Deoxyribozymes Generating Chemiluminescent Signals

20240132941 ยท 2024-04-25

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to self-phosphorylating deoxyribozymes containing or consisting of the nucleotide sequence: 5-X.sup.1X.sup.2X.sup.3AX.sup.4X.sup.5-R.sup.1-X.sup.6X.sup.7X.sup.8X.sup.9X.sup.10-bp1-helix1-R.sup.2-helix2-bp2-X.sup.11TGACX.sup.12TGGGAX.sup.13-helix3-X.sup.14-R.sup.3-3 (SEQ ID NO. 1) wherein X.sup.1 is G or T; X.sup.2 is G or T; X.sup.3 is A or C; X.sup.4 is G or T; X.sup.5 is A or T; X.sup.6 is G or T or A; X.sup.7 is A or C or G or T; X.sup.8 is A or G or T; X.sup.9 is T or C or A or G; X.sup.10 is A or T or G; X.sup.11 is G or A; X.sup.12 is T or C or G; X.sup.13 is T or G or C; X.sup.14 is G or A or C or T; R.sup.1 represents a nucleotide sequence containing 3 to 30 nucleotides; R.sup.2 represents a nucleotide sequence containing 3 to 30 nucleotides; R.sup.3 represents a nucleotide sequence containing 0 to 30 nucleotides; bp1 and bp2 are nucleotides selected from G, A, C, T, which together form a base pair; helix1, helix2, and helix3 each independently denotes a nucleotide sequence preferably containing 4 or more nucleotides, wherein helix1, helix2, and helix3 together form a triple helical structure. The deoxyribozymes of the present invention may be used for detection of chemiluminescent substrates, or for detection of analytes (ligands) based on chemiluminescent reaction of the substrates catalyzed by the deoxyribozymes.

    Claims

    1. A deoxyribozyme containing or consisting of nucleotide sequence: TABLE-US-00239 (SEQIDNO.1) 5-X.sup.1x.sup.2X.sup.3AX.sup.4X.sup.5-R.sup.1-X.sup.6X.sup.7X.sup.8X.sup.9X.sup.10-bp1-helix1-R.sup.2-helix2- bp2-X.sup.11TGACX.sup.12TGGGAX.sup.13-helix3-X.sup.14-R.sup.3-3 wherein X.sup.1 is G or T; X.sup.2 is G or T; X.sup.3 is A or C; X.sup.4 is G or T; X.sup.5 is A or T; X.sup.6 is G or T or A; X.sup.7 is A or C or G or T; X.sup.8 is A or G or T; X.sup.9 is T or C or A or G; X.sup.10 is A or T or G; X.sup.11 is G or A; X.sup.12 is T or C or G; X.sup.13 is T or G or C; X.sup.14 is G or A or C or T; R.sup.1 represents a nucleotide sequence containing 3 to 30 nucleotides; R.sup.2 represents a nucleotide sequence containing 3 to 30 nucleotides; R.sup.3 represents a nucleotide sequence containing 0 to 30 nucleotides; bp1 and bp2 are nucleotides selected from G, A, C, T, which together form a base pair; helix1, helix2, and helix3 each independently denotes a nucleotide sequence preferably containing 4 or more nucleotides, wherein helix1, helix2, and helix3 together form a triple helical structure.

    2. The deoxyribozyme according to claim 1, containing or consisting of nucleotide sequence: TABLE-US-00240 (SEQIDNO.1) 5-X.sup.1x.sup.2X.sup.3AX.sup.4X.sup.5-R.sup.1-X.sup.6X.sup.7X.sup.8X.sup.9X.sup.10-bp1-helix1-R.sup.2-helix2- bp2-X.sup.11TGACX.sup.12TGGGAX.sup.13-helix3-X.sup.14-R.sup.3-3 wherein X.sup.1 is G; X.sup.2 is G; X.sup.3 is A or C; X.sup.4 is G; X.sup.5 is A or T; X.sup.6 is G; X.sup.7 is A; X.sup.8 is A; X.sup.9 is T or C; X.sup.10 is A; X.sup.11 is G; X.sup.12 is T or C; X.sup.13 is T; X.sup.14 is G or A or C or T; and wherein one or more, preferably one or two, of X.sup.1-X.sup.14 are replaced by the following nucleotides: X.sup.1=T; X.sup.2=T; X.sup.4=T; X.sup.6=T or A; X.sup.7=C or G or T; X.sup.8=G or T; X.sup.9=A or G; X.sup.10=T or G; X.sup.11=A; X.sup.12=G; X.sup.13=G or C.

    3. The deoxyribozyme according to claim 1, containing or consisting of nucleotide sequence: TABLE-US-00241 (SEQIDNO.2) 5-GGX.sup.3AGX.sup.5-R.sup.1-GAAX.sup.9A-bp1-helix1-R.sup.2-helix2-bp2- GTGACX.sup.12TGGGAT-helix3-X.sup.14-R.sup.3-3 wherein X.sup.3 is A or C; X.sup.5 is A or T; X.sup.9 is T or C; X.sup.12 is T or C; X.sup.14 is G or A or C or T.

    4. The deoxyribozyme according to claim 1, containing or consisting of nucleotide sequence: TABLE-US-00242 (SEQIDNO.3) 5-GGAAGA-R.sup.1-GAATA-bp1-helix1-R.sup.2-helix2-bp2- GTGACTTGGGAT-helix3-G-R.sup.3-3, wherein R.sup.1 represents a nucleotide sequence containing 3 to 30 nucleotides; R.sup.2 represents a nucleotide sequence containing 3 to 30 nucleotides; R.sup.3 represents a nucleotide sequence containing 0 to 30 nucleotides; bp1 and bp2 are nucleotides selected from G, A, C, T, which together form a base pair; helix1, helix2, and helix3 each independently denotes a nucleotide sequence preferably containing 4 or more nucleotides, wherein helix1, helix2, and helix3 together form a triple helical structure.

    5. The deoxyribozyme according to claim 1, wherein R.sup.3 is or contains an aptamer, and R.sup.2 is or contains a sequence complementary to the aptamer.

    6. The deoxyribozyme according to claim 1, wherein helix1, helix2, helix3 is CCCC, GGGG, GGGG; or CCCT, AGGG, GGGT; or CTCC, GGAG, GAGG; or CCCT, AGGG, GGGA.

    7. The deoxyribozyme according to claim 1, containing or consisting of a sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO: 17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO. 20, SEQ ID NO, 21, SEQ ID NO:22, SEQ ID NO. 23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:32, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42. SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ Ii) NO:61, SEQ NO:62, SEQ NO:63, SEQ ID NO:64, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, SEQ ID NO:70, SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:76, SEQ ID NO:77, SEQ ID NO: 78, SEQ ID NO:79, SEQ ID NO:80, SEQ ID NO:81, SEQ ID NO:82, SEQ ID NO:84, SEQ ID NO:92, SEQ ID NO:93, SEQ ID NO:94, SEQ ID NO:95, SEQ ID NO:96, SEQ ID NO:97, SEQ ID NO:98, SEQ ID NO:100, SEQ ID NO:101, SEQ ID NO:102, SEQ ID NO:108, SEQ ID NO:109, SEQ ID NO:110, SEQ ID NO:111, SEQ ID NO:113, SEQ ID NO:114, SEQ ID NO:115, SEQ ID NO:118, SEQ ID NO:119, SEQ ID NO:120, SEQ ID NO:121, SEQ ID NO:122, SEQ ID NO:123, SEQ ID NO:124, SEQ ID NO:125, SEQ ID NO:126, SEQ ID NO:127, SEQ I NO:128, SEQ ID NO:129, SEQ ID NO:130, SEQ ID NO:131, SEQ ID NO. 132, SEQ ID NO:133, SEQ ID NO:134, SEQ ID NO:136, SEQ ID NO:143, SEQ ID NO:144, SEQ ID NO:145, SEQ ID NO:146, SEQ ID NO:148, SEQ ID NO:149, SEQ ID NO:152, SEQ ID NO:153, SEQ ID NO:154, SEQ ID NO:155, SEQ ID NO:156, SEQ ID NO:157, SEQ ID NO:158, SEQ ID NO:159, SEQ ID NO:160, SEQ ID NO:161, SEQ NO:162, SEQ ID NO:163, SEQ ID NO:164, SEQ ID NO:167, SEQ ID NO:168, SEQ ID NO:169, SEQ ID NO:170, SEQ ID NO:171, SEQ ID NO:172, SEQ ID NO:173, SEQ ID NO:174, SEQ ID NO:175, SEQ ID NO:176, SEQ ID NO:177, SEQ ID NO:178, SEQ ID NO:179, SEQ ID NO:180, SEQ ID NO:181, SEQ ID NO:182, SEQ ID NO:183, SEQ ID NO:184, SEQ ID NO:185, SEQ ID NO:186, SEQ ID NO:187, SEQ ID NO:188, SEQ ID NO:189, SEQ ID NO:190, SEQ ID NO:191, SEQ ID NO:192, SEQ ID NO:193, SEQ ID NO:194, SEQ ID NO:195, SEQ ID NO:196, SEQ ID NO:197, SEQ ID NO:198, SEQ ID NO:199, SEQ ID NO:200, SEQ ID NO:201, SEQ ID NO:202, SEQ ID NO:203, SEQ ID NO:204, SEQ ID NO:205, SEQ ID NO:206, SEQ ID NO:207, SEQ ID NO:208, SEQ ID NO:209, SEQ ID NO:210, SEQ ID NO:211, SEQ ID NO:212, SEQ ID NO:213, SEQ ID NO:214, SEQ ID NO:215, SEQ ID NO:216, SEQ ID NO:217, SEQ ID NO:218, SEQ ID NO:219, SEQ ID NO:220, SEQ ID NO:221, SEQ ID NO:222, SEQ ID NO:223, SEQ ID NO:224, SEQ ID NO:225, SEQ ID NO:226, SEQ ID NO:227, SEQ ID NO:228, SEQ ID NO:229, SEQ ID NO:230, SEQ ID NO:231, SEQ ID NO:233, SEQ ID NO:235, SEQ ID NO:237, and SEQ ID NO:239.

    8. A method of in vitro detection of the deoxyribozyme according to claim 1 as a signaling component of a molecular device in biosensing, diagnostics, and/or molecular computing.

    9. The method of in vitro detection of a chemiluminescent substrate, containing a phosphate functional group, in a sample, containing the steps of: bringing the sample into contact with the deoxyribozyme according to claim 1; causing the generation of an optical signal by cleavage of the phosphate functional group from the substrate present in the sample by self-phosphorylation of the deoxyribozyme; and detecting the generated optical signal.

    10. The method of in vitro detection of the deoxyribozyme according to claim 1 in a sample, containing the steps of: bringing the sample into contact with a chemiluminescent substrate containing a phosphate functional group; causing the generation of an optical signal by cleavage of the phosphate functional group from the substrate by self-phosphorylation of the deoxyribozyme present in the sample; and detecting the generated optical signal.

    11. The method of in vitro detection of a ligand in a sample, containing the steps of: bringing the sample into contact with the deoxyribozyme according to claim 1 and with a chemiluminescent substrate containing a phosphate functional group and capable of generating an optical signal upon cleavage of the phosphate functional group; wherein the deoxyribozyme is in an inactive state and wherein R.sup.3 contains an aptamer for the ligand so that when the ligand binds to the aptamer, the deoxyribozyme is converted into an active state; causing the generation of an optical signal by cleavage of the phosphate functional group from the substrate present in the sample by self-phosphorylation of the deoxyribozyme in the active state; and detecting the generated optical signal.

    12. The method according to claim 11, wherein the ligand is selected from an oligonucleotide, a protein, a small molecule, a metal ion, a lipid.

    13. The method according to claim 9, wherein the chemiluminescent substrate is a compound selected from the group of phosphate-stabilized 1,2-dioxetanes, preferably selected from disodium 2-chloro-5-(4-methoxyspiro{1,2-dioxetane-3,2-(5-chloro)tricyclo[3.3.1.1.sup.3.7]decan}-4-yl)phenyl phosphate and disodium 3-(4-methoxyspiro {1,2-dioxetane-3,2-(5-chloro)tricyclo[3.3.1.13.7]decan}-4-yl) phenyl phosphate.

    Description

    FIGURES

    [0105] FIG. 1: Reaction scheme of deoxyribozyme-catalyzed light production using the CDP-Star? substrate.

    [0106] FIG. 2: Schematic diagram of the method used to develop deoxyribozymes that phosphorylate themselves in the presence of the chemiluminescent substrate as described in Example 1.

    [0107] FIG. 3: Light production of a deoxyribozyme in the presence of the chemiluminescent CDP-Star? substrate (see also Example 4).

