METHOD FOR PREPARING A TRANSFORMED, SALMO SALAR INTERFERON GAMMA (IFNG)-PRODUCING LACTOCOCCUS LACTIS BACTERIUM
20240131088 ยท 2024-04-25
Inventors
- Mario Cesar Gerardo TELLO REYES (Santiago, CL)
- Alvaro Eugenio SANTIBA?EZ VARGA (Santiago, CL)
- Mick Philippe PARRA MARDONEZ (Santiago, CL)
- Diego Enrique PAINE CABRERA (Santiago, CL)
- Claudia Andrea ZAPATA ROJAS (Santiago, CL)
- Andrea Del Pilar GARCES FERNANDEZ (Santiago, CL)
Cpc classification
A23V2002/00
HUMAN NECESSITIES
A23K50/80
HUMAN NECESSITIES
A23V2002/00
HUMAN NECESSITIES
A61K9/0053
HUMAN NECESSITIES
A61K35/744
HUMAN NECESSITIES
C12R2001/46
CHEMISTRY; METALLURGY
A23V2200/3204
HUMAN NECESSITIES
A23V2200/3204
HUMAN NECESSITIES
C12N15/746
CHEMISTRY; METALLURGY
International classification
A61K35/744
HUMAN NECESSITIES
A23K50/80
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
The present invention falls within the technical field of aquaculture, and specifically, the invention relates to a specific solution for preventing and treating bacterial diseases using a Lactococcus lactic lactic acid bacterium transformed to produce an interferon type II (IFN II) immunostimulating cytokine, particularly interferon gamma (IFNg or IFNy). Said transformed bacterium has been deposited in the Chilean Microbial Genetic Resources Collection at INIA with accession number RGM 2416 dated 22 Oct. 2017.
Claims
1. A method of preparing transformed L. lactis bacteria comprising steps of: a) digesting with restriction enzymes a plasmid that contains the reading frame of Salmo salar IFN? codon optimized for Lactococcus lactis, b) purifying the digestion product, corresponding to the IFN? gene with sticky ends for restriction enzymes; c) meanwhile, digesting the plasmid NZ8149 with enzymes; d) purifying the linearized plasmid from an agarose gel; e) ligating both purified products with ligase; f) dialyzing the ligation product; and g) transforming electrocompetent L. lactis bacteria with the ligated plasmid.
2. The method according to claim 1, wherein the enzymes of step a) are restriction enzymes NcoI and XbaI.
3. The method according to claim 1, wherein the enzymes of step c) are restriction enzymes NcoI and XbaI.
4. The method according to claims 1, wherein the electrocompetent bacteria of step g) belongs to the strain L. lactis NZ3900.
5. The method according to claim 1, wherein the enzymes of step a) and step c) are the same restriction enzymes.
6. The method according to claim 1, wherein the enzymes of step a) and step c) are the different restriction enzymes.
7. The method according to claim 1, wherein said plasmid to transform L. lactis bacteria to produce interferon gamma (IFN?) comprising a vector pNZ8149 and a sequence P1-Usp45-IFN?-GGG-6xHIS; wherein P1 is L. lactis constitutive expression promoter; Usp45 is a secretion signal; IFN? is Salmo salar interferon gamma (IFN?) mature mRNA coding sequence; GGG is a sequence coding for three glycines and 6xHis is a sequence coding for 6 terminal histidines.
8. A method of preparing transformed L. lactis bacteria comprising steps of: a) digesting with restriction enzymes a plasmid, wherein said plasmid to transform L. lactis bacteria to produce interferon gamma (IFN?) comprising a vector pNZ8149 and a sequence P1-Usp45-IFN?-GGG-6xHIS; wherein P1 is L. lactis constitutive expression promoter; Usp45 is a secretion signal; IFN? is Salmo salar interferon gamma (IFN?) mature mRNA coding sequence; GGG is a sequence coding for three glycines and 6xHis is a sequence coding for 6 terminal histidines. b) purifying the digestion product, corresponding to the IFN? gene with sticky ends for restriction enzymes; c) meanwhile, digesting the plasmid NZ8149 with enzymes; d) purifying the linearized plasmid from an agarose gel; e) ligating both purified products with ligase; f) dialyzing the ligation product; and g) transforming electrocompetent L. lactis bacteria with the ligated plasmid.
