MODULATED DAY-LENGTH SENSITIVE CANNABIS PLANTS, GENES, MARKERS, AND BREEDING

20240130311 ยท 2024-04-25

    Inventors

    Cpc classification

    International classification

    Abstract

    Cannabis plants that have a modulated day-length sensitivity phenotype are provided. Also provided are alleles or genomic sequences providing a modulated day-length sensitivity phenotype to a Cannabis plant and methods for providing a Cannabis plant that has a modulated day-length sensitivity phenotype.

    Claims

    1. (canceled)

    2. (canceled)

    3. (canceled)

    4. (canceled)

    5. Use of a marker for establishing the presence of an autoflower allele or an autoflower-conferring a genomic sequence in a Cannabis plant, wherein the marker indicates presence of an allele that encodes an autoflower protein, wherein the autoflower protein is a PRR protein or a protein that interacts with a PRR protein or a protein that interacts with a protein in a PRR protein complex or a protein upstream or downstream of a signal transduction pathway of PRR.

    6. A method for providing a Cannabis plant with a modulated day-length sensitivity phenotype, wherein the method comprises the steps of: a) selecting an autoflower Cannabis plant, designated as the first Cannabis plant, wherein the selection comprises any of: detecting an autoflower phenotype in a plant, or establishing the presence of an autoflower allele or autoflower genomic sequence; b) transferring the autoflower allele or autoflower genomic sequence of step a) into a recipient Cannabis plant, thereby conferring a modulated day-length sensitivity phenotype to the recipient Cannabis plant; and c) detecting presence of an autoflower allele in the recipient Cannabis plant wherein at least the selecting of step a) and/or the detecting of step c) comprises use of a marker indicative of the autoflower allele.

    7. The method according to claim 6, wherein the transferring of step b comprises a cross of the first Cannabis plant with a second Cannabis plant that does not have a modulated day-length sensitivity phenotype, and subsequently selecting a recipient Cannabis plant that has a modulated day-length sensitivity phenotype.

    8. The method according to claim 5, wherein the transferring of step b comprises a technique selected from genetic transformation, gene editing, gene inactivation, or gene deletion.

    9. The method according to claim 5, wherein in step a) establishing the presence of the autoflower allele or autoflower conferring genomic sequence in a Cannabis plant comprises use of one or more markers, wherein the marker indicates presence of an allele that encodes an autoflower protein, wherein the autoflower protein is a PRR protein or a protein that interacts with a PRR protein or a protein that interacts with a protein in a PRR protein complex or a protein upstream or downstream of a signal transduction pathway of PRR.

    10. A method of producing a Cannabis plant having a modulated day-length sensitivity phenotype, the method comprising: a) growing at least one plant expressing an exogenous or modified regulatory protein, said plant comprising an exogenous or modified nucleic acid, said exogenous or modified nucleic acid comprising a regulatory region operably linked to a nucleic acid encoding said regulatory protein, wherein the regulatory protein is a PRR protein or a protein that interacts with a PRR protein or a protein that interacts with a protein in a PRR protein complex or a protein upstream or downstream of a signal transduction pathway of PRR, wherein the exogenous or modified regulatory protein is capable of modulating day-length sensitivity of the plant; and b) producing the at least one plant, wherein the at least one plant has a modulated day-length sensitivity phenotype.

    11. The method of claim 10, wherein the regulatory region is a promoter.

    12. The method of claim 11, wherein the promoter is a tissue-specific promoter.

    13. The method of claim 12, wherein the promoter is expressed in inflorescence tissue or leaf tissue.

    14. The method of claim 11, wherein the promoter is a cell type-specific promoter.

    15. The method of claim 11, wherein the promoter is an inducible promoter.

    16. (canceled)

    17. The method of claim 6, wherein the modulated day-length sensitivity phenotype is an autoflower phenotype, attenuation of day-length sensitivity, or increase of day-length sensitivity.

    18. (canceled)

    19. (canceled)

    20. (canceled)

    21. The use of claim 5, wherein the allele encodes an autoflower protein, wherein the autoflower protein is a pseudoresponse regulator (PRR) protein or a protein that interacts with a PRR protein or a protein that interacts with a protein in a PRR protein complex or a protein upstream or downstream of a signal transduction pathway of PRR.

    22. The use of claim 21, wherein the allele is represented by a coding sequence having at least 35% nucleotide sequence identity with the known sequence of PRR37 in Oryza sativa.

    23. The method of claim 10, wherein the modulated day-length sensitivity phenotype is an autoflower phenotype, attenuation of day-length sensitivity, or increase of day-length sensitivity.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0022] FIG. 1 shows results from QTL mapping.

    DETAILED DESCRIPTION

    [0023] Day-length neutral (autoflower) Cannabis varieties typically express less desirable phenotypic characteristics than day-length sensitive Cannabis varieties. For example, lower cannabinoid content, leafy inflorescences and a limited aroma profile are commonly associated with day-length neutral varieties and tend to produce an inferior finished product. There is significant interest in breeding Cannabis to develop autoflower varieties that otherwise have desirable genotypes or phenotypes. Such breeding typically involves a cross of a first, day-length sensitive (photoperiod) parent plant having a desired phenotype (referred to herein as a Value Phenotype) with a second parent plant having an autoflower phenotype, whatever other traits it may have. For purposes of this disclosure, a plant expressing all of the desirable features of a given first parent, the Value Phenotype, but in an autoflower form, can be referred to as an Autoflower Value Phenotype plant.

    [0024] Any plant with a modulated day-length sensitivity phenotype can be defined as a plant that demonstrates a different sensitivity to day length than wild type plants. For example, the phenotype can include an autoflower phenotype, attenuation of day-length sensitivity, or increase of day-length sensitivity.

    [0025] The Value Phenotype can include at least one trait selected from one or more of: high THCA accumulation; specific cannabinoid ratio(s); a composition of terpenes and/or other aroma active and aromatic molecules; monoecy or dioecy (enable or prevent hermaphroditism); branchless or branched architectures with specific height to branch length ratios or total branch length; determinant growth; time to maturity; high flower to leaf ratios that enable pathogen resistance through improved airflow; high flower to leaf ratios that maximize light penetration and flower development in the vertical canopy space; a finished plant height that enables tractor farming inside high tunnels; a finished plant height and flower to leaf ratio that maximizes light penetration all the way to the ground but minimizes total plant height; trichome size; trichome density; advantageous flower structures for oil or flower production (flower diameter length, long or short internodal spacing distance, flower-to-leaf determination ratio (leafiness of flower)); metabolites that provide enhanced properties to finished oil products (oxidation resistance, color stability, cannabinoid and terpene stability); specific variants affecting cannabinoid or aromatic molecule biosynthetic pathways; modulators of the flowering time phenotype that increase or decrease maturation time; flower biomass yield and composition; crude oil yield and composition; resistance to botrytis, powdery mildew, fusarium, pythium, cladosporium, alternaria, spider mites, broad mites, russet mites, aphids, nematodes, caterpillars, HLVd or any other Cannabis pathogen or pest of viral, bacterial, fungal, insect, or animal origin; propensity to host specific beneficial and/or endophytic microflora; heavy metal composition in tissues; specific petiole and leaf angles and lengths; and/or the like.

    [0026] The invention relates to one or more molecular markers and marker-assisted breeding of autoflower Cannabis plants. Detection of a marker and/or other linked marker can be used to identify, select and/or produce plants having the autoflower phenotype and/or to eliminate plants from breeding programs or from planting that do not have the autoflower phenotype. The molecular marker can be utilized to indicate a plant's possession of an autoflower allele well before the trait can be morphologically or functionally manifest in the plant, and also when the plant is heterozygous for the autoflower allele and therefore would never display the autoflower phenotype. Specifically, in the context of breeding to develop Autoflower Value Phenotype varieties, a molecular marker correlating strongly with the autoflower trait can permit very early testing of progeny of a cross to identify those progeny that possess one or more autoflower alleles and discard those individuals that do not. This permits shifting the allele frequency of any plants remaining in the breeding pool, after such screening, to eliminate any plants that do not have at least one autoflower allele. In some embodiments of the invention, the analysis is capable of distinguishing between individuals that are homozygous for the autoflower allele versus those that are heterozygous. In such situations it can be advantageous to discard any heterozygous individuals.

    Definitions

    [0027] Although the following terms are believed to be well understood by one of ordinary skill in the art, the following definitions are set forth to facilitate understanding of the presently disclosed subject matter.

    [0028] As used herein, the terms a or an or the can refer to one or more than one. For example, a marker (e.g., SNP, QTL, haplotype) can mean one marker or a plurality of markers (e.g., 2, 3, 4, 5, 6, and the like).

    [0029] As used herein, the term and/or refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (or).

    [0030] As used herein, the term about, when used in reference to a measurable value such as an amount of mass, dose, time, temperature, and the like, is meant to encompass, in different embodiments, variations of 20%, 10%, 5%, 1%, 0.5%, or even 0.1% of the specified amount.

    [0031] As used herein, the transitional phrase consisting essentially of means that the scope of a claim is to be interpreted to encompass the specified materials or steps recited in the claim and any others that do not materially affect the basic and novel characteristic(s) of the claimed invention. Thus, the term consisting essentially of when used in a claim of this invention is not intended to be interpreted to be equivalent to either comprising or consisting of.

    [0032] As used herein, the term allele refers to one of two or more different nucleotides or nucleotide sequences that occur at a specific locus.

    [0033] A locus is a position on a chromosome where a gene or marker or allele is located. In some embodiments, a locus can encompass one or more nucleotides.

    [0034] As used herein, the terms desired allele, target allele and/or allele of interest are used interchangeably to refer to an allele associated with a desired trait. In some embodiments, a desired allele can be associated with either an increase or a decrease (relative to a control) ofor ina given trait, depending on the nature of the desired phenotype. In some embodiments of this invention, the phrase desired allele, target allele or allele of interest refers to an allele(s) that is associated with autoflower phenotype.

    [0035] A marker is associated with a trait when said trait is linked to it and when the presence of the marker is an indicator of whether and/or to what extent the desired trait or trait form will occur in a plant/germplasm comprising the marker. Similarly, a marker is associated with an allele or chromosome interval when it is linked to it and when the presence of the marker is an indicator of whether the allele or chromosome interval is present in a plant/germplasm comprising the marker. For example, a marker associated with autoflower refers to a marker whose presence or absence can be used to predict whether a plant will carry an autoflower allele or display an autoflower phenotype.

    [0036] As used herein, the term autoflower or day length neutral refers to a plant's ability to transition from a vegetative growth stage to a flowering stage independent of length of day. As used herein, AF can be an abbreviation for autoflower.

    [0037] As used herein, the term photoperiod sensitivity refers to the sensitivity of a plant to length of day. Photoperiod sensitive plants will transition from a vegetative growth to a flowering stage based on the plant's perception of length of day. Autoflower plants have low or no photoperiod sensitivity. As used herein, PP can be an abbreviation for photoperiod.

    [0038] As used herein, the terms backcross and backcrossing refer to the process whereby a progeny plant is crossed back to one of its parents one or more times (e.g., 1, 2, 3, 4, 5, 6, 7, 8, etc.). In a backcrossing scheme, the donor parent refers to the parental plant with the desired gene or locus to be introgressed. The recipient parent (used one or more times) or recurrent parent (used two or more times) refers to the parental plant into which the gene or locus is being introgressed. For example, see Ragot, M. et al. Marker-assisted Backcrossing: A Practical Example, in TECHNIQUES ET UTILISATIONS DES MARQUEURS MOLECULAIRES LES COLLOQUES, Vol. 72, pp. 45-56 (1995); and Openshaw et al., Marker-assisted Selection in Backcross Breeding, in PROCEEDINGS OF THE SYMPOSIUM ANALYSIS OF MOLECULAR MARKER DATA pp. 41-43 (1994). The initial cross gives rise to the F1 generation. The term BC1 refers to the second use of the recurrent parent, BC2 refers to the third use of the recurrent parent, and so on.

    [0039] As used herein, the terms cross or crossed refer to the fusion of gametes via pollination to produce progeny (e.g., cells, seeds or plants). The term encompasses both sexual crosses (the pollination of one plant by another) and selfing (self-pollination, e.g., when the pollen and ovule are from the same plant). The term crossing refers to the act of fusing gametes via pollination to produce progeny.

    [0040] As used herein, the terms cultivar and variety refer to a group of similar plants that by structural or genetic features and/or performance can be distinguished from other varieties within the same species.

    [0041] As used herein, the terms elite and/or elite line refer to any line that is substantially homozygous and has resulted from breeding and selection for desirable agronomic performance.

    [0042] As used herein, the terms exotic, exotic line and exotic germplasm refer to any plant, line or germplasm that is not elite. In general, exotic plants/germplasms are not derived from any known elite plant or germplasm, but rather are selected to introduce one or more desired genetic elements into a breeding program (e.g., to introduce novel alleles into a breeding program).

    [0043] A genetic map is a description of genetic linkage relationships among loci on one or more chromosomes within a given species, generally depicted in a diagrammatic or tabular form. For each genetic map, distances between loci are measured by the recombination frequencies between them. Recombination between loci can be detected using a variety of markers. A genetic map is a product of the mapping population, types of markers used, and the polymorphic potential of each marker between different populations. The order and genetic distances between loci can differ from one genetic map to another.

    [0044] As used herein, the term genotype refers to the genetic constitution of an individual (or group of individuals) at one or more genetic loci, as contrasted with the observable and/or detectable and/or manifested trait (the phenotype). Genotype is defined by the allele(s) of one or more known loci that the individual has inherited from its parents. The term genotype can be used to refer to an individual's genetic constitution at a single locus, at multiple loci, or more generally, the term genotype can be used to refer to an individual's genetic make-up for all the genes in its genome. Genotypes can be indirectly characterized, e.g., using markers and/or directly characterized by nucleic acid sequencing.

    [0045] As used herein, the term germplasm refers to genetic material of or from an individual (e.g., a plant), a group of individuals (e.g., a plant line, variety or family), or a clone derived from a line, variety, species, or culture. The germplasm can be part of an organism or cell, or can be separate from the organism or cell. In general, germplasm provides genetic material with a specific genetic makeup that provides a foundation for some or all of the hereditary qualities of an organism or cell culture. As used herein, germplasm includes cells, seed or tissues from which new plants can be grown, as well as plant parts that can be cultured into a whole plant (e.g., leaves, stems, buds, roots, pollen, cells, etc.).

    [0046] A haplotype is the genotype of an individual at a plurality of genetic loci, i.e., a combination of alleles. Typically, the genetic loci that define a haplotype are physically and genetically linked, i.e., on the same chromosome segment. The term haplotype can refer to polymorphisms at a particular locus, such as a single marker locus, or polymorphisms at multiple loci along a chromosomal segment.

    [0047] As used herein, the term heterozygous refers to a genetic status wherein different alleles reside at corresponding loci on homologous chromosomes.

    [0048] As used herein, the term homozygous refers to a genetic status wherein identical alleles reside at corresponding loci on homologous chromosomes.

    [0049] As used herein, the term hybrid in the context of plant breeding refers to a plant that is the offspring of genetically dissimilar parents produced by crossing plants of different lines or breeds or species, including but not limited to the cross between two inbred lines.

    [0050] As used herein, the term inbred refers to a substantially homozygous plant or variety. The term can refer to a plant or plant variety that is substantially homozygous throughout the entire genome or that is substantially homozygous with respect to a portion of the genome that is of particular interest.

    [0051] As used herein, the term indel refers to an insertion or deletion in a pair of nucleotide sequences, wherein a first sequence can be referred to as having an insertion relative to a second sequence or the second sequence can be referred to as having a deletion relative to the first sequence.

    [0052] As used herein, the terms introgression, introgressing and introgressed refer to both the natural and artificial transmission of a desired allele or combination of desired alleles of a genetic locus or genetic loci from one genetic background to another. For example, a desired allele at a specified locus can be transmitted to at least one progeny via a sexual cross between two parents of the same species, where at least one of the parents has the desired allele in its genome. Alternatively, for example, transmission of an allele can occur by recombination between two donor genomes, e.g., in a fused protoplast, where at least one of the donor protoplasts has the desired allele in its genome. The desired allele can be a selected allele of a marker, a QTL, a transgene, or the like. Offspring comprising the desired allele can be backcrossed one or more times (e.g., 1, 2, 3, 4, or more times) to a line having a desired genetic background, selecting for the desired allele, with the result being that the desired allele becomes fixed in the desired genetic background. For example, a marker associated with metribuzin tolerance can be introgressed from a donor into a recurrent parent that is metribuzin intolerant. The resulting offspring could then be backcrossed one or more times and selected until the progeny possess the genetic marker(s) associated with metribuzin tolerance in the recurrent parent background.

    [0053] As used herein, the term linkage refers to the degree with which one marker locus is associated with another marker locus or some other. The linkage relationship between a genetic marker and a phenotype can be given as a probability or adjusted probability. Linkage can be expressed as a desired limit or range. For example, in some embodiments, any marker is linked (genetically and physically) to any other marker when the markers are separated by less than about 50, 40, 30, 25, 20, or 15 map units (or cM).

    [0054] A centimorgan (cM) or a genetic map unit (m.u.) is a unit of measure of recombination frequency and is defined as the distance between genes for which 1 product of meiosis in 100 is recombinant One cM is equal to a 1% chance that a marker at one genetic locus will be separated from a marker at a second locus due to crossing over in a single generation. Thus, a recombinant frequency (RF) of 1% is equivalent to 1 m.u. or cM.

    [0055] As used herein, the phrase linkage group refers to all of the genes or genetic traits that are located on the same chromosome. Within the linkage group, those loci that are close enough together can exhibit linkage in genetic crosses. Since the probability of crossover increases with the physical distance between loci on a chromosome, loci for which the locations are far removed from each other within a linkage group might not exhibit any detectable linkage in direct genetic tests. The term linkage group is mostly used to refer to genetic loci that exhibit linked behavior in genetic systems where chromosomal assignments have not yet been made. Thus, the term linkage group is, in common usage and in many embodiments, synonymous with the physical entity of a chromosome, although one of ordinary skill in the art will understand that a linkage group can also be defined as corresponding to a region of (i.e., less than the entirety) of a given chromosome.

    [0056] As used herein, the term linkage disequilibrium refers to a non-random segregation of genetic loci or traits (or both). In either case, linkage disequilibrium implies that the relevant loci are within sufficient physical proximity along a length of a chromosome so that they segregate together with greater than random (i.e., non-random) frequency (in the case of co-segregating traits, the loci that underlie the traits are in sufficient proximity to each other). Markers that show linkage disequilibrium are considered linked. Linked loci co-segregate more than 50% of the time, e.g., from about 51% to about 100% of the time. In other words, two markers that co-segregate have a recombination frequency of less than 50% (and, by definition, are separated by less than 50 cM on the same chromosome). As used herein, linkage can be between two markers, or alternatively between a marker and a phenotype. A marker locus can be associated with (linked to) a trait, e.g., metribuzin tolerance. The degree of linkage of a genetic marker to a phenotypic trait is measured, e.g., as a statistical probability of co-segregation of that marker with the phenotype.

    [0057] Linkage disequilibrium is most commonly assessed using the measure r.sup.2, which is calculated using the formula described by Hill and Robertson, Theor. Appl. Genet. 38:226 (1968). When r.sup.2=1, complete linkage disequilibrium exists between the two marker loci, meaning that the markers have not been separated by recombination and have the same allele frequency. Values for r.sup.2 above ? indicate sufficiently strong linkage disequilibrium to be useful for mapping. Ardlie et al., Nature Reviews Genetics 3:299 (2002). Hence, alleles are in linkage disequilibrium when r.sup.2 values between pairwise marker loci are greater than or equal to about 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0.

    [0058] As used herein, the term linkage equilibrium describes a situation where two markers independently segregate, i.e., sort among progeny randomly. Markers that show linkage equilibrium are considered unlinked (whether or not they lie on the same chromosome).

    [0059] As used herein, the terms marker and genetic marker are used interchangeably to refer to a nucleotide and/or a nucleotide sequence. A marker can be, but is not limited to, an allele, a gene, a haplotype, a chromosome interval, a restriction fragment length polymorphism (RFLP), a simple sequence repeat (SSR), a random amplified polymorphic DNA (RAPD), a cleaved amplified polymorphic sequence (CAPS) (Rafalski and Tingey, Trends in Genetics 9:275 (1993)), an amplified fragment length polymorphism (AFLP) (Vos et al., Nucleic Acids Res. 23:4407 (1995)), a single nucleotide polymorphism (SNP) (Brookes, Gene 234:177 (1993)), a sequence-characterized amplified region (SCAR) (Paran and Michelmore, Theor. Appl. Genet. 85:985 (1993)), a sequence-tagged site (STS) (Onozaki et al., Euphytica 138:255 (2004)), a single-stranded conformation polymorphism (SSCP) (Orita et al., Proc. Natl. Acad. Sci. USA 86:2766 (1989)), an inter-simple sequence repeat (ISSR) (Blair et al., Theor. Appl. Genet. 98:780 (1999)), an inter-retrotransposon amplified polymorphism (IRAP), a retrotransposon-microsatellite amplified polymorphism (REMAP) (Kalendar et al., Theor. Appl. Genet. 98:704 (1999)), an isozyme marker, an RNA cleavage product (such as a Lynx tag) or any combination of the markers described herein. A marker can be present in genomic or expressed nucleic acids (e.g., ESTs). A number of Cannabis genetic markers are known in the art, and are published or available from various sources. In some embodiments, a genetic marker of this invention is an SNP allele, a SNP allele located in a chromosome interval and/or a haplotype (combination of SNP alleles) each of which is associated with an autoflower phenotype.