    [0108] FIG. 4: Minimized catalytic core and preferred nucleotides at unpaired positions. (A) Deoxyribozyme before minimization (see also Example 2). (B) Deoxyribozyme after minimization (see also Example 7). Solid horizontal lines hydrogen bonds in base pairs in the Watson-Crick duplex of the triple helix; dashed horizontal lines=hydrogen bonds formed by the third strand of the triple helix. Note that only positions in the minimized catalytic core of the deoxyribozyme (shown in capital letters) are numbered. (C) Effects of mutations in unpaired positions. Only mutations with enrichment values?3.1?10.sup.?3 (frequency in the evolved pool divided by frequency in the starting pool) are shown. Percent activity is relative to SEQ ID NO:15 (shown in panel B and indicated by a dash in the graph). See also Example 9 and Table 2.

    [0109] FIG. 5: Secondary structure model and analysis of base triples. (A) Secondary structure model. (B) Triple-mutant cycle consistent with the 15-18-36 base triple. See also Example 8. (C) Activity of canonical, partially disrupted (partial), and fully disrupted (other) triples. Each triple was inserted into SEQ ID NO:15 (shown in panel A) at either 13-20-34, 14-19-35, 15-18-36 or 16-17-37; the average activity of these four mutants is indicated by each bar. See also Example 11 and Table 4.

    [0110] FIG. 6: (A) Secondary structure model showing positions (R.sup.1, R.sup.2, and R.sup.3) at which spacers with different lengths and sequences can be inserted. (B) Activity of deoxyribozymes containing randomized spacers of different lengths at R.sup.1, R.sup.2, or R.sup.3. N indicates a position containing 25% A, 25% C, 25% G, and 25% T. See also Example 13. (C) Activity of deoxyribozymes in which randomly chosen spacers of different lengths and sequences were inserted into R.sup.1, R.sup.2, and/or R.sup.3. Five different examples were tested for each architecture. Sec also Example 14.

    [0111] FIG. 7: Deoxyribozyme sensor that produces light in the presence of a specific oligonucleotide, Example 5. (A) Design of the sensor. Left: deoxyribozyme before engineering. Middle: engineered deoxyribozyme sensor in the OFF conformation. 1 and 1c represent complementary sequences. Right: engineered deoxyribozyme sensor in the ON conformation in which the ligand (in this case an oligonucleotide) is bound to 1c by base pairing. (B) Sensitivity of the sensor. Production of light as a function of DNA concentration for an oligonucleotide complementary to the deoxyribozyme sensor. (C) Specificity of the sensor. Light production of five deoxyribozyme sensors (Example 15) in the presence of either an oligonucleotide complementary to the sensor (i.e. sensor 1 with target 1) or oligonucleotides not complementary to the sensor (i.e. sensor 1 with targets 2, 3, 4, or 5). Black squares indicate pairs for which the rate enhancement (light produced in the presence of target divided by light produced in the absence of target) exceeds 5-fold.

    [0112] FIG. 8: Effect of reaction conditions on deoxyribozyme-catalyzed light production, Example 16.

    EXAMPLES

    Example 1: Procedure for Selecting Light-Producing Deoxyribozymes

    Initial Selection

    [0113] A single-stranded pool with the sequence GGAAGAGATGGCGACN.sub.70AGCTGATCCTGATGG (SEQ ID NO. 4) was ordered from IDT and purified by PAGE. 10.sup.16 different sequences from this pool were mixed with the blocking oligonucleotide BO1 (CCATCAGGATCAGCT, SEQ ID NO. 5) in water, heated at 65? C. for 2 minutes and cooled at RT for 5 minutes. They were then incubated for 24 hours (round 1-6) or 10 minutes (round 7-9) with the substrate CDP-Star (Roche) as follows: 1 ?M DNA pool, 1.5 ?M blocking oligonucleotide BO1, 1? selection buffer (50 mM HEPES pH 7.4, 200 mM KCl, 1 mM ZnCl.sub.2, 1 ?M Ce(SO.sub.4).sub.2, 0.1 ?M PbCl.sub.2), and 1 mM CDP-Star DNA was then precipitated in ethanol, and ligated to a short oligonucleotide with the sequence. GAATTCTAATACGACTCACTATA (SEQ ID NO. 6) using a splint-ligation method, T4 DNA ligase (Jena Bioscience), and a splint oligonucleotide with the sequence GTCGCCATCTCTTCCTATAGTGAGTCGTATTAG (SEQ ID NO. 7). All oligonucleotides were kept at a concentration of 2.5 ?M. Molecules were then separated by gel shift using 6% Urea-PAGE, and molecules of the size 120 nt (corresponding to ligated pool members) were excised from the gel, eluted, and precipitated with ethanol. These molecules were then amplified by PCR using Tag Polymerase (Jena Bioscience) and the FWD1 (GAATTCTAATACGACTCACTATA, SEQ ID NO. 6) and REV1 (CCATCAGGATCAGCT, SEQ ID NO. 5) primers. The FWD1 primer contained a single RNA linkage at its 3 end so the reaction site of the deoxyribozyme could be regenerated. After another ethanol precipitation, the sense strands of the double-stranded molecules were base hydrolyzed, and the two strands were separated using 6% Urea-PAGE to regenerate the single-stranded DNA pool.

    Re-selection

    [0114] A library was generated by randomly mutagenizing the most active deoxyribozyme isolated in the original selection: [0115] GGAAGAGATGGCGACGACACAGGGACGATGCCGAATATCCTCAGTGCGCAGGGCCGCAG GGGGGAGTGACTTGGGATGGGGGGTCAGCTGATCCTGATGG (SEQ ID NO. 8) at a rate of 21% per position. The sequence of this library was GGAAGAGATGGCGACGACACAGGGACGATGCCGAATATCCTCAGTGCCGAG GGCCGCAGGGGGGAGTGACTTGGGATGGGGGGTCCACTAATGATCTGCCCGATG (SEQ ID NO. 9) (mutagenized positions are indicated in bold). This library was ordered from IDT and purified by PAGE. 10.sup.14 different sequences from this pool were mixed with the blocking oligonucleotide BO2 (CATCGGGCAGATCATTAGTG, SEQ ID NO. 10) in water, heated at 65? C. for 2 minutes and cooled at RT for 5 minutes. The mixture was then incubated for 10 minutes (round 1-3) or 1 minute (round 4-7) with CDP-Star at the following final concentrations: 1 ?M DNA pool, 1.5 ?M blocking oligonucleotide (BO2), 1? selection buffer, and 1 mM CDP-Star. DNA was then ethanol precipitated, and ligated to a short oligonucleotide with the sequence ACCGCTCAGGTGTAGTATCA (SEQ ID NO. 11) using a splint-ligation method, T4 DNA ligase (Jena Bioscience GmbH), and a splint oligonucleotide with the sequence GTCGCCATCTCTTCCTGATACTACACCTGAGCGGT (SEQ ID NO. 12). All oligonucleotides were kept at a concentration of 2.5 ?M. Molecules were then separated by gel shift using 6% Urea-PAGE, and molecules of the size of 125 nt (corresponding to ligated pool members) were excised from the gel, eluted, and precipitated with ethanol. These molecules were then amplified by PCR using Q5 Hot Start Polymerase (NEB) and the FWD2 (ACCGCTCAGGTGTAGTATCA, SEQ ID NO. 13) and REV2 (CATCGGGCAGATCATTAGTG, SEQ ID NO. 10) primers. The FWD2 primer contained a single RNA linkage at its 3 end so the reaction site of the deoxyribozyme could be regenerated, and the REV2 primer contained a 5 phosphate group so the reverse strand could be selectively degraded. The reactions were then purified using the NucleoSpin Gel and PCR Clean-up kit (Macharey-Nagel), and the reverse strand was removed by digestion with ?-exonuclease (NEB). After a second purification with the NucleoSpin Gel and PCR Clean-up kit, the remaining sense strands were base hydrolyzed, and purified using 6% Urea-PAGE to regenerate single-stranded DNA pool.

    Example 2: Consensus Sequence Based on an Alignment of 135,000 Light-Producing Deoxyribozyme Variants Isolated by In Vitro Selection

    [0116] After 6 rounds of the reselection the evolved pool was characterized by high-throughput sequencing. The analysis was performed using the Illumina HiSeq System (2?150 bp, paired-end; NGSelect Amplicon product by Eurofins Genomics). Raw reads were processed with the cutadapt tool to remove adapter and primer sequences, perform quality trimming, and filter low quality reads. Paired-end reads were oriented, merged with the program fastq-join, and aligned using Clustal Omega. Data quality was evaluated using the FastQC tool. The secondary structure of the deoxyribozyme was predicted using comparative sequence analysis, which included frequency calculations of all di- and trinucleotide combinations and mutual information analysis (Gutell,R.R., Power,A., Hertz,G.Z., Putz,E.J. and Stormo,G.D. (1992). Nuc Acids Res, 20, 5785-57951) using in-house scripts. Analysis of conservation led to the identification of the consensus sequence 5 GGAAGA-(26 variable nucleotides)-GAATATCCCC-(18 variable nucleotides)-GGGGAGTGACTTGGGATGGGGG 3 (SEQ ID NO. 14). Detailed information about all tools used is listed in Table 1.

    TABLE-US-00004 TABLE 1 Tools used for data analysis Tool Version Source cutadapt 1.15 https://cutadapt.readthedocs.io/en/stable/ fastq-join 1.3.1 https://github.com/brwnj/fastq-join Clustal Omega 1.2.4 https://www.ebi.ac.uk/Tools/msa/clustalo/ FastQC 0.11.5 https://www.bioinformatics.babraham.ac.uk/ projects/fastqc/ ViennaRNA 2.4.12 https://www.tbi.univie.ac.at/RNA/

    Example 3: Measuring Deoxyribozyme Catalytic Activity using a Ligation Assay

    [0117] Oligonucleotides were ordered from Sigma-Aldrich and purified by PAGE or HPLC prior to use. Each deoxyribozyme was mixed with either water alone or water and the appropriate blocking oligonucleotide (indicated in Examples 5 and 6), heated at 65? C. for 2 minutes, and cooled at RT for 10 minutes. After that, 5? Selection Buffer and CDP-Star? were added. Final concentrations were 1 ?M deoxyribozyme, 1.5 ?M blocking oligonucleotide (when needed), 1? Selection Buffer (50 mM HEPES pH 7.4, 200 mM KCl, 1 mM ZnCl.sub.2, 1 M Ce(SO.sub.4).sub.2, 0.1 ?M PbCl.sub.2), and 1 mM CDP-Star?. Reactions were incubated for various times in the dark at RT and ethanol-precipitated. Deoxyribozymes were then ligated to a short oligonucleotide as described in Example 1. Reacted and unreacted molecules were then separated on 6% PAGE gels, and the amount of ligated product was determined using ImageQuant TL software (GE Healthcare LifeSciences).

    Example 4: Generation of a Chemiluminescent Signal using the Deoxyribozyme

    [0118] Sequences of the isolated deoxyribozymes were ordered from Sigma-Aldrich and purified by PAGE or HPLC prior to use. Deoxyribozymes were mixed with either water or water and the appropriate blocking oligonucleotide, heated at 65? C. for 2 minutes, and cooled at RT for 10 minutes. After that, 5? Selection Buffer was added, and samples were transferred to a white half-area 96 well plate (Corning). CDP-Star? was added, and chemiluminescence was measured for 1 to 24 hours using a Tecan Spark plate reader (Tecan Group). Final concentrations were 1 ?M deoxyribozyme, 1.5 ?M blocking oligonucleotide (when necessary), 1? Selection Buffer (50 mM HEPES pH 7.4, 200 mM KCl, 1 mM ZnCl.sub.2, 1 ?M Ce(SO.sub.4).sub.2, 0.1 ?M PbCl.sub.2), and 1 mM CDP-Star?.

    Example 5: Catalytic Activity of Deoxyribozymes from the Initial Selection

    [0119] Deoxyribozymes from the initial selection were tested as described in Example 4, except using 0.25 mM rather than 1 mM CDP-Star? substrate. The most active variant was

    TABLE-US-00005 (SEQIDNO.8) GGAAGAGATGGCGACGACACAGGGACGATGCCGAATATCC TCAGTGCGCAGGGCCGCAGGGGGGAGTGACTTGGGATGGG GGGTCAGCTGATCCTGATGG, [0120] and it generated light with a rate enhancement of 39.6-fold relative to the reaction in the absence of deoxyribozyme. The blocking oligonucleotide used was REV1 (CCATCAGGATCAGCT, SEQ ID NO. 5).