9. The method of claim 8, wherein the plasmid contains the reading frame of Salmo salar IFN? codon optimized for Lactococcus lactis.
10. The method according to claim 1, wherein the enzymes of step a) and step c) are the same restriction enzymes.
Description
DESCRIPTION OF THE FIGURES
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
DETAILED DESCRIPTION
[0050] The present invention refers to a probiotic feed that comprises lactic acid bacteria, particularly L. lactis, transformed to produce an immunostimulant cytokine, preferably type II IFN, to immunostimulate aquatic species against bacterial infections, thus achieving heterologous expression of an immunostimulant protein of Salmo salar in lactic acid bacteria. The L. lactisbacteria has been assigned the accession number RGM 2416, dated Oct. 22, 2017, by the INIA's Chilean Collection of Microbial Genetic Resources, Chile.
[0051] Immunostimulant proteins strongly regulate immune response. Administration of recombinant immunostimulant proteins have allowed their use as a therapeutic to increase immune response against bacterial pathogens. In aquaculture, there are no available in situ heterologous production systems for functional immunostimulant proteins for therapeutic use. Lactic acid bacteria are GRAS (Generally Regarded as Safe) organisms, that because of this classification have been used as vaccines and as therapeutic release systems.
[0052] The lactic acid bacteria of this invention can be used to express and secrete functional immunostimulant proteins in aquatic species, particularly in fishes and preferably in Salmo salar and rainbow trout. The present lactic acid bacteria allows non-invasive immunogenic protection applicable in large scale, capable of increasing current immunization systems.
[0053] Administration of the present lactic acid bacteria, that produce an immunostimulant cytokine, can stimulate in vivo the expression of genes that respond to IFN gamma and reduce mortality of aquatic species challenged with F. psychropillhum and P. salmonis
[0054] Using molecular biology tools, lactic acid bacteria was generated that produce an immunostimulant cytokine. Its immunostimulant properties were studied in species highly important for aquaculture, administrating an oral dosage of 1?10.sup.7 UFC per fish. Immunostimulation was assessed quantifying genes that respond to this cytokine using real time qPCR normalizing their expression against the housekeeping gene eF1a. To achieve this objective, total RNA was extracted from immunological organs (spleen and kidney), which were previously assessed studying their morphology and any signs of toxicity. The lactic acid bacteria produce and secret the heterologous protein. The protein was located mainly in the cytoplasmatic fraction. The bioassays showed that the protein is functional when stimulating the expression of immunological genes.
[0055] The invention relates, particularly, to transformed Lactococcus lactis bacteria that produce interferon gamma from Salmo salar that includes the DNA construction that comprises pNZ8149-P1-USP45-IFNg-GGG-6xHIS where pNZ8149 is the transformed vector; P1 is L. lactis constitutive expression promoter; Usp45 is a secretion signal; IFN? is Salmo salar interferon gamma (IFN?) mature mRNA coding sequence; GGG is a sequence coding for three glycines and 6xHis is s sequence coding for 6 terminal histidines. The transformed strain of Lacococcus lactis is identified as NZ3900, however, it is not limiting and other strains of L. lactis could be used. The bacteria is preferably Lactococcus lactis NZ3900 transformed with the genetic system that comprises the plasmid pNZ8149/P1-USP45-IFNg-GGG-6xHIS. Preferably, the recombinant strain is the one with the accession number RGM 2416, dated Oct. 22, 2017, by the INIA's Chilean Collection of Microbial Genetic Resources, Chile.
[0056] It is also part of the invention, a useful plasmid to transform L. lactis bacteria to produce interferon gamma (IFN?) that comprising the vector pNZ8149 and the sequence P1-Usp45-IFN?-GGG-6xHIS; where P1 is L. lactis constitutive expression promoter; Usp45 is a secretion signal; IFN? is Salmo salar interferon gamma (IFN?) mature mRNA coding sequence; GGG is a sequence coding for three glycines and 6xHis is s sequence coding for 6 terminal histidines.