    [0060] As used herein, the term background marker refers to markers throughout a genome that are polymorphic between a recurrent parent and a donor parent, and that are not known to be associated with a trait sought to be introgressed from a donor parent genome to the recurrent parent genome.

    [0061] Markers corresponding to genetic polymorphisms between members of a population can be detected by methods well-established in the art. These include, but are not limited to, nucleic acid sequencing, hybridization methods, amplification methods (e.g., PCR-based sequence specific amplification methods), detection of restriction fragment length polymorphisms (RFLP), detection of isozyme markers, detection of polynucleotide polymorphisms by allele specific hybridization (ASH), detection of amplified variable sequences of the plant genome, detection of self-sustained sequence replication, detection of simple sequence repeats (SSRs), detection of randomly amplified polymorphic DNA (RAPD), detection of single nucleotide polymorphisms (SNPs), and/or detection of amplified fragment length polymorphisms (AFLPs). Thus, in some embodiments of this invention, such well known methods can be used to detect the SNP alleles as defined herein.

    [0062] Accordingly, in some embodiments of this invention, a marker is detected by amplifying a Glycine sp. nucleic acid with two oligonucleotide primers by, for example, the polymerase chain reaction (PCR).

    [0063] A marker allele, also described as an allele of a marker locus, can refer to one of a plurality of polymorphic nucleotide sequences found at a marker locus in a population that is polymorphic for the marker locus.

    [0064] Marker-assisted selection (MAS) or marker-assisted breeding is a process by which phenotypes are selected based on marker genotypes. Marker assisted selection/breeding includes the use of marker genotypes for identifying plants for inclusion in and/or removal from a breeding program or planting.

    [0065] As used herein, the terms marker locus and marker loci refer to a specific chromosome location or locations in the genome of an organism where a specific marker or markers can be found. A marker locus can be used to track the presence of a second linked locus, e.g., a linked locus that encodes or contributes to expression of a phenotypic trait. For example, a marker locus can be used to monitor segregation of alleles at a locus, such as a QTL or single gene, that are genetically or physically linked to the marker locus.

    [0066] As used herein, the terms marker probe and probe refer to a nucleotide sequence or nucleic acid molecule that can be used to detect the presence of one or more particular alleles within a marker locus (e.g., a nucleic acid probe that is complementary to all of or a portion of the marker or marker locus, through nucleic acid hybridization). Marker probes comprising about 8, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more contiguous nucleotides can be used for nucleic acid hybridization. Alternatively, in some aspects, a marker probe refers to a probe of any type that is able to distinguish (i.e., genotype) the particular allele that is present at a marker locus.

    [0067] As used herein, the term molecular marker can be used to refer to a genetic marker, as defined above, or an encoded product thereof (e.g., a protein) used as a point of reference when identifying a linked locus. A molecular marker can be derived from genomic nucleotide sequences or from expressed nucleotide sequences (e.g., from a spliced RNA, a cDNA, etc.). The term also refers to nucleotide sequences complementary to or flanking the marker sequences, such as nucleotide sequences used as probes and/or primers capable of amplifying the marker sequence. Nucleotide sequences are complementary when they specifically hybridize in solution, e.g., according to Watson-Crick base pairing rules. Some of the markers described herein can also be referred to as hybridization markers when located on an indel region. This is because the insertion region is, by definition, a polymorphism vis-?-vis a plant without the insertion. Thus, the marker need only indicate whether the indel region is present or absent. Any suitable marker detection technology can be used to identify such a hybridization marker, e.g., SNP technology.

    [0068] As used herein, the term primer refers to an oligonucleotide which is capable of annealing to a nucleic acid target and serving as a point of initiation of DNA synthesis when placed under conditions in which synthesis of a primer extension product is induced (e.g., in the presence of nucleotides and an agent for polymerization such as DNA polymerase and at a suitable temperature and pH). A primer (in some embodiments an extension primer and in some embodiments an amplification primer) is in some embodiments single stranded for maximum efficiency in extension and/or amplification. In some embodiments, the primer is an oligodeoxyribonucleotide. A primer is typically sufficiently long to prime the synthesis of extension and/or amplification products in the presence of the agent for polymerization. The minimum lengths of the primers can depend on many factors, including, but not limited to temperature and composition (A/T vs. G/C content) of the primer. In the context of amplification primers, these are typically provided as a pair of bi-directional primers consisting of one forward and one reverse primer or provided as a pair of forward primers as commonly used in the art of DNA amplification such as in PCR amplification. As such, it will be understood that the term primer, as used herein, can refer to more than one primer, particularly in the case where there is some ambiguity in the information regarding the terminal sequence(s) of the target region to be amplified. Hence, a primer can include a collection of primer oligonucleotides containing sequences representing the possible variations in the sequence or includes nucleotides which allow a typical base pairing.

    [0069] Primers can be prepared by any suitable method. Methods for preparing oligonucleotides of specific sequence are known in the art, and include, for example, cloning and restriction of appropriate sequences and direct chemical synthesis. Chemical synthesis methods can include, for example, the phospho di- or tri-ester method, the diethylphosphoramidate method and the solid support method disclosed in U.S. Pat. No. 4,458,066.

    [0070] Primers can be labeled, if desired, by incorporating detectable moieties by for instance spectroscopic, fluorescence, photochemical, biochemical, immunochemical, or chemical moieties.

    [0071] The PCR method is well described in handbooks and known to the skilled person. After amplification by PCR, target polynucleotides can be detected by hybridization with a probe polynucleotide which forms a stable hybrid with that of the target sequence under stringent to moderately stringent hybridization and wash conditions. If it is expected that the probes are essentially completely complementary (i.e., about 99% or greater) to the target sequence, stringent conditions can be used. If some mismatching is expected, for example if variant strains are expected with the result that the probe will not be completely complementary, the stringency of hybridization can be reduced. In some embodiments, conditions are chosen to rule out non-specific/adventitious binding. Conditions that affect hybridization, and that select against non-specific binding are known in the art, and are described in, for example, Sambrook & Russell (2001). Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., United States of America. Generally, lower salt concentration and higher temperature hybridization and/or washes increase the stringency of hybridization conditions.

    [0072] As used herein, the term probe refers to a single-stranded oligonucleotide sequence that will form a hydrogen-bonded duplex with a complementary sequence in a target nucleic acid sequence analyte or its cDNA derivative.

    [0073] Different nucleotide sequences or polypeptide sequences having homology are referred to herein as homologues. The term homologue includes homologous sequences from the same and other species and orthologous sequences from the same and other species. Homology refers to the level of similarity between two or more nucleotide sequences and/or amino acid sequences in terms of percent of positional identity (i.e., sequence similarity or identity). Homology also refers to the concept of similar functional properties among different nucleic acids, amino acids, and/or proteins.

    [0074] As used herein, the phrase nucleotide sequence homology refers to the presence of homology between two polynucleotides. Polynucleotides have homologous sequences if the sequence of nucleotides in the two sequences is the same when aligned for maximum correspondence. The percentage of sequence homology for polynucleotides, such as 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99 or 100 percent sequence homology, can be determined by comparing two optimally aligned sequences over a comparison window (e.g., about 20-200 contiguous nucleotides), wherein the portion of the polynucleotide sequence in the comparison window can include additions or deletions (i.e., gaps) as compared to a reference sequence for optimal alignment of the two sequences. Optimal alignment of sequences for comparison can be conducted by computerized implementations of known algorithms, or by visual inspection. Readily available sequence comparison and multiple sequence alignment algorithms are, respectively, the Basic Local Alignment Search Tool (BLAST?; Altschul et al. (1990) J Mol Biol 215:403-10; Altschul et al. (1997) Nucleic Acids Res 25:3389-3402) and ClustalX (Chenna et al. (2003) Nucleic Acids Res 31:3497-3500) programs, both available on the Internet. Other suitable programs include, but are not limited to, GAP, BestFit, PlotSimilarity, and FASTA, which are part of the Accelrys GCG Package available from Accelrys Software, Inc. of San Diego, Calif., United States of America.

    [0075] As used herein sequence identity refers to the extent to which two optimally aligned polynucleotide or polypeptide sequences are invariant throughout a window of alignment of components, e.g., nucleotides or amino acids. Identity can be readily calculated by known methods including, but not limited to, those described in: Computational Molecular Biology (Lesk, A. M., ed.) Oxford University Press, New York (1988); Biocomputing: Informatics and Genome Projects (Smith, D. W., ed.) Academic Press, New York (1993); Computer Analysis of Sequence Data, Part I (Griffin, A. M., and Griffin, H. G., eds.) Humana Press, New Jersey (1994); Sequence Analysis in Molecular Biology (von Heinje, G., ed.) Academic Press (1987); and Sequence Analysis Primer (Gribskov, M. and Devereux, J., eds.) Stockton Press, New York (1991).

    [0076] As used herein, the term substantially identical or corresponding to means that two nucleotide sequences have at least 50%, 60%, 70%, 75%, 80%, 85%, 90% or 95% sequence identity. In some embodiments, the two nucleotide sequences can have at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity.

    [0077] An identity fraction for aligned segments of a test sequence and a reference sequence is the number of identical components which are shared by the two aligned sequences divided by the total number of components in the reference sequence segment, i.e., the entire reference sequence or a smaller defined part of the reference sequence. Percent sequence identity is represented as the identity fraction multiplied by 100. As used herein, the term percent sequence identity or percent identity refers to the percentage of identical nucleotides in a linear polynucleotide sequence of a reference (query) polynucleotide molecule (or its complementary strand) as compared to a test (subject) polynucleotide molecule (or its complementary strand) when the two sequences are optimally aligned (with appropriate nucleotide insertions, deletions, or gaps totaling less than 20 percent of the reference sequence over the window of comparison). In some embodiments, percent identity can refer to the percentage of identical amino acids in an amino acid sequence.

    [0078] Optimal alignment of sequences for aligning a comparison window is well known to those skilled in the art and can be conducted by tools such as the local homology algorithm of Smith and Waterman, the homology alignment algorithm of Needleman and Wunsch, the search for similarity method of Pearson and Lipman, and optionally by computerized implementations of these algorithms such as GAP, BESTFIT, FASTA, and TFASTA available as part of the GCG? Wisconsin Package? (Accelrys Inc., Burlington, Mass.). The comparison of one or more polynucleotide sequences can be to a full-length polynucleotide sequence or a portion thereof, or to a longer polynucleotide sequence. For purposes of this invention percent identity can also be determined using BLAST? X version 2.0 for translated nucleotide sequences and BLAST? N version 2.0 for polynucleotide sequences.

    [0079] The percent of sequence identity can be determined using the Best Fit or Gap program of the Sequence Analysis Software Package? (Version 10; Genetics Computer Group, Inc., Madison, Wis.). Gap utilizes the algorithm of Needleman and Wunsch (Needleman and Wunsch, J Mol. Biol. 48:443-453, 1970) to find the alignment of two sequences that maximizes the number of matches and minimizes the number of gaps. BestFit performs an optimal alignment of the best segment of similarity between two sequences and inserts gaps to maximize the number of matches using the local homology algorithm of Smith and Waterman (Smith and Waterman, Adv. Appl. Math., 2:482-489, 1981, Smith et al. Nucleic Acids Res. 11:2205-2220, 1983).

    [0080] Useful methods for determining sequence identity are also disclosed in Guide to Huge Computers (Martin J. Bishop, ed., Academic Press, San Diego (1994)), and Carillo et al. (Applied Math 48:1073 (1988)). More particularly, preferred computer programs for determining sequence identity include but are not limited to the Basic Local Alignment Search Tool (BLAST?) programs which are publicly available from National Center Biotechnology Information (NCBI) at the National Library of Medicine, National Institute of Health, Bethesda, Md. 20894; see BLAST? Manual, Altschul et al., NCBI, NLM, NIH; (Altschul et al., J. Mol. Biol. 215:403-410 (1990)); version 2.0 or higher of BLAST? programs allows the introduction of gaps (deletions and insertions) into alignments; for peptide sequence BLAST? X can be used to determine sequence identity; and for polynucleotide sequence BLAST? N can be used to determine sequence identity.

    [0081] As used herein, the terms phenotype, phenotypic trait or trait refer to one or more traits of an organism. The phenotype can be observable to the naked eye, or by any other means of evaluation known in the art, e.g., microscopy, biochemical analysis, or an electromechanical assay. In some cases, a phenotype is directly controlled by a single gene or genetic locus, i.e., a single gene trait. In other cases, a phenotype is the result of several genes.

    [0082] As used herein, the term polymorphism refers to a variation in the nucleotide sequence at a locus, where said variation is too common to be due merely to a spontaneous mutation. A polymorphism must have a frequency of at least about 1% in a population. A polymorphism can be a single nucleotide polymorphism (SNP), or an insertion/deletion polymorphism, also referred to herein as an indel. Additionally, the variation can be in a transcriptional profile or a methylation pattern. The polymorphic site or sites of a nucleotide sequence can be determined by comparing the nucleotide sequences at one or more loci in two or more germplasm entries.

    [0083] As used herein, the term plant can refer to a whole plant, any part thereof, or a cell or tissue culture derived from a plant. Thus, the term plant can refer, as indicated by context, to a whole plant, a plant component or a plant organ (e.g., leaves, stems, roots, etc.), a plant tissue, a seed and/or a plant cell. A plant cell is a cell of a plant, taken from a plant, or derived through culture from a cell taken from a plant.

    [0084] The term Cannabis or cannabis refers to a genus of flowering plants in the family Cannabaceae. Cannabis is an annual, dioecious, flowering herb that, by some taxonomic approaches, includes, but is not limited to three different species, Cannabis sativa, Cannabis indica and Cannabis ruderalis. Other taxonomists argue that the genus Cannabis is monospecific, and use sativa as the species name. The genus Cannabis is inclusive.

    [0085] As used herein, the term plant part includes but is not limited to embryos, pollen, seeds, leaves, flowers (including but not limited to anthers, ovules and the like), fruit, stems or branches, roots, root tips, cells including cells that are intact in plants and/or parts of plants, protoplasts, plant cell tissue cultures, plant calli, plant clumps, and the like. Thus, a plant part includes Cannabis tissue culture from which Cannabis plants can be regenerated. Further, as used herein, plant cell refers to a structural and physiological unit of the plant, which comprises a cell wall and also can refer to a protoplast. A plant cell of the present invention can be in the form of an isolated single cell or can be a cultured cell or can be a part of a higher-organized unit such as, for example, a plant tissue or a plant organ.

    [0086] As used herein, the term population refers to a genetically heterogeneous collection of plants sharing a common genetic derivation.

    [0087] As used herein, the terms progeny, progeny plant, and/or offspring refer to a plant generated from a vegetative or sexual reproduction from one or more parent plants. A progeny plant can be obtained by cloning or selfing a single parent plant, or by crossing two parental plants and includes selfings as well as the F1 or F2 or still further generations. An F1 is a first-generation offspring produced from parents at least one of which is used for the first time as donor of a trait, while offspring of second generation (F2) or subsequent generations (F3, F4, and the like) are specimens produced from selfings or crossings of F1s, F2s and the like. An F1 can thus be (and in some embodiments is) a hybrid resulting from a cross between two true breeding parents (the phrase true-breeding refers to an individual that is homozygous for one or more traits), while an F2 can be (and in some embodiments is) an offspring resulting from self-pollination of the F1 hybrids.

    [0088] As used herein, the term reference sequence refers to a defined nucleotide sequence used as a basis for nucleotide sequence comparison. The reference sequence for a marker, for example, can be obtained by genotyping a number of lines at the locus or loci of interest, aligning the nucleotide sequences in a sequence alignment program, and then obtaining the consensus sequence of the alignment. Hence, a reference sequence identifies the polymorphisms in alleles at a locus. A reference sequence need not be a copy of an actual nucleic acid sequence from a relevant organism; however, a reference sequence is useful for designing primers and probes for actual polymorphisms in the locus or loci.

    Genetic Mapping

    [0089] Genetic loci correlating with particular phenotypes, such as photoperiod sensitivity, can be mapped in an organism's genome. By identifying a marker or cluster of markers that co-segregate with a trait of interest, the breeder is able to rapidly select a desired phenotype by selecting for the proper marker (a process called marker-assisted selection). Such markers can also be used by breeders to design genotypes in silico and to practice whole genome selection.

    [0090] The present invention provides markers associated with autoflower. Detection of these markers and/or other linked markers can be used to identify, select and/or produce plants having the autoflower phenotype and/or to eliminate plants from breeding programs or from planting that do not have the autoflower phenotype.

    [0091] Alleles, genomic sequences, markers, and methods for providing a Cannabis plant with a modulated day-length sensitivity phenotype are provided.

    Markers Associated with Autoflower

    [0092] Molecular markers are used for the visualization of differences in nucleic acid sequences. This visualization can be due to DNA-DNA hybridization techniques after digestion with a restriction enzyme (e.g., an RFLP) and/or due to techniques using the polymerase chain reaction (e.g., SNP, STS, SSR/microsatellites, AFLP, and the like). In some embodiments, all differences between two parental genotypes segregate in a mapping population based on the cross of these parental genotypes. The segregation of the different markers can be compared and recombination frequencies can be calculated. Methods for mapping markers in plants are disclosed in, for example, Glick & Thompson (1993) Methods in Plant Molecular Biology and Biotechnology, CRC Press, Boca Raton, Florida, United States of America; Zietkiewicz et al. (1994) Genomics 20:176-183.

    [0093] The recombination frequencies of genetic markers on different chromosomes and/or in different linkage groups are generally 50%. Between genetic markers located on the same chromosome or in the same linkage group, the recombination frequency generally depends on the physical distance between the markers on a chromosome. A low recombination frequency typically corresponds to a low genetic distance between markers on a chromosome. Comparison of all recombination frequencies among a set of genetic markers results in the most logical order of the genetic markers on the chromosomes or in the linkage groups. This most logical order can be depicted in a linkage map. A group of adjacent or contiguous markers on the linkage map that is associated with a trait of interest can provide the position of a locus associated with that trait.

    [0094] Thus, the methods provided herein can be used for detecting the presence of the autoflower trait markers in Cannabis plant or germplasm, and can therefore be used in methods involving marker-assisted breeding and selection of Cannabis plants having the autoflower phenotype.

    [0095] Thus, methods for identifying, selecting and/or producing a Cannabis plant or germplasm with the autoflower trait can comprise detecting the presence of a genetic marker associated with the autoflower trait. The marker can be detected in any sample taken from a Cannabis plant or germplasm, including, but not limited to, the whole plant or germplasm, a portion of said plant or germplasm (e.g., a cell, leaf, seed, etc, from said plant or germplasm) or a nucleotide sequence from said plant or germplasm

    Alleles, Sequences, Markers

    [0096] In some embodiments, the invention relates to an allele for providing a modulated day-length sensitivity phenotype to a Cannabis plant, wherein the allele encodes an autoflower protein, wherein the autoflower protein is a pseudoresponse regulator (PRR) protein or a protein that interacts with a PRR protein or a protein that interacts with a protein in a PRR protein complex or a protein upstream or downstream of a signal transduction pathway of PRR.

    [0097] In some embodiments, the allele is represented by a coding sequence having at least 35% nucleotide sequence identity with the known sequence of PRR37 in Oryza sativa (hereinafter referred to as PRR37). In some embodiments, the genomic sequence can have 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95% or greater identity to PRR37 in Oryza sativa or any other species having a PRR37 gene.

    [0098] Some embodiments of the invention relate to a genomic sequence for providing an autoflower phenotype to a Cannabis plant, wherein the genomic sequence comprises 35% nucleotide sequence identity with PRR37. In some embodiments, the genomic sequence can have 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%. 95% or greater identity to PRR37.

    [0099] Further information can be found in Gao H, Jin M, Zheng X M, et al. Days to heading 7, a major quantitative locus determining photoperiod sensitivity and regional adaptation in rice. Proc Natl Acad Sci US A. 2014; 111(46):16337-16342. doi:10.1073/pnas.1418204111; and Koo B H, Yoo S C, Park J W, et al. Natural variation in OsPRR37 regulates heading date and contributes to rice cultivation at a wide range of latitudes. Mol Plant. 2013; 6(6):1877-1888. doi:10.1093/mp/sst088; each of which is fully incorporated by reference herein.

    [0100] A marker sequence can correlate with presence of a desired phenotype. Some embodiments of the invention relate to a marker indicative of presence of an allele capable of modulating day-length sensitivity in a Cannabis plant. In some embodiments, the marker is a first marker having a sequence identical to SEQ ID NO 3 or the marker is a second marker located in proximity to the first marker, wherein the proximity is sufficient to provide greater than 95%, 98%, 99%, 99.5%, or 99.9% correlation between presence of the second marker and presence of the first marker.