    Example 6: Catalytic Activity of Deoxyribozymes from the Reselection

    [0121] The ten most abundant deoxyribozymes in the reselection were tested as described in Example 4, except using 0.25 mM rather than 1 mM CDP-Star? substrate. The most abundant deoxyribozyme was

    TABLE-US-00006 (SEQIDNO.15) GGAAGATATGGCGCGAACAAATGGACAATGCCGAATATCC CCCGCACGCAGGGCAACAAGGGGGAGTGACTTGGGATGGG GGCTGCACTAATGATCTGCCCGATG [0122] and it generated light with a rate enhancement of 97.9-fold relative to the reaction in the absence of deoxyribozyme. The blocking oligo used was REV2 (CATCGGGCAGATCATTAGTG, SEQ ID NO. 10).

    [0123] The second most abundant deoxyribozyme was

    TABLE-US-00007 (SEQIDNO.16) GGAAGAAATGACGAGGCCACACGGACGAGGCTGAATATCC TCACTGCGGTGTGCCCCAGGGAGGAGTGACTTGGGATGGT GGGTTCACTAATGATCTGCCCGATG [0124] and it generated light with a rate enhancement of 130.4-fold relative to the reaction in the absence of deoxyribozyme. The blocking oligo used was REV2 (CATCGGGCAGATCATTAGTG, SEQ ID NO. 10).

    [0125] The third most abundant deoxyribozyme was

    TABLE-US-00008 (SEQIDNO.17) GGAAGATAGTGTGTCGATAAAGGGACAATGCTGAATTTCC TCCCTGAGCOGGCGCGTAGGGGGGAGTGACTTGGGATGGG GGGTGCACTAATGATCTGCCCGATG [0126] and it generated light with a rate enhancement of 187-fold relative to the reaction in the absence of deoxyribozyme. The blocking oligo used was REV2 (CATCGGGCAGATCATTAGTG, SEQ ID NO. 10).

    [0127] The fourth abundant deoxyribozyme was

    TABLE-US-00009 (SEQIDNO.18) GGAAGACTTGACGAGCGCACAGCGCTTGTTCAGAATATCA CCCGTCATGTGTTCGTGAAGGGGGAGTGACTTGGGATGGG GGTTCCACTAATGATCTGCCCGATG [0128] and it generated light with a rate enhancement of 129.2-fold relative to the reaction in the absence of deoxyribozyme. The blocking oligo used was REV2 (CATCGGGCAGATCATTAGTG, SEQ ID NO. 10).

    [0129] The fifth most abundant deoxyribozyme was

    TABLE-US-00010 (SEQIDNO.19) GGAAGAAATGGTGCGACACAGGGGCGCTCCAGAATATCCT CATTGCGATATGCCGCAGGGAGGAGTGACTTGGGATGGTG GGTCCACTAATGATCTGCCCGATG [0130] and it generated light with a rate enhancement of 169.3-fold relative to the reaction in the absence of deoxyribozyme. The blocking oligo used was REV2 (CATCGGGCAGATCATTAGTG, SEQ ID NO. 10).

    [0131] The sixth most abundant deoxyribozyme was

    TABLE-US-00011 (SEQIDNO.20) GGAAGAAATGTAGAGGAAACAGTGACTCTGCAGAATATCC TCACTGCGTAGTGGGGCAGGGGGGAGTGACTTGGGATGGG GGCTACACTAATGATCTGCCCGATG [0132] and it generated light with a rate enhancement of 186.5-fold relative to the reaction in the absence of deoxyribozyme. The blocking oligo used was REV2 (CATCGGGCAGATCATTAGTG, SEQ ID NO. 10).

    [0133] The seventh most abundant deoxyribozyme was

    TABLE-US-00012 (SEQIDNO.21) GGAAGAAACGCGACGACACAGTAATGATGCGGAATATCCC CCCTTCATAGGGCGAAAGGGGGGAGTGACTTGGGATGGGG GTTACACTAATGATCTGCCCGATG [0134] and it generated light with a rate enhancement of 116.7-fold relative to the reaction in the absence of deoxyribozyme. The blocking oligo used was REV2 (CATCGGGCAGATCATTAGTG, SEQ ID NO. 10).

    [0135] The eighth most abundant deoxyribozyme was

    TABLE-US-00013 (SEQIDNO.22) GGCAGAGATGGCAACGTCAACATGAGGATGCCGCATATCC CCAGTGCACACTTGGGCAGTGGGGAGTGACTTGGGATGGG GGAAACACTAATGATCTGCCCGATG [0136] and it generated light with a rate enhancement of 155.8-fold relative to the reaction in the absence of deoxyribozyme. The blocking oligo used was REV2 (CATCGGGCAGATCATTAGTG, SEQ ID NO. 10).

    [0137] The ninth most abundant deoxyribozyme was

    TABLE-US-00014 (SEQIDNO.23) GGAAGATATGGCGGTGACTCTTCGAAGCTGCCGAATATCC CCCGTGCGCGGAGCCTCAGGGGGGAGTGACTTGGGATGGG GGGTCCACTAATGATCTGCCCGATG [0138] and it generated light with a rate enhancement of 135.5-fold relative to the reaction in the absence of deoxyribozyme. The blocking oligo used was REV2 (CATCGGGCAGATCATTAGTG, SEQ ID NO. 10).

    [0139] The tenth most abundant deoxyribozyme was

    TABLE-US-00015 (SEQIDNO.24) GGAAGAAATGCCGACCTCCCAGGGTGGAGGCTGAATATCCACCATGGTC CGGAACGGATGGGGGAGTGACTTGGGATGGGGGAACCACTAATGATCTG CCCGATG [0140] and it generated light with a rate enhancement of 152.6-fold relative to the reaction in the absence of deoxyribozyme. The blocking oligo used was REV2 (CATCGGGCAGATCATTAGTG, SEQ ID NO. 10).

    Example 7: Identification of the Catalytic Core of the Deoxyribozyme

    [0141] To identify the catalytic core of the deoxyribozyme, variable regions in the sequence alignment of deoxyribozymes from the reselection (Example 1) were either deleted or replaced with AAAA linkers. The minimized deoxyribozyme also contained a T to C mutation at position 15 in helix 1 (numbering corresponds to that used in FIG. 4) which occurred frequently in deoxyribozymes from the reselection. This deoxyribozyme was tested as described in Examples 3 and 4, except using 0.25 mM rather than 1 mM CDP-Star? substrate.

    [0142] The sequence of the minimized catalytic core of the deoxyribozyme is

    TABLE-US-00016 (SEQIDNO.25) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG

    [0143] The amount of product in the ligation assay was 34.6% relative to a control oligonucleotide containing a 5 phosphate. It also generated 128-fold more light than the background reaction in the absence of deoxyribozyme in the light-production assay. The catalytic activities of the variants described in Examples 8-13 are expressed relative to the activity of this construct.

    Example 8: Confirming the Secondary Structure Model of the Deoxyribozyme

    [0144] To confirm the triple helix in the secondary structure model of the deoxyribozyme, a series of mutants were constructed in which a proposed base triple involving positions 15, 18, and 36 (numbering corresponds to that used in FIG. 4) was disrupted in various ways in single and double mutants, and restored in a triple mutant made up of mutations that by themselves disrupt the triple. Deoxyribozymes were tested as described in Example 4, except using 0.25 mM rather than 1 mM CDP-Star? substrate.

    [0145] The first mutant in the series

    TABLE-US-00017 (SEQIDNO.25) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0146] contains a canonical triple (15C 18G 36G), and it generated 100% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25, which is the same sequence).

    [0147] The second mutant in the series

    TABLE-US-00018 (SEQIDNO.26) GGAAGAAAAAGAATATCCTCAAAAGGGGAGTGACTTGGGATGGGGG [0148] contains a disrupted triple (15T 18G 36G), and it generated 33.6% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0149] The third mutant in the series

    TABLE-US-00019 (SEQIDNO.27) GGAAGAAAAAGAATATCCCCAAAAGAGGAGTGACTTGGGATGGGGG [0150] contains a disrupted triple (15C 18A 36G), and it generated 4.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0151] The fourth mutant in the series

    TABLE-US-00020 (SEQIDNO.28) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGTGG [0152] contains a disrupted triple (15C 18G 36T), and it generated 28.3% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0153] The fifth mutant in the series

    TABLE-US-00021 (SEQIDNO.29) GGAAGAAAAAGAATATCCTCAAAAGAGGAGTGACTTGGGATGGGGG [0154] contains a disrupted triple (15T 18A 36G), and it generated 11.8% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0155] The sixth mutant in the series

    TABLE-US-00022 SEQIDNO:20= (SEQIDNO.30) GGAAGAAAAAGAATATCCTCAAAAGGGGAGTGACTTGGGATGGTGG [0156] contains a disrupted triple (15T 18G 36T), and it generated 7.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0157] The seventh mutant in the series

    TABLE-US-00023 (SEQIDNO.31) GGAAGAAAAAGAATATCCCCAAAAGAGGAGTGACTTGGGATGGTGG [0158] contains a disrupted triple (15C 18A 36T), and it generated 7.7% as much light as the most common minimized catalytic core in the reselection (SEC) ID NO. 25).

    [0159] The eighth mutant in the series

    TABLE-US-00024 (SEQIDNO.32) GGAAGAAAAAGAATATCCTCAAAAGAGGAGTGACTTGGGATGGTGG [0160] contains a canonical triple (15T 18A 36T), and it generated 72.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO 25).

    Example 9: Catalytic Activity of Minimized Catalytic Cores Containing Point Mutations in Unpaired Regions which Occurred Frequently in Deoxyribozymes from the Reselection

    [0161] Minimized catalytic cores containing point mutations in unpaired regions (positions 1-11, 22-33, and 38; numbering as in FIG. 4) which occurred frequently in deoxyribozymes from the reselection were tested as described in Example 4, except using 0.25 mM rather than 1 mM CDP-Star? substrate. These catalytic cores correspond to sequences in which R.sup.1 was replaced by AAAA, R.sup.2 was replaced by AAAA, and R.sup.3 was deleted. The results are summarized in the text as well as in Table 2 below.

    TABLE-US-00025 TABLE 2 Preferred nucleotides at unpaired positions in the deoxyribozyme. Enrichment is the frequency of the mutation in the evolved library divided by its frequency in the starting library. Only mutations with enrichment values ?3.1 ? 10.sup.?3 are shown. Percent activity is the amount of light produced by a variant of SEQ ID NO. 25 containing the indicated mutation relative to SEQ ID NO. 25 (which is normalized to a value of 100%). Position Nucleotide Enrichment % activity 1 G 1.2 100 T 4.7 ? 10.sup.?3 9.9 2 G 1.2 100 T 3.1 ? 10.sup.?3 11 3 A 1.2 100 C 1.1 106.2 4 A 1.3 100 5 G 1.3 100 T 3.6 ? 10.sup.?3 14 6 A 1.3 100 T .sup.3 ? 10.sup.?1 77 7 G 1.7 100 T 2.7 ? 10.sup.?2 13.1 A 3.3 ? 10.sup.?3 18.5 8 A 1.3 100 C 1 5.3 G 1.4 ? 10.sup.?1 13.2 T 1.1 ? 10.sup.?1 25 9 A 1.5 100 T 1.4 ? 10.sup.?1 21.4 G 1.8 ? 10.sup.?2 21.9 10 T 1.4 100 A 1.4 ? 10.sup.?1 54.7 C 5.6 ? 10.sup.?2 81.5 G 1.7 ? 10.sup.?2 32.7 11 A 1.4 100 T .sup.5 ? 10.sup.?1 42.8 G 1.6 ? 10.sup.?1 34.3 22 G 1.7 100 A 8.5 ? 10.sup.?3 43 23 T 1.5 100 24 G 1.7 100 25 A 1.5 100 26 C 1.5 100 27 T 1.5 100 C 1.3 ? 10.sup.?2 76 G 4.7 ? 10.sup.?3 14.1 28 T 1.5 100 29 G 1.7 100 30 G 1.7 100 31 G 1.8 100 32 A 1.5 100 33 T 1.5 100 G 6.3 ? 10.sup.?3 20.5 C 5.9 ? 10.sup.?3 29.7 38 G 1.6 100 T 3.3 ? 10.sup.?1 156.4 A 1.4 ? 10.sup.?1 94.1 C 5.3 ? 10.sup.?2 148.2

    [0162] The first construct in this series contains the 1T mutation. It has the sequence

    TABLE-US-00026 (SEQIDNO.33) TGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0163] and it generated 9.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0164] The second construct in this series contains the 2T mutation. It has the sequence

    TABLE-US-00027 (SEQIDNO.34) GTAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0165] and it generated 11% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0166] The third construct in this series contains the 3C mutation. It has the sequence

    TABLE-US-00028 (SEQIDNO.35) GGCAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0167] and it generated 106.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0168] The fourth construct in this series contains the 5T mutation. It has the sequence

    TABLE-US-00029 (SEQIDNO.36) GGAATAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0169] and it generated 14% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0170] The fifth construct in this series contains the 6T mutation. It has the sequence

    TABLE-US-00030 (SEQIDNO.37) GGAAGTAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0171] and it generated 77% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0172] The sixth construct in this series contains the 7T mutation. It has the sequence