[0057] Likewise, the invention relates to a method to prepare the transformed L. lactis bacteria that comprises the following steps: [0058] a) Digesting with restriction enzymes a plasmid that contains the reading frame of Salmo salar IFNg codon optimized for Lactococcus lactis, [0059] b) ing the digestion product, corresponding to the IFNg gene with sticky ends for restriction enzymes, [0060] c) Meanwhile, digesting with the same enzymes the plasmid NZ8149, [0061] d) Purifying the linearized plasmid from an agarose gel, [0062] e) Ligating both purified products with ligase, [0063] f) Dialyzing the ligation product, [0064] g) Transforming electrocompetent L. lactis bacteria with the ligated plasmid.
[0065] The restriction enzymes are preferably, for steps a) and c) restriction enzymes Ncol and Xbal and electrocompetent bacteria of step g) is the strain L. lactis NZ3900.
[0066] It is part of this invention a probiotic feed to immunostimulate aquatic species, preferably immunostimulate fishes. The probiotic feed comprises transformed L. lactis bacteria with a transformed Lactococcus lactis bacteria producing interferon gamma of Salmo salar that includes the DNA construction that comprises pNZ8149-P1-USP45-IFNg-GGG-6xHIS where pNZ8149 is the transformed vector; P1 is L. lactis constitutive expression promoter; Usp45 is a secretion signal; IFN? is Salmo salar interferon gamma (IFN?) mature mRNA coding sequence; GGG is a sequence coding for three glycines and 6xHis is s sequence coding for 6 terminal histidines. Likewise, the invention comprises the method to prepare the probiotic feed described above.
[0067] Additionally, this invention protects any immunomodulatory composition for aquatic species, under the broadest scope of composition. The composition can be liquid or solid and have excipients to provide stability for storage and enhance bioavailability of the transformed bacteria of this invention. Furthermore, the composition includes all combinations of useful organic molecules to administrate to aquatic species such as proteins, lipids, saccharides, in combination with the transformed L. lactis bacteria described above or with the bacteria described in the preferred conducted examples. This composition can comprise the combination of the bacteria of the invention with recombinant protein vaccines or with nucleic acid vaccines, bacterines, probiotics, prebiotics or other immunomodulators, vitamins, etc.
[0068] The use of the transformed L. lactis bacteria is for preparing feed or a useful composition for immunostimulating aquatic species, particularly, to immunostimulate fishes. The given use for these bacteria is to prepare useful feed to reduce bacterial load, preferably bacterial load of Flavobacterium psychrophilum and or Piscirickettsia salmonis. The use of the bacteria and the feed that comprises it is to prepare a feed or a useful composition to treat or prevent infection from Flavobacterium psychrophilum and/or Piscirickettsia salmonis in fishes.
[0069] Is part of this invention, a kit that includes a packing that comprises the transformed L. lactisbacteria with the DNA construction pNZ8149-P1-USP45-IFNg-GGG-6xHIS. Likewise, this kit can comprise instructions to be used to feed, treat or prevent bacterial diseases in aquatic species, preferably, fishes important for aquaculture. In the preferred embodiment instructions have information for the use for feeding fishes, treat or prevent diseases caused by Flavobacterium psychrophilum and Piscirickettsia salmonis in fishes.
[0070] The invention also comprises the method to reduce bacterial load in aquatic species, that comprises the administration to this species the feed prepared with transformed L. lactisbacteria, selected from any bacteria that comprises the DNA construction pNZ8149-P1-USP45-IFNg-GGG-6xHIS detailed in the examples of this invention. The aquatic species are preferably fishes, and the method treats or prevents infection with Flavobacterium psychrophilum or Piscirickettsia salmonis. The method for delivery is capable of treating or preventing a bacterial infection by reducing bacterial load in aquatic species, preferably fishes.
EXAMPLES
[0071] Example 1: Using synthetic biology the coding gene for a codon-optimized immunostimulating protein from Salmo salar with a secretion peptide and 6 histidine tail was designed and synthesized. The gene was clones into a food grade expression vector. Production of the heterologous protein was confirmed using Western Blot and its functionality through bioassays.