    [0101] The SNP identified herein as diagnostic for autoflower is designated as such because 100% of screened plants homozygous for this SNP display the autoflower phenotype. This perfect correlation between genotype and resulting phenotype is believed to be due to the SNP being at the locus of a loss-of-function mutation in the prr37 gene. Thus, any plant homozygous for this allele will have no functioning PRR37 protein, resulting in an autoflower phenotype.

    [0102] This causal relationship between a loss of PRR37 function and the autoflower phenotype is consistent with preliminary observations indicating that one or more other alleles also have a perfect correlation between their homozygous genotype and an autoflower phenotype. Such alleles are believed to represent other loss-of-function mutations in the prr37 gene.

    [0103] Thus, under this analysis, any of such alleles, if homozygous, can be sufficient to confer the autoflower phenotype, but none is be considered necessary because of the multiple lesions in the prr37 gene or its regulator regions that could equally result in loss of PRR37 function. Also, under this analysis, a plant being heterozygous for two different diagnostic alleles, each representing a different type of loss-of-function, would also be expected to display the autoflower phenotype because such plant would lack a functional PRR37 protein.

    Linkage Drag

    [0104] When plant breeding introduces a desired gene (target gene) from a donor parent to improve a cultivar for a specific trait, other genes closely linked to the target gene are also typically carried from the donor parent to the recipient cultivar. The undesired alleles of non-target genes from the donor parent, because of their close linkage with the target gene, often persist even after multiple backcrosses. The persistent non-target genes often reduce the fitness or desirability of the backcross progenya phenomenon known as linkage drag. Molecular makers offer a tool in which the amount of donor DNA can be monitored during each backcross generation, in order to reduce linkage drag.

    [0105] It is well known that efforts to introgress the AF trait into other cultivars of Cannabis result in progeny that are not as phenotypically desirable as the original photoperiod parent. This can be attributed to linkage drag. Accordingly, the markers of the present invention can be used to monitor and minimize linkage drag as plants are crossed and backcrossed in efforts to introgress AF into Value Phenotype recipient plants.

    [0106] Inheritance patterns from crosses of AF and photoperiod parents indicate that AF is determined by a recessive allele of a single gene. The markers of the present invention define a region of chromosome 1 in which this single AF locus resides. The region defined by these markers comprises 98 transcripts, according to Cannabis sativa csl0 RefSeq assembly accession: GCF_900626175.2 (Assembly [Internet]. Bethesda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2012-2022 Jan. 24. Accession No. GCF_900626175.2, cs10; Available from: www <dot> ncbi <dot> nlm <dot> nih <dot> gov <slash> assembly <slash> GCF_900626175.2). Table 1 lists genes and positions within the segment of the chromosome defined by the markers. Thus, given that only one gene controls the AF trait, many or all of the other genes listed in Table 1 contribute to linkage drag, to some degree. The invention includes a breeding protocol capable of introgressing the AF gene into a Value Phenotype recipient parent, while leaving most or all of the other genes listed in Table 1 behind, will result in an improved AF Value Phenotype cultivar.

    TABLE-US-00001 TABLE 1 seqname Cs10_Chr Start_Pos End_Pos Gene Product Marker_Num NC_044371.1 1 19342709 19347249 gene = product = protein- LOC115707983 tyrosine- phosphatase MKP1, transcript variant X1 NC_044371.1 1 19342709 19347249 gene = product = protein- LOC115707983 tyrosine- phosphatase MKP1, transcript variant X2 NC_044371.1 1 19347249 19354466 Intergenic M01, M02 NC_044371.1 1 19354466 19362100 gene = product = beta- LOC115707986 hexosaminidase 1 NC_044371.1 1 19368217 19380104 gene = product = probable LOC115707984 DNA double-strand break repair Rad50 ATPase NC_044371.1 1 19381034 19403194 gene = product = probable M03 LOC115707987 membrane- associated kinase regulator 4 NC_044371.1 1 19411191 19415240 gene = product = ankyrin M04, LOC115707985 repeat-containing M05 protein ITN1 NC_044371.1 1 19586800 19590447 gene = product = LOC115706681 uncharacterized LOC115706681, transcript variant X2 NC_044371.1 1 19586801 19591181 gene = product = LOC115706681 uncharacterized LOC115706681, transcript variant X1 NC_044371.1 1 19623001 19626945 gene = product = protein LOC115708189 NRT1/PTR FAMILY 2.7 NC_044371.1 1 19670607 19672347 gene = product = LOC115703863 uncharacterized LOC115703863 NC_044371.1 1 19675794 19679721 gene = product = protein LOC115706683 NRT1/PTR FAMILY 2.7-like NC_044371.1 1 19679721 19691506 Intergenic M06, M07 NC_044371.1 1 19691506 19696923 gene = product = nuclear M08, LOC115706176 transcription factor M09 Y subunit B-1, transcript variant X2 NC_044371.1 1 19691506 19696923 gene = product = nuclear M08, LOC115706176 transcription factor M09 Y subunit B-1, transcript variant X4 NC_044371.1 1 19691507 19696923 gene = product = nuclear M08, LOC115706176 transcription factor M09 Y subunit B-1, transcript variant X1 NC_044371.1 1 19691507 19696923 gene = product = nuclear M08, LOC115706176 transcription factor M09 Y subunit B-1, transcript variant X3 NC_044371.1 1 19691507 19696923 gene = product = nuclear M08, LOC115706176 transcription factor M09 Y subunit B-1, transcript variant X5 NC_044371.1 1 19712612 19715469 gene = product = probable M10, LOC115704691 RNA-binding M11 protein ARP1 NC_044371.1 1 19715469 19726723 Intergenic M12, M13 NC_044371.1 1 19726723 19728921 gene = product = floral LOC115708151 homeotic protein APETALA 2, transcript variant X1 NC_044371.1 1 19726723 19728918 gene = product = floral LOC115708151 homeotic protein APETALA 2, transcript variant X2 NC_044371.1 1 19778639 19780198 gene = product = LOC115703865 uncharacterized LOC115703865 NC_044371.1 1 19782063 19783840 gene = product = LOC115703866 uncharacterized LOC115703866 NC_044371.1 1 19802609 19815150 gene = product = regulator M14, LOC115706264 of nonsense M15, transcripts UPF2 M16 NC_044371.1 1 19822088 19823007 gene = product = LOC115703868 uncharacterized LOC115703868 NC_044371.1 1 19826131 19827204 gene = product = LOC115703869 uncharacterized LOC115703869 NC_044371.1 1 19843513 19847204 gene = product = zinc finger LOC115706080 CCCH domain- containing protein 11 NC_044371.1 1 19849983 19850489 gene = product = LOC115703870 uncharacterized LOC115703870 NC_044371.1 1 19860264 19863668 gene = product = protein LOC115703871 TONNEAU 1a-like NC_044371.1 1 19863668 19985933 Intergenic M17, M18 NC_044371.1 1 19985933 19992033 gene = product = two- M19, LOC115705128 component M20, response regulator- M21 like PRR37 NC_044371.1 1 19992033 20010950 Intergenic M22 NC_044371.1 1 20010950 20018438 gene = product = TBC1 M23, LOC115704703 domain family M24, member 8B M25 NC_044371.1 1 20018438 20032520 Intergenic M26 NC_044371.1 1 20032520 20036951 gene = product = CDP- LOC115705441 diacylglycerol glycerol-3- phosphate 3- phosphatidyltransferase 2 NC_044371.1 1 20574051 20576803 gene = product = LOC115705487 uncharacterized LOC115705487 NC_044371.1 1 20595436 20599191 gene = product = LOC115703873 uncharacterized LOC115703873 NC_044371.1 1 20615998 20619859 gene = product = WD LOC115708215 repeat-containing protein WRAP73, transcript variant X1 NC_044371.1 1 20615998 20619859 gene = product = WD LOC115708215 repeat-containing protein WRAP73, transcript variant X2 NC_044371.1 1 20640845 20644771 gene = product = protein LOC115706652 IQ-DOMAIN 1- like NC_044371.1 1 20653407 20659939 gene = product = calcium- LOC115705663 binding mitochondrial carrier protein SCaMC-1-like NC_044371.1 1 20664332 20664739 gene = product = low LOC115707338 temperature- induced protein lt101.2 NC_044371.1 1 20667500 20669307 gene = product = LOB LOC115704698 domain-containing protein 1 NC_044371.1 1 20696892 20698904 gene = product = LOC115708282 uncharacterized LOC115708282 NC_044371.1 1 20698904 20713556 Intergenic M27 NC_044371.1 1 20713556 20727975 gene = product = Golgi to M28, LOC115705207 ER traffic protein 4 M29, homolog M30, M31, M32, M33, M34, M35, M36 NC_044371.1 1 20735420 20738200 gene = product = LOC115703875 uncharacterized LOC115703875 NC_044371.1 1 20760091 20762582 gene = product = LOC115703876 uncharacterized LOC115703876 NC_044371.1 1 20762582 20775753 Intergenic M37, M38, M39, M40, M41 NC_044371.1 1 20775753 20778199 gene = product = LOC115703877 uncharacterized LOC115703877 NC_044371.1 1 20790932 20795500 gene = product = LOC115706745 uncharacterized LOC115706745, transcript variant X1 NC_044371.1 1 20790932 20795500 gene = product = LOC115706745 uncharacterized LOC115706745, transcript variant X2 NC_044371.1 1 20816258 20818673 gene = product = protein LOC115703878 FAR1-RELATED SEQUENCE 5-like NC_044371.1 1 20830310 20833207 gene = product = LOC115703879 uncharacterized LOC115703879 NC_044371.1 1 20852425 20858895 gene = product = pre-rRNA- LOC115706767 processing protein TSR1 homolog NC_044371.1 1 20861533 20868270 gene = product = LOC115706769 phosphoglucomutase NC_044371.1 1 20874609 20881142 gene = product = M42 LOC115706728 endoplasmic reticulum metallopeptidase 1- like NC_044371.1 1 20892287 20897961 gene = product = DNA LOC115706762 polymerase epsilon subunit 3-like NC_044371.1 1 20898688 20900527 gene = product = LOC115703880 uncharacterized LOC115703880 NC_044371.1 1 20901023 20905614 gene = product = 3- LOC115706743 hydroxyisobutyryl- CoA hydrolase-like protein 2, mitochondrial NC_044371.1 1 20957532 20960672 gene = product = LOC115703881 bifunctional dihydrofolate reductase- thymidylate synthase 1-like NC_044371.1 1 20962955 20970736 gene = product = LOC115706734 diaminopimelate decarboxylase 2, chloroplastic NC_044371.1 1 20996324 20998378 gene = product = LOC115703882 uncharacterized LOC115703882 NC_044371.1 1 20998925 20999638 gene = product = protein LOC115706761 PXR1-like NC_044371.1 1 21021481 21025532 gene = product = mRNA- M43 LOC115706748 decapping enzyme subunit 2 NC_044371.1 1 21030259 21033631 gene = product = DNA LOC115706763 polymerase epsilon subunit 3 NC_044371.1 1 21044054 21048463 gene = product = 3- LOC115706744 hydroxyisobutyryl- CoA hydrolase-like protein 2, mitochondrial NC_044371.1 1 21082797 21086224 gene = product = aquaporin LOC115706754 PIP2-2 NC_044371.1 1 21100198 21104415 gene = product = LOC115706733 bifunctional dihydrofolate reductase- thymidylate synthase, transcript variant X5 NC_044371.1 1 21105580 21109352 gene = product = LOC115706735 diaminopimelate decarboxylase 2, chloroplastic-like NC_044371.1 1 21134331 21139980 gene = product = LOC115703883 phosphatidylinositol/ phosphatidylcholine transfer protein SFH3-like NC_044371.1 1 21142406 21146635 gene = product = trafficking LOC115706760 protein particle complex subunit 1, transcript variant X1 NC_044371.1 1 21142554 21144446 gene = product = trafficking LOC115706760 protein particle complex subunit 1, transcript variant X2 NC_044371.1 1 21142554 21144432 gene = product = trafficking LOC115706760 protein particle complex subunit 1, transcript variant X3 NC_044371.1 1 21147123 21147770 gene = product = LOC115703884 uncharacterized LOC115703884 NC_044371.1 1 21152489 21155502 gene = product = LOC115706764 uncharacterized LOC115706764, transcript variant X1 NC_044371.1 1 21152489 21155502 gene = product = LOC115706764 uncharacterized LOC115706764, transcript variant X2 NC_044371.1 1 21152489 21155502 gene = product = LOC115706764 uncharacterized LOC115706764, transcript variant X4 NC_044371.1 1 21152581 21155502 gene = product = LOC115706764 uncharacterized LOC115706764, transcript variant X3 NC_044371.1 1 21152591 21155502 gene = product = LOC115706764 uncharacterized LOC115706764, transcript variant X5 NC_044371.1 1 21155973 21157289 gene = product = LOC115706749 caffeoylshikimate esterase NC_044371.1 1 21157426 21161133 gene = product = WPP LOC115706727 domain-associated protein NC_044371.1 1 21165867 21168970 gene = product = M44 LOC115706732 asparagine tRNA ligase, cytoplasmic 1 NC_044371.1 1 21171737 21172419 gene = product = sulfated LOC115703886 surface glycoprotein 185 NC_044371.1 1 21178192 21184371 gene = product = patatin- M45, LOC115706736 like protein 6 M46, M47 NC_044371.1 1 21198455 21204613 gene = product = M48, LOC115706741 chorismate synthase, M49, chloroplastic M50, M51 NC_044371.1 1 21204613 21270041 Intergenic M52 NC_044371.1 1 21270041 21271053 gene = product = LOC115703887 uncharacterized LOC115703887 NC_044371.1 1 21271053 21328132 Intergenic M53, M54, M55 NC_044371.1 1 21328132 21332291 gene = product = protein M56 LOC115706740 IQ-DOMAIN 1 NC_044371.1 1 21371455 21375371 gene = product = WD LOC115706772 repeat-containing protein WRAP73- like NC_044371.1 1 21381497 21382484 gene = product = LOC115703888 uncharacterized LOC115703888 NC_044371.1 1 21416708 21419512 gene = product = LOC115706747 uncharacterized LOC115706747 NC_044371.1 1 21433547 21437041 gene = product = 18S rRNA LOC115706751 (guanine-N(7))- methyltransferase RID2, transcript variant X1 NC_044371.1 1 21433547 21436754 gene = product = 18S rRNA LOC115706751 (guanine-N(7))- methyltransferase RID2, transcript variant X3 NC_044371.1 1 21433549 21437041 gene = product = 18S rRNA LOC115706751 (guanine-N(7))- methyltransferase RID2, transcript variant X2 NC_044371.1 1 21437550 21440586 gene = product = general LOC115706756 transcription factor IIF subunit 2 NC_044371.1 1 21447348 21462402 gene = product = beta- M57 LOC115706737 taxilin, transcript variant X1 NC_044371.1 1 21447348 21462402 gene = product = beta- M57 LOC115706737 taxilin, transcript variant X2 NC_044371.1 1 21447348 21462402 gene = product = beta- M57 LOC115706737 taxilin, transcript variant X3 NC_044371.1 1 21447348 21462402 gene = product = beta- M57 LOC115706737 taxilin, transcript variant X4 NC_044371.1 1 21447348 21462402 gene = product = beta- M57 LOC115706737 taxilin, transcript variant X5 NC_044371.1 1 21447348 21462402 gene = product = beta- M57 LOC115706737 taxilin, transcript variant X6 NC_044371.1 1 21447348 21462380 gene = product = beta- M57 LOC115706737 taxilin, transcript variant X8 NC_044371.1 1 21474635 21477538 gene = product = elongation LOC115706739 factor 1-alpha NC_044371.1 1 21477812 21479214 gene = product = M58, LOC115706758 uncharacterized M59 LOC115706758 NC_044371.1 1 21483096 21486104 gene = product = heat shock LOC115706731 protein 83

    [0107] This principle can be applied by identifying parental markers for any or all genes capable of affecting AF phenotype. AF and Value Phenotype parents in a given cross can be genotyped for various markers in this or nearby regions of chromosome 1 to identify which loci are polymorphic as to the two parents in the cross. At any locus with an allele pair, if the autoflower parent has one allele and the Value Phenotype parent has the other allele in the pair, the alleles at such locus are then identified as a Useful Allele Pair. Progeny of a given cross can be screened for one or more Useful Allele Pairs to confirm individual progeny with desirable recombinations of chromosome 1. Such progeny would carry the autoflower allele of the autoflower parent but with a reduced number of other chromosome 1 alleles of the autoflower parent. For example, each F2 individual showing the AF trait can be scored to determine the number of such markers that correspond to those of the Value Phenotype parent versus the number of such markers that correspond to the AF parent. In this approach, even in the absence of defining which gene causes the AF trait, linkage drag can be reduced by selecting for progeny showing the AF phenotype that also show the fewest AF-parent markers. In a situation in which the specific gene causing the AF trait is known, such as prr37, progeny of any cross can be screened for presence of the specific AF allele associated with a loss-of-function or change-of-function in the PRR37 protein, sufficient to result in an AF phenotype, while also screening for absence of AF-parent alleles at any or all of the other loci in this region of chromosome 1. Thus, it is within the scope of the present invention to use the markers described herein to define a region of chromosome 1 in which to identify markers useful for reducing linkage drag in breeding AF Value Phenotype plants. It is further within the scope of the present invention to address any or all of the genes that cause AF to screen in favor of Value Phenotype parental alleles for these genes, and against AF parent alleles for these genes, with the exception of the AF gene or in the presence of an AF phenotype in the plants thus screened.

    [0108] In a method of backcrossing, the autoflower trait can be introgressed into a parent having the Value Phenotype (the recurrent parent) by crossing a first plant of the recurrent parent with a second plant having the autoflower trait (the donor parent). The recurrent parent is a plant that does not have the autoflower trait but possesses a Value Phenotype. The progeny resulting from a cross between the recurrent parent and donor parent is referred to as the F1 progeny. One or several plants from the F1 progeny can be backcrossed to the recurrent parent to produce a first-generation backcross progeny (BC1). One or several plants from the BC1 can be backcrossed to the recurrent parent to produce BC2 progeny. This process can be performed for one, two, three, four, five, or more generations. At each generation including the F1, BC1, BC2 and all subsequent generations, the population can be screened for the presence of the autoflower allele using a SNP previously found to be diagnostic of AF. In principle, the progeny resulting from the process of crossing the recurrent parent with the autoflower donor parent are heterozygous for one or more genes responsible for autoflowering. When appropriate, the last backcross generation can be selfed and screened for individuals homozygous for the autoflower allele in order to provide for pure breeding (inbred) progeny with Autoflower Value Phenotype.

    [0109] In a method of backcrossing, at each generation including the F1, BC1, BC2 and all subsequent generations, the population can be screened with one or more additional background markers throughout the genome that are not known to be associated with the autoflower trait. These selected markers throughout the genome are known to be polymorphic between the recurrent parent and the donor parent. The background markers can be utilized to select against the donor parent alleles throughout the genome in favor of the recurrent parent alleles. The background markers can be utilized to preferentially select progeny at each generation including the F1, BC1, BC2 and all subsequent generations that also exhibit the presence of the desired autoflower allele(s).

    [0110] Recombinant target markers can be used to identify favorable or unfavorable alleles proximal to the desired target autoflower trait.

    [0111] In some embodiments, the markers can be defined by their position on chromosome 1, in various ways, for example, in terms of physical position or genetic position. In some embodiments, the markers can be defined by their physical position on chromosome 1, expressed as the number of base pairs from the beginning of the chromosome to the marker (using CS10 as the reference genome). In some embodiments, the markers can be defined by their genetic position on chromosome 1, expressed as the number of centimorgans (a measure of recombination frequency) from the beginning of the chromosome to the marker. In other embodiments, a marker can be defined based upon its location within a given QTL.

    Methods

    [0112] The methods provided herein can be used for detecting the presence of the autoflower trait markers in Cannabis plant or germplasm, and can therefore be used in methods involving marker-assisted breeding and selection of Cannabis plants having the autoflower phenotype.

    [0113] Thus, methods for identifying, selecting and/or producing a Cannabis plant or germplasm with the autoflower trait can comprise detecting the presence of a genetic marker associated with the autoflower trait. The marker can be detected in any sample taken from a Cannabis plant or germplasm, including, but not limited to, the whole plant or germplasm, a portion of said plant or germplasm (e.g., a cell, leaf, seed, etc, from said plant or germplasm) or a nucleotide sequence from said plant or germplasm.

    [0114] Breeding methods can include recurrent, bulk or mass selection, pedigree breeding, open pollination breeding, marker assisted selection/breeding, double haploids development and selection breeding. Double haploids are produced by the doubling of a set of chromosomes (1 N) from a heterozygous plant to produce a completely homozygous individual.

