.2 30:50 Grade - diagnosed HD grade, Specimen - frozen tissue samples, Age - years at death, F - female, M - male, N.E. - not estimated, n.a. - not applicable, CAG repeats -number of CAG repeats of both alleles. .sup.1SBB as described in Vonsattel et al., Acta Neuropathol 115:509-532 (2008)
Murine Tissues
[0084] R6/2 mice, which carry the promoter sequence and exon 1 of a mutant human HTT gene with approximately 150 CAG repeats, were obtained from JAX (Bar Harbor, ME). A colony was maintained by breeding R6/2 males with B6CBAF1 females (JAX). CAG repeat length was determined for every mouse in the colony and mice with 150 +/-10 CAG repeats were used. PCR genotyping was performed. Three, six and Nine week-old R6/2 mice were used in the experiments.
[0085] AANAT-KO mice on CBA and DBA backgrounds were generated using CRISPR-Cas9 methods. CBA/J embryos and DBA/J2 embryos were injected with a mixture of Cas9 mRNA, Aanat-guide1-F sequence TAATACGACTCACTATAGGTGATGTTCAACA-TGGGCGTCGTTTTAGAGCTAGAAATAGCA; SEQ ID NO: 1) and Aanat-guide2-F sequence TAATACGACTCACTATAGGGGGAGACAGCGGTTCCCAACGTTTT-AGAGCTAGAAATAGCA; SEQ ID NO:2). From the injected zygotes, 2-cell embryos were transferred to the oviducts of pseudopregnant female recipients. Potential founder mice were genotyped and those with AANAT deletion were bred with WT to determine germline transmission. Founders with germline transmission were bred with WT to generate heterozygotes. Heterozygotes are bred to generate littermate PCN and F2 KO and WT mice. Tissues were obtained from mice within the colony resulting from age and sex matched offspring of KOxKO or WTxWT F3 breeding.
Brain and Ventricle Size Analysis
[0086] Histological staining and stereotactic analysis were done. AANAT-KO and littermate control mice were anesthetized and transcardially perfused with 4% buffered paraformaldehyde. The brains were removed and postfixed in the perfusate for overnight, rinsed in buffer, weighed, and cryoprotected in a graded series of 10 and 20% glycerol/2% dimethyl sulfoxide (DMSO). Frozen serial sections were cut at 50 mm, stored in six-well plates, and stained for Nissl substance by using cresyl violet. Serial-cut coronal tissue sections (every fourth section) from the rostral segment of the neostriatum to the level of the anterior commissure (interaural 5.34 mm/bregma 1.54 mm to interaural 3.7 mm/bregma 0.10 mm were used for volumetric analysis. Images were captured by Nikon E800 microscope with SPOT Flex camera and analysed with NIH ImageJ software.
Melatonin Detection
[0087] Mouse pineal gland, differentiated N2a cell pellet and isolated mitochondria were re-suspended in 500 .Math.L of 1xPBS solution with protease inhibitor set III (Millipore, 539134) and MAO-A inhibitor (Clorgyline, M3778, SigmaAldrich), followed by sonication on ice (3 strokes each). All samples were analyzed using UPLC-MS/MS. The UPLC-MS/MS method for quantitation of melatonin employs liquid-liquid extraction and detection with a triple quad mass spectrometer. To each sample (0.5 mL) is added 50 .Math.L ammonium hydroxide and 10 .Math.L internal standard (d4 melatonin 50 ng/mL). Samples are vortexed and extracted with 2 mL methylene chloride. After centrifugation, the methylene chloride was evaporated under a gentle stream of nitrogen and the residue reconstituted in 50 .Math.l H.sub.2O for injection onto an Acquity UPLC BEH C18 column (2.1 X 100 mm). Samples are eluted with 2 mM ammonium formate in water and acetonitrile using a gradient from 97:3 (initial water:ACN) to 60:40 over five minutes and maintained at 60:40 for 0.5 minutes before re-equilibration at 97:3. Total run time was 7.5 minutes. Melatonin and the internal standard were detected in the positive mode with a Thermo Fisher TSQ Quantum Ultra mass spectrometer interfaced via an electrospray ionization probe with the Waters UPLC Acquity solvent delivery system. Transitions used for analysis were 237.1 .fwdarw. 178.1 for d.sub.4 melatonin and 233.1 .fwdarw. 174.1 for melatonin. The method was used to quantify melatonin in brain homogenates, cell culture media, cell lysates, and serum/plasma samples. Calibrators were extracted from PBS buffer, cell culture media or stripped human plasma to match the sample matrix. The lower limit of quantitation is 1 pg/mL.