    TABLE-US-00031 (SEQIDNO.38) GGAAGAAAAATAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0173] and it generated 13.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0174] The seventh construct in this series contains the 7A mutation. It has the sequence

    TABLE-US-00032 (SEQIDNO.39) GGAAGAAAAAAAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0175] and it generated 18.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0176] The eighth construct in this series contains the 8C mutation. It has the sequence

    TABLE-US-00033 (SEQIDNO.40) GGAAGAAAAAGCATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0177] and it generated 5.3% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0178] The ninth construct in this series contains the 8G mutation. It has the sequence

    TABLE-US-00034 (SEQIDNO.41) GGAAGAAAAAGGATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0179] and it generated 13.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0180] The tenth construct in this series contains the 8T mutation. It has the sequence

    TABLE-US-00035 (SEQIDNO.42) GGAAGAAAAAGTATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0181] and it generated 25% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0182] The eleventh construct in this series contains the 9T mutation. It has the sequence

    TABLE-US-00036 (SEQIDNO.43) GGAAGAAAAAGATTATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0183] and it generated 21.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0184] The twelfth construct in this series contains the 9G mutation. It has the sequence

    TABLE-US-00037 (SEQIDNO.44) GGAAGAAAAAGAGTATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0185] and it generated 21.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0186] The thirteenth construct in this series contains the 10A mutation. It has the sequence

    TABLE-US-00038 (SEQIDNO.45) GGAAGAAAAAGAAAATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0187] and it generated 54.7% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0188] The fourteenth construct in this series contains the 10C mutation. It has the sequence

    TABLE-US-00039 (SEQIDNO.46) GGAAGAAAAAGAACATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0189] and it generated 81.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0190] The fifteenth construct in this series contains the 10G mutation. It has the sequence

    TABLE-US-00040 (SEQIDNO.47) GGAAGAAAAAGAAGATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0191] and it generated 32.7% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0192] The sixteenth construct in this series contains the 11T mutation. It has the sequence

    TABLE-US-00041 (SEQIDNO.48) GGAAGAAAAAGAATTTCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0193] and it generated 42.8% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0194] The seventeenth construct in this series contains the 11G mutation. It has the sequence

    TABLE-US-00042 (SEQIDNO.49) GGAAGAAAAAGAATGTCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0195] and it generated 34.3% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0196] The eighteenth construct in this series contains the 22A mutation. It has the sequence

    TABLE-US-00043 (SEQIDNO.50) GGAAGAAAAAGAATATCCCCAAAAGGGGAATGACTTGGGATGGGGG [0197] and it generated 43% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0198] The nineteenth construct in this series contains the 27C mutation. It has the sequence

    TABLE-US-00044 (SEQIDNO.51) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACCTGGGATGGGGG [0199] and it generated 76% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0200] The twentieth construct in this series contains the 27G mutation. It has the sequence

    TABLE-US-00045 (SEQIDNO.52) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACGTGGGATGGGGG [0201] and it generated 14.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0202] The twenty first construct in this series contains the 33G mutation. It has the sequence

    TABLE-US-00046 (SEQIDNO.53) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGAGGGGGG [0203] and it generated 20.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0204] The twenty second construct in this series contains the 33C mutation. It has the sequence

    TABLE-US-00047 (SEQIDNO.54) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGACGGGGG [0205] and it generated 29.7% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0206] The twenty third construct in this series contains the 38T mutation. It has the sequence

    TABLE-US-00048 (SEQIDNO.55) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGT [0207] and it generated 156.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0208] The twenty fourth construct in this series contains the 38A mutation. It has the sequence

    TABLE-US-00049 (SEQIDNO.56) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGA [0209] and it generated 94.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0210] The twenty fifth construct in this series contains the 38C mutation. It has the sequence

    TABLE-US-00050 (SEQIDNO.57) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGC [0211] and it generated 148.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    Example 10: Catalytic Activity of Minimized Catalytic Cores Containing Different Combinations of Canonical Base Pairs and Base Triples

    [0212] Minimized catalytic cores containing different combinations of canonical base pairs (at the 12-21 base pair) and base triples (at the 13-20-34, 14-19-35, 15-18-36, and 16-17-37 base triples; numbering as in FIG. 4) were tested as described in Example 4, except using 0.25 mM rather than 1 mM CDP-Star? substrate. These catalytic cores correspond to sequences in which R.sup.1 was replaced by AAAA, R.sup.2 was replaced by AAAA, and R.sup.3 was deleted. The results are summarized in the text as well as in Table 3 below.

    TABLE-US-00051 TABLE 3 Activity of deoxyribozymes containing helices with different sequences and lengths. Percent activity is the amount of light produced by a variant of SEQ ID: 15 containing the indicated mutations relative to SEQ ID: 15 (which is normalized to a value of 100%). Positions Pair or triple % activity 12-21 T-A 100 A-T 96 C-G 12.2 G-C 51.6 13-20-34 All C-G:G 100 14-19-35 15-18-36 16-17-37 13-20-34 T-A:A 15.1 T-A:T 11 14-19-35 T-A:A 119.1 T-A:T 45.4 15-18-36 T-A:A 61 T-A:T 72.9 16-17-37 T-A:A 98.6 T-A:T 141.7 14-19-35 All T-A:A 27.4 15-18-36 16-17-37 14-19-35 All T-A:T 34.9 15-18-36 16-17-37 13-20-34 All T-A:A 14.1 14-19-35 15-18-36 16-17-37 13-20-34 All T-A:T 12.5 14-19-35 15-18-36 16-17-37 16-17-37 Deleted 24.3 15-18-36 Deleted 3.3 16-17-37 14-19-35 Deleted 3.1 15-18-36 16-17-37

    [0213] The first construct in this series contains T at position 12 and A at position 21. It has the sequence

    TABLE-US-00052 (SEQIDNO.25) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0214] and it generated 100% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25, which is the same sequence).

    [0215] The second construct in this series contains A at position 12 and T at position 21. It has the sequence

    TABLE-US-00053 (SEQIDNO.58) GGAAGAAAAAGAATAACCCCAAAAGGGGTGTGACTTGGGATGGGGG [0216] and it generated 96% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0217] The third construct in this series contains C at position 12 and G at position 21. It has the sequence

    TABLE-US-00054 (SEQIDNO.59) GGAAGAAAAAGAATACCCCCAAAAGGGGGGTGACTTGGGATGGGGG [0218] and it generated 12.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0219] The fourth construct in this series contains G at position 12 and C at position 21. It has the sequence

    TABLE-US-00055 (SEQIDNO.60) GGAAGAAAAAGAATAGCCCCAAAAGGGGCGTGACTTGGGATGGGGG [0220] and it generated 51.6% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0221] The fifth construct in this series contains C-C:G base triples at positions 13-20-34, 14-19-35, 15-18-36, and 16-17-37. It has the sequence

    TABLE-US-00056 (SEQIDNO.25) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0222] and it generated 100% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25, which is the same sequence).

    [0223] The sixth construct in this series contains a T-A:A base triple at position 13-20-34 and C-G:G triples at the other positions in the triple helix. It has the sequence

    TABLE-US-00057 (SEQIDNO.61) GGAAGAAAAAGAATATTCCCAAAAGGGAAGTGACTTGGGATAGGGG [0224] and it generated 15.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0225] The seventh construct in this series contains a T-A:T base triple at position 13-20-34 and C-G:G triples at the other positions in the triple helix. It has the sequence

    TABLE-US-00058 (SEQIDNO.62) GGAAGAAAAAGAATATTCCCAAAAGGGAAGTGACTTGGGATTGGGG [0226] and it generated 11% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0227] The eighth construct in this series contains a T-A:A base triple at position 14-19-35 and C-G:G triples at the other positions in the triple helix. It has the sequence

    TABLE-US-00059 (SEQIDNO.63) GGAAGAAAAAGAATATCTCCAAAAGGAGAGTGACTTGGGATGAGGG [0228] and it generated 119.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0229] The ninth construct in this series contains a T-A:T base triple at position 14-19-35 and C-G:G triples at the other positions in the triple helix. It has the sequence

    TABLE-US-00060 (SEQIDNO.64) GGAAGAAAAAGAATATCTCCAAAAGGAGAGTGACTTGGGATGTGGG [0230] and it generated 45.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0231] The tenth construct in this series contains a T-A:A base triple at position 15-18-36 and C-G:G triples at the other positions in the triple helix. It has the sequence

    TABLE-US-00061 (SEQIDNO.65) GGAAGAAAAAGAATATCCTCAAAAGAGGAGTGACTTGGGATGGAGG [0232] and it generated 61% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0233] The eleventh construct in this series contains a T-A:T base triple at position 15-18-36 and C-G:G triples at the other positions in the triple helix. It has the sequence

    TABLE-US-00062 (SEQIDNO.66) GGAAGAAAAAGAATATCCTCAAAAGAGGAGTGACTTGGGATGGTGG [0234] and it generated 72.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0235] The twelfth construct in this series contains a T-A:A base triple at position 16-17-37 and C-G:G triples at the other positions in the triple helix. It has the sequence

    TABLE-US-00063 (SEQIDNO.67) GGAAGAAAAAGAATATCCCTAAAAAGGGAGTGACTTGGGATGGGAG [0236] and it generated 98.6% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0237] The thirteenth construct in this series contains a T-A:T base triple at position 16-17-37 and C-G:G triples at the other positions in the triple helix. It has the sequence

    TABLE-US-00064 (SEQIDNO.68) GGAAGAAAAAGAATATCCCTAAAAAGGGAGTGACTTGGGATGGGTG [0238] and it generated 141.7% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0239] The fourteenth construct in this series contains a C-G:G base triple at position 13-20-34 and T-A:A base triples at position 14-19-35, 15-18-36, and 16-17-37. It has the sequence

    TABLE-US-00065 (SEQIDNO.69) GGAAGAAAAAGAATATCTTTAAAAAAAGAGTGACTTGGGATGAAAG [0240] and it generated 27.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0241] The fifteenth construct in this series contains a C-G:G base triple at position 13-20-34 and T-A:T base triples at position 14-19-35, 15-18-36, and 16-17-37. It has the sequence

    TABLE-US-00066 (SEQIDNO.70) GGAAGAAAAAGAATATCTTTAAAAAAAGAGTGACTTGGGATGTTTG [0242] and it generated 34.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0243] The sixteenth construct in this series contains T-A:A base triples at all positions in the triple helix. It has the sequence

    TABLE-US-00067 (SEQIDNO.71) GGAAGAAAAAGAATATTTTTAAAAAAAAAGTGACTTGGGATAAAAG [0244] and it generated 14.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0245] The seventeenth construct in this series contains T-A:T base triples at all positions in the triple helix. It has the sequence

    TABLE-US-00068 (SEQIDNO.72) GGAAGAAAAAGAATATTTTTAAAAAAAAAGTGACTTGGGATTTTTG [0246] and it generated 12.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0247] The eighteenth construct in this series contains a deleted triple at position 16-17-37 and C-G:G triples at the other positions in the triple helix. It has the sequence

    TABLE-US-00069 (SEQIDNO.73) GGAAGAAAAAGAATATCCCAAAAGGGAGTGACTTGGGATGGGG [0248] and it generated 24.3% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0249] The nineteenth construct in this series contains deleted triples at positions 16-17-37 and 15-18-36, and C-G:G triples at the other positions in the triple helix. It has the sequence

    TABLE-US-00070 (SEQIDNO.74) GGAAGAAAAAGAATATCCAAAAGGAGTGACTTGGGATGGG [0250] and it generated 3.3% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0251] The twentieth construct in this series contains deleted triples at positions 16-17-37, 15-18-36, and 14-19-35, and a C:G:G triple at position 13-20-34 in the triple helix. it has the sequence

    TABLE-US-00071 (SEQIDNO.75) GGAAGAAAAAGAATATCAAAAGAGTGACTTGGGATGG [0252] and it generated 3.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    Example 11: Catalytic Activity of Minimized Catalytic Cores Containing Partially or Completely Disrupted Base Triples

    [0253] Minimized catalytic cores containing different partially or completely disrupted triples at the 13-20-34, 14-19-35, 15-18-36, and 16-17-37 base triples (numbering as in FIG. 4) were tested as described in Example 4, except using 0.25 mM rather than 1 mM CDP-Star? substrate. These catalytic cores correspond to sequences in which R.sup.1 was replaced by AAAA, R.sup.2 was replaced by AAAA, and R.sup.3 was deleted. The results are summarized in the text as well as in Table 4 below.