    [0115] The invention relates to molecular markers and marker-assisted breeding of autoflower Cannabis plants. Specifically, in the context of breeding to develop Autoflower Value Phenotype varieties, a molecular marker correlating strongly with the autoflower trait can permit very early testing of progeny of a cross to identify those progeny that possess one or more autoflower alleles and discard those individuals that do not. This permits shifting the allele frequency of any plants remaining in the breeding pool, after such screening, to eliminate any plants that do not have at least one autoflower allele. In some embodiments of the invention, the analysis is capable of distinguishing between individuals that are homozygous for the autoflower allele versus those that are heterozygous. In such situations it can be advantageous to discard any heterozygous individuals.

    [0116] Additional breeding methods that, in some embodiments, can be combined with marker-assisted breeding are known to those of ordinary skill in the art and include, e.g., methods discussed in Chahal and Gosal (Principles and procedures of plant breeding: biotechnological and conventional approaches, CRC Press, 2002, ISBN 084931321X, 9780849313219); Taji et al. (In vitro plant breeding, Routledge, 2002, ISBN 156022908X, 9781560229087); Richards (Plant breeding systems, Taylor & Francis U S, 1997, ISBN 0412574500, 9780412574504); Hayes (Methods of Plant Breeding, Publisher: READ BOOKS, 2007, ISBN1406737062, 9781406737066); each of which is incorporated by reference in its entirety. The Cannabis genome has been sequenced (Bakel et al., The draft genome and transcriptome of Cannabis sativa, Genome Biology, 12(10): R102, 2011). Molecular makers for Cannabis plants are described in Datwyler et al. (Genetic variation in hemp and marijuana (Cannabis sativa L.) according to amplified fragment length polymorphisms, J Forensic Sci. 2006 March; 51(2):371-5.); Pinarkara et al., (RAPD analysis of seized marijuana (Cannabis sativa L.) in Turkey, Electronic Journal of Biotechnology, 12(1), 2009), Hakki et al., (Inter simple sequence repeats separate efficiently hemp from marijuana (Cannabis sativa L.), Electronic Journal of Biotechnology, 10(4), 2007); Gilmore et al. (Isolation of microsatellite markers in Cannabis sativa L. (marijuana), Molecular Ecology Notes, 3(1): 105-107, March 2003); Pacifico et al., (Genetics and marker-assisted selection of chemotype in Cannabis sativa L.), Molecular Breeding (2006) 17:257-268); and Mendoza et al., (Genetic individualization of Cannabis sativa by a short tandem repeat multiplex system, Anal Bioanal Chem (2009) 393:719-726); each of which is herein incorporated by reference in its entirety.

    [0117] Additional breeding methods that can be used in certain embodiments of the invention, can be found, for example in, U.S. patent Ser. No. 10/441,617B2.

    [0118] Some embodiments of the invention relate to a method for providing a Cannabis plant with a modulated day-length sensitivity phenotype. The method can include: [0119] a) selecting an autoflower Cannabis plant, designated as the first Cannabis plant, wherein the selection comprises any of: detecting an autoflower phenotype in a plant, or establishing the presence of an autoflower allele or autoflower genomic sequence; [0120] b) transferring the autoflower allele or autoflower genomic sequence of step a) into a recipient Cannabis plant, thereby conferring a modulated day-length sensitivity phenotype to the recipient Cannabis plant; and [0121] c) detecting presence of an autoflower allele in the recipient Cannabis plant wherein at least the selecting of step a) and/or the detecting of step c) comprises use of any of the markers disclosed herein wherein the marker indicative of the autoflower allele.

    [0122] Establishing the presence of the allele or the corresponding genomic sequence can be done using any standard means in the art, for example, by presence of absence of any of the markers described herein, or by observation of the autoflower phenotype, or by detection of the protein product of the autoflower gene.

    [0123] Transferring the allele or genomic sequence can be done by breeding and/or genetic manipulation.

    [0124] For example, in some embodiments, transferring the allele or genomic sequence can include a cross of the first Cannabis plant with a second Cannabis plant that does not have a modulated day-length sensitivity phenotype, and subsequently selecting a recipient Cannabis plant that has a modulated day-length sensitivity phenotype. Offspring can also be screened for presence of a diagnostic marker, such as any of the markers described herein, to enable discarding undesired offspring at an early stage of development.

    [0125] In other embodiments, transferring the allele or genomic sequence can include a technique selected from genetic transformation, gene editing, gene inactivation, or gene deletion. Methods can include, for example, using any method for introducing site specific modification, including, but not limited to, through the use of gene repair oligonucleotides (e.g. US Patent Publication 2013/0019349), or through the use of double-stranded break technologies such as TALENs, meganucleases, zinc finger nucleases, CRISPR-Cas, and the like.

    [0126] In some embodiments, establishing the presence of the autoflower allele or autoflower conferring genomic sequence in a Cannabis plant can include use of one or more markers as described herein, wherein the marker indicates presence of an allele that encodes an autoflower protein, wherein the autoflower protein is a PRR protein or a protein that interacts with a PRR protein or a protein that interacts with a protein in a PRR protein complex or a protein upstream or downstream of a signal transduction pathway of PRR.

    [0127] Some embodiments of the invention relate to a method of producing a Cannabis plant having a modulated day-length sensitivity phenotype. The method can include: [0128] a) growing at least one plant expressing an exogenous or modified regulatory protein, wherein the plant includes an exogenous or modified nucleic acid, wherein the exogenous or modified nucleic acid includes a regulatory region operably linked to a nucleic acid encoding said regulatory protein, wherein the regulatory protein is a PRR protein or a protein that interacts with a PRR protein or a protein that interacts with a protein in a PRR protein complex or a protein upstream or downstream of a signal transduction pathway of PRR, wherein the exogenous or modified regulatory protein is capable of modulating day-length sensitivity of the plant; and/or [0129] b) producing at least one plant with a modulated day-length sensitivity phenotype.

    [0130] In some embodiments, the regulatory region can be a promoter. The promoter can be a tissue-specific promoter. For example, the promoter can be expressed in inflorescence tissue or leaf tissue. In other embodiments, the promoter is a cell-type-specific promoter. In some embodiments, the promoter is an inducible promoter.

    [0131] The term regulatory region refers to nucleotide sequences that influence transcription or translation initiation and rate, and stability and/or mobility of a transcription or translation product. Regulatory regions include, without limitation, promoter sequences, enhancer sequences, response elements, protein recognition sites, inducible elements, protein binding sequences, 5 and 3 untranslated regions (UTRs), transcriptional start sites, termination sequences, polyadenylation sequences, and introns.

    [0132] As used herein, the term operably linked refers to positioning of a regulatory region and a sequence to be transcribed in a nucleic acid so as to influence transcription or translation of such a sequence. For example, to bring a coding sequence under the control of a promoter, the translation initiation site of the translational reading frame of the polypeptide is typically positioned between one and about fifty nucleotides downstream of the promoter. A promoter can, however, be positioned as much as about 5,000 nucleotides upstream of the translation initiation site, or about 2,000 nucleotides upstream of the transcription start site. A promoter typically comprises at least a core (basal) promoter. A promoter also may include at least one control element, such as an enhancer sequence, an upstream element or an upstream activation region (UAR). For example, a suitable enhancer is a cis-regulatory element (?212 to ?154) from the upstream region of the octopine synthase (ocs) gene. Fromm et al., The Plant Cell, 1:977-984 (1989). The choice of promoters to be included depends upon several factors, including, but not limited to, efficiency, selectability, inducibility, desired expression level, and cell- or tissue-preferential expression. It is a routine matter for one of skill in the art to modulate the expression of a coding sequence by appropriately selecting and positioning promoters and other regulatory regions relative to the coding sequence.

    [0133] Some suitable promoters initiate transcription specifically, or predominantly, in certain cell types. For example, a promoter that is active predominantly in a reproductive tissue (e.g., fruit, ovule, pollen, pistil, female gametophyte, egg cell, central cell, nucellus, suspensor, synergid cell, inflorescence, embryonic tissue, embryo sac, embryo, zygote, endosperm, integument, or seed coat) can be used. Thus, as used herein a cell type- or tissue-preferential promoter is one that drives expression preferentially in the target tissue, but may also lead to some expression in other cell types or tissues as well. Methods for identifying and characterizing promoter regions in plant genomic DNA include, for example, those described in the following references: Jordano et al., Plant Cell, 1:855-866 (1989); Bustos et al., Plant Cell, 1:839-854 (1989); Green et al., EMBO J., 7:4035-4044 (1988); Meier et al., Plant Cell, 3:309-316 (1991); and Zhang et al., Plant Physiology, 110:1069-1079 (1996).

    [0134] Examples of various classes of promoters are described below. Some of the promoters indicated below as well as additional promoters are described in more detail in U.S. patent application Ser. Nos. 60/505,689; 60/518,075; 60/544,771; 60/558,869; 60/583,691; 60/619,181; 60/637,140; 60/757,544; 60/776,307; 10/957,569; 11/058,689; 11/172,703; 11/208,308; 11/274,890; 60/583,609; 60/612,891; 11/097,589; 11/233,726; 10/950,321; PCT/US05/011105; PCT/US05/034308; and PCT/US05/23639. It will be appreciated that a promoter may meet criteria for one classification based on its activity in one plant species, and yet meet criteria for a different classification based on its activity in another plant species.

    [0135] Some embodiments of the invention relate to a method of making a Cannabis plant having a modulated day-length sensitivity phenotype. The method can include: [0136] a) introducing an exogenous nucleic acid into a plurality of plant cells, wherein the exogenous nucleic acid comprising a regulatory region operably linked to a nucleic acid encoding a regulatory protein, wherein the regulatory protein is a PRR protein or a protein that interacts with a PRR protein or a protein that interacts with a protein in a PRR protein complex or a protein upstream or downstream of a signal transduction pathway of PRR; and/or [0137] b) selecting a plant produced from the plurality of plant cells that has a modulated day-length sensitivity phenotype.

    [0138] Some embodiments of the invention relate to the use of a marker for establishing the presence of an autoflower allele or an autoflower-conferring genomic sequence in a Cannabis plant, wherein the marker indicates presence of an allele that encodes an autoflower protein. The autoflower protein can be a PRR protein or a protein that interacts with a PRR protein or a protein that interacts with a protein in a PRR protein complex or a protein upstream or downstream of a signal transduction pathway of PRR.

    [0139] As used herein, a plant with a modulated day-length sensitivity phenotype can be defined as a plant that demonstrates a different sensitivity to day length than wild type plants. For example, the phenotype can include an autoflower phenotype, attenuation of day-length sensitivity, or increase of day-length sensitivity.

    Plants, Plant Parts, Tissues, Cells, Seeds

    [0140] Some embodiments of the invention relate to plants, plant parts, tissues, cells, and/or seeds derived from a plant according to any of the methods disclosed herein.

    [0141] In addition to the Cannabis plants described herein which are the result of marker-assisted breeding without the use of genetic manipulation, also provided herein are transgenic plant cells and plants comprising at least one recombinant nucleic acid construct or exogenous nucleic acid. A recombinant nucleic acid construct or exogenous nucleic acid can include a regulatory region as described herein, a nucleic acid encoding a regulatory protein as described herein, or both. In certain cases, a transgenic plant cell or plant comprises at least two recombinant nucleic acid constructs or exogenous nucleic acids, one including a regulatory region, and one including a nucleic acid encoding the associated regulatory protein.

    [0142] A plant or plant cell used in methods of the invention contains a recombinant nucleic acid construct as described herein. A plant or plant cell can be transformed by having a construct integrated into its genome, i.e., can be stably transformed. Stably transformed cells typically retain the introduced nucleic acid with each cell division. A plant or plant cell can also be transiently transformed such that the construct is not integrated into its genome. Transiently transformed cells typically lose all or some portion of the introduced nucleic acid construct with each cell division such that the introduced nucleic acid cannot be detected in daughter cells after a sufficient number of cell divisions. Both transiently transformed and stably transformed transgenic plants and plant cells can be useful in the methods described herein.

    [0143] Typically, transgenic plant cells used in methods described herein constitute part or all of a whole plant. Such plants can be grown in a manner suitable for the species under consideration, either in a growth chamber, a greenhouse, or in a field. Transgenic plants can be bred as desired for a particular purpose, e.g., to introduce a recombinant nucleic acid into other lines, to transfer a recombinant nucleic acid to other species or for further selection of other desirable traits. Alternatively, transgenic plants can be propagated vegetatively for those species amenable to such techniques. Progeny includes descendants of a particular plant or plant line. Progeny of an instant plant include seeds formed on F1, F2, F3, F4, F5, F6 and subsequent generation plants, or seeds formed on BC1, BC2, BC3, and subsequent generation plants, or seeds formed on F1BC1, F1BC2, F1BC3, and subsequent generation plants. Seeds produced by a transgenic plant can be grown and then selfed (or outcrossed and selfed) to obtain seeds homozygous for the nucleic acid construct.

    [0144] Transgenic plant cells growing in suspension culture, or tissue or organ culture, can be useful for rapid propagation or a large number of progeny through tissue-culture techniques. For the purposes of this invention, solid and/or liquid tissue culture techniques can be used. When using solid medium, transgenic plant cells can be placed directly onto a growth medium or can be placed onto a filter film that is then placed in contact with the medium. When using liquid medium, transgenic plant cells can be placed onto a floatation device, e.g., a porous membrane that contacts the liquid medium. Solid medium typically is made from liquid medium by adding agar. For example, a solid medium can be Murashige and Skoog (MS) medium containing agar and a suitable concentration of an auxin, e.g., 2,4-dichlorophenoxyacetic acid (2,4-D), and a suitable concentration of a cytokinin, e.g., kinetin.

    [0145] When transiently transformed plant cells are used, a reporter sequence encoding a reporter polypeptide having a reporter activity can be included in the transformation procedure and an assay for reporter activity or expression can be performed at a suitable time after transformation. A suitable time for conducting the assay typically is about 1-21 days after transformation, e.g., about 1-14 days, about 1-7 days, or about 1-3 days. The use of transient assays is particularly convenient for rapid analysis in different species, or to confirm expression of a heterologous regulatory protein whose expression has not previously been confirmed in particular recipient cells.

    [0146] Techniques for introducing nucleic acids into monocotyledonous and dicotyledonous plants are known in the art, and include, without limitation, Agrobacterium-mediated transformation, viral vector-mediated transformation, electroporation and particle gun transformation, e.g., U.S. Pat. Nos. 5,538,880, 5,204,253, 6,329,571 and 6,013,863. If a cell or tissue culture is used as the recipient tissue for transformation, plants can be regenerated from transformed cultures if desired, by techniques known to those skilled in the art. See, e.g., Niu et al., Plant Cell Rep. V19:304-310 (2000); Chang and Yang, Bot. Bull. Acad. Sin., V37:35-40 (1996), and Han et al., Biotechnology in Agriculture and Forestry, V44:291 (ed. by Y. P. S. Bajaj), Springer-Verlag, (1999).

    [0147] A population of transgenic plants can be screened and/or selected for those members of the population that have a desired trait or phenotype conferred by expression of the transgene. Selection and/or screening can be carried out over one or more generations, which can be useful to identify those plants that have a desired trait, such as an increased level of one or more terpenoid compounds. Selection and/or screening can also be carried out in more than one geographic location. In some cases, transgenic plants can be grown and selected under conditions which induce a desired phenotype or are otherwise necessary to produce a desired phenotype in a transgenic plant. In addition, selection and/or screening can be carried out during a particular developmental stage in which the phenotype is exhibited by the plant.

    [0148] Further information is provided in U.S. Pat. No. 8,124,839B2, which is fully incorporated by reference herein.

    Photoperiod Value Phenotype Autoflower Plant

    [0149] Embodiments of the invention relate to a method of plant breeding to develop an Autoflower Value Phenotype. In some embodiments, the method can include providing a first parent plant, having a phenotype defined as a Value Phenotype, wherein the Value Phenotype comprises at least one trait of interest; providing a second parent plant, having an autoflower phenotype; crossing the first and second parent plants; recovering progeny from the crossing step; screening the progeny for presence of at least one autoflower allele using a marker having at least 51% correlation with presence of the autoflower allele; selecting autoflower carrier progeny, wherein cells of said autoflower carrier progeny comprise at least one autoflower allele; conducting further breeding steps using autoflower carrier progeny crossed with plants having the Value Phenotype; repeating the screening, selecting and conducting steps until at least one plant having an Autoflower Value Phenotype is obtained. In some embodiments, the progeny is screened for presence of at least one autoflower allele using a marker having at least 60, 70, 75, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or about 100% correlation with presence of the autoflower allele.

    [0150] In some embodiments, the Value Phenotype can include at least one trait selected from: [0151] high THCA accumulation; [0152] specific cannabinoid ratio(s); [0153] a composition of terpenes and/or other aroma active or aromatic molecules; [0154] monoecy or dioecy (enable or prevent hermaphroditism); [0155] branchless or branched architectures with specific height to branch length ratios or total branch length; [0156] determinant growth; [0157] time to maturity; [0158] high flower to leaf ratios that enable pathogen resistance through improved airflow; [0159] high flower to leaf ratios that maximize light penetration and flower development in the vertical canopy space; [0160] a finished plant height that enables tractor farming inside high tunnels; [0161] a finished plant height and flower to leaf ratio that maximizes light penetration all the way to the ground but minimizes total plant height; [0162] trichome size; [0163] trichome density; [0164] advantageous flower structures for oil or flower production (flower diameter length, long or short internodal spacing distance, flower-to-leaf determination ratio (leafiness of flower); [0165] metabolites that provide enhanced properties to finished oil products (oxidation resistance, color stability, cannabinoid and terpene stability); [0166] specific variants affecting cannabinoid or aromatic molecule biosynthetic pathways; [0167] modulators of the flowering time phenotype that increase or decrease maturation time; [0168] flower biomass yield and composition; [0169] flower crude oil yield and composition; [0170] resistance to botrytis, powdery mildew, fusarium, pythium, cladosporium, alternaria, spider mites, broad mites, russet mites, aphids, nematodes, caterpillars, HLVd or any other Cannabis pathogen or pest of viral, bacterial, fungal, insect, or animal origin; [0171] propensity to host specific beneficial and/or endophytic microflora; [0172] heavy metal composition in tissues; [0173] specific petiole and leaf angles and lengths; [0174] and/or the like.

    [0175] Some embodiments of the invention relate to a plant or plant part produced by the method described above.

    [0176] Some embodiments of the invention relate to a Cannabis plant comprising an autoflower allele and an allele of a Value Phenotype.

    [0177] Further information can be found in U.S. Provisional Application No. 63/150,381, filed on Feb. 17, 2021; U.S. application Ser. No. 17/651,310, filed on Feb. 16, 2022; and International Application No. PCT/US2022/070696, filed Feb. 17, 2022, which are hereby fully incorporated by reference herein.

    [0178] The present invention provides a method of identifying and/or selecting a Cannabis plant or germplasm with the autoflower trait, comprising detecting, in said plant or germplasm, the presence of a homozygous T allele at position 19,988,827 of chromosome 1 of reference genome sequence for CS10 Genomics Database Accession GCA_900626175.2 CS10 (https://www.ncbi nlm nih.gov/assembly/GCF_900626175.2), thereby identifying and/or selecting a Cannabis plant or germplasm with the autoflower trait.

    [0179] Additionally, provided herein is a method of producing a Cannabis plant with the autoflower trait, comprising: a) detecting, in Cannabis germplasm, the presence of the T allele at position 19,988,827 of reference genome sequence of chromosome 1 for CS10 Genomics Genomics Database Accession GCA_900626175.2 CS10) producing a plant from said Cannabis germplasm, thereby producing a Cannabis plant with the autoflower trait.

    [0180] In particular embodiments of this invention, detection of the T allele described herein can comprise amplifying a region of the Cannabis genome with a primer pair comprising a first oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 1 (forward primer) and a second oligonucleotide comprising the nucleotide sequence of SEQ ID NO: 2 (reverse primer) or SEQ ID NO: 6 (alternative reverse primer) to produce an amplification product, wherein an amplification product of about 66 base pairs detects the T allele corresponding to the autoflower phenotype. An amplification product of about 66-69 base pairs resulting in a G allele from an amplification reaction employing the oligonucleotides of SEQ ID NO: 1 and SEQ ID NO: 2 identifies a Cannabis plant or germplasm lacking the autoflower allele of this invention. Other suitable candidates for primer sequences can be obtained by analysis of the genomic DNA 5 and 3 of the SEQ ID NO:5. One of skill in the art would be able to determine the appropriate PCR conditions for a suitable primer pair of this invention.

    [0181] The following examples are included to demonstrate various embodiments of the invention and are not intended to be a detailed catalog of all the different ways in which the present invention may be implemented or of all the features that may be added to the present invention. Persons skilled in the art will appreciate that numerous variations and additions to the various embodiments may be made without departing from the present invention. Hence, the following descriptions are intended to illustrate some particular embodiments of the invention, and not to exhaustively specify all permutations, combinations and variations thereof.

    EXAMPLES

    Example 1

    Identification of SNPs Associated with the Autoflower Trait

    [0182] Two Cannabis sativa accessions (CCA1_AF?CCA2_PP), were obtained to map the autoflower locus. Both accessions had been previously phenotyped for the autoflower trait. CCA1_AF displayed the autoflower phenotype or trait while CCA2_PP did not display the autoflower phenotype. In order to detect the autoflower trait by visible phenotype, the recessive autoflower (AF) must also be present in a homozygous state.