[0072] The present invention consists in a recombinant Lactococcus lactis NZ3900 strain, that comprises the plasmid NZ8149 into which a synthetic DNA segment, that comprises P1 promoter, the signal peptide of protein USP45, a gene that codifies the mature sequence of type I interferon of Salmo salar and a tail of 3 glycines and 6 histidines, denominated as pNZ8149-IFNgSS (
[0073] The sequence of the IFN? gene was obtained from Salmo salar's genome and codon-optimized to be expressed in an L. lactis host (
Methodology
[0074] Design of the pNZ8149 vector. To design the lactococcal vector, the plasmid pNZ8140 (Mobitec?) was used as backbone and the plasmid pJet1.2-IFNg (Genescript?) contained the reading frame of Salmo salar's IFN? (GenBank: FJ263446.1). The IFN? gene was codon-optimized in silico for Lactococcus lactis NZ3900 using the online application www.kazusa.or.jp, and then modified to include in the amino terminal end the sequence that codifies the USP45 peptide and in the carboxylic end a sequence that codifies a tail of 3 glycines and 6 histidines (GGGHHHHHH) SEQ ID No:5. These sequences were added in frame with the L. lactis codon-optimized IFN? gene. Likewise, the P1 promoter sequence was added in silico to the 5 end of the sequence that codifies USP45-IFNg-GGGHHHHHH. This new sequence, P1-USP45-IFNg-GGGHHHHHH was synthetized in vitro and cloned into pJet1.2 (Genescript?) (
[0075] Because the plasmids pNZ8149 and pJet1.2-IFN? have a replication origin for propagation in E. coli and ampicillin resistance as selection marker, the MC1061 strain was used to obtain high concentrations of both plasmids. Afterwards, both plasmids were digested for 1 hour at 37? C. with enzymes Ncol and Xbal, present in the multiple cloning site of pNZ8149 and in each end of the IFN? in pJet1.2. Both digestions were corroborated in a 1% w/v agarose gel from which the linear vector and the insert were purified using the Wizard SV Gel and PCR Clean-Up System (Promega?). The vector and the insert were ligated overnight at 4? C. and dialyzed the next day for 30 minutes prior to electroporation with Lactococcus lactis NZ3900 to obtain the bacteria with vector pNZ8149-IFNg.
[0076] Detection of IFN? in L. lactis cultures. To detect the expression of the recombinant protein, Western Blot assays were performed from cytoplasmatic extract of sonicated L. lactis. To do so, a preculture of L. lactis pNZ8149-IFNg was cultured overnight at 30? C. in M17 media with 0.5% lactose. The following day, a 40 mL culture was inoculated with 2% inoculum, after cultivating at 30? C. up to an OD.sub.600 0.4-0.6 the culture was divided in equal parts. To some cultures, nisin was added between 0 and 10 ng/mL. Cultures were then incubated for 2 hours at 30? C. Afterwards, bacteria were collected through centrifugation at 7,000 RPM for 20 min at 4? C.
[0077] The bacterial pellet was resuspended in 500 uL of PBS1x supplemented with a protease inhibitor 1 mM. Afterwards, it was sonicated 5 times for 15 seconds each with an Ultrasonic processor Sonic Vibracell VCX130 (90% amplitude), kept in ice between cycles. The sample was centrifuged at 6,000 RPM for 10 min at 4? C. and the supernatant was separated from the cellular debris, storage in a new tube and frozen at ?20? C. until its use.
[0078] To determine total protein concentration in the extract the Bradford method was used. Once the concentration was known, it was normalized to resolve and compare the amount of protein through SDS-PAGE electrophoresis. 10 ug of the cytoplasmatic extract of induced and not induced with nisin IFN? producingL. lactis and of L. lactis that contained a pNZ8149 plasmid without a IFN? reading frame as control were loaded. Samples were run in an electrophoresis for 40 min at 60 V and then for 1.5 hr at 120 V. Proteins contained in the polyacrylamide gel were transferred to a nitrocellulose membrane at 300 mA for 7 min. Afterwards, the membrane was blocked with a PBS-BSA 2% solution while shaking at 4? C. Then, the membrane was washed at room temperature 3 times for 10 minutes with PBS 1X-Tween 20 at 0.1% and incubated for 1 hour with an anti-His primary antibody at a 1:2,000 dilution in a 2% PBS-BSA solution. Next, the membrane was washed with the same procedure and then incubated for 1 hour with a 1:5,000 dilution of the secondary antibody, an anti-rabbit IgG conjugated with horseradish peroxidase. The membrane was washed again and developed by chemiluminescence with the Supersignal? West Pico Chemilumminescent Substrate Kit, incubating the solutions for 5 minutes and exposing the membrane y a digital development equipment C-Digiy model 3600 (LI-COR) for 7 minutes for imaging.