    TABLE-US-00072 TABLE 4 Activity of deoxyribozymes containing disrupted base triples. Percent activity is the amount of light produced by a variant of SEQ ID NO. 25 containing the indicated mutations relative to SEQ ID NO. 25 (which is normalized to a value of 100%). Asterisks indicate base triples with enrichment values (frequency in evolved library divided by frequency in starting library) ?10.sup.?3. Sequence Type of % activity of triple triple 13-20-34 14-19-35 15-18-36 16-17-37 C-G:G Canonical 100* 100* 100* 100* T-A:T 11* 45.4 72.9* 141.7* T-A:A 15.1 119.1* 61* 98.6* A G:G Partial 64* 36* 22.4* 92.3 G G:G Hoogsteen 25 12.2 36 32.1 T G:G 48.6 32 33.6* 73.1* A A:A 19.5 26.8 25.9 59.3 C A:A 14.9 16.5 13.6 41.2 G A:A 17.7 50.6 7.9* 26.9 A A:T 28.2 19.5 33.1 104.3 C A:T 2.8 2.9 7.7* 107.4 G A:T 15 24.4 29 82.7 C-G A Partial 6.8 44.1* 18.4 50.9 C-G T Watson- 6.4 54.2 28.3 71 T-A G Crick 3.8 3.5 11.8 29.6 A-T A Other 89.1 G-C A 38.7 T G T 3.6 3.7 7.1 35.2 G T A 22.7 G G C 6.9 6.8 9.4* 13.5 C C G 6.8 6.5 5.8 7.2 C A G 3.1 2.9 4.9 11.3

    [0254] The first construct in the series contains an A G:G triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00073 (SEQIDNO.76) GGAAGAAAAAGAATATACCCAAAAGGGGAGTGACTTGGGATGGGGG [0255] and it generated 64% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0256] The next construct in the series contains a G G:G triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00074 (SEQIDNO.77) GGAAGAAAAAGAATATGCCCAAAAGGGGAGTGACTTGGGATGGGGG [0257] and it generated 25% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0258] The next construct in the series contains a T G:G triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00075 (SEQIDNO.78) GGAAGAAAAAGAATATTCCCAAAAGGGGAGTGACTTGGGATGGGGG [0259] and it generated 48.6% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0260] The next construct in the series contains a A A:A triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00076 (SEQIDNO.79) GGAAGAAAAAGAATATACCCAAAAGGGAAGTGACTTGGGATAGGGG [0261] and it generated 19.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0262] The next construct in the series contains a C A:A triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00077 (SEQIDNO.80) GGAAGAAAAAGAATATCCCCAAAAGGGAAGTGACTTGGGATAGGGG [0263] and it generated 14.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0264] The next construct in the series contains a G A:A triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00078 (SEQIDNO.81) GGAAGAAAAAGAATATGCCCAAAAGGGAAGTGACTTGGGATAGGGG [0265] and it generated 17.7% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0266] The next construct in the series contains a A A:T triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00079 (SEQIDNO.82) GGAAGAAAAAGAATATACCCAAAAGGGAAGTGACTTGGGATTGGGG [0267] and it generated 28.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0268] The next construct in the series contains a C A:T triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00080 (SEQIDNO.83) GGAAGAAAAAGAATATCCCCAAAAGGGAAGTGACTTGGGATTGGGG [0269] and it generated 2.8% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0270] The next construct in the series contains a G A:T triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00081 (SEQIDNO.84) GGAAGAAAAAGAATATGCCCAAAAGGGAAGTGACTTGGGATTGGGG [0271] and it generated 15% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0272] The next construct in the series contains a C-G A triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00082 (SEQIDNO.85) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATAGGGG [0273] and it generated 6.8% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0274] The next construct in the series contains a C-G T triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00083 (SEQIDNO.86) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATTGGGG [0275] and it generated 6.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0276] The next construct in the series contains a T-A G triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00084 (SEQIDNO.87) GGAAGAAAAAGAATATTCCCAAAAGGGAAGTGACTTGGGATGGGGG [0277] and it generated 3.8% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0278] The next construct in the series contains a T G T triple at position 13-20-34 in the triple. helix. It has the sequence

    TABLE-US-00085 (SEQIDNO.88) GGAAGAAAAAGAATATTCCCAAAAGGGGAGTGACTTGGGATTGGGG [0279] and it generated 3.6% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0280] The next construct in the series contains a G G C triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00086 (SEQIDNO.89) GGAAGAAAAAGAATATGCCCAAAAGGGGAGTGACTTGGGATCGGGG [0281] and it generated 6.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0282] The next construct in the series contains a C C G triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00087 (SEQIDNO.90) GGAAGAAAAAGAATATCCCCAAAAGGGCAGTGACTTGGGATGGGGG [0283] and it generated 6.8% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0284] The next construct in the series contains a C A G triple at position 13-20-34 in the triple helix. It has the sequence

    TABLE-US-00088 (SEQIDNO.91) GGAAGAAAAAGAATATCCCCAAAAGGGAAGTGACTTGGGATGGGGG [0285] and it generated 3.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0286] The next construct in the series contains a A G:G triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00089 (SEQIDNO.92) GGAAGAAAAAGAATATCACCAAAAGGGGAGTGACTTGGGATGGGGG [0287] and it generated 36% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0288] The next construct in the series contains a G G:G triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00090 (SEQIDNO.93) GGAAGAAAAAGAATATCGCCAAAAGGGGAGTGACTTGGGATGGGGG [0289] and it generated 12.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0290] The next construct in the series contains a T G:G triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00091 (SEQIDNO.94) GGAAGAAAAAGAATATCTCCAAAAGGGGAGTGACTTGGGATGGGGG [0291] and it generated 49% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0292] The next construct in the series contains a A A:A triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00092 (SEQIDNO.95) GGAAGAAAAAGAATATCACCAAAAGGAGAGTGACTTGGGATGAGGG [0293] and it generated 26.8% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0294] The next construct in the series contains a C A:A triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00093 (SEQIDNO.96) GGAAGAAAAAGAATATCCCCAAAAGGAGAGTGACTTGGGATGAGGG [0295] and it generated 16.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0296] The next construct in the series contains a G A:A triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00094 (SEQIDNO.97) GGAAGAAAAAGAATATCGCCAAAAGGAGAGTGACTTGGGATGAGGG [0297] and it generated 50.6% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0298] The next construct in the series contains a A A:T triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00095 (SEQIDNO.98) GGAAGAAAAAGAATATCACCAAAAGGAGAGTGACTTGGGATGTGGG [0299] and it generated 19.5% as much light as the most common minimized catalytic core in the reselection (SEQ NO. 25).

    [0300] The next construct in the series contains a C A:T triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00096 (SEQIDNO.99) GGAAGAAAAAGAATATCCCCAAAAGGAGAGTGACTTGGGATGTGGG [0301] and it generated 2.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0302] The next construct in the series contains a G A:T triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00097 (SEQIDNO.100) GGAAGAAAAAGAATATCGCCAAAAGGAGAGTGACTTGGGATGTGGG [0303] and it generated 24.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0304] The next construct in the series contains a C-G A triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00098 (SEQIDNO.101) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGAGGG [0305] and it generated 52.3% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0306] The next construct in the series contains a C-G T triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00099 (SEQIDNO.102) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGTGGG [0307] and it generated 54.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0308] The next construct in the series contains a T-A G triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00100 (SEQIDNO.103) GGAAGAAAAAGAATATCTCCAAAAGGAGAGTGACTTGGGATGGGGG [0309] and it generated 3.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0310] The next construct in the series contains a T G T triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00101 (SEQIDNO.104) GGAAGAAAAAGAATATCTCCAAAAGGGGAGTGACTTGGGATGTGGG [0311] and it generated 3.7% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0312] The next construct in the series contains a G G C triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00102 (SEQIDNO.105) GGAAGAAAAAGAATATCGCCAAAAGGGGAGTGACTTGGGATGCGGG [0313] and it generated 6.8% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0314] The next construct in the series contains a C C G triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00103 (SEQIDNO.106) GGAAGAAAAAGAATATCCCCAAAAGGCGAGTGACTTGGGATGGGGG [0315] and it generated 6.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0316] The next construct in the series contains a C A G triple at position 14-19-35 in the triple helix. It has the sequence

    TABLE-US-00104 (SEQIDNO.107) GGAAGAAAAAGAATATCCCCAAAAGGAGAGTGACTTGGGATGGGGG [0317] and it generated 2.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0318] The next construct in the series contains a A G:G triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00105 (SEQIDNO.108) GGAAGAAAAAGAATATCCACAAAAGGGGAGTGACTTGGGATGGGGG [0319] and it generated 22.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0320] The next construct in the series contains a G G:G triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00106 (SEQIDNO.109) GGAAGAAAAAGAATATCCGCAAAAGGGGAGTGACTTGGGATGGGGG [0321] and it generated 36% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0322] The next construct in the series contains a T G:G triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00107 (SEQIDNO.26) GGAAGAAAAAGAATATCCTCAAAAGGGGAGTGACTTGGGATGGGGG [0323] and it generated 33.6% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0324] The next construct in the series contains a A A:A triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00108 (SEQIDNO.110) GGAAGAAAAAGAATATCCACAAAAGAGGAGTGACTTGGGATGGAGG [0325] and it generated 25.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0326] The next construct in the series contains a C A:A triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00109 (SEQIDNO.111) GGAAGAAAAAGAATATCCCCAAAAGAGGAGTGACTTGGGATGGAGG [0327] and it generated 13.6% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0328] The next construct in the series contains a G A:A triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00110 (SEQIDNO.112) GGAAGAAAAAGAATATCCGCAAAAGAGGAGTGACTTGGGATGGAGG [0329] and it generated 7.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0330] The next construct in the series contains a A A:T triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00111 (SEQIDNO.113) GGAAGAAAAAGAATATCCACAAAAGAGGAGTGACTTGGGATGGTGG [0331] and it generated 33.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0332] The next construct in the series contains a C A:T triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00112 (SEQIDNO.31) GGAAGAAAAAGAATATCCCCAAAAGAGGAGTGACTTGGGATGGTGG [0333] and it generated 7.7% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0334] The next construct in the series contains a G A:T triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00113 (SEQIDNO.114) GGAAGAAAAAGAATATCCGCAAAAGAGGAGTGACTTGGGATGGTGG [0335] and it generated 29% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0336] The next construct in the series contains a C-G A triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00114 (SEQIDNO.115) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGAGG [0337] and it generated 18.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0338] The next construct in the series contains a C-G T triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00115 (SEQIDNO.28) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGTGG [0339] and it generated 28.3% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0340] The next construct in the series contains a T-A G triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00116 (SEQIDNO.29) GGAAGAAAAAGAATATCCTCAAAAGAGGAGTGACTTGGGATGGGGG [0341] and it generated 11.8% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0342] The next construct in the series contains a T G T triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00117 (SEQIDNO.30) GGAAGAAAAAGAATATCCTCAAAAGGGGAGTGACTTGGGATGGTGG [0343] and it generated 7.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0344] The next construct in the series contains a G G C triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00118 (SEQIDNO.116) GGAAGAAAAAGAATATCCGCAAAAGGGGAGTGACTTGGGATGGCGG [0345] and it generated 9.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0346] The next construct in the series contains a C C G triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00119 (SEQIDNO.117) GGAAGAAAAAGAATATCCCCAAAAGCGGAGTGACTTGGGATGGGGG [0347] and it generated 58% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0348] The next construct in the series contains a C A G triple at position 15-18-36 in the triple helix. It has the sequence