Cell Culture and Differentiation
[0088] N2a cells were obtained from ATCC and grown in DMEM/F12 medium with 10% FBS. AANAT-KO N2a cells were generated as described elsewhere (see, e.g., Suofu et al., PNAS 114:E7997-E8006 (2017)). N2a cells were differentiated by exposing them to 10 .Math.M retinoic acid (RA) with 2% fetal bovine serum (FBS) for 8 days. Every alternate day, the culture medium of differentiating N2a cells was replaced with fresh medium containing 10 .Math.M of RA. N2a cells were treated with 5 .Math.M melatonin during differentiation to evaluate the effect of melatonin in WT and AANAT-KO N2a differentiated neurons. Fresh melatonin was added with RA every alternate day for 8 days. All experiments were performed in 8-day-differentiated neurons with or without melatonin. STHdh.sup.Q7/Q7 (Q7) STHdh.sup.Q111/Q111 (Q111) cells were grown in MEM culture medium with 10% FBS. Differentiation of Q7 and Q111 cells was induced by exposing cells to 10 ng/mL α-FGF, 250 .Math.M 3-isobutyl-1-methylxanthine (IBMX), 200 nM phorbol 12-myristate 13-acetate (TPA), 50 .Math.M forskolin and 10 .Math.M dopamine for 2 days. AANAT-KO and littermate WT primary cerebro-cortical neuron (PCN) cultures were prepared from embryonic day (E) 15.5 embryos, as described elsewhere (see, e.g., Yano et al., Nature neuroscience 17:822 (2014)).
Generation of mtDNA-Deficient Cells
[0089] To generate the mtDNA deficient phenotype, N2a cells were grown in DMEM/F12 supplemented with 10% (vol/vol) FBS, 100 .Math.g/mL pyruvate, 50 .Math.g/mL uridine and 1 .Math.g/mL ethidium bromide for 3 weeks. mtDNA depletion was evaluated by quantitative real-time PCR and immunoblots of mtDNA-encoded proteins.
Immunostaining
[0090] Cells were fixed in 4% paraformaldehyde in PBS for 10 minutes, permeabilized with 0.1% Triton X-100 in PBS for 15 minutes at room temperature, and subjected to immunofluorescence with the indicated primary and secondary antibodies. Samples were imaged with the Olympus IX-81-DSU in confocal mode.
Reactive Oxygen Species (ROS), Mitochondrial Membrane Potential (MMP), Mitochondrial Permeability Transition (MPT) Assays
[0091] ROS accumulation in cells was estimated by either DCFDA for total ROS or Mitosox for mitochondrial ROS. Cells were incubated in 20 .Math.M DCFDA for 45 minutes or 5 .Math.M Mitosox for 15 minutes at 37° C. and fluorescence was measured using plate reader or flowcytometry. For MMP estimation, JC-1 or TMRM were used. Cells were incubated in 2 .Math.g/mL JC-1 or 25 nM TMRM for 30 minutes at 37° C. and fluorescence were measured using plate reader or flowcytrometry. MPT was assayed using MitoProbe™ Transition Pore Assay Kit (Invitrogen) according to the manufacturer’s protocol.
Mitochondrial Isolation
[0092] Brain mitochondria were isolated by Percoll density centrifugation as described elsewhere (see, e.g., Yano et al., Nature neuroscience 17:822 (2014); and Baranov et al., PNAS 116:650-659 (2019)). Cellular mitochondria were isolated by using Mitochondria Isolation kit, mouse (Miltenyi Biotec). In brief, 1x10.sup.7 cells were collected and centrifuged at 300 x g for 5 minutes and washed with PBS. After washing, cells were lysed in 1 mL ice-cold lysis buffer by passing through a 27-gauge needle 15 times on ice. After lysis, lysate was incubated with 50 .Math.L of anti-Tom22 microbeads in 1x separation buffer for 1 hour at 4° C. Further, suspension was then passed through pre-separation filter (Miltenyi Biotec) on LS column and washed with 1x separation buffer. Mitochondria were eluted with IM-2 (Isolation Buffer 2, 225 mM sucrose, 75 mM mannitol, 5 mM HEPES, PH 7.4 at 4° C.) and centrifuged at 13,000 x g for 4 minutes at 4° C.