[0079] Detection of IFN? in the supernatant of L. lactis cultures. To detect the protein from the supernatant of L. lactis cultures, the supernatant was collected after centrifuging the bacterial culture, then it was precipitated with 6 volumes of acetone and stored at ?20? C. overnight. Afterwards, it was centrifuged at 6,000 RPM for 10 min at 4? C., then the supernatant was discarded and the precipitate was washed 2 times with double distilled water, finally, the pellet was resuspended in 50 uL of protein lading buffer. To detect the protein the Western Blot protocol described above was used.
[0080] IFN? mRNA quantification in L. lactis cultures. To correlate the induction of protein with IFN? messenger RNA levels generated by L. lactis (
[0081] Biological activity of IFN? produced by L. lactis. To determine if the produced protein was biologically active, cytoplasmatic extracts of the bacteria were incubated with SHK-1 cells, cells derived from Salmo salar (Table 1) and then some transcripts involved in the response to IFN? were quantified. Briefly, different proportions between L. lactis and L. lactis-IFN? cytoplasmatic extracts were mixed with L-15 medium and incubated for 8 hours at 16? C. with SHK-1 cells to determine the contribution of the recombinant protein amount from the total protein content by the bacteria. Afterwards, total RNA from salmon cells was extracted using the E.Z.N.A Total RNA kit (OMEGA bio-tek) and treated with DNase I (Promega?). Treated RNA was used for synthesis of cDNA with Oligo(dT) with the following reaction mix: 11 uL of treated RNA, 0.5 uL of Oligo(dt) (10 mM), 1 uL of dNTPs (10 mM each), 0.2 uL of M-MLV (Promega C)), 7 uL of nuclease free water. The obtained cDNA was diluted 1:2 and used for relative quantification of transcripts related to the immune response by qPCR with the following reaction mix: 2 uL of cDNA, 5 uL of 2X SensiMix SYBR No-ROX Kit, 0.25 uL of Fw (10 mM),0.25 uL of Rv (10 mM) and 2 uL of nuclease free water (Table 2).
TABLE-US-00001 TABLE 1 (FIG. 5) Amount of total protein used in assays to determine the contribution of IFN? to the immune response of SHK-1 cells. Samples with 20 ug of total protein amount were obtained by mixing sonicated lysate of IFN? expressing L. lactis (L.L IFN?) and lysate of L. lactis that does not express it (L.L empty) in different proportions. Starting from the sample containing 20 ug of total protein all working dilutions were prepared. L.L IFN? L.L empty Final protein (ug) (ug) content (ug) 0.0 20.0 20 2.0 18.0 20 6.0 14.0 20 10.0 10.0 20 14.0 6.0 20 20.0 0.0 20
TABLE-US-00002 TABLE2 Nucleotidesequenceofprimersusedforquantificationofimmune responsegenesandstudiedpathogens. Gene Primer 5.fwdarw.3 IFN?salmon FW CCGTACACCGATTGAGGACT RV GCGGCATTACTCCATCCTAA IL-1bsalmon FW CCCCATTGAGACTAAAGCCA RV GCAACCTCCTCTAGGTGCAG TGF-?salmon FW AGCTCTCGGAAGAAACGACA RV AGTAGCCAGTGGGTTCATGG gammaIP10salmon FW GTGTCTGAATCCAGAGGCTCCA RV TCTCATGGTGCTCTCTGTTCCA IFN? FW CACATTTGCAAAATCTTTGGGCT L.lactis-IFN? RV CAATCGTTGTGCTTGTCGTCT IL-6salmon FW CCTTGCGGAACCAACAGTTTG RV CCTCAGCAACCTTCATCTGGTC IL-12salmon FW TGACGCTTTTTCTCACCGGTTGT RV ACGCTTTGCAGCATGAGCTTGA eF1?salmon FW GGGTGAGTTTGAGGCTGGTA RV TTCTGGATCTCCTCAAACCG RpoSF. FW GAAGATGGAGAAGGTAATTTAGTT psychrophilum GATATT RV CAAATAACATCTCCTTTTTCTACAACT TGA STAT1 FW GACCAGCGAACCCAAGAACCTGAA RV CACAAAGCCCAGGATGCAACCAT rDNA16S FW AGGGAGACTGCCGGTGATA P.salmonis RV ACTACGAGGCGCTTTCTCA
Result Description