    TABLE-US-00120 (SEQIDNO.27) GGAAGAAAAAGAATATCCCCAAAAGAGGAGTGACTTGGGATGGGGG [0349] and it generated 4.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0350] The next construct in the series contains a A G:G triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00121 (SEQIDNO.118) GGAAGAAAAAGAATATCCCAAAAAGGGGAGTGACTTGGGATGGGGG [0351] and it generated 92.3% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0352] The next construct in the series contains a G G:G triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00122 (SEQIDNO.119) GGAAGAAAAAGAATATCCCGAAAAGGGGAGTGACTTGGGATGGGGG [0353] and it generated 32.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0354] The next construct in the series contains a T G:G triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00123 (SEQIDNO.120) GGAAGAAAAAGAATATCCCTAAAAGGGGAGTGACTTGGGATGGGGG [0355] and it generated 73.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0356] The next construct in the series contains a A A:A triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00124 (SEQIDNO.121) GGAAGAAAAAGAATATCCCAAAAAAGGGAGTGACTTGGGATGGGAG [0357] and it generated 59.3% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0358] The next construct in the series contains a C A:A triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00125 (SEQIDNO.122) GGAAGAAAAAGAATATCCCCAAAAAGGGAGTGACTTGGGATGGGAG [0359] and it generated 41.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0360] The next construct in the series contains a G A:A triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00126 (SEQIDNO.123) GGAAGAAAAAGAATATCCCGAAAAAGGGAGTGACTTGGGATGGGAG [0361] and it generated 26.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0362] The next construct in the series contains a A A:T triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00127 (SEQIDNO.124) GGAAGAAAAAGAATATCCCAAAAAAGGGAGTGACTTGGGATGGGTG [0363] and it generated 104.3% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0364] The next construct in the series contains a C A:T triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00128 (SEQIDNO.125) GGAAGAAAAAGAATATCCCCAAAAAGGGAGTGACTTGGGATGGGTG [0365] and it generated 107.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0366] The next construct in the series contains a G A:T triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00129 (SEQIDNO.126) GGAAGAAAAAGAATATCCCGAAAAAGGGAGTGACTTGGGATGGGTG [0367] and it generated 82.7% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0368] The next construct in the series contains a C-G A triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00130 (SEQIDNO.127) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGAG [0369] and it generated 50.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0370] The next construct in the series contains a C-G T triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00131 (SEQIDNO.128) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGTG [0371] and it generated 71% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0372] The next construct in the series contains a T-A G triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00132 (SEQIDNO.129) GGAAGAAAAAGAATATCCCTAAAAAGGGAGTGACTTGGGATGGGGG [0373] and it generated 29.6% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0374] The next construct in the series contains a A-T A triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00133 (SEQIDNO.130) GGAAGAAAAAGAATATCCCAAAAATGGGAGTGACTTGGGATGGGAG [0375] and it generated 89.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0376] The next construct in the series contains a G-C A triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00134 (SEQIDNO.131) GGAAGAAAAAGAATATCCCGAAAACGGGAGTGACTTGGGATGGGAG [0377] and it generated 38.7% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0378] The next construct in the series contains a T G T triple at position 16-17-37 in the triple helix. It has

    TABLE-US-00135 (SEQIDNO.132) GGAAGAAAAAGAATATCCCTAAAAGGGGAGTGACTTGGGATGGGTG [0379] and it generated 35.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0380] The next construct in the series contains a G T A triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00136 (SEQIDNO.133) GGAAGAAAAAGAATATCCCGAAAATGGGAGTGACTTGGGATGGGAG [0381] and it generated 22.7% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0382] The next construct in the series contains a G G C triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00137 (SEQIDNO.134) GGAAGAAAAAGAATATCCCGAAAAGGGGAGTGACTTGGGATGGGCG [0383] and it generated 13.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0384] The next construct in the series contains a C C G triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00138 (SEQIDNO.135) GGAAGAAAAAGAATATCCCCAAAACGGGAGTGACTTGGGATGGGGG [0385] and it generated 7.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0386] The next construct in the series contains a C A G triple at position 16-17-37 in the triple helix. It has the sequence

    TABLE-US-00139 (SEQIDNO.136) GGAAGAAAAAGAATATCCCCAAAAAGGGAGTGACTTGGGATGGGGG [0387] and it generated 11.3% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    Example 12: Catalytic Activity of Minimized Catalytic Cores of Deoxyribozymes from the Reselection

    [0388] The 50 most abundant minimized catalytic cores of deoxyribozymes in the reselection (cores 1-50) were tested as described in Example 4, except using 0.25 mM rather than 1 mM CDP-Star? substrate. These correspond to sequences in which R.sup.1 was replaced by AAAA, R.sup.2 was replaced by AAAA, and R.sup.3 was deleted. Core 1 (SEQ ID NO. 25) is already described in Example 7, Cores 2 (SEQ ID NO:26) and 3 (SEQ ID NO:32) are already described in Example 8, Cores 8 (SEQ ID NO:40), 12 (SEQ ID NO:48), 19 (SEQ ID NO:55), 20 (SEQ ID NO:41), 21 (SEQ ID NO:42), 24 (SEQ ID NO:57), 39 (SEQ ID NO:47), 40 (SEQ ID NO:37), 42 (SEQ ID NO:46), and 48 (SEQ ID NO:56) are already described m Example 9. cores 16 (SEQ ID NO:66), 32 (SEQ ID NO:67), and 46 (SEQ ID NO:63) are already described in Example 10, and Cores 5 (SEQ ID NO:92) 6 (SEQ ID NO:108), 34 (SEQ ID NO:101), 41 (SEQ ID NO:94) are already described in Example 11. The remaining cores are listed here.

    [0389] The sequence of core 4 is

    TABLE-US-00140 (SEQIDNO.137) GGAAGAAAAAGAATTTCCTCAAAAGGGGAGTGACTTGGGATGGGGG [0390] and it generated 5.6% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0391] The sequence of core 7 is

    TABLE-US-00141 (SEQIDNO.138) GGCAGAAAAAGCATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0392] and it generated 8.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0393] The sequence of core 9 is

    TABLE-US-00142 (SEQIDNO.139) GGAAGAAAAAGCATATCCTCAAAAGGGGAGTGACTTGGGATGGGGG [0394] and it generated 4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0395] The sequence of core 10 is

    TABLE-US-00143 (SEQIDNO.140) GGAAGAAAAAGAATATCCGCAAAAGGGGAGTGACTTGGGATGGCGA [0396] and it generated 4.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0397] The sequence of core 11 is

    TABLE-US-00144 (SEQIDNO.141) GGAAGAAAAAGATAGTAACCAAAAGGGGAGTGACTTGGGATGGGGG [0398] and it generated 2.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0399] The sequence of core 13 is

    TABLE-US-00145 (SEQIDNO.142) GGAAGAAAAAGCATATCCCCAAAAGGGGAGTGACTTGGGATGGGGT [0400] and it generated 6.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0401] The sequence of core 14 is

    TABLE-US-00146 (SEQIDNO.143) GGAAGAAAAAGAATATCCTCAAAAGGGGAGTGACTTGGGATGGGGT [0402] and it generated 51.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0403] The sequence of core 15 is

    TABLE-US-00147 (SEQIDNO.144) GGAAGTAAAAGAATATCCTCAAAAGGGGAGTGACTTGGGATGGGGT [0404] and it generated 36.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0405] The sequence of core 17 is

    TABLE-US-00148 (SEQIDNO.145) GGAAGAAAAAGTATATCCTCAAAAGGGGAGTGACTTGGGATGGGGG [0406] and it generated 14.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0407] The sequence of core 18 is

    TABLE-US-00149 (SEQIDNO.146) GGAAGAAAAAGCATATCCACAAAAGGGGAGTGACTTGGGATGGGGG [0408] and it generated 10.3% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0409] The sequence of core 22 is

    TABLE-US-00150 (SEQIDNO.147) GGCAGTAAAAGCATATCCACAAAAGGGGAGTGACTTGGGATGGGGG [0410] and it generated 9.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0411] The sequence of core 23 is

    TABLE-US-00151 (SEQIDNO.148) GGAAGAAAAAGGATATCCTCAAAAGGGGAGTGACTTGGGATGGGGG [0412] and it generated 14% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0413] The sequence of core 25 is

    TABLE-US-00152 (SEQIDNO.149) GGAAGTAAAAGCATATCCTCAAAAGGGGAGTGACTTGGGATGGGGG [0414] and it generated 10.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0415] The sequence of core 26 is

    TABLE-US-00153 (SEQIDNO.150) GGAAGAAAAAGAATATCATCAAAAGGGGAGTGACTTGGGATGGGGG [0416] and it generated 9.7% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0417] The sequence of core 27 is

    TABLE-US-00154 (SEQIDNO.151) GGAAGAAAAATATCTACCCTAAAAGGGGAGTGACTTGGGATGGGGG [0418] and it generated 8.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0419] The sequence of core 28 is

    TABLE-US-00155 (SEQIDNO.152) GGAAGAAAAAGCATATCCCCAAAAGGGGAGTGACTTGGGATGAGGG [0420] and it generated 12.7% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0421] The sequence of core 29 is

    TABLE-US-00156 (SEQIDNO.153) GGAAGAAAAAGAATATCCTCAAAAGGGGAGTGACTTGGGATAGGGG [0422] and it generated 21.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0423] The sequence of core 30 is

    TABLE-US-00157 (SEQIDNO.154) GGAAGAAAAAGGATATCCACAAAAGGGGAGTGACTTGGGATGGGGG [0424] and it generated 21.1% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0425] The sequence of core 31 is

    TABLE-US-00158 (SEQIDNO.155) GGAAGAAAAAGCATATCCTCAAAAGAGGAGTGACTTGGGATGGTGG [0426] and it generated 13.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0427] The sequence of core 33 is

    TABLE-US-00159 (SEQIDNO.156) GGCAGAAAAAGAATATCCTCAAAAGGGGAGTGACTTGGGATGGGGG [0428] and it generated 121.6% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0429] The sequence of core 33 is

    TABLE-US-00160 (SEQIDNO.157) GGAAGTAAAAGAATATCACCAAAAGGGGAGTGACTTGGGATGGGGG [0430] and it generated 50.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0431] The sequence of core 36 is

    TABLE-US-00161 (SEQIDNO.158) GGAAGAAAAAGAACATCCTCAAAAGGGGAGTGACTTGGGATGGGGG [0432] and it generated 27.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0433] The sequence of core 37 is

    TABLE-US-00162 (SEQIDNO.159) GGAAGAAAAAGCATATACCCAAAAGGGGAGTGACTTGGGATGGGGG [0434] and it generated 14.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0435] The sequence of core 38 is

    TABLE-US-00163 (SEQIDNO.160) GGAAGAAAAAGCGTATACCCAAAAGGGGAGTGACTTGGGATGGGGC [0436] and it generated 11.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0437] The sequence of core 43 is

    TABLE-US-00164 (SEQIDNO.161) GGAAGTAAAAGAATTTCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0438] and it generated 71.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0439] The sequence of core 44 is

    TABLE-US-00165 (SEQIDNO.162) GGAAGAAAAAGAATATCCTCAAAAGGGGAGTGACTTGGGATGGGGA [0440] and it generated 44.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0441] The sequence of core 45 is

    TABLE-US-00166 (SEQIDNO.163) GGAAGAAAAAGAATATCCTTAAAAGAGGAGTGACTTGGGATGGTGG [0442] and it generated 60.4% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0443] The sequence of core 47 is

    TABLE-US-00167 (SEQIDNO.164) GGCAGAAAAAGAATATCCCCAAAAGGGGAATGACTTGGGATGGGGG [0444] and it generated 23.9% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0445] The sequence of core 49 is

    TABLE-US-00168 (SEQIDNO.165) GGAAGAAAAAGAATATTCTCAAAAGGGGAGTGACTTGGGATGAGGG [0446] and it generated 8.2% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    [0447] The sequence of core 50 is

    TABLE-US-00169 (SEQIDNO.166) GGAAGAAAAAGAATTTCCCCAAAAGGGAAGTGACTTGGGATTGGGG [0448] and it generated 8.5% as much light as the most common minimized catalytic core in the reselection (SEQ ID NO. 25).

    Example 13: Identification of Sites in the Deoxyribozyme at Which New Sequences Can Be Inserted

    [0449] Deletion analysis (described in Example 7) showed that R.sup.1 (originally 26 nucleotides) could be replaced by AAAA, that R.sup.1 (originally 18 nucleotides) could be replaced by AAAA, and R.sup.3 (originally 18 nucleotides) could be deleted (see FIG. 6 for the locations of R.sup.1, R.sup.2, and R.sup.3 mapped onto the secondary structure of the deoxyribozyme). To determine the extent to which other nucleotides could also be inserted at these positions, a series of constructs was generated in which random sequence regions of different lengths (N=25% A, 25% C, 25% G, and 25% T) were inserted at R.sup.1, R.sup.3. Deoxyribozymes were tested as described in Example 4, except using 0.25 mM rather than 1 mM CDP-Star? substrate. The notation N.sub.3, N.sub.10, N.sub.30 means that the oligonucleotide tested contained a mix of sequences at the positions indicated with Nsa particular oligonucleotide would have in each position a 25% chance of having an A, a 25% chance of having a C, a 25% chance of haying G, and a 25% chance of having a T. This allows us to conclude that the sequence works regardless of the specific nucleotides in these positions.

    [0450] The first deoxyribozyme in the series

    TABLE-US-00170 (SEQIDNO.167) GGAAGAN.sub.3GAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0451] contained an N3 insertion at R.sup.1. This generated 36.8% as much light as SEQ ID NO. 25 (a variant with an AAAA insertion at R.sup.1).

    [0452] The second deoxyribozyme in the series

    TABLE-US-00171 (SEQIDNO.168) GGAAGAN.sub.10GAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0453] contained an N10 insertion at R.sup.1. This generated 31.6% as much light as SEQ ID NO. 25 (a variant with an AAAA insertion at R.sup.1).

    [0454] The third deoxyribozyme in the series

    TABLE-US-00172 (SEQIDNO.169) GGAAGAN.sub.30GAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0455] contained an N30 insertion at R.sup.1. This generated 16.5% as much light as SEQ ID NO. 25 (a variant with AAAA insertion at R.sup.1).