    [0183] Only SNP VAR1_20, (or chr1:19,988,827_G/T) a genomic sequence corresponding to 201 bp of reference genome CS10 (assembly from NCBI version: GCA_900626175.2 CS10) chromosome 1 position 19,988,726 to 19,988,928 base pairs was sequenced in both of the CCA2_PP and (CCA1_AF?CCA2_PP) F2 progenies. A comparison of the sequences generated from both materials identified a homozygous SNP T at bp 19,988,827 (SEQ ID NO: 3; also shown herein as the nucleotides at position 19,988,827 in the nucleotide sequence of SEQ ID NO: 5) present in CCA1_AF and the homozygous SNP G in CCA2_PP. While not to be limited by theory, the homozygous SNP T at bp 19,988,827 appears to be a genomic polymorphism that can be used as a marker that is tightly or completely and unequivocally associated with the autoflower trait. The presence of the homozygous T allele at position 19,988,827 of chromosome 1 is associated with autoflower (photoperiod insensitive) while the presence of the G allele is associated with the photoperiod sensitive phenotype. Var1_20 (or chr1:19,988,827_G/T) has been mapped in the CS10 genome to chromosome 1 and a region that has not been previously associated with the autoflower trait.

    Example 2

    Sequencing

    [0184] Whole genome: Low-coverage (Skim-Seq) data were used to detect QTL signals. Sequencing depth varied as follows: 173 samples at 2? coverage, 20 samples at 8? coverage, and a parental line (CCA2_PP) at 30? coverage. The sequencing data for 192 progeny samples passed required QC standards and were used in the QTL analysis. As a reference genome the CS10 assembly from NCBI was used, version: GCA_900626175.2. Samples were mapped to the reference genome followed by a Variant Calling pipeline using GATK and other tools to process the Skim-Seq data optimally. The segregating genotypes in the progeny were inferred for each sample at each location along the genome with 3 possible genotypes as follows: AA, AB, BB.

    Example 3

    Validation of KASPAR (VAR1_20) Assay in Wide Range of Cannabis sativa

    [0185] A wide variety of Cannabis sativa accessions (4,921 total accessions) were selected to determine if the homozygous T allele of variant1_20 (or chr1:19,988,827_G/T) mapped in the F2 population correlated with the presence of the autoflower trait in diverse genetic backgrounds of Cannabis. The materials submitted include 85 segregating F2 populations from Trials BM1C1, M5C1, Q1C1, and T2C5 (4,654 individual accessions), 46 Marker Assisted Backcrossing selections from Trials B1C1 through B60C2 (246 individual accessions), and 1 advanced inbred family from Trial A1C1 (21 individual accessions). The marker trait association was confirmed to be tightly or completely and unequivocally associated with the autoflower trait by showing a 100% correlation of the presence of the homozygous SNPs T and presence of the autoflower trait in the screened materials.

    [0186] A large collection of Cannabis accessions was obtained which represent a wide genetic diversity in Cannabis. The autoflower trait is a recessive trait which must be present in a homozygous state in order to be observed phenotypically. Individuals from a variety of accessions were sprouted and cotyledons were collected for isolation of DNA for PCR analysis. The accessions were subsequently transplanted, grown to maturity, and characterized for the autoflower phenotype. DNA isolation and analysis of the SNP by PCR was performed and data generated on all individuals are outlined in Table 2.

    TABLE-US-00002 TABLE 2 Variety of Cannabis sativa accessions evaluated for KASPAR Variant1_20 (or chr1: 19,988,827_G/T) assay and association of G/T alleles with the autoflower phenotype. Number Number Total Number Observations Observations VAR1_20 Predicted VAR1_20 Photoperiod Autoflower Genotype Phenotype Observations Phenotype Phenotype Concordance G Photoperiod 114 114 0 100% G/T Photoperiod 420 420 0 100% T Autoflower 4387 0 4387 100%

    [0187] These data demonstrate that the assay is able to detect the homozygous alleles T, G and heterozygous G/T in a wide range of Cannabis genetics. In addition, the T homozygous allele is 100% associated with the presence of the autoflower trait. These data indicate that this assay can be used as a marker for the autoflower trait in further breeding of Cannabis lines. Various molecular assays (PCR based or DNA based) can be used to detect the presence of the SNP, as are well known in the art.

    Example 4

    Linkage of SNP and Autoflower Trait

    [0188] The SNP was first confirmed to be tightly or completely and unequivocally associated with the autoflower trait by correlation of the presence of the homozygous T allele and presence of the autoflower trait in a segregating F2 population. The reverse correlation was also analyzed, where the heterozygous SNP state G/T or homozygous G state were observed and the absence of the autoflower trait was confirmed. A recombination event is defined as either the presence of the homozygous T alleles and absence of the autoflower trait; or as the homozygous G or heterozygous G/T and the presence of the autoflower trait. A recombination event can be used to determine the genetic distance between the marker (i.e., detection of the SNP T) and gene or gene locus which is responsible for autoflower. Determining genetic distance is a standard technique used by one of ordinary skill in the art.

    [0189] The segregating F2 population was generated by crossing the two accessions. F2 progeny were developed by crossing these 2 lines to first generate an F1 population as seed. The F1 population was planted and the resulting plants were allowed to self-fertilize under short day conditions (12 hours of light and dark) to generate the F2 population which was used for mapping purposes. Individuals from the F2 population were grown in a long day cycle, where the photoperiod sensitive plants will not flower, and look for the plants that do flower. The ones that flower are considered autoflower. Plants were evaluated for the presence/absence of the autoflower trait and for the SNP state at Var1_20 (or chr1:19,988,827_G/T) (homozygous T, homozygous G or heterozygous G/T). Detection of the SNP was performed by a PCR based assay. A total of 192 individuals from the F2 population were evaluated for both the genotype (SNP) and phenotype (autoflower).

    [0190] 100% correlation between the presence of the homozygous T allele and the presence of the autoflower phenotype was observed. The reverse correlation of homozygous G or heterozygous GT alleles of Var1_20 (or chr1:19,988,827_G/T) and absence of the autoflower phenotype was also observed. No recombinants were found where the plant showed the presence of the T/T alleles and the absence of autoflower trait. Using standard genetic mapping techniques, this analysis indicates that the SNP is 0 centiMorgans away from the genetic locus that is responsible for the autoflower trait. The data describe a correlation (or unequivocal statistical association) between the presence of the homozygous T allele and the autoflower trait (AF). This correlation (or unequivocal statistical association) was 100% as there was no individual that showed the autoflower trait but did not have the homozygous T allele.

    Example 5

    Phenotypic Correlation Between Autoflower and Agronomic or Composition (Value Trait) Performance

    [0191] Varieties extracted for commercial production were evaluated for different traits including, total cannabinoid concentration, total THC concentration, total terpene concentration (as mg/g of dry matter) and oil yield as % of fresh frozen biomass. Autoflower varieties showed significantly lower cannabinoid, THC, and terpene concentrations, as well as oil yield than the daylength sensitive varieties.

    [0192] Sample descriptives for total concentration of cannabinoids, THC, terpenes, and oil yield percent.

    TABLE-US-00003 TABLE 3 Terpene Cannabinoids THC Total Total Oil Total Concen- Concen- Yield Concentration tration tration Percent (mg/g) (mg/g) (mg/g) % Class AF PP AF PP AF PP AF PP # 214 341 214 341 216 154 33 155 Mate- rials Mean 134 207.5 121.7 183.1 3 5.4 4 5.9 Std. 31.8 35.5 30.5 31.8 1.4 2.5 0.5 0.9 Devi- ation P <0.001 <0.001 <0.001 <0.001 value

    [0193] These results clearly show the relationship between auto-flowering/daylength sensitivity and economically important traits in Cannabis sativa. The auto-flowering characteristic is always/generally associated with lower values of these economically important traits than daylength sensitivity. Because of the genetic structure of these two groups of materialsbeing selfed progenies of auto-flowering?daylength sensitive segregating crossesthis observation is strong evidence for the existence of negative genetic linkage between the autoflower allele at the auto-flower locus and agronomically and economically desirable traits. Breaking such negative linkage involves specific processes, including the use of specific markers outside of yet closely flanking the autoflower locus.

    Example 6

    Breeding for Improved Autoflower Materials

    [0194] A number of crosses are made between autoflower lines and PP materials (clones) with the objective of developing autoflower lines with agronomic and composition (value trait or traits) performance similar to that of the PP parent. Large (several hundred) F2 populations are developed and screened for the presence of the autoflower allele using a SNP previously found to be diagnostic of AF. Plants homozygous for the autoflower allele are selected. The selected plants are phenotyped for flowering behavior to confirm their being AF. They are also phenotyped for composition traits, based on which a further selection step is carried out. F2 plants with positive results as to all selection criteria are self-fertilized to generate F3 seed. F3 families are phenotyped for agronomic and composition traits, and selected on the basis of their performance. One or more plants from each selected family are selfed to generate the following generation. This process is followed for a number of generations, up to the F7 generation in a number of cases. All materials from F3 and beyond always show the autoflower phenotype. All, however, also show performance levels significantly lower than day-length sensitive materials for one or more agronomic or composition traits (value traits).

    [0195] Without wishing to be bound by a particular theory, the difficulty in recovering an agronomically- or compositionally-acceptable C. sativa plant with autoflower is most likely the result of linkage drag of undesirable traits from the autoflower sources.

    Example 7

    Marker Assisted Backcrossing

    [0196] In a method of backcrossing, the autoflower trait is introgressed into a parent having the Value Phenotype (the recurrent parent) by crossing a first plant of the recurrent parent with a second plant having the autoflower trait (the donor parent). The recurrent parent is a plant that does not have the autoflower trait but possesses a Value Phenotype. The progeny resulting from a cross between the recurrent parent and donor parent is referred to as the F1 progeny. One or several plants from the F1 progeny are backcrossed to the recurrent parent to produce a first-generation backcross progeny (BC1). One or several plants from the BC1 are backcrossed to the recurrent parent to produce BC2 progeny. At each generation including the F1, BC1, BC2 and all subsequent generations, the population is screened for the presence of the autoflower allele using a SNP previously found to be diagnostic of AF. The progeny resulting from the process of crossing the recurrent parent with the autoflower donor parent are heterozygous for one or more genes responsible for autoflowering. The last backcross generation is selfed and screened for individuals homozygous for the autoflower allele in order to provide for pure breeding (inbred) progeny with Autoflower Value Phenotype.

    Example 8

    Background Markers

    [0197] In a method of backcrossing, at each generation including the F1, BC1, BC2 and all subsequent generations, the population is screened with additional background markers throughout the genome that are not known to be associated with the autoflower trait. These selected markers throughout the genome are known to be polymorphic between the recurrent parent and the donor parent. The background markers are utilized to select against the donor parent alleles throughout the genome in favor of the recurrent parent alleles. The background markers are utilized to preferentially select progeny at each generation including the F1, BC1, BC2 and all subsequent generations that also exhibit the presence of the desired autoflower allele(s).

    Example 9

    Evidence for Linkage Between Autoflower Locus and Loci Involved in Agronomic and Composition Traits (Value Traits)

    [0198] Genes of interest for agronomic and composition traits including Abiotic Stress Response, Autoflower, Defense Response, Flowering, Plant Development and Terpene Synthesis were identified and categorized based on functionality and gene ontology descriptions. The selected genes of interest were placed relative to the markers identified in the association mapping. See Appendix 1.

    [0199] For the sake of simplification genes were grouped into gene intervals. Some of these gene intervals included multiple genes involved in multiple traits. These gene intervals were positioned based on physical position against the Cs10 Genome Assembly (GCA_900626175.2).

    TABLE-US-00004 TABLE 4 Genes linked with autoflower locus on chromosome 1: Gene Intervals Beginning Position (bp) End Position (bp) GI1 12,331,257 15,023,503 GI2 16,178,336 19,290,938 GI3 19,717,871 19,958,734 Exemplary AF locus 19,985,933 19,992,033 GI4 19,994,256 20,030,132 GI5 20,067,897 39,266,953 GI6 40,668,367 60,618,753 GI7 64,562,451 90,967,989

    Example 10

    QTL Mapping of Autoflower and Agronomic and Composition Traits (Value Traits)

    [0200] A population of 186 F2 Cannabis sativa plants was generated from a cross between a known photoperiod sensitive (PP) parent and a known photoperiod insensitive/autoflower (AF) parent to conduct a QTL mapping experiment for a number of traits of interest.

    [0201] Each F2 plant was phenotyped in 2021 for daylength sensitivity (with two phenotypes: PP or AF), CBD content, THC content, and a number of other traits.

    [0202] Each F2 plant was also genotyped at 600 SNP loci, including one marker very tightly linked to the AF/PP locus on chromosome 1 and fully diagnostic of the daylength sensitivity phenotype (AF marker). A QTL mapping analysis was conducted from the phenotypic and genotypic data, using single-factor analyses of variance (ANOVA), performed with JMP?, Version 16.1.0. SAS Institute Inc., Cary, N C, 1989-2021.

    [0203] A number of ANOVAs were found to be significant, including that where the dependent variable (phenotype) was THC content (%) and the independent variable (genotype) was the AF marker: (F(2,183)=16.064, p=<0.0001), the allele coming from the AF parent of the cross displaying a significantly lower THC content than the allele coming from the PP parent of that same cross. In the mapping population, the homozygous AF allele state resulted in a 20% reduction in THC content (%) when compared to the homozygous PP allele state. This evidence of the presence of a THC content QTL in the vicinity of the AF locus, in repulsion with the AF allele (unfavorable THC content allele in coupling with favorable daylength sensitivity allele), contributes to the understanding of the basis for the generally lower performance of AF germplasm when compared to PP germplasm, and sheds light on the fact that some of that difference in performance may be due to unfavorable linkages between AF and other traits, such as THC content as demonstrated here, on chromosome 1. See FIG. 1.

    TABLE-US-00005 TABLE 5 Summary of Fit Rsquare 0.149343 Adj Rsquare 0.140047 Root Mean Square Error 3.618427 Mean of Response 21.81034 Observations (or Sum Wgts) 186

    TABLE-US-00006 TABLE 6 Analysis of Variance Sum of Mean Prob > Source DF Squares Square F Ratio F AF 2 420.6514 210.326 16.064 <.0001 Error 183 2396.022 13.093 C. Total 185 2816.673

    TABLE-US-00007 TABLE 7 Means for One Way ANOVA Lower Upper Level Number Mean Std Error 95% 95% AF 90 20.3805 0.38142 19.628 21.133 H 16 21.3228 0.90461 19.538 23.108 PP 80 23.5164 0.40455 22.718 24.315

    Example 11

    Association Mapping of Autoflower and Agronomic and Composition Traits (Value Traits)

    [0204] A set of 267 Cannabis sativa materials, including heterozygous clones and inbred families (F3's and F4's) were selected to form a diverse association mapping (AM) panel. The panel consisted of materials with a wide range of flowering behavior, terpenes, maturity and other agronomic traits.

    [0205] These materials were phenotyped in 2020 for a number of traits including daylength sensitivity (AF or photo), days to maturity, CBD, THC, and a set of terpene profiles.

    [0206] All materials were genotyped with 600 SNPs and used for the GWAS analysis.

    [0207] Data analysis: Association mapping based on mixed linear model (MLM) with population structure as a covariate was conducted using TASSEL, a JAVA based open-source software for linkage and association analysis (Bradbury et al., 2007).

    [0208] Results: The autoflower locus was mapped to chromosome 1 at position 19,988,827 bp (as positions are established in the cs10 reference genome). Significant associations for different terpene profiles and maturity were identified on chromosome 1 as well as other chromosomes.

    [0209] Significant marker trait associations were used to assign co-segregating or adjacent significant markers into QTL intervals. Markers with the most significant p-values were extracted as representative markers for each marker trait association. Some of the loci were detected for multiple traits, so all those were combined under one QTL interval. The most significant QTLs were positioned based on physical position against the Cs10 Genome Assembly (GCA_900626175.2).

    TABLE-US-00008 TABLE 8 QTL regions significantly associated with terpene profiles and days to maturity (p.MLM < 0.001) and linked to the autoflower locus in an interval of interest, on chromosome 1. Beginning QTL Position End Num Intervals (bp) Position Trait SNPs QTLI1 14,443,748 15,023,503 Terpene Profile 2 QTLI2 18,014,544 19,290,938 Terpene Profile, 3 Days to Maturity Exemplary 19,985,933 19,992,033 Autoflower AF locus QTLI3 20,067,897 23,470,482 Terpene Profile 2 QTLI4 40,668,367 42,149,848 Days to Maturity 2 QTLI5 64,562,451 79,771,913 Days to Maturity 3

    [0210] GWAS revealed the existence of loci involved in agronomic and composition traits (value traits) linked to the autoflower locus on chromosome 1, and where the autoflower allele is in repulsion phase with favorable alleles for these agronomic and composition traits (that is the autoflower allele and unfavorable alleles for agronomic and composition traits are carried by one of the two homologous copies of chromosome 1, while the daylength-sensitive allele and unfavorable alleles for agronomic and composition traits are carried by the other homologous copy of chromosome 1). As a result, autoflower and unfavorable alleles for agronomic and composition traits are generally inherited together. Breaking this undesirable inheritance relationship between autoflower and favorable alleles for agronomic and composition traits requires being able to select very infrequent recombination events that may occur between the autoflower locus and linked loci involved in agronomic and composition traits. Selecting such infrequent recombination events would require the screening of very large numbers of individual plants. Such recombination events are practically impossible to observe phenotypically on individual plants. Therefore, the most and possibly only effective approach to select such desirable recombination events is through the use of the markers located between the autoflower locus and neighboring agronomic and composition trait loci, as illustrated herein.

    Example 12

    Identification and Use of Markers to Break Unfavorable Associations Between the Autoflower Phenotype and Low PotencyDevelopmental Leaf-to-Flower Commitment

    [0211] Based on the evidence for linkage between the autoflower locus and loci involved in agronomic and composition traits, markers are developed to enable the breaking of unfavorable linkage between the autoflower phenotype and the inferior autoflower alleles of other value traits. The use of such markers allows for selection of recombination events between the autoflower locus and other loci involved in other value traits, on chromosome 1, where the autoflower locus is found.

    [0212] A special focus on potency implicates various kinds of genes that can affect potency, including genes involved in developmental leaf-to-flower commitment. The AF phenotype in Cannabis is often associated with inflorescences that are, on the average, more leafy than most photoperiod varieties. The greater leafiness can contribute to lower potency because (a) trichome density is much lower on leaf tissue than on flower tissue; and (b) cannabinoids are produced and stored in the trichomes. Simply stated, more leaves per flower generally results in fewer trichomes per flower, and therefore a reduced capacity to produce and store cannabinoids.

    [0213] It is noted that both the AP2 and UPF2 genes have been functionally characterized to affect flower development and may be involved in the leaf-to-flower commitment during development. Other genes on chromosome 1 that also contribute to leaf-to-flower commitment are also identified, and alleles for these loci are determined in one or more AF plants. These alleles are compared with alleles for the same loci from a variety of Value Phenotype photoperiod plants. Any alleles for floral development genes on chromosome 1, that are different in AF plants as compared with Value Phenotype plants are designated as AF-associated alleles.

    [0214] Having identified AF-associated alleles for genes related to floral development, marker-assisted breeding is conducted using an AF parent and one or more Value Phenotype photoperiod parents. The MAB includes intensive selection against the AF-associated alleles while selecting for presence of an AF allele or, in some cases, selecting for AF phenotype. Progeny plants having an AF allele while having fewer AF-associated alleles than the parent AF plant show increased potency as compared with the AF parent.

    Example 13

    [0215] Identification and use of markers to break unfavorable associations between the autoflower phenotype and low potencytrichome size and/or density

    [0216] Based on the evidence for linkage between the autoflower locus and loci involved in agronomic and composition traits, markers are developed to enable the breaking of unfavorable linkage between the autoflower phenotype and the inferior autoflower alleles of other value traits. The use of such markers allows for selection of recombination events between the autoflower locus and other loci involved in other value traits, on chromosome 1, where the autoflower locus is found.

    [0217] A special focus on potency implicates various kinds of genes that can affect potency, including genes involved in trichome size and/or density. Trichome size and/or density have clear implications as to overall potency, because cannabinoids are made and stored in trichomes.

    [0218] Genes on chromosome 1 that affect trichome size and/or density are identified, and alleles for these loci are determined in one or more AF plants. These alleles are compared with alleles for the same loci from a variety of Value Phenotype photoperiod plants. Any alleles for trichome size/density genes on chromosome 1, that are different in AF plants as compared with Value Phenotype plants are designated as AF-associated alleles.

    [0219] Having identified AF-associated alleles for trichome size/density-related genes, marker-assisted breeding is conducted using an AF parent and one or more Value Phenotype photoperiod parents. The MAB includes intensive selection against the AF-associated alleles while selecting for presence of an AF allele or, in some cases, selecting for AF phenotype. Progeny plants having an AF allele while having fewer AF-associated alleles than the parent AF plant show increased potency as compared with the AF parent.