[0082] pNZ8149 has a food grade selection marker that allows lactose metabolism (LacF), it has a constitutive promoter P1 and a nisin inducible promoter, L. lactis' natural secretion signal Usp45, Salmo salar IFN? codifying gene and a histidine tag. RepA and RepC are genes that allow the plasmid's replication (
[0083] When using the cytoplasmitic extract of sonicated bacteria on salmon SHK-1 cell line, normalizing the amount of total protein (Table 1) it is possible to detect the induction of transcipts such as STAT1, gIP10 and IL-1b, suggesting that the protein is functional in vitro because the first two are involved in the signalling cascade initiated by IFN? and the third is involved in the natural proimmflamatory response following IFNg. (
Example 2: Effects of administering IFN? producig L. lactis bacteria
[0084] To assess the immunoestimulating effect of IFN? producing L. lactis in an in vivo model an assay was performed with rainbow trouts (average weight: 20-25 g) were the effect of the probiotic was evaluated through the course of the experiment during and after feeding it as it is described in
[0085] The approach consisted in acclimating the fish for 7 days, then feeding them for 7 days with a) L. lactis-IFN?, b) L. lactis with an empty vector and c) commercial feed. At day 0 (before treatment), 2 and 6 and 3 fish were sampled. Afterwards, treatment was suspended and all fish were given commercial feed. Then, 3 fish were sampled from each group at days 1, 3, 5 and 7 days after probiotic feed. While sampling, during probiotic feed (d.p.f) and after probiotic feed (a.p.f), 100 uL of blood was extracted from 3 fish, which were then sacrificed prior to spleen and kidney extraction. Blood was used to quantify lysozyme enzymatic activity in serum by means of Micrococcus luteus suspensions. The assay consisted in measuring the decrease of absorbance at 450 nm in 180 uL of a M. luteus stock incubated with 20 uL of serum, using as a positive control 200-400 units of lysozyme/mL.
[0086] The following formula was used to calculate the amount of lysozyme:
[0087] To determine if stimulation of the immune response at a transcript level occurs, total RNA from spleen and kidney was extracted with TRIzol following the manufacturers recommendation. Then, cytokines IL-1?, IL-6, IL-12, TGF-?, IFN?, gamma IP10 and STAT1 were quantified by relative quantification. Treated RNA with DNase I was used as template for cDNA synthesis with Oligo(dT) following this reaction mixture: 11 uL od treated RNA, 0.5 uL of Oligo(dt) (10 mM), 1 uL of dNTP (10 mM each), 0.5 uL of M-MLV (Promega?), 7 uL of nuclease free water. The obtained cDNA was diluted 1:2 and used as template for relative quantification of the transcripts related to the immune response by qPCR with the following reaction mix: 2 uL of cDNA, 5 uL of 2X SensiMix SYBR No-ROX Kit, 0.25 uL of Fw (10 mM), 0.25 uL of Rv (10 mM) and 2 uL of nuclease free water (Table 2).
[0088] To assess if the observed immunostimulation is able to create protection against pathogens relevant to salmon farming, a challenge in rainbow trouts (average weight: 15-20 g) was set up using F. psychrophilum (1?10.sup.8 bacteria/fish) as model. Fish were acclimated for 7 days prior to treatment; then, a 7 day special feeding period began and 5 days later the challenge was performed. Afterwards, mortality was registered during the following 18 days to asses immune response and bacterial load.