    [0456] The fourth deoxyribozyme in the series

    TABLE-US-00173 (SEQIDNO.170) GGAAGAAAAAGAATATCCCCN.sub.3GGGGAGTGACTTGGGATGGGGG [0457] contained an N3 insertion at R.sup.2. This generated 110.8% as much light as SEQ ID NO. 25 (a variant with an AAAA insertion at R.sup.2).

    [0458] The fifth deoxyribozyme in the series

    TABLE-US-00174 (SEQIDNO.171) GGAAGAAAAAGAATATCCCCN.sub.10GGGGAGTGACTTGGGATGGGGG [0459] contained an N10 insertion at R.sup.2. This generated 68.4% as much light as SEQ ID NO. 25 (a variant with an AAAA insertion at R.sup.2).

    [0460] The sixth deoxyribozyme in the series

    TABLE-US-00175 (SEQIDNO.172) GGAAGAAAAAGAATATCCCCN.sub.30GGGGAGTGACTTGGGATGGGGG [0461] contained an N30 insertion at R.sup.2. This generated 41.1% as much light as SEQ ID NO. 25 (a variant with an AAAA insertion at R.sup.2).

    [0462] The seventh deoxyribozyme in the series

    TABLE-US-00176 (SEQIDNO.173) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGGN.sub.3 [0463] contained an N3 extension at at R.sup.3. This generated 84.5% as much light as SEQ ID NO. 25 (a variant with no extension at R.sup.3).

    [0464] The eighth deoxyribozyme in the series

    TABLE-US-00177 (SEQIDNO.174) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGGN.sub.10 [0465] contained an N10 extension at R.sup.3. This generated 52% as much light as SEQ ID NO. 25 (a variant with no extension at R.sup.3).

    [0466] The ninth deoxyribozyme in the series

    TABLE-US-00178 (SEQIDNO.175) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGGN.sub.30 [0467] contained an N30 extension at R.sup.3. This generated 29.1% as much light as SEQ ID NO. 25 (a variant with no extension at R.sup.3).

    Example 14: Further Characterization of Insertion Sites in the Deoxyribozyme

    [0468] To further characterize deoxyribozyme insertion sites, five different variants of each of the nine R.sup.1-R.sup.2-R.sup.3 architectures described in Example 13 were generated in which arbitrary sequences were inserted at R.sup.1, R.sup.2, and/or R.sup.3. In addition, five different variants of each of two new R.sup.1-R.sup.2-R.sup.3 architectures were generated. See FIG. 6 for the locations of R.sup.1, R.sup.2, and R.sup.3 mapped onto the secondary structure of the deoxyribozyme. Deoxyribozymes were tested as described in Example 4, except using 0.25 mM rather than 1 mM CDP-Star? substrate.

    [0469] The first deoxyribozyme in the series

    TABLE-US-00179 (SEQIDNO.176) GGAAGAAGAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0470] contained an arbitrary 3 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 108.2% as much light as SEQ ID NO. 25 (a variant with the sequence AAAA at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3).

    [0471] The next deoxyribozyme in the series

    TABLE-US-00180 (SEQIDNO.177) GGAAGAACTGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0472] contained an arbitrary 3 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 54.3% as much light as SEQ ID NO. 25.

    [0473] The next deoxyribozyme in the series

    TABLE-US-00181 (SEQIDNO.178) GGAAGATAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0474] contained an arbitrary 3 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 169.1% as much light as SEQ ID NO. 25.

    [0475] The next deoxyribozyme in the series

    TABLE-US-00182 (SEQIDNO.179) GGAAGAACCGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0476] contained an arbitrary 3 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 61.5% as much light as SEQ ID NO. 25.

    [0477] The next deoxyribozyme in the series

    TABLE-US-00183 (SEQIDNO.180) GGAAGACCAGAATATCCCCAAAAGGGGAGTGACTTGGGATG GGGG [0478] contained an arbitrary 3 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 70.8% as much light as SEQ ID NO. 25.

    [0479] The next deoxyribozyme in the series

    TABLE-US-00184 (SEQIDNO.181) GGAAGAGGGATGACCAGAATATCCCCAAAAGGGGAGTGACT TGGGATGGGGG [0480] contained an arbitrary 10 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 29.6% as much light as SEQ ID NO. 25.

    [0481] The next deoxyribozyme in the series

    TABLE-US-00185 (SEQIDNO.182) GGAAGAACGTAATCGGGAATATCCCCAAAAGGGGAGTGACT TGGGATGGGGG [0482] contained an arbitrary 10 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 49.1% as much light as SEQ ID NO. 25.

    [0483] The next deoxyribozyme in the series

    TABLE-US-00186 (SEQIDNO.183) GGAAGACCTCGCTACCGAATATCCCCAAAAGGGGAGTGACT TGGGATGGGGG [0484] contained an arbitrary 10 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 25.3% as much light as SEQ ID NO. 25.

    [0485] The next deoxyribozyme in the series

    TABLE-US-00187 (SEQIDNO.184) GGAAGAGGGGGATCTTGAATATCCCCAAAAGGGGAGTGACT TGGGATGGGGG [0486] contained an arbitrary 10 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 19.3% as much light as SEQ ID NO. 25.

    [0487] The next deoxyribozyme in the series

    TABLE-US-00188 (SEQIDNO.185) GGAAGATTAACGTCTCGAATATCCCCAAAAGGGGAGTGACT TGGGATGGGGG [0488] contained an arbitrary 10 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 33.3% as much light as SEQ ID NO. 25.

    [0489] The next deoxyribozyme in the series

    TABLE-US-00189 (SEQIDNO.186) GGAAGACGCCCGCTGTTTTACAGTGCTGCAAAAAACGAATA TCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0490] contained an arbitrary 30 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 32.7% as much light as SEQ ID NO. 25.

    [0491] The next deoxyribozyme in the series

    TABLE-US-00190 (SEQIDNO.187) GGAAGAAGTCTGGCCGTCGAATCTGGCCTATGTATTGAATA TCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0492] contained an arbitrary 30 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 22.5% as much light as SEQ ID NO. 25.

    [0493] The next deoxyribozyme in the series

    TABLE-US-00191 (SEQIDNO.188) GGAAGACATAAGAGTGGTGGCGACCGTTACAATTAGGAATA TCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0494] contained an arbitrary 30 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 29.8% as much light as SEQ ID NO. 25.

    [0495] The next deoxyribozyme in the series

    TABLE-US-00192 (SEQIDNO.189) GGAAGAAATGGGCTCGAATTAACGGGTAGTTAATTAGAATA TCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0496] contained an arbitrary 30 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 15.7% as much light as SEQ ID NO. 25.

    [0497] The next deoxyribozyme in the series

    TABLE-US-00193 (SEQIDNO.190) GGAAGAAGGTGATAGGGGAGCGCACGGAATTACCCAGAATA TCCCCAAAAGGGGAGTGACTTGGGATGGGGG [0498] contained an arbitrary 30 nucleotide sequence at R.sup.1, AAAA at R.sup.2, and no nucleotides at R.sup.3. This generated 14.9% as much light as SEQ ID NO. 25.

    [0499] The next deoxyribozyme in the series

    TABLE-US-00194 (SEQIDNO.191) GGAAGAAAAAGAATATCCCCGGAGGGGAGTGACTTGGGATGGGGG [0500] contained AAAA at R.sup.1, an arbitrary 3 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 116.5% as much light as SEQ ID NO. 25.

    [0501] The next deoxyribozyme in the series

    TABLE-US-00195 (SEQIDNO.192) GGAAGAAAAAGAATATCCCCGAGGGGGAGTGACTTGGGATGGGGG [0502] contained AAAA at R.sup.1, an arbitrary 3 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 96.7% as much light as SEQ ID NO. 25.

    [0503] The next deoxyribozyme in the series

    TABLE-US-00196 (SEQIDNO.193) GGAAGAAAAAGAATATCCCCTAAGGGGAGTGACTTGGGATGGGGG [0504] contained AAAA at R.sup.1, an arbitrary 3 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 151.2% as much light as SEQ ID NO. 25.

    [0505] The next deoxyribozyme in the series

    TABLE-US-00197 (SEQIDNO.194) GGAAGAAAAAGAATATCCCCGCTGGGGAGTGACTTGGGATGGGGG [0506] contained AAAA at R.sup.1, an arbitrary 3 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 127.9% as much light as SEQ ID NO. 25.

    [0507] The next deoxyribozyme in the series

    TABLE-US-00198 (SEQIDNO.195) GGAAGAAAAAGAATATCCCCAATGGGGAGTGACTTGGGATGGGGG [0508] contained AAAA at R.sup.1, an arbitrary 3 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 101.9% as much light as SEQ ID NO. 25.

    [0509] The next deoxyribozyme in the series

    TABLE-US-00199 (SEQIDNO.196) GGAAGAAAAAGAATATCCCCGGGAAGGCCTGGGGAGTGACTTGGG ATGGGGG [0510] contained AAAA at R.sup.1, an arbitrary 10 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 104% as much light as SEQ ID NO. 25.

    [0511] The next deoxyribozyme in the series

    TABLE-US-00200 (SEQIDNO.197) GGAAGAAAAAGAATATCCCCTTTTACTGTGGGGGAGTGACTTGGG ATGGGGG [0512] contained AAAA at R.sup.1, an arbitrary 10 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 92.8% as much light as SEQ ID NO. 25.

    [0513] The next deoxyribozyme in the series

    TABLE-US-00201 (SEQIDNO.198) GGAAGAAAAAGAATATCCCCCTTAGCAAATGGGGAGTGACTTGGG ATGGGGG [0514] contained AAAA at R.sup.1, an arbitrary 10 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 59.9% as much light as SEQ ID NO. 25.

    [0515] The next deoxyribozyme in the series

    TABLE-US-00202 (SEQIDNO.199) GGAAGAAAAAGAATATCCCCAAAAAGCATGGGGGAGTGACTTGGG ATGGGGG [0516] contained AAAA at R.sup.1, an arbitrary 10 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 86% as much light as SEQ ID NO. 25.

    [0517] The next deoxyribozyme in the series

    TABLE-US-00203 (SEQIDNO.200) GGAAGAAAAAGAATATCCCCAATTTCACCCGGGGAGTGACTTGGG ATGGGGG [0518] contained AAAA at R.sup.1, an arbitrary 10 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 36.2% as much light as SEQ ID NO. 25.

    [0519] The next deoxyribozyme in the series

    TABLE-US-00204 (SEQIDNO.201) GGAAGAAAAAGAATATCCCCTAACGAGTCTCAAAAGCTACTTCGC TATAAGGGGAGTGACTTGGGATGGGGG [0520] contained AAAA at R.sup.1, an arbitrary 30 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 50.4% as much light as SEQ ID NO. 25.

    [0521] The next deoxyribozyme in the series

    TABLE-US-00205 (SEQIDNO.202) GGAAGAAAAAGAATATCCCCGGGTGACACCACCGATAACGAGCCT TAAACGGGGAGTGACTTGGGATGGGGG [0522] contained AAAA at R.sup.1, an arbitrary 30 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 35.7% as much light as SEQ ID NO. 25.

    [0523] The next deoxyribozyme in the series

    TABLE-US-00206 (SEQIDNO.203) GGAAGAAAAAGAATATCCCCCGACCACCAACCCAAGTAGACATTA TGAGTGGGGAGTGACTTGGGATGGGGG [0524] contained AAAA at R.sup.1, an arbitrary 30 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 38.1% as much light as SEQ ID NO. 25.

    [0525] The next deoxyribozyme in the series

    TABLE-US-00207 (SEQIDNO.204) GGAAGAAAAAGAATATCCCCTGGCTCCCTCCAAGGGTAGGCATTC ACGAGGGGGAGTGACTTGGGATGGGGG [0526] contained AAAA at R.sup.1, an arbitrary 30 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 41% as much light as SEQ ID NO. 25.

    [0527] The next deoxyribozyme in the series

    TABLE-US-00208 (SEQIDNO.205) GGAAGAAAAAGAATATCCCCGCAGTGTAGTGAGAGGACCTCAGCA CACGCGGGGAGTGACTTGGGATGGGGG [0528] contained AAAA at R.sup.1, an arbitrary 30 nucleotide sequence at R.sup.2, and no nucleotides at R.sup.3. This generated 106.2% as much light as SEQ NO. 25.

    [0529] The next deoxyribozyme in the series

    TABLE-US-00209 (SEQIDNO.206) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGG GGAT [0530] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 3 nucleotide sequence at R.sup.3. This generated 131% as much light as SEQ ID NO. 25.

    [0531] The next deoxyribozyme in the series

    TABLE-US-00210 (SEQIDNO.207) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGG GTGG [0532] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 3 nucleotide sequence at R.sup.3. This generated 90.4% as much light as SEQ ID NO. 25.