    Example 14

    Identification and Use of Markers to Break Unfavorable Associations Between the Autoflower Phenotype and Low Potency THC Biosynthesis

    [0220] Based on the evidence for linkage between the autoflower locus and loci involved in agronomic and composition traits, markers are developed to enable the breaking of unfavorable linkage between the autoflower phenotype and the inferior autoflower alleles of other value traits. The use of such markers allows for selection of recombination events between the autoflower locus and other loci involved in other value traits, on chromosome 1, where the autoflower locus is found.

    [0221] A special focus on potency implicates various kinds of genes that can affect potency, including genes involved in THC biosynthesis. THC biosynthesis has clear implications as to overall potency, lower rates of THC biosynthesis will directly affect THC accumulation in floral trichomes.

    [0222] Genes on chromosome 1 that affect THC biosynthesis are identified, and alleles for these loci are determined in one or more AF plants. These alleles are compared with alleles for the same loci from a variety of Value Phenotype photoperiod plants. Any alleles for THC biosynthesis genes on chromosome 1, that are different in AF plants as compared with Value Phenotype plants are designated as AF-associated alleles.

    [0223] Having identified AF-associated alleles for THC biosynthesis-related genes, marker-assisted breeding is conducted using an AF parent and one or more Value Phenotype photoperiod parents. The MAB includes intensive selection against the AF-associated alleles while selecting for presence of an AF allele or, in some cases, selecting for AF phenotype. Progeny plants having an AF allele while having fewer AF-associated alleles than the parent AF plant show increased potency as compared with the AF parent.

    Example 15

    The AF Marker in External Representative Diversity Accessions: The Possible Existence of Alternative Alleles Sufficient to Produce Autoflowering Phenotypes

    [0224] A collection of 210 Whole Genome Sequencing datasets on external and internal Cannabis samples were examined for genotype calls at the Var1_20 (or chr1:19,988,827_G/T) locus. The internal sample set genotype calls and observed phenotypes, as well as those genotype calls and observed phenotypes from the fine-mapping and marker deployment data disclosed here in Example 3 were used to produce inferred phenotypes in Table 9 below for external samples where no phenotype data was available. The overwhelming majority of samples are inferred to be photoperiodic. This analysis produced evidence that there is more than one autoflowering allele in the Cannabis autoflowering allele pool, which is described further below.

    [0225] Lowryder is generally understood to be the trait source for modern commercial autoflowering marijuana Cannabis and it has the same Var1_20 (or chr1:19,988,827_G/T) diagnostic T:T genotype that exists in all of our autoflowering germplasm where all evidence presented here suggests it to be diagnostic and sufficient to produce the phenotype in our germplasm collection.

    [0226] Finola is an industrial oilseed hemp, understood to be an autoflowering Cannabis cultivar but not confirmed to be with an observed phenotype in this dataset, which does not have the Var1_20 (or chr1:19,988,827_G/T) T:T genotype. This suggests there is more than one autoflowering allele in the Cannabis autoflowering allele pool but does not preclude Var1_20 (or chr1:19,988,827_G/T) T:T from being diagnostic, causal, and sufficient in our autoflowering materials.

    [0227] The inventors note that the accession labeled AutoAK is G:T at Var1_20 (or chr1:19,988,827_G/T) from which we infer the sample is of a photoperiodic phenotype based on the heterozygous genotype and dominant nature of the photoperiodic G allele. Without the understanding that Var1_20 (or chr1:19,988,827_G/T) T:T is sufficient to produce the autoflowering phenotype, while Var1_20 (or chr1:19,988,827_G/T) G:G or G:T dominantly confers a photoperiodic phenotype in our germplasm, one could errantly assume that this is an autoflowering sample by the given sample name. It is possible that this is a genotyping error, a bulked sampling error, or a mislabeled sample, but it cannot be confirmed with any degree of certainty as it is an external sample and genotype data point without an observed autoflowering or photoperiodic phenotype. The inventors also note that if this sample were to be derived from the same autoflowering trait source as Finola, or a different trait source with yet another allele sufficient to confer the autoflowering phenotype, that this heterozygous genotype could exist while still producing an autoflowering phenotype plant due to the sufficiency of the alternative autoflowering allele.

    [0228] The inventors maintain the accuracy and fidelity of the Var1_20 (or chr1:19,988,827_G/T) marker as predictive of the autoflowering phenotype in its homozygous T:T form, and note that this data, based on the Var1_20 (or chr1:19,988,827_G/T) G:G genotype and understood phenotype of the Finola sample, suggests that at least one more allele exists that is sufficient to produce the autoflowering phenotype.

    TABLE-US-00009 TABLE 9 Marker genotypes and phenotypes of internal and external accessions Genotype INFERRED source ID GENOTYPE PHENOTYPE PHENOTYPE notes internal WGS1 10 G PP PP internal WGS1 11 K PP PP internal WGS1 12 T AF AF internal WGS1 13 K PP PP internal WGS1 14 K PP PP internal WGS1 15 T AF AF internal WGS1 16 K PP PP internal WGS1 17 K PP PP internal WGS1 18 G PP PP internal WGS1 19 T AF AF internal WGS1 1 K PP PP internal WGS1 20 G PP PP internal WGS1 2 G PP PP internal WGS1 3 T AF AF internal WGS1 4 K PP PP internal WGS1 5 K PP PP internal WGS1 6 K PP PP internal WGS1 7 T AF AF internal WGS1 8 G PP PP internal WGS1 9 K PP PP internal WGS1 p3 G PP PP internal WGS2 CCA4- T AF AF 20AF18514 external WGS3 Carmen G PP ? external WGS3 Skunk1 G PP ? external WGS3 CBDRx18 G PP ? external WGS3 Domnesia G PP ? external WGS3 SourTsunami_x_ G PP ? CataractKush external WGS3 Master_Kush_km G PP ? external WGS3 Herijuana G PP ? external WGS3 Grape_Stomper G PP ? external WGS3 Saint_Jack G PP ? external WGS3 80_E3 G PP ? external WGS3 80_E1 G PP ? external WGS3 Tiborszallasi G PP ? external WGS3 Eletta_ G PP ? Campana external WGS3 CS_1_2016_ G PP ? CSU external WGS3 Carmaleonte G PP ? external WGS3 IdaliaFT_1_ G PP ? CSU external WGS3 Harlox G PP ? external WGS3 C3_USO1_ G PP ? F1_15_CSU external WGS3 Fedora17_ G PP ? 6_1_CSU external WGS3 Carmagnola_ G PP ? 3_km external WGS3 BlueBerry G PP ? Cheesecake_ x_JL_Male external WGS3 JamaicanLion- G PP ? Mother external WGS3 JamaicanLion- G PP ? Father external WGS3 Citrix G PP ? external WGS3 Headcheese G PP ? external WGS3 Sour_Diesel G PP ? external WGS3 Red_Eye_ G PP ? OG external WGS3 Tahoe_OG G PP ? external WGS3 Black_84 G PP ? external WGS3 Sour_Tsunami G PP ? external WGS3 Mothers_ G PP ? Milk_5 external WGS3 Chem_91 G PP ? external WGS3 Arcata_ G PP ? Trainwreck external WGS3 Black_Beauty G PP ? external WGS3 Ecofibre G PP ? external WGS3 F2_UC_8 G PP ? external WGS3 Netherlands- G PP ? Chamaeleon external WGS3 China-27 G PP ? external WGS3 China-26 G PP ? external WGS3 Italy- G PP ? Carmagnola1 external WGS3 China-25 G PP ? external WGS3 China-24 G PP ? external WGS3 China-23 G PP ? external WGS3 China-22 G PP ? external WGS3 China-21 G PP ? external WGS3 China-20 G PP ? external WGS3 China-19 G PP ? external WGS3 China-18 G PP ? external WGS3 China-17 G PP ? external WGS3 China-16 G PP ? external WGS3 France- G PP ? Santhica27 external WGS3 China-15 G PP ? external WGS3 SRX11046261- G PP ? VIR449 external WGS3 Colombia- G PP ? Colombian8 external WGS3 Peru G PP ? external WGS3 Thailand- G PP ? WildThailand external WGS3 VIR223 G PP ? external WGS3 China- G PP ? R3in1344 external WGS3 China- G PP ? R3in1343 external WGS3 China- G PP ? R3in1342 external WGS3 China- G PP ? R2in1354 external WGS3 France- G PP ? Fedora17 external WGS3 China- G PP ? R2in1353 external WGS3 China- G PP ? R2in1352 external WGS3 China- G PP ? R1in1364 external WGS3 China- G PP ? Rlin1363 external WGS3 China- G PP ? R1in1362 external WGS3 India-14 G PP ? external WGS3 SRX11046245- G PP ? VIR507 external WGS3 SRX11046244- G PP ? VIR493 external WGS3 Bulgaria- G PP ? VIR369 external WGS3 Ukraine- G PP ? VIR201 external WGS3 France- G PP ? Ferimon12 external WGS3 VIR37 G PP ? external WGS3 China- G PP ? R3in1341 external WGS3 China- G PP ? R2in1351 external WGS3 China- G PP ? R1in1361 external WGS3 Uzbekistan- G PP ? VIR4833 external WGS3 Uzbekistan- G PP ? VIR4832 external WGS3 Uzbekistan- G PP ? VIR4831 external WGS3 Kazakhstan- G PP ? VIR4693 external WGS3 Kazakhstan- G PP ? VIR4692 external WGS3 Kazakhstan- G PP ? VIR4691 external WGS3 Poland- G PP ? Bialobrzeskie external WGS3 Pakistan- G PP ? 13 external WGS3 Pakistan- G PP ? 12 external WGS3 Pakistan- G PP ? 11 external WGS3 Pakistan- G PP ? 10 external WGS3 India-9 G PP ? external WGS3 India-8 G PP ? external WGS3 India-7 G PP ? external WGS3 India-6 G PP ? external WGS3 India-5 G PP ? external WGS3 India-4 G PP ? external WGS3 France-B52 G PP ? external WGS3 India-3 G PP ? external WGS3 India-2 G PP ? external WGS3 India-1 G PP ? external WGS3 Ukraine- G PP ? Juso14 external WGS3 France-PP9 G PP ? external WGS3 France- G PP ? HinduKush external WGS3 France- G PP ? HawaiiMauiWaui external WGS3 France- G PP ? MexicanSativa external WGS3 France-Haze G PP ? external WGS3 France- G PP ? NorthernLight external WGS3 France- G PP ? AlpineRocket external WGS3 France- G PP ? RuderalisIndica external WGS3 France-Top44 G PP ? external WGS3 France- G PP ? BigSkunk external WGS3 France-BigBud G PP ? external WGS3 France- G PP ? Swaziland external WGS3 Spain- G PP ? Deltallosa external WGS3 Hungary- G PP ? Tiborszallasi external WGS3 Italy- G PP ? Carmagnola2 external WGS3 Poland-Beniko G PP ? external WGS3 Italy- G PP ? Fibranova external WGS3 Hungary- G PP ? Kompolti external WGS3 Hungary- G PP ? UnikoB external WGS3 NIDA1 G PP ? external WGS3 Colombia_ G PP ? Rio_Negro external WGS3 Mexican_E G PP ? external WGS3 CBD_Shark G PP ? external WGS3 CBD_God G PP ? external WGS3 CBD_Critical G PP ? external WGS3 BCBG G PP ? external WGS3 Blueberry_ G PP ? Kush external WGS3 Armageddon G PP ? external WGS3 White_Shark G PP ? external WGS3 Wabanaki G PP ? external WGS3 Anka G PP ? external WGS3 Ultra_Sour G PP ? external WGS3 Time_Warp G PP ? external WGS3 TB1004 G PP ? external WGS3 Simcoe G PP ? external WGS3 Sensi_Big G PP ? external WGS3 R2 G PP ? external WGS3 Nukem G PP ? external WGS3 Nordle G PP ? external WGS3 Nepali_Diesel G PP ? external WGS3 Mongolian G PP ? external WGS3 Afghani_Kush G PP ? external WGS3 Lemon_Nigerian G PP ? external WGS3 Kush G PP ? external WGS3 Kanata G PP ? external WGS3 Island_Honey G PP ? external WGS3 Head_Band G PP ? external WGS3 Hash_Plant G PP ? external WGS3 Ghost_Train G PP ? external WGS3 Critical_Kali G PP ? external WGS3 Critical_Kush G PP ? external WGS3 CBD_Yummy G PP ? external WGS3 ACDC G PP ? external WGS3 Acadia G PP ? external WGS3 White_Widow_1 G PP ? external WGS3 Afghan_Kush_1 G PP ? external WGS3 Carmagnola_1 G PP ? external WGS3 Carmagnola_2 G PP ? external WGS3 Carmagnola_3_rl G PP ? external WGS3 Dagestani_hemp G PP ? external WGS3 Chem91 G PP ? external WGS3 Original_Sour_ G PP ? Diesel external WGS3 Durban_ G PP ? Poison_1 external WGS3 Hawaiian G PP ? external WGS3 Lebanese G PP ? external WGS3 Tora_Bora G PP ? external WGS3 Afghan_Kush_2 G PP ? external WGS3 G13 G PP ? external WGS3 Harlequin_rl G PP ? external WGS3 Cannatonic_rl G PP ? external WGS3 Auto_AK47 K PP ? Phenotype and sample integrity unknown external WGS3 Low_Ryder T AF ? Likely trait source for modern commercial autoflowers external WGS3 Pre-98_ G PP ? Bubba_Kush external WGS3 Jack_Herer_1 G PP ? external WGS3 Maui_Waui G PP ? external WGS3 Super_Lemon_ G PP ? Haze_rl external WGS3 Afghan_Kush_3 G PP ? external WGS3 Hindu_Kush G PP ? external WGS3 Durban_Poison_2 G PP ? external WGS3 Rocky_Mountain_ G PP ? Bluberry external WGS3 R4 G PP ? external WGS3 Kunduz G PP ? external WGS3 Feral_Kansas G PP ? external WGS3 Kompolti_1 G PP ? external WGS3 Kompolti_2 G PP ? external WGS3 EuroOil_2 G PP ? external WGS3 Afghan_Kush_6 G PP ? external WGS3 Chinese_hemp G PP ? external WGS3 Girl_Scout_ G PP ? Cookies_1 external WGS3 Grape_Ape_1 G PP ? external WGS3 B-5 G PP ? external WGS3 Chocolope_1 G PP ? external WGS3 Alaskan_ G PP ? Thunderfuck external WGS3 Blueberry_DJ G PP ? external WGS3 Blue_Dream_3 G PP ? external WGS3 Afghan_Kush_4 G PP ? external WGS3 Liberty_Haze G PP ? external WGS3 Tangerine_Haze G PP ? external WGS3 Sievers_Infinity G PP ? external WGS3 Skunk_1 G PP ? external WGS3 OG_Kush G PP ? external WGS3 Golden_Goat_2 G PP ? external WGS3 Feral_Nebraska_1 G PP ? external WGS3 Feral_Nebraska_3 G PP ? external WGS3 Afghan_Kush_5 G PP ? external WGS3 Carmagnola_4_rl G PP ? external WGS3 Carmagnola_5 G PP ? external WGS3 Carmagnola_6 G PP ? external WGS3 Purple_Kush G PP ? external WGS3 Harlequin_jt G PP ? external WGS3 Finola_kl G PP ? Industrial hemp that may be autoflower- ing

    Sequences

    [0229]