[0089] In this assay the following treatments were studied: a) Fish fed for 7 days with L. lactis-IFN?(1?10.sup.7 bacteria/fish) and then infected, b) Fish fed for 7 days with L. lactis with an empty vector (1?10.sup.7 bacteria/fish) and then infected and c) Fish fed for 7 days with commercial feed and then infected. Mortality was registered for 17 days after infection, time during which spleen of dying fish was extracted and from fish that survived the experiment for bacterial load quantification
[0090] To determine if higher doses or a prolonged diet could increase survival, a second challenge in rainbow trout (average weight: 30-40 g) was performed with F. psychrophilum (1?10.sup.8 bacteria/fish). In this assay, fish were acclimated for 7 days, then special feeding began for 7 days and 5 days afterwards the challenge was performed. The following conditions were studied: a) Fish fed for 7 days with a doses 3 times higher than the original of L. lactis-IFN?(3?10.sup.7 bacteria/fish) and then infected, b) Fish fed for 13 days with L. lactis-IFN? (1x10 7 bacteria/fish) and then infected, c) Fish fed for 7 days with L. lactis-IFN? (1?10.sup.7 bacteria/fish) and then infected, d) Fish fed for 7 days with L. lactis with and empty plasmid (1?10.sup.7 bacteria/fish) and then infected and e) Fish fed for 7 days with a commercial feed and then infected. To determine if probiotic administration changes the physical condition, length and weight of surviving fish was recorded.
[0091] To assess the protective effect of L. lactis-IFN? on Salmo salar, the intracellular bacteria Pisiricketssia salmonis was used as a model (1?10.sup.7 bacteria/fish). Fish were first acclimated for 7 days and then the following treatments began: a) Fish fed for 7 days L. lactis-IFN? (1?10.sup.7 bacteria/fish) and then infected, b) Fish fed for 14 days L. lactis-IFN? (1x10 7 bacteria/fish) and then infected, c) Fish fed for 7 days with L. lactis with and empty plasmid (1x10 7 bacteria/fish) and then infected and d) Fish fed for 7 days with commercial feed and then infected. Mortality was recorded for 23 days after infection.
[0092] Bacterial Load: Bacterial load of infected fish with P. salmonis or F. psycrophillum was determined by absolute qPCR using total DNA extracted from the immunological organs spleen and kidney. From these organs, total DNA was extracted with the Wizzart Genomic DNA Kit (Promega C)). Purified DNA was quantified by absorbance at 260 nm. 50 ng of total DNA were used for the qPCR reaction. To detect P. psycrophillum the primers rpoS-F (5 GAA GAT GGA GAA GGT AAT TTA GTT GAT 3) and rpoS-R (5 CAA ATA ACA TCT CCT TTT TCT ACA ACT 3) were used, which amplify a 200 bp fragment. To detect P. salmonis the primers 16SPS-F (5 AGG GAG ACT GCC GGT GAT A 3) and 16SPS-R (5 ACT ACG AGG CGC TTT CTC A 3) were used. Each amplification product showed only one denaturation peak indicating a specific amplification product. For each one of the amplicons a calibration curve was constructed with increasing concentrations of the PCR product previously cloned on pGEM-T. Through this method the number of bacteria was calculated, assuming that there is only one copy of the gene in each bacterium chromosome.