Immunoblotting
[0093] Samples (isolated mitochondria or whole-cell lysates) were cleared by centrifugation at 20,000 x g, equal amounts of protein were separated on Novex 4-12% gradient polyacrylamide gels (Invitrogen), and proteins transferred overnight onto 0.45 .Math.m polyvinylidene difluoride (PVDF) membranes. The membranes were then incubated with the indicated primary antibodies overnight at 4° C. followed by incubation with secondary antibodies (Li-Cor) for 1 hour at room temperature, which were detected using the Odyssey CLx Infrared Imaging System (Li-Cor). Band intensities were quantified using Image Studio (Li-Cor).
RNA Isolation and Quantitative PCR
[0094] Total RNA was isolated using the RNeasy Plus kit (Qiagen) and quantified using a ND-1000 spectrophotometer. cDNA was prepared using 1000 ng total RNA by a reverse transcription PCR (RT-PCR) using a high capacity cDNA reverse transcription kit (Applied Biosystems). qPCR was performed on cDNA using SYBR Green chemistry. qPCR was performed on a Biorad CFX touch PCR using Applied Biosystems PowerUp SYBR green master mix. Fold changes in expression were calculated by the ΔΔCt method using mouse β-Actin as an endogenous control for mRNA expression. All fold changes were expressed normalized to the untreated control. Primers used are listed in Table 3.
TABLE-US-00003 Oligonucleotide/Primers Target Sequence SEQ ID NO: mt-CO1 F: 5′-GCCCCAGATATAGCATTCCC-3′ 3 R: 5′-GTTCATCCTGTTCCTGCTCC-3′ 4 mt-Dloop1 F: 5′-AATCTACCATCCTCCGTGAAACC-3′ 5 R: 5′-TCAGTTTAGCTACCCCCAAGTTTAA-3′ 6 mt-Dloop3 F: 5′-TCCTCCGTGAAACCAACAA-3′ 7 R: 5’-AGCGAGAAGAGGGGCATT-3’ 8 cGAS F: 5′-ACCGGACAAGCTAAAGAAGGTGCT-3′ 9 R: 5′-GCAGCAGGCGTTCCACAACTTTAT-3′ 10 STING F: 5’-GTCCTCTATAAGTCCCTAAGCATG-3’ 11 R: 5′-AAGATCAACCGCAAGTACCC-3′ 12 IRF3 F: 5′-CACAAGGACAAGGACGGAG-3′ 13 R: 5′-ATGCAGAACCACAGAGTGTAG-3′ 14 Caspase-1 F: 5′-TCTGTATTCACGCCCTGTTG-3′ 15 R: 5′-GATAAATTGCTTCCTCTTTGCCC-3′ 16 IL-6 F: 5′-CCACTCACCTCTTCAGAACG-3′ 17 R: 5′-CATCTTTGGAAGGTTCAGGTTG-3′ 18 IL-1β F: 5′-ACGGACCCCAAAAGATGAAG-3′ 19 R: 5′-TTCTCCACAGCCACAATGAG-3′ 20 IL-18 F: 5′-GCCTCAAACCTTCCAAATCAC-3′ 21 R: 5′-GTTGTCTGATTCCAGGTCTCC-3′ 22 IFN-α F: 5′-TCTGTGCTTTCCTGATGGTC-3′ 23 R: 5′-GGTTATGAGTCTGAGGAAGGTC-3′ 24 IFN-β F: 5′-CAGCCCTCTCCATCAACTATAAG-3′ 25 R: 5′-TCTCCGTCATCTCCATAGGG-3′ 26 PSD95 F: 5′-GTGACAACCAAGAAATACCGC-3′ 27 R: 5′-TTCACCTGCAACTCATATCCTG-3′ 28 Synaptophysin F: 5′-AGTGCCCTCAACATCGAAG-3′ 29 R: 5′-GCCACGGTGACAAAGAATTC-3′ 30 Homer-1 F: 5′-CAGAGCAAGTTTTCATTGGGC-3′ 31 R: 5′-TGTGTTCGGGTCAATCTGG-3′ 32 B-Actin F: 5′-ACCTTCTACAATGAGCTGCG-3′ 33 R: 5′-CTGGATGGCTACGTACATGG-3′ 34
Cytosolic mtDNA Quantification
[0095] For measurement of mtDNA in cytosol in cells, cell fractions were prepared using Cell Fractionation Kit (Abeam). For measurement of cytosolic mtDNA in brain, tissues were homogenized in IM buffer (5 mM HEPES-Tris (pH 7.4), 225 mM sucrose, 75 mM mannitol and 1 mM EGTA) and divided into two equal parts. One part is then centrifuged at 1,300 x g for 3 minutes and supernatant again spun at 20000 x g for 10 minutes. Resultant supernatant was collected as cytosolic fraction. Cytosolic fraction (200 .Math.L) and corresponding total tissue or cellular homogenate were used to isolate cytosolic and total DNA, respectively. The copy number of mtDNA encoding cytochrome c oxidase 1 (mt-CO1), mt-Dloop1 and mt-Dloop3 was measured by quantitative real-time PCR with same volume of DNA solution. Normalization to the nuclear genome was performed using DNA isolated from tissue homogenate using β-actin.