    TABLE-US-00010 SEQIDNO:1.Exemplarycs10conservedforwardprimer. CAAAAAAACATGCAAGGACATCCCTGTAA SEQIDNO:2.Exemplarycs10referenceGallelespecificreverseprimer. ATTTTAAATCCAAAATAAAGGAAATATACTCAC SEQIDNO:3.SequenceassociatedwiththeAFphenotype: gatctcgttttgactgaggtagtcatgccctgtttatctggtattggtcttctaggcaagatcatgagcaaaaaaacatgcaagga catccctgtaatta[T]tgagtatatttcctttattttggatttaaaataatacttttttctctagtatctttttgtaatttatacttttaa ctaatacatttattgtgtgtgtttg SEQIDNO:4.SequenceassociatedwiththePPphenotype. gatctcgttttgactgaggtagtcatgccctgtttatctggtattggtcttctaggcaagatcatgagcaaaaaaacatgcaagga catccctgtaatta[G]tgagtatatttcctttattttggatttaaaataatacttttttctctagtatctttttgtaatttatacttttaa ctaatacatttattgtgtgtgtttg SEQIDNO:5.ThissequenceresidesonChromosome1,referencegenome theCS10assemblyfromNCBIwasused,version:GCA_900626175.2.thissequence residesatpositions19985933to1992033.TheSNPGassociatedwithphotoperiodas setforthinSEQIDNO:3islocatedatnucleotides19,988,827. AAAAAAAAAAAGAAAAACCTCTGGTTTCTAACTTTTGAACTTTATTCCACCATTGGCGATTATCATCCAA GTTCGAATGAAGTTTTGAGAGAGAGGTATTCTCACTTTGTATAAAGTAGCAACTTGTTGCTCAATGTTGA TTTTCTTTTCCCTATTTGTTTCTTCATCTTTTGTTTGGCTGTTAAGAAAATTTTAAAGGAACACAACGGG AAAAATGTTATAATGAAGGAACGAGAGTATTTGATTTTTCACAGTATAGTGTTTCCGAGTACTACTCACT CATTCACTGAAAAATGAAAAAAAAATATGTATATATGTAATATATTTGTATTTACTGAATTATTTGGCTT TCCTTCTCTTCCCGCTCTCTAAATTGTTTGCATGTATTCTATAAATTCATAAATTAATATATATTTTATC TCGGATAATTGAAGTGTTTCTTAACGTCTTGATGATATGAAAAGGAGAATGACCTTTGGAATTAAGTGTT CTGAAATCTACCAAAGAACCTCTTTCTCACCATATATTAGCAAACCCTATAAGTTTTAATTGAGTTGAAT ATGCATGATTAAAGCTTACACACTTGTTAATTGTTTGAAGATTCATGAGTTTGGTATATCATGATGCTG TTATTATCTCTATATCAAAAGATAGTTTGATATGAACTTTATATTCAGGAACTTTTTTATTCTTATTTAA CCATATAGTTGTGCTTCTGTTATCTTTTATGTCCATTATCTGGGTTCAGTTTTTGTTAATTATACTGTTA TATGCATCAAAAAAAGCTACGGTTAAATTTATATGTGCTACATACCTTGTATACTTTCGATCGCAATATA GATTGATAGTGGGAAAGTAGTAGAGATATGGGAATAGAAAAGGATCATAATCATTTCCTTCCCTTTTATT TGTTGTGTCTAATTCAACTTTTCCTAATTTTATGCTATTGGGACTTTGATCAGAACACACAGACACACAC ATATGCTATCCACCTTATTCTTCTTCTTGGTTTCTGATAGCAATATATTTGTACTTATTATTTGTCTTTT GTAGAGGATCTGTGAAGGGGCTTTCTGTTTTACTTGAGCCTGTATTTTTGTCACAACGGGATGTGCAAGA ACTCTTGTGGATCAGCTTTCTCGCCAGCTCTATCCATTACCCTTCTCATCATTGATCTTATTGAATCTGG TTGATGAAAATGGTCCAGATGAATAATAAAGCTCCCGTAACCAATGATGAGCTAACTGAGCTGAATCACC GGATTCAAGATGGGAAAAAAGAAAGAAGGGAGAGGGTTACGAGAGAACGCCAAGGGCTCTCAGAGGAACA TGAATCTAGGATCAATGAAGATGTGCAACAACATGTCAGCAATGGGGAGATTGGAACAGTACAGGCTCTG GAGAGGAGTCATTCTGGCCAGCGGAGGTCTCAGCAACAGCCTCAAGGACATTTGGTTCGCTGGGAGAGGT TCCTAGCTTTCAGGTCGCTAAAGGTTTTATTGGTGGAAAATGATGACTCAACTCGCCATATTGTCAGCGC GCTACTAAGAAATTGTGGCTACGAAGGTCAGTACGTTTCAGCAACATGAAATGATCATTGCATTTCTCTT ATGCAGAAGTATACACTCTATGTTAATGGCTTTATGTTTGATTATTGACGGAGATGACTTTTAAAGTAAA CACTGTAGTAGATCTTATGAATAAACTTGATGTTATATGATATGAAAGGAAACCATGTTTATTTGCTCCA CTACGAGTAATAATATCCATGGTCTAATAGTTGTTGTCACTAACCATAACCTAGAAAGAGTGGTCTTAGG ATTAGCCTCGCTGATCCACACCTCACCTCTTGTAGAGAAGGTCAAGGGTTCAATCCCTCCCCCGCCCTCC AAAGAAAGATATAACAAACAGAAAACGAATCAAAAGAATAAAAAACAAACAAGTAAGGTGAGCATGGCAC TATTATTAGACTAAAGCTTGTTTTAGTTTAATATAAGTAGATCTTATTTCTGAAATGTTATTTTCCACCA TCTAATTACACACATTTCTAGACTGATCCCCTGATCTTGTGGCAGCGCTCTTTTTCTGAGTTCCTATCAG AAATGCTGAAAACTATTAAACTAGTTTTTGTTACTTATTTATTTTCTTTTGTTTTAACACTACATTTTAA CAACAGTTCCTATACTCTGGTGCTTCACGTGTCTATTTGTGCTATTTTGATGTTCATATTTATAGTCTAG CGGGAAGTTTTTTAGTCATTTCGTTCATGAAGGGTCAAGTACGATTTCTTGACCTAGCTTAGATTTTGAC ATAGAACCATTCTTGAGGATACTACAGTGGGTTACTTAGTTTGTAGAGTATGTTTATGTGTACCTTCTAA AGATAACCTGGTTATAAGTATGATATTCTCGAAAAGAAAAACATGTTGCTCCAGACCTGTTGGCAATTGA CATCTTACTTTCTAGCTATGATAATTAGACATTCAGTCGCTATATTTATGTCATGCTTTCTTCATCATCA TTTTTCATATATGTGTTCAAGTTATGGTAAGCTATTTAAATATTGTTATTTTATTTGACCATGTTTTATT TCCAACGCAAACTGCTTGGTATAATATTACATAAATGTTAGCCAGAAGCTTTGATTTAGTTTACATCCTA AAAGTCAAAACTAGAATTTTATTGGTTCCCTCAATAAACTAACAATTATTCAATGTATTCTCATATTGGC AGTTACAGCTGTAGAAAATGGCAGACAAGCTTGGAAAGTCTTAGAAGATCTTGTGACAGATGTTGATCTC GTTTTGACTGAGGTAGTCATGCCCTGTTTATCTGGTATTGGTCTTCTAGGCAAGATCATGAGCAAAAAAA CATGCAAGGACATCCCTGTAATTAGTGAGTATATTTCCTTTATTTTGGATTTAAAATAATACTTTTTTCT CTAGTATCTTTTTGTAATTTATACTTTTAACTAATACATTTATTGTGTGTGTTTGTGTTTGTGTTTTCAC AGTGATGTCTTCACATGATTCTAGGAGTATGGTCTTTAAGTGTTTATCGAAAGGTGCCGTTGACTTTTTA GTGAAACCTATTCGAAAGAATGAGCTGAAAAACCTTTGGCAACATGTTTGGAGAAAATGCCACATTGTGA GTTGCAATCTATTTGATTTATTATATCATGGACCAATTCACCTTGAGGTTCAGGTTTCTTCTCATTTATG CATTTTGTTTTTCATTAAGCACCAATTGTCGAACTATACCAAAGAAAACAAACAAAAAAATGGCTTCAAT CTTTGCTTGATAAAAAATATGTTTTATGTAATGCAAACATCACTTAATTGACATAATACCATTAAACACA GAAATTTGCTCGAGTTGTGCATTAATTTTTCATATTTTCATCAGTCTAGTAATAGTGGAAGTGAAAGTGG TATATGGATTGAAAAGCCTTTAAAGTCAAGAACTGTGGAACATTCAGACAACAACAGTGGCAGCAATGAT GAGGATGATACTGACAGCATTGGTCTAAATTTCAGGAATGAAAGTGACAGTGGAACACAGGTATTTCACT AAATTTCATGAAAGAGTTTTGTTTTTTTTTTTTGGTGGGAATGAAGTTTTATGTCTTTGTATTTACAGAA ATATTAGCGAAATGTTAGTTTCCACATGAAGTTTTATGTTTTATGTATCAAGAAACTACTATAATTATGT TAGTTTCCACACACCTAGTTTGGAATTTGTCTATCACAGCACCCATATATCTATTTACCATGTTTGCATA TTACTCATTTGATCTTGGTGGAGGAATATTCATGTAAGAGTTTTTAATACTTTTATGTATATGTAAGTGG AGAAGGAATGATAATTAGCAAGATAAGAAAACAAGAAAAAGAATGAAAACTTACTACTGAGCTTTTACAG AGCTCTTGGACAAAGAGAGCAGAAGTTGACAGCCCTCAGGCAGTGTCGTGGGAGCAGTTTGCTGATCTTC CTGATAGCACTAATCATCAGGTCAATCATCCAAGGCAAGAAGCCTTTGGAAACAACTGGGTACCTGAAAA TGCAACAGTAACACCACGCCCACATAATGATGAGCTTGGTAGGCAAATTTTCCTAACATCTTTTTTTTTT TTAACTTTCTTCCATTCTCGATCATTCTCTAAGTTATGATTTATTTAAATTGTTTAGACAAAAAAGTCAT GGGAAAAGACTTGAAAATAGGATTACCTAGCCTTCTTGAAGACACAAGTGAAAAAGGGCTGACCAACATG GAAGGTACTAATAAAGATAAATGTTCTGAACTGAACTCAAAGAAAGATGATCAGGAGCAGGAGAAAAGGG AATTAGACCTCAACAATGAAGAACCGAGTGCAGAAAAGACCCAAGCTGTTGATCTGATGGGTGTCTCCAA TTATAGTATTGATCCTCACATGGAAAGTGGAGTTCTTGATGTCCCAAACGAACTCTCCAAGGCTGCCTGC ATGAGAGATAATGCCAACCATGAGAATAAAGAAACACCTTTTTTTGAGCTCATTTTAAAGAGGCCAAGAG ATATCCAAGATACTGGAACCAGCGCACACGATCGAAATGTTTTGAGACATTCCGATATTTCAGCTTTTTC AAGGTATAGAAATATTTTGTGTTGATATAAACATGCTCAATAACAATTAACTCTAAATTTAAGAATATAA CTAAGTCCCATTACCATGCAGGTATAACATTGTTTCAACTGCAAACCAAGCTCCAACAGGGAACATAGGA AGCTGTTCTCCTCTAGATAATAGCTCAGATGCAGCAAAAACAGAATCAATCCCAAATTTGCAATCTGATT CAAATGGTACACCTCCCAACCAGGGTTCCAATGGTAGTAGCAACAATAATGACATGGGATCCACTACGAA TAATGCTTTTACCAAACAAGTGGCTTTTGCAGAGAGGCCTACAAACAAATCCACAATCAAACTCCAATCA AACACTGGTTTCCAACAAGTGCAAAATGGCCAAGCCTCCCTTCAGACTATTATTCAAGGTAAATACTCGA ATATGATGCCTCAGTAATTAATTCAAATAAGACACAAGCAAAGGCCACATACCACTTCATAATATCTTTT CATCGATGTTGATTTGTTTTACAAAAACTATGGCTGCAGATGCTTCACAGTGTGGTTCATCCAATGCATT GAGAGCACCCATGGAAGGCAATATTAGTAATCACAGTCTCAACAGGAGTGGGTCAGGTAGTAACCATGGT AGCAACGGACAAAAGAGAAGCACCAATGCTTCAAACTCCAGGGGAAAAAGACAGAAAGTGAGAGTGTGGT TACTGGAAGAGGGAAAACCATTGAAGGAAGTGAATCGGATGGAAATCGATTTGCACAAAGAGAAGCTGCT TTGAAAAGATTCCGCCAGAAGAGGCAAGAAAGATGCTTTGAGAAAAAGGTAAACAGAAAATCACCCCCCT TATTTTCTCTAAGAAGTAAATCATGGAAACAAACAAGTAGGCGTCTGAAAGAAGGAAGTTTCATTTTCAA CACTACACATTTGAACCATCATCTTTGGGATCCAGTTAGTATGAAGCTTTTTGGGAAAAAAAAAAGGAAA AGAACAGAAAATTGTTTCCCTGAAATATAAATAATTGATCTGTTTCCTTTGAAGTTCCATATTGCTGACC TGAAGCATTAATTTTTACTTTTTCAGGTGAGATATCAGAGTAGAAAAAAACTGGCAGAACAAAGACCCCG AATTCGAGGACAATTTATTAGAAAGGGAATGAATGAAAACAAGGGAAAAGGCATAAATTACGAACCTGAA CCAATTTCATAACAGGAGCCATTAGAATCCTTGATGCAGATGTGGTGCGTTTGCAGTAGATAGTTACAGA GCTTTTATGATTGAATATATGGGACTGTATTAATATTGAAGGTGTATAAGTAATATGCCAACGGCTGTGC TAGGATTAAGTACTACAATTCTACTAAATAGAAGGTGATAAACCCTCAAAAAGAATAGAGCCTTCTCTCA ATAAATCACTTTAAGTGGGTGTAATATTATTATTTCATGACTAGATGATCATTTTAACTTGAATGGATGG TTGAAGAAACT

    [0230] SEQ ID NO: 6. Exemplary cs10 alternate T allele specific reverse primer.

    [0231] The various methods and techniques described above provide a number of ways to carry out the application. Of course, it is to be understood that not necessarily all objectives or advantages described are achieved in accordance with any particular embodiment described herein. Thus, for example, those skilled in the art will recognize that the methods can be performed in a manner that achieves or optimizes one advantage or group of advantages as taught herein without necessarily achieving other objectives or advantages as taught or suggested herein. A variety of alternatives are mentioned herein. It is to be understood that some embodiments specifically include one, another, or several features, while others specifically exclude one, another, or several features, while still others mitigate a particular feature by including one, another, or several other features.

    [0232] Furthermore, the skilled artisan will recognize the applicability of various features from different embodiments. Similarly, the various elements, features and steps discussed above, as well as other known equivalents for each such element, feature or step, can be employed in various combinations by one of ordinary skill in this art to perform methods in accordance with the principles described herein. Among the various elements, features, and steps some will be specifically included and others specifically excluded in diverse embodiments.

    [0233] Although the application has been disclosed in the context of certain embodiments and examples, it will be understood by those skilled in the art that the embodiments of the application extend beyond the specifically disclosed embodiments to other alternative embodiments and/or uses and modifications and equivalents thereof.

    [0234] In some embodiments, any numbers expressing quantities of ingredients, properties such as molecular weight, reaction conditions, and so forth, used to describe and claim certain embodiments of the disclosure are to be understood as being modified in some instances by the term about. Accordingly, in some embodiments, the numerical parameters set forth in the written description and any included claims are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding that the numerical ranges and parameters setting forth the broad scope of some embodiments of the application are approximations, the numerical values set forth in the specific examples are usually reported as precisely as practicable.

    [0235] In some embodiments, the terms a and an and the and similar references used in the context of describing a particular embodiment of the application (especially in the context of certain claims) are construed to cover both the singular and the plural. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (for example, such as) provided with respect to certain embodiments herein is intended merely to better illuminate the application and does not pose a limitation on the scope of the application otherwise claimed. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the application.

    [0236] Variations on preferred embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. It is contemplated that skilled artisans can employ such variations as appropriate, and the application can be practiced otherwise than specifically described herein. Accordingly, many embodiments of this application include all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the application unless otherwise indicated herein or otherwise clearly contradicted by context.

    [0237] All patents, patent applications, publications of patent applications, and other material, such as articles, books, specifications, publications, documents, things, and/or the like, referenced herein are hereby incorporated herein by this reference in their entirety for all purposes, excepting any prosecution file history associated with same, any of same that is inconsistent with or in conflict with the present document, or any of same that may have a limiting effect as to the broadest scope of the claims now or later associated with the present document. By way of example, should there be any inconsistency or conflict between the description, definition, and/or the use of a term associated with any of the incorporated material and that associated with the present document, the description, definition, and/or the use of the term in the present document shall prevail.

    [0238] In closing, it is to be understood that the embodiments of the application disclosed herein are illustrative of the principles of the embodiments of the application. Other modifications that can be employed can be within the scope of the application. Thus, by way of example, but not of limitation, alternative configurations of the embodiments of the application can be utilized in accordance with the teachings herein. Accordingly, embodiments of the present application are not limited to that precisely as shown and described.