Result Description
[0093] To asses the in vivo effect, transformed bacteria was administrated with feed to healthy rainbow trout specimens, then these were analyzed during and after feeding. Two paramenters were studied from spleen and kidney: a) transcripts related to immune respone of IFNg from spleen and kidney during probiotic feeding (
[0094] Given that estimulation of type II IFN related genes was observed, the protective effect of the probiotic was assessed, for this an experiment was set up where rainbow trout were challenged with Flavobacterium psychrophillum (
[0095] When administrating L. lactis-IFN? for a longer period of time (13 days instead of 7), it was observed higher survival (54%) than in fish fed for 7 days (42%), the same effect was seen in fish fed with a dosage 3 times higher than the original one (42%), which indicates that prolonging feeding gives a better result (
[0096] The potential use of the probiotic in Salmo salar challenged with Pisciricketssia salmonis was studied, fish fed with L. lactis-IFNg for 7 days (Treatment a: 28% survival) present a slight increase in protection compared to fish treated with the probiotic for 14 days (treatment b: 25% survival) suggesting that the protective effect against P. salmonis is given when feeding fish for 7 days and then it is maintained constant. On the other hand, fish fed with L. lactiswith an empty vector (treatment c: 0% survival) presented total mortality, however, fish fed with L. lactis with the plasmid without insert/commercial feed showed significant disparity in their mortality (Treatment d: 12% and 50% each replica). Therefore, L. lactis-IFN? can contribute to the survival of fish infected with P. salmonis (
[0097] To determine if L. lactis pNZ8149 without insert has an effect on survival of fish challenged with P. salmonis, the experiment was repeated with Salmo salar specimens (average weight: 50 g) infected and fed with probiotic (
TABLE-US-00003 Sequences <110> ConsorcioTecnol?gicodeSociedadAcu?colaS.A.yUniversidaddeSantiago <120> LactococcusLactisbacteriatransformed,RGM2416,producingSalmosalar interferongamma(IFNg),feedancompositionthatcomprisesit,toimmunostimulate aquaticspeciesandpreventinfectionofF.psychrophilium,P.salmonisorbothand methostoobtainit. <160> 5 <210> 1 <211> 779 <212> ADN <400> 1 ccatggtatagatctaattaatctataaaccatatccctctttggaatcaaaatttatta 60 tctactcctttgtagatatgttataatacaagtatcaatgatctgggagaccacaacggt 120 ttcccactagaaataattttgtttaactttagaaaggagatatacgcatgaaaaaaaaga 180 ttatctcagctattttaatgtctacagtgatactttctgctgcagccccgttgtcaggtg 240 tttacgctgctcaatatacatcaattaatatgaaatcaaatattgataaacttaaagtac 300 attataaaattagtaaagatcaattgtttaatggaaaaccagtttttcctaaagatacat 360 ttgaagattcagaacgtagagtttggatgtctgttgtattagatgtatatcgttcaattt 420 ttaatcaaatgcttaatcaaacaggtgatcaagaagtacgtgaaagattagatcaagtta 480 aaggaaaagtacaagaaactcaaaaacattattttcttaaacgaattccagaattgagaa 540 cacatttgcaaaatctttgggctattgaaactagtaatacaactgttcaaggaaaagcat 600 tgtcagaatttattactatttatgaaaaagcttctaaattagcacttaaaattcatttaa 660 agaaagataatcgacgtaaaagacgacaagcacaacgattgaaaagtagtattatgggag 720 gtggacatcatcatcatcatcattaaaaaaaagtcttaaaataataaaaatagtctaga <210> 2 <211> 161 <212> ADN <400> 2 tatagatctaattaatctataaaccatatccctctttggaatcaaaatttattatctact 60 cctttgtagatatgttataatacaagtatcaatgatctgggagaccacaacggtttccca 120 ctagaaataattttgtttaactttagaaaggagatatacgc <210> 3 <211> 81 <212> ADN <400> 3 atgaaaaaaaagattatctcagctattttaatgtctacagtgatactttctgctgcagcc 60 ccgttgtcaggtgtttacgct <210> 4 <211> 468 <212> ADN <400> 4 gctcaatatacatcaattaatatgaaatcaaatattgataaacttaaagtacattataaa 60 attagtaaagatcaattgtttaatggaaaaccagtttttcctaaagatacatttgaagat 120 tcagaacgtagagtttggatgtctgttgtattagatgtatatcgttcaatttttaatcaa 180 atgcttaatcaaacaggtgatcaagaagtacgtgaaagattagatcaagttaaaggaaaa 240 gtacaagaaactcaaaaacattattttcttaaacgaattccagaattgagaacacatttg 300 caaaatctttgggctattgaaactagtaatacaactgttcaaggaaaagcattgtcagaa 360 tttattactatttatgaaaaagcttctaaattagcacttaaaattcatttaaagaaagat 420 aatcgacgtaaaagacgacaagcacaacgattgaaaagtagtattatg <210> 5 <211> 24 <212> ADN <400> 5 ggaggtggacatcatcatcatcat