Mitochondrial In Vitro Protein Import Assay
[0096] Ornithine transcarbamylase (OTC) precursor cDNA in pGEM-3Zf(+)-pOTC plasmid was transcribed and translated in vitro using the TNT Coupled Reticulocyte Lysate System (Promega) in the presence of [.sup.35S] methionine (PerkinElmer). Following translation, [.sup.35S] methionine-labeled pOTC was incubated with isolated mitochondria at 25° C. for the indicated times, and mitochondria containing imported OTC were collected by centrifugation (9,000 x g, 10 minutes) and subjected to SDS/PAGE. Mature OTC, which represents the cleaved protein after translocation into the mitochondrial matrix, was quantified by ImageJ (NIH). The data are presented as normalized by input (total [.sup.15S] pOTC per lane).
Protein Transfection
[0097] Q7/Q111 cells were plated in six-well plates a day before protein transfections. Cells were washed twice with warm DMEM without FBS, then transfected for 4 hours at 37° C. with 2 .Math.g/mL DNase I or lactate dehydrogenase as a non-targeted protein control through the use of PULSin reagent (Polyplus transfection). After 4 hours, transfection medium was removed and cells were incubated for 2 hours in complete growth media, and differentiation induced by differentiation media as described above.
Statistics
[0098] Statistical analyses were performed with Prism software (GraphPad). Data were obtained from at least three independent experiments and expressed as mean ± SEM unless otherwise specified. The Student’s t-test was used for parametric data. Paired t-tests were used for experiments with multiple samples from the same source. ANOVA followed by Tuckey’s test were used for analysis of more than two groups. P -values less than 0.05 were considered statistically significant (indicated in figures as: *, P<0.05; **, P<0.01; ***, P<0.001).
Example 2: Characterization of AANAT-KO Mice
[0099] AANAT-KO mice were further characterized at 1 year. For each experiment, at least three (N ≥ 3) AANAT-KO mice were examined and at least seven (N ≥ 7) WT were examined.
[0100] Immune Cytology suggestive of inflammatory dysfunction was examined in 1-year old AANAT-KO mice. 1 year old AANAT-KO, compared to WT, have increased % of B-cells, increased number of dendritic cells, increased number of neutrophils, and increased NK cells (
[0101] Lipid oxidation was examined in 1-year old AANAT-KO mice. Reactive oxygen species levels increased with age (
[0102] Increased activation of caspases was examined in 1-year old AANAT-KO mice. Caspase activation increased with age (
[0103] Mitochondrial biogenesis (as indicated by PCG1α polypeptide expression) was examined in 1-year old AANAT-KO mice. Decreased brain mitochondrial biogenesis was observed with age (
[0104] Mitochondrial DNA is released from dysfunctional mitochondria, and mitochondrial DNA release increases with age. Release of mitochondrial DNA into the cytoplasm was examined in 1-year old AANAT-KO mice. Mitochondrial release was accelerated in AANAT-KO mice (
[0105] Activation of cytoplasmic DNA sensing pathways (as indicated by activation of the cGAS-STING-IRF3 pathway and downstream cytokines) was examined in 1-year old AANAT-KO mice. Activation of the cGAS-STING-IRF3 pathway was observed in both brain protein and in brain mRNA (
[0106] Survival of AANAT-KO mice was also compared to survival of WT mice. WT mice have shorter lifespans than AANAT-KO mice (
Other Embodiments
[0107] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.