    TABLE-US-00011 Start Pos. End Pos. Gene UniprotKB Cite Gene Chr. (bp) (bp) Product Interval ID Comment Source LOC115705376 1 460002 464565 protein ENHANCED na Q9FHK4 Defense 1 DISEASE Response RESISTANCE 4 LOC115707628 1 3692051 3692910 chitinase 4-like na O04138 Defense 1 Response LOC115704140 1 4959476 4962976 strigolactone esterase na Q9SQR3 Plant 6 D14-like Development LOC115704108 1 5209955 5213465 strigolactone esterase na Q9SQR3 Plant 6 D14 Development LOC115705119 1 10066725 10068493 nematode resistance na O04203 Defense 1 protein-like HSPRO2 Response LOC115706556 1 10078469 10082713 glycosyltransferase na Q9LY62 Plant 1 family 64 protein C4 Development LOC115706452 1 10167402 10172565 folylpolyglutamate na F4K2A1 Plant 1 synthase Development LOC115705653 1 10173974 10179713 protein NEDD1 na B3H5K9 Plant 1 Development LOC115706248 1 10182664 10185621 serine/threonine- na P48484 Plant 1 protein phosphatase Development PP1 isozyme 4 LOC115705123 1 11532014 11534127 protein phosphatase na P49598 Plant 1 2C 37 Development LOC115703763 1 11596931 11597584 probable na Q9LHS9 Plant 1 transcriptional Development regulator RABBIT EARS LOC115705015 1 11609350 11611397 16 kDa phloem protein na Q9M2T2 Defense 1 1 Response LOC115707648 1 11681060 11687327 ARF guanine- na Q42510 Plant 1 nucleotide exchange Development factor GNOM LOC115704658 1 11705515 11712188 ARF guanine- na Q42510 Plant 1 nucleotide exchange Development factor GNOM LOC115705643 1 11754089 11756592 AT-hook motif na Q9M2S3 Defense 1 nuclear-localized Response protein 15 LOC115706853 1 11868962 11870810 serine/threonine- na Q9FR53 Plant 1 protein kinase TOR- Development like LOC115708105 1 11960132 11963477 ribulose bisphosphate na P10896 Defense 1 carboxylase/oxygenase Response activase, chloroplastic LOC115708228 1 12007193 12009724 L-type lectin-domain na Q9M2S4 Defense 1 containing receptor Response kinase S.4 LOC115703769 1 12039497 12040427 thaumatin-like protein na P50699 Defense 1 Response LOC115707119 1 12207816 12209951 aspartic proteinase na Q9LZL3 Plant 1 PCS1 Development LOC115706206 1 12233020 12236910 E3 ubiquitin-protein na Q9M2S6 Abiotic 1 ligase SDIR1 Stress Response LOC115703771 1 12272982 12274769 ethylene-responsive na Q8H1E4 Abiotic 1 transcription factor Stress RAP2-4-like Response LOC115707445 1 12343437 12344906 glucan endo-1,3-beta- 1 Q9FHX5 Defense 1 glucosidase Response LOC115705530 1 12433345 12435274 transcription factor 1 Q8S9H7 Flowering 1 DIVARICATA LOC115704948 1 12452013 12458503 coronatine-insensitive 1 O04197 Defense 1 protein 1 Response LOC115706039 1 12937290 12938883 protein EARLY 1 O04211 Flowering 1 FLOWERING 4 LOC115705580 1 13029650 13035917 nuclear pore complex 1 Q9FFK6 Defense 1 protein NUP88 Response LOC115705581 1 13036253 13040887 cytochrome P450 1 Q42569 Flowering 1 90A1 LOC115706424 1 13120072 13121974 chlorophyll a-b 1 Q9S7W1 Plant 1 binding protein Development CP29.3, chloroplastic LOC115703789 1 13300921 13301943 ethylene-responsive 1 A0MES8 Defense 1 transcription factor Response ABI4 LOC115704226 1 13470243 13472670 trihelix transcription 1 Q9LJG8 Plant 1 factor ASIL2 Development LOC115705875 1 14332449 14337902 auxin transporter-like 1 Q9S836 Plant 1 protein 2 Development LOC115708077 1 14425030 14429381 probable zinc 1 Q9FFK3 Plant 1 metalloprotease Development EGY2, chloroplastic LOC115706187 1 14471823 14476594 anthranilate synthase 1 P32068 Plant 1 alpha subunit 1, Development chloroplastic-like LOC115705837 1 14565223 14570008 anthranilate synthase 1 P32068 Plant 1 alpha subunit 1, Development chloroplastic LOC115707975 1 14644286 14648676 probable zinc 1 Q9FFK3 Plant 1 metalloprotease Development EGY2, chloroplastic LOC115706168 1 14738283 14743604 auxin transporter-like 1 Q9S836 Plant 1 protein 2 Development LOC115706842 1 14985853 14987729 protein BREAKING 1 Q5BPF3 Plant 1 OF ASYMMETRY IN Development THE STOMATAL LINEAGE LOC115706606 1 14998374 15001200 superoxide dismutase 1 O81235 Defense 1 [Mn], mitochondrial Response LOC115706200 1 15040145 15044282 alpha-galactosidase 3 na Q8VXZ7 Plant 1 Development LOC115704018 1 15117393 15120227 superoxide dismutase na O81235 Defense 1 [Mn], mitochondrial- Response like LOC115707509 1 15131346 15132772 protein BREAKING na Q5BPF3 Plant 1 OF ASYMMETRY IN Development THE STOMATAL LINEAGE-like LOC115703809 1 15234400 15236198 protein GAMETE na Q9LFS2 Plant 1 EXPRESSED 3 Development LOC115703810 1 15236480 15238231 protein GAMETE na Q9LFS2 Plant 1 EXPRESSED 3-like Development LOC115703812 1 15245656 15247318 protein GAMETE na Q9LFS2 Plant 1 EXPRESSED 3-like Development LOC115707415 1 15405946 15407231 16 kDa phloem protein na Q9M2T2 Defense 1 1 Response LOC115708093 1 15411560 15412636 16 kDa phloem protein na Q9M2T2 Defense 1 1-like Response LOC115706268 1 15415008 15418566 serine/arginine-rich na Q8L3X8 Abiotic 1 SC35-like splicing Stress factor SCL30 Response LOC115707758 1 15458111 15461043 receptor-like na Q65XV8 Defense 1 cytoplasmic kinase Response 176 LOC115706046 1 15467872 15471660 triosephosphate na P48491 Plant 1 isomerase, cytosolic Development LOC115707396 1 15550202 15551485 16 kDa phloem protein na Q9M2T2 Defense 1 1-like Response LOC115708048 1 15555831 15556874 16 kDa phloem protein na Q9M2T2 Defense 1 1 Response LOC115707664 1 15591075 15594025 receptor-like na Q65XV8 Defense 1 cytoplasmic kinase Response 176 LOC115706180 1 15600957 15605292 triosephosphate na P48491 Plant 1 isomerase, cytosolic- Development like LOC115706759 1 15812476 15813368 UDP- na Q9FIA0 Plant 1 glycosyltransferase Development 76C2 LOC115705042 1 16088182 16088984 18.1 kDa class I heat na P19037 Abiotic 1 shock protein-like Stress Response LOC115705192 1 16309120 16312421 geranylgeranyl 2 O80642 Abiotic 1 transferase type-1 Stress subunit beta Response LOC115703837 1 16333984 16334699 RING-H2 finger 2 Q9LX93 Defense 1 protein ATL5-like Response LOC115705537 1 16502494 16508224 elongator complex 2 Q9FNA4 Plant 1 protein 1 Development LOC115706118 1 17708291 17711327 eukaryotic translation 2 O04202 Plant 1 initiation factor 3 Development subunit F LOC115707341 1 17736346 17737192 WUSCHEL-related 2 Q8H1D2 Plant 1 homeobox 5 Development LOC115704794 1 17809134 17811013 aquaporin PIP1-2-like 2 Q06611 Plant 1 Development LOC115705614 1 18550573 18555132 glucan endo-1,3-beta- 2 Q9FHX5 Defense 1 glucosidase Response LOC115704992 1 18900705 18901809 zinc finger protein 2 Q42410 Abiotic 1 ZAT12 Stress Response LOC115705890 1 18940084 18942251 WAT1-related protein 2 O80638 Plant 1 At2g39510-like Development LOC115705892 1 18974401 18976327 WAT1-related protein 2 O80638 Plant 1 At2g39510 Development LOC115705891 1 19033360 19035330 WAT1-related protein 2 O80638 Plant 1 At2g39510 Development LOC115708167 1 19068823 19070752 WAT1-related protein 2 O80638 Plant 1 At2g39510-like Development LOC115704024 1 19131885 19133568 actin-depolymerizing 2 Q39251 Plant 1 factor 2 Development LOC115707008 1 19143232 19144512 protein UPSTREAM 2 Q9LX14 Plant 1 OF FLC Development LOC115707046 1 19145357 19148341 nucleolin 1 2 Q9FVQ1 Plant 1 Development LOC115704213 1 19173526 19176502 receptor-like protein 2 Q9LK35 Defense 1 kinase THESEUS 1 Response LOC115707202 1 19217473 19223517 transcription initiation 2 Q9MAU3 Plant 1 factor TFIID subunit 6 Development LOC115707264 1 19229654 19234420 spliceosome- 2 PODKLA Plant 1 associated protein 130 Development A LOC115706831 1 19250006 19253484 caffeoylshikimate 2 Q9C942 Plant 6 esterase Development LOC115706075 1 19260772 19265413 protein-tyrosine- 2 Q9C5S1 Defense 1 phosphatase MKP1- Response like LOC115703861 1 19314102 19320767 ankyrin repeat- na Q9C7A2 Abiotic 1 containing protein Stress ITN1-like Response LOC115707983 1 19342709 19347249 protein-tyrosine- na Q9C5S1 Defense 1 phosphatase MKP1 Response LOC115707985 1 19411191 19415240 ankyrin repeat- na Q9C7A2 Abiotic 1 containing protein Stress ITN1 Response LOC115704691 1 19712612 19715469 probable RNA-binding na Q9M1S3 Plant 1 protein ARP1 Development LOC115708151 1 19726723 19728921 floral homeotic protein 3 P47927 Flowering 1 APETALA 2 LOC115706264 1 19802609 19815150 regulator of nonsense 3 F4IUX6 Defense 1 transcripts UPF2 Response LOC115705128 1 19985933 19992033 two-component AF Q0D3B6 Autoflower 1 response regulator-like PRR37 LOC115703878 1 20816258 20818673 protein FAR1- 5 Q9SZL8 Plant 1 RELATED Development SEQUENCE 5-like LOC115706748 1 21021481 21025532 mRNA-decapping 5 Q8GW31 Plant 1 enzyme subunit 2 Development LOC115706754 1 21082797 21086224 aquaporin PIP2-2 5 P43287 Plant 1 Development LOC115703883 1 21134331 21139980 phosphatidylinositol/ 5 Q93ZE9 Flowering 1 phosphatidylcholine transfer protein SFH3- like LOC115706749 1 21155973 21157289 caffeoylshikimate 5 Q9C942 Plant 6 esterase Development LOC115706736 1 21178192 21184371 patatin-like protein 6 5 O80959 Defense 1 Response LOC115706751 1 21433547 21437041 18S rRNA (guanine- 5 Q9LVD0 Plant 1 N(7))- Development methyltransferase RID2 LOC115706731 1 21483096 21486104 heat shock protein 83 5 P27323 Defense 1 Response LOC115705698 1 21548989 21562933 protein LONG AFTER 5 A0A1I9LN01 Plant 1 FAR-RED 3 Development LOC115708138 1 21587198 21589633 tetraspanin-6 5 Q9C7C1 Plant 1 Development LOC115705883 1 21631321 21636641 MLO-like protein 12 5 O80961 Defense 1 Response LOC115707642 1 21862431 21868753 methionine--tRNA 5 Q9M2T9 Plant 1 ligase, Development chloroplastic/ mitochondrial LOC115703890 1 22253112 22253711 protein FAR1- 5 Q9SZL8 Plant 1 RELATED Development SEQUENCE 5-like LOC115708244 1 22613465 22615178 allene oxide synthase 3 5 Q6Z6L1 Defense 1 Response LOC115705209 1 22999950 23004754 E3 ubiquitin-protein 5 Q9LTA6 Plant 1 ligase WAV3 Development LOC115705154 1 23007202 23009312 large ribosomal RNA 5 Q9LT27 Plant 1 subunit accumulation Development protein YCED homolog 1, chloroplastic LOC115706398 1 23035351 23041015 protein ENHANCED 5 Q8VZF6 Defense 1 DISEASE Response RESISTANCE 2-like LOC115705217 1 23100817 23103941 GATA transcription 5 Q9SV30 Plant 1 factor 8 Development LOC115706063 1 23122609 23126114 auxin response factor 5 Q93YR9 Plant 1 16 Development LOC115706668 1 23248120 23252933 phenylalanine 5 P35510 Defense 1 ammonia-lyase 1 Response LOC115708259 1 23329839 23337516 probable lysine- 5 Q6BDA0 Flowering 5 specific demethylase ELF6 LOC115707768 1 23803018 23809314 methionine--tRNA 5 Q9M2T9 Plant 1 ligase, Development chloroplastic/ mitochondrial LOC115708301 1 24496766 24498194 peroxisomal fatty acid 5 Q9ZPI6 Flowering 1 beta-oxidation multifunctional protein AIM1-like LOC115708299 1 24498265 24503783 peroxisomal fatty acid 5 Q9ZPI6 Flowering 1 beta-oxidation multifunctional protein AIM1 LOC115706913 1 24532123 24537064 transcription factor 5 Q9S7G7 Plant 1 MYB3R-1 Development LOC115705426 1 24596432 24601013 protein LIKE COV 1 5 Q8VY49 Plant 1 Development LOC115705894 1 24942837 24945282 ninja-family protein 5 Q94F39 Abiotic 1 AFP3 Stress Response LOC115705830 1 25411606 25417172 WD-40 repeat- 5 O22607 Flowering 1 containing protein MSI4 LOC115706333 1 25434413 25435675 protein EFFECTOR 5 F4K933 Plant 1 OF Development TRANSCRIPTION 2- like LOC115705658 1 25438604 25440440 pentatricopeptide 5 Q9ZQE5 Plant 1 repeat-containing Development protein At2g15690, mitochondrial-like LOC115706152 1 25459686 25464017 protein NDL1-like 5 Q9ASU8 Plant 6 Development LOC115704198 1 25468675 25470602 receptor-like protein 5 Q6JN46 Defense 1 EIX2 Response LOC115703920 1 25470605 25472293 receptor-like protein 5 Q6JN47 Defense 1 EIX1 Response LOC115703921 1 25480134 25484146 receptor-like protein 5 Q6JN46 Defense 1 EIX2 Response LOC115704723 1 25508917 25512502 receptor-like protein 5 Q6JN46 Defense 1 EIX2 Response LOC115704060 1 25573324 25577071 receptor-like protein 5 Q6JN46 Defense 1 EIX2 Response LOC115703929 1 25638458 25644464 receptor-like protein 5 Q6JN47 Defense 1 EIX1 Response LOC115705509 1 25812090 25819204 dolichyl- 5 Q93ZY3 Abiotic 1 diphosphooligosaccharide-- Stress protein Response glycosyltransferase subunit STT3A LOC115707308 1 25851978 25854860 SNW/SKI-interacting 5 O80653 Flowering 1 protein A LOC115706082 1 25912236 25920307 cell division cycle 5 Q8LGU6 Plant 1 protein 27 homolog B Development LOC115703943 1 26690186 26691314 peroxidase 7-like 5 Q9SY33 Abiotic 1 Stress Response LOC115704932 1 26709252 26709993 17.8 kDa class I heat 5 Q9LNW0 Abiotic 1 shock protein-like Stress Response LOC115705162 1 26731767 26733459 metacaspase-4 5 O64517 Defense 1 Response LOC115705161 1 26733633 26754867 protein FORGETTER 5 F4IF36 Plant 1 1 Development LOC115703947 1 26759318 26761463 octanoyltransferase 5 Q948J9 Plant 1 LIP2p, chloroplastic Development LOC115707530 1 26766485 26779325 E3 ubiquitin-protein 5 Q9SAL0 Defense 1 ligase RGLG4-like Response LOC115706643 1 26820658 26824620 NAC domain- 5 Q9LS24 Abiotic 1 containing protein 96 Stress Response LOC115706029 1 26953575 26959039 inositol 5 Q8GWB7 Plant 1 phosphorylceramide Development glucuronosyltransferase 1 LOC115703950 1 26975646 26989149 DNA-directed RNA 5 Q5D869 Defense 1 polymerase V subunit Response 1 LOC115708346 1 27022179 27027035 putative disease 5 Q9LRR4 Defense 1 resistance RPP13-like Response protein 1 LOC115704805 1 27081749 27085903 E3 ubiquitin-protein 5 Q10L91 Abiotic 1 ligase DIS1 Stress Response LOC115705657 1 27125299 27128771 protein Iojap-related, 5 Q9CAF9 Plant 1 mitochondrial Development LOC115706648 1 27146417 27156517 protein LNK2 5 F4JCX9 Flowering 1 LOC115705095 1 27157587 27166333 THO complex subunit 5 Q93VM9 Defense 1 1-like Response LOC115705649 1 27637863 27641705 receptor-like protein 5 P47735 Defense 1 kinase 5 Response LOC115706090 1 27663018 27666860 receptor-like protein 5 P47735 Defense 1 kinase 5 Response LOC115704873 1 27757381 27759040 MOB kinase activator- 5 Q9FHI1 Plant 1 like 1A Development LOC115704500 1 27782804 27783776 germin-like protein 5 P92995 Defense 1 Response LOC115703963 1 27863427 27866876 probable glucan endo- 5 O49352 Defense 1 1,3-beta-glucosidase Response BG4 LOC115703964 1 27889405 27891439 12-oxophytodienoate 5 Q9FUP0 Defense 1 reductase 3-like Response LOC115704687 1 27943047 27944926 probable glucan endo- 5 O49352 Defense 1 1,3-beta-glucosidase Response BG4 LOC115706394 1 27977420 27994954 12-oxophytodienoate 5 Q9FUP0 Defense 1 reductase 3-like Response LOC115706393 1 27991920 27994962 12-oxophytodienoate 5 Q9FUP0 Defense 1 reductase 3-like Response LOC115706391 1 27999501 28002834 12-oxophytodienoate 5 Q9FUP0 Defense 1 reductase 3 Response LOC115707489 1 28063218 28065659 growth-regulating 5 O81001 Plant 1 factor 1 Development LOC115707487 1 28067386 28076984 protein CTR9 5 B5X0I6 Flowering 1 homolog LOC115708224 1 28439232 28440518 abscisic acid receptor 5 O80920 Plant 1 PYLA Development LOC115705451 1 29130698 29146129 succinate- 5 Q9SAK4 Abiotic 1 semialdehyde Stress dehydrogenase, Response mitochondrial-like LOC115703603 1 29163075 29165210 myb family 5 Q9SAK5 Flowering 1 transcription factor APL LOC115703974 1 29941447 29941770 E3 ubiquitin-protein 5 Q9LX93 Defense 1 ligase RING1-like Response LOC115706567 1 31718119 31720661 protein EFFECTOR 5 F4K933 Plant 1 OF Development TRANSCRIPTION 2- like LOC115706872 1 36262646 36264680 disease resistance 5 Q9FT77 Defense 1 protein RLM3 Response LOC115707013 1 37621366 37624241 trimethyltridecatetraene 5 A0A1D6F9Y9 Terpene 3 synthase-like Synthesis LOC115704231 1 39032675 39034746 protein 5 Q9SLV0 Plant 6 DETOXIFICATION Development 51 LOC115705619 1 39964920 39980127 succinate- na Q9SAK4 Abiotic 1 semialdehyde Stress dehydrogenase, Response mitochondrial-like LOC115706189 1 40582862 40585944 laccase-6 na P93366 Plant 6 Development LOC115705547 1 41535074 41537655 protein TIFY 3B-like 6 Q9C5K8 Defense 1 Response LOC115704045 1 41638186 41641000 NAC domain- 6 Q9LS24 Abiotic 1 containing protein 96 Stress Response LOC115704046 1 41647091 41649663 protein NTM1-like 9 6 F4JN35 Defense 1 Response LOC115707050 1 41661906 41664692 NAC domain- 6 Q53NF7 Abiotic 1 containing protein 71- Stress like Response LOC115706598 1 41892932 41895370 NAC domain- 6 Q53NF7 Abiotic 1 containing protein 71 Stress Response LOC115704295 1 42053906 42057064 transcription factor 6 Q39081 Plant 1 CAULIFLOWER Development LOC115705224 1 42149387 42157032 protein LHY-like 6 Q6R0H1 Flowering 1 LOC115707066 1 43022734 43025460 trimethyltridecatetraene 6 A0A1D6F9Y9 Terpene 3 synthase Synthesis LOC115704075 1 44588468 44589140 (?)-germacrene D 6 Q6Q3H3 Terpene 3 synthase Synthesis LOC115705864 1 45043187 45045579 trihelix transcription 6 Q9LJG8 Plant 1 factor ASIL2 Development LOC115704090 1 46406694 46513230 receptor-like protein 6 P47735 Defense 1 kinase 5 Response LOC115703573 1 46725784 46727601 pentatricopeptide 6 Q9ZQE5 Plant 1 repeat-containing Development protein At2g15690, mitochondrial-like LOC115706032 1 46739199 46743524 protein NDL1 6 Q9ASU8 Plant 6 Development LOC115704999 1 46809734 46813214 receptor-like protein 6 Q6JN46 Defense 1 EIX2 Response LOC115707722 1 55899816 55902108 protein ELF4-LIKE 3 6 Q8S8F5 Flowering 1 LOC115704162 1 57624124 57625673 protein FAR1- 6 Q9SZL8 Plant 1 RELATED Development SEQUENCE 5-like LOC115704959 1 58152025 58153682 MOB kinase activator- 6 Q9FHI1 Plant 1 like 1A Development LOC115705125 1 58676076 58681797 two-component 6 Q689G6 Flowering 1 response regulator-like PRR95 LOC115704169 1 58840241 58843700 two-component 6 Q689G6 Flowering 1 response regulator-like PRR95 LOC115704202 1 62886507 62890810 putative disease na Q9LRR4 Defense 1 resistance RPP13-like Response protein 1 LOC115703755 1 62895004 62902603 putative disease na Q7XA40 Defense 1 resistance protein Response RGA3 LOC115704203 1 62904066 62906027 putative disease na Q9LRR4 Defense 1 resistance RPP13-like Response protein 1 LOC115704206 1 62980339 62989765 putative disease na Q9LRR4 Defense 1 resistance RPP13-like Response protein 1 LOC115706515 1 63680003 63682789 laccase-12 na P93366 Plant 6 Development LOC115706969 1 63752455 63755239 laccase-12-like na P93366 Plant 6 Development LOC115707304 1 64561706 64564684 (?)-germacrene D na Q6Q3H3 Terpene 3 synthase-like Synthesis LOC115705430 1 67036923 67043465 sucrose synthase 7 P13708 Plant 6 Development LOC115708111 1 67272472 67274373 NAC domain- 7 Q84WP6 Plant 6 containing protein 43- Development like LOC115705483 1 68154480 68160992 sucrose synthase 7 P13708 Plant 6 Development LOC115704010 1 69543915 69544589 probable xyloglucan 7 Q8LF99 Plant 6 endotransglucosylase/ Development hydrolase protein 26 LOC115705551 1 70321427 70326341 protein ENHANCED 7 Q9FHK4 Defense 1 DISEASE Response RESISTANCE 4 LOC115704368 1 75480550 75480924 E3 ubiquitin-protein 7 Q9LX93 Defense 1 ligase RING1-like Response LOC115704370 1 75498921 75499325 E3 ubiquitin-protein 7 Q9LX93 Defense 1 ligase RING1-like Response LOC115705753 1 76116340 76120780 diphosphomevalonate 7 F4JCU3 Terpene 3 decarboxylase MVD2, Synthesis peroxisomal, transcript variant X2 LOC115705779 1 76338789 76340757 transcription factor 7 Q8S9H7 Flowering 1 DIVARICATA LOC115706086 1 79600017 79603326 protein ABIL1 7 Q8S8M5 Plant 6 Development LOC115705896 1 79624700 79625935 acidic endochitinase 7 P19172 Defense 1 Response LOC115704845 1 79841893 79843306 ethylene-responsive 7 O82339 Plant 1 transcription factor Development CRF5 LOC115705930 1 81275345 81280137 protein FLOWERING 7 Q9CAE3 Flowering 5 LOCUS D LOC115704419 1 81627750 81630346 disease resistance 7 Q9M667 Defense 1 protein RPP13-like Response LOC115708293 1 82446742 82459983 putative disease 7 Q9SX38 Defense 1 resistance protein Response At1g50180 LOC115706217 1 84415154 84422125 MLO-like protein 11 7 Q9FI00 Defense 1 Response LOC115704465 1 84796041 84796756 disease resistance 7 F4JNB7 Defense 1 protein RPP5-like Response LOC115706507 1 86583450 86596088 mediator of RNA 7 H3K2Y6 Flowering 6 polymerase II transcription subunit 12 LOC115707599 1 86962839 86963589 disease resistance 7 F7J0N2 Defense 1 protein RGA5-like Response LOC115706939 1 87492519 87505383 MADS-box protein 7 O64645 Flowering 6 SOC1 LOC115704294 1 87513236 87519439 agamous-like MADS- 7 Q8LLR1 Plant 5 box protein MADS3 Development LOC115704439 1 87554396 87556217 gibberellin 20 oxidase 7 O04705 Plant 5 1-D Development LOC115706670 1 87776866 87778696 gibberellin 2-beta- 7 Q8LEA2 Plant 5 dioxygenase 1 Development LOC115706711 1 87981034 87993666 polycomb group 7 8L6Y4 Flowering 1 protein EMBRYONIC FLOWER 2 LOC115706816 1 88295385 88298890 zinc finger BED 7 B9FJG3 Plant 1 domain-containing Development protein RICESLEEPER 1 LOC115707067 1 89722933 89724872 protein ELF4-LIKE 4 7 Q570U6 Flowering 1 LOC115704534 1 89871993 89875730 disease resistance 7 Q39214 Defense 6 protein RPM1 Response LOC115704535 1 89883796 89887362 probable disease 7 P0C8S1 Defense 1 resistance RPP8-like Response protein 2 LOC115704536 1 89894163 89898218 probable disease 7 Q9LQ54 Defense 1 resistance protein Response At1g59620 LOC115704538 1 89907443 89911045 putative disease 7 Q9SX38 Defense 1 resistance protein Response At1g50180 LOC115707097 1 89945346 89948624 trimethyltridecatetraene 7 A0A1D6F9Y9 Terpene 3 synthase Synthesis LOC115704542 1 90130806 90133127 disease resistance 7 Q39214 Defense 6 protein RPM1 Response LOC115707510 1 90134805 90138744 probable disease 7 Q8W3K0 Defense 1 resistance protein Response At1g58602 LOC115707140 1 90258804 90261164 trihelix transcription 7 Q9LJG8 Plant 1 factor ASIL2 Development LOC115704917 1 90844005 90850931 disease resistance 7 F2VYU4 Defense 1 protein Pik-1 Response LOC115707243 1 90920807 90925402 farnesyl 7 Q09152 Terpene 3 pyrophosphate Synthesis synthase 1 LOC115708252 1 91520967 91528976 disease resistance na Q38834 Defense 1 RPP13-like protein 4 Response LOC115707345 1 91574789 91594109 disease resistance na Q38834 Defense 1 RPP13-like protein 4 Response LOC115707431 1 93260484 93264233 (3S,6E)-nerolidol na A0A438FFI5 Terpene 3 synthase 1 Synthesis LOC115707440 1 93272460 93281349 (3S,6E)-nerolidol na A0A438FFI5 Terpene 3 synthase 1 Synthesis LOC115707439 1 93293175 93297813 (E,E)-alpha-farnesene na E5GAF9 Terpene 3 synthase Synthesis LOC115704609 1 95539370 95540527 probable disease na Q84WD3 Defense 1 resistance protein Response At4g19060 LOC115707659 1 95547788 95551161 putative disease na POCB16 Defense 1 resistance protein Response At4g19050 LOC115707660 1 95558909 95561464 disease resistance na Q38834 Defense 1 RPP13-like protein 4 Response LOC115707673 1 95669006 95670339 protein MOTHER of na Q9XFK7 Plant 1 FT and TFL1 Development LOC115707816 1 98473959 98475878 probable xyloglucan na Q8LF99 Plant 6 endotransglucosylase/ Development hydrolase protein 8 LOC115705250 1 98881945 98885343 probable disease na Q8RXS5 Defense 1 resistance protein Response At5g63020 LOC115705312 1 99205969 99207282 caffeoylshikimate na Q9C942 Plant 6 esterase Development LOC115705245 1 99404746 99408696 cellulose synthase A na O48946 Plant 6 catalytic subunit 1 Development [UDP-forming] LOC115707871 1 99711927 99715699 zinc finger BED na Q9M2N5 Plant 1 domain-containing Development protein DAYSLEEPER LOC115707885 1 99830187 99837437 protein TOPLESS na Q0WV90 Plant 6 Development LOC115707972 1 100472554 100475218 protein HEADING na Q6K678 Flowering 6 DATE REPRESSOR 1 LOC115707995 1 100590340 100599253 ENHANCER OF AG- na Q9XER9 Flowering 6 4 protein 2 LOC115708006 1 100705924 100709761 putative disease na Q9LRR4 Defense 1 resistance RPP13-like Response protein 1 LOC115708005 1 100711463 100717126 putative disease na Q9LRR4 Defense 1 resistance RPP13-like Response protein 1 LOC115704650 1 100719260 100722348 putative disease na Q9LRR5 Defense 1 resistance protein Response At3g14460 LOC115705060 1 100729423 100733616 putative disease na Q9LRR4 Defense 1 resistance RPP13-like Response protein 1 LOC115708024 1 100735638 100737240 endochitinase EP3 na Q9M2U5 Defense 1 Response LOC115708023 1 100746791 100748186 endochitinase EP3 na Q9M2U5 Defense 1 Response