    [0533] The next deoxyribozyme in the series

    TABLE-US-00211 (SEQIDNO.208) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGG GTGT [0534] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 3 nucleotide sequence at R.sup.3. This generated 86.3% as much light as SEQ ID NO. 25.

    [0535] The next deoxyribozyme in the series

    TABLE-US-00212 (SEQIDNO.209) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGATGGGG GGCG [0536] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 3 nucleotide sequence at R.sup.3. This generated 53.4% as much light as SEQ ID NO. 25.

    [0537] The next deoxyribozyme in the series

    TABLE-US-00213 (SEQIDNO.210) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGAT GGGGGTGG [0538] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 3 nucleotide sequence at R.sup.3. This generated 61.1% as much light as SEQ ID NO. 25. The next deoxyribozyme in the series

    TABLE-US-00214 (SEQIDNO.211) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGA TGGGGGACCTAGGCAA [0539] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 10 nucleotide sequence at R.sup.3. This generated 66.9% as much light as SEQ ID NO. 25.

    [0540] The next deoxyribozyme in the series

    TABLE-US-00215 (SEQIDNO.212) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGA TGGGGGTGTTCATCAA [0541] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 10 nucleotide sequence at R.sup.3. This generated 90.9% as much light as SEQ ID NO. 25.

    [0542] The next deoxyribozyme in the series

    TABLE-US-00216 (SEQIDNO.213) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGA TGGGGGGATAGACTCT [0543] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 10 nucleotide sequence at R.sup.3. This generated 79.8% as much light as SEQ ID NO. 25.

    [0544] The next deoxyribozyme in the series

    TABLE-US-00217 (SEQIDNO.214) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGA TGGGGGATACCCTTGT [0545] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 10 nucleotide sequence at R.sup.3. This generated 47% as much light as SEQ ID NO. 25.

    [0546] The next deoxyribozyme in the series

    TABLE-US-00218 (SEQIDNO.215) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGA TGGGGGCGATCTGACG [0547] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 10 nucleotide sequence at R.sup.3. This generated 125.8% as much light as SEQ ID NO. 25.

    [0548] The next deoxyribozyme in the series

    TABLE-US-00219 (SEQIDNO.216) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGA TGGGGGCGAAGTTGGCAAACATTATAAGTTGGGGAG [0549] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 30 nucleotide sequence at R.sup.3. This generated 49.5% as much light as SEQ ID NO. 25.

    [0550] The next deoxyribozyme in the series

    TABLE-US-00220 (SEQIDNO.217) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGA TGGGGGCAAGGACTTTATACAATGCTCGCGGGTCGA [0551] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 30 nucleotide sequence at R.sup.3. This generated 76.2% as much light as SEQ ID NO. 25.

    [0552] The next deoxyribozyme in the series

    TABLE-US-00221 (SEQIDNO.218) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGA TGGGGGTGGAGCATGCATTCTTGGACAAAATCTTGT [0553] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 30 nucleotide sequence at R.sup.3. This generated 61% as much light as SEQ ID NO. 25.

    [0554] The next deoxyribozyme in the series

    TABLE-US-00222 (SEQIDNO.219) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGA TGGGGGGTGCTACTTAAATTCTGTGTGTGACTTTAA [0555] contained AAAA at R.sup.1, AAAA at R.sup.2, and an arbitrary 30 nucleotide sequence at R.sup.3. This generated 49.6% as much light as SEQ ID NO. 25.

    [0556] The next deoxyribozyme in the series

    TABLE-US-00223 (SEQIDNO.220) GGAAGAAAAAGAATATCCCCAAAAGGGGAGTGACTTGGGA TGGGGGTTGGCTGCCGTCCCAGGCGGCACGATAGAC [0557] contained AAAA at R.sup.1; AAAA at R.sup.2, and an arbitrary 30 nucleotide sequence at R.sup.3. This generated 88.7% as much light as SEQ ID NO. 25.

    [0558] The next deoxyribozyme in the series

    TABLE-US-00224 (SEQIDNO.221) GGAAGATCCTGAATATCCCCTTGAGGGGAGTGACTTGGGA TGGGGGCTAG [0559] contained an arbitrary 4 nucleotide sequence at R.sup.1, R.sup.2, and R.sup.3. This generated 252.4% as much light as SEQ ID NO. 25.

    [0560] The next deoxyribozyme in the series

    TABLE-US-00225 (SEQIDNO.222) GGAAGAGAACGAATATCCCCACCTGGGGAGTGACTTGGGA TGGGGGCGAA [0561] contained an arbitrary 4 nucleotide sequence at R.sup.1, R.sup.2, and R.sup.3. This generated 59.9% as much light as SEQ ID NO. 25.

    [0562] The next deoxyribozyme in the series

    TABLE-US-00226 (SEQIDNO.223) GGAAGATGCCGAATATCCCCGTCGGGGGAGTGACTTGGGA TGGGGGTACG [0563] contained an arbitrary 4 nucleotide sequence at R.sup.1, R.sup.2, and R.sup.3. This generated 78.7% as much light as SEQ ID NO. 25.

    [0564] The next deoxyribozyme in the series

    TABLE-US-00227 (SEQIDNO.224) GGAAGAGCGAGAATATCCCCACAGGGGGAGTGACTTGGGA TGGGGGACGG [0565] contained an arbitrary 4 nucleotide sequence at R.sup.1, R.sup.2, and R.sup.3. This generated 66.1% as much light as SEQ ID NO. 25.

    [0566] The next deoxyribozyme in the series

    TABLE-US-00228 (SEQIDNO.225) GGAAGACCCTGAATATCCCCCCGTGGGGAGTGACTTGGGATGGGGGGCT C [0567] contained an arbitrary 4 nucleotide sequence at R.sup.1, R.sup.2, and R.sup.3. This generated 48.7% as much light as SEQ ID NO. 25.

    [0568] The next deoxyribozyme in the series

    TABLE-US-00229 (SEQIDNO.226) GGAAGACTTTACCTACGAATATCCCCGTAGGCACTCGGGGAGTGACTTG GGATGGGGGACGCTCCCAT [0569] contained an arbitrary 10 nucleotide sequence at R.sup.1, R.sup.2, and R.sup.3. This generated 28.2% as much light as SEQ ID NO. 25.

    [0570] The next deoxyribozyme in the series

    TABLE-US-00230 (SEQIDNO.227) GGAAGATCGATGAGGCGAATATCCCCAGATCACCTAGGGGAGTGACTTG GGATGGGGGAGCGGCACCG [0571] contained an arbitrary 10 nucleotide sequence at R.sup.1, R.sup.2, and R.sup.2. This generated 40.7% as much light as SEQ ID NO. 25.

    [0572] The next deoxyribozyme in the series

    TABLE-US-00231 (SEQIDNO.228) GGAAGACTCCTITTATGAATATCCCCCTGTCTTTAAGGGGAGTGACTTG GGATGGGGGCAGATCGCTA [0573] contained an arbitrary 10 nucleotide sequence at R.sup.1, R.sup.2, and R.sup.3. This generated 17.2% as much light as SEQ ID NO. 25.

    [0574] The next deoxyribozyme in the series

    TABLE-US-00232 (SEQIDNO.229) GGAAGATCGACCGCCAGAATATCCCCTCAGCGCGAGGGGGAGTGACTTG GGATGGGGGAGAAGGAAGT [0575] contained an arbitrary 10 nucleotide sequence at R.sup.1, R.sup.2, and R.sup.3. This generated 15% as much light as SEQ ID NO. 25.

    [0576] The next deoxyribozyme in the series

    TABLE-US-00233 (SEQIDNO.230) GGAAGATAACGTAGGGGAATATCCCCCCAGAAGGTAGGGGAGTGACTTG GGATGGGGGCCCCGGACGT [0577] contained an arbitrary 10 nucleotide sequence at R.sup.1, R.sup.2, and R.sup.3. This generated 19.8% as much light SEQ ID NO. 25.

    Example 15: Method for Detection of Specific Oligonucleotide Sequences using a Light-Producing Deoxyribozyme Sensor

    [0578] To generate a version of this deoxyribozyme that can sense oligonucleotides with specific sequences, we inserted part of the sequence of the target oligonucleotide into R.sup.2, and the reverse complement of the full target oligonucleotide into R.sup.3. In the absence of the target, R.sup.2 and R.sup.3 form a helix by Watson-Clack interactions that inhibits the deoxyribozyme. In the presence of the target, however, the inhibitory helix cannot form because R.sup.3 binds to the target rather than R.sup.2. This results in catalytic activity and the production of light. Deoxyribozymes were tested as described, in Example 4 (except using 0.25 mM rather than 1 mM CDP-Star? substrate) in the presence of either 0 ?M or 10 ?M oligonucleotide ligand (=target).

    [0579] The first sensor we generated

    TABLE-US-00234 (SEQIDNO.231) GGAAGAAAAAGAATATCCCCCAATCGTGCGGGGAGTGACTTGGGATGGG GGAAGCACGATTGACCTTC(targetisGAAGGTCAATCGTGC, SEQIDNO.232) [0580] generated light with a rate enhancement of 38.4 -fold in the presence of 10 ?M target and 1.9-fold in the absence of the target.

    [0581] The second sensor we generated

    TABLE-US-00235 (SEQIDNO.233) GGAAGAAAAAGAATATCCCCCTCTTAAGAGGGGAGTGACTTGGGATGGG GGAATCTTAAGAGAAGGGA(targetisTCCCTTCTCTTAAGA, SEQIDNO.234) [0582] generated light with a rate enhancement of 15-fold in the presence of 10 ?M target and 2.7-fold in the absence of the target.

    [0583] The third sensor we generated

    TABLE-US-00236 (SEQIDNO.235) GGAAGAAAAAGAATATCCCCGGCACTGATGGGGAGTGACTTGGGATGGG GGAAATCAGTGCCCAGTGG(targetisCCACTGGGCACTGAT, SEQIDNO.236) [0584] generated light with a rate enhancement of 35.6-fold relative to the reaction in the absence of deoxyribozyme in the presence of 10 ?M target and 2.4-fold in the absence of the target.

    [0585] The fourth sensor we generated

    TABLE-US-00237 (SEQIDNO.237) GGAAGAAAAAGAATATCCCCATGATCGGAGGGGAGTGACTTGGGATGGG GGAATCCGATCATCCGAAG(targetisCTTCGGATGATCGGA, SEQIDNO.238) [0586] generated light with a rate enhancement of 44.8-fold relative to the reaction in the absence of deoxyribozyme in the presence of 10 ?M target and 6.8-fold in the absence of the target.

    [0587] The fifth sensor we generated

    TABLE-US-00238 (SEQIDNO.239) GGAAGAAAAAGAATATCCCCAGTAATAGCGGGGAGTGACTTGGGATGGG GGAAGCTATTACTTATCTT(targetisAAGATAAGTAATAGC, SEQIDNO.240) [0588] generated light with a rate enhancement of 37.5-fold relative to the reaction in the absence of deoxyribozyme in the presence of 10 ?M target and 4.6-fold in the absence of the target.

    Example 16: Effect of Reaction Conditions on Deoxyribozyme-Catalyzed Light Production

    [0589] A deoxyribozyme with the sequence SEQ ID NO. 25 was tested as described in Example 4 except for the following changes.

    [0590] In FIG. 8A, the buffer contained 1 ?M deoxyribozyme, 20 mM HEPES, pH 7.4, 20 mM KCl, varying concentrations of ZnCl.sub.2, and 62.5 ?M CDP-Star?.

    [0591] In FIG. 8B, the buffer contained 1 ?M. deoxyribozyme, 20 mM HEPES at various pH values, 20 mM KCl, 0.65 mM ZnCl.sub.2, and 62.5 ?M CDP-Star?.

    [0592] In FIG. 8C, the buffer contained 1 ?M deoxyribozyme, 20 mM HEPES, pH 7.4, varying concentrations of KCl, 1 nM ZnCl.sub.2, and 62.5 ?M CDP-Star?.

    [0593] In FIG. 8D, the buffer contained 1 ?M deoxyribozyme, 20 mM HEPES, pH 7.4, 20 mM KCl, 0.65 mM ZnCl.sub.2, and varying concentrations of CDP-Star.

    [0594] In FIG. 8E, the buffer contained varying concentrations of deoxyribozyme, 20 mM KCl, 0.65 mM ZnCl.sub.2, 20 mM HEPES, pH 7.4, and 62.5 ?M CDP-Star.

    [0595] In FIG. 8F, the column labeled Sel indicates the amount of light produced using the conditions of the original selection (1 ?M deoxyribozyme, 50 mM HEPES, pH 7.4, 200 mM KCl, 1 ?M CeCl.sub.3, 0.1 ?M PbCl.sub.2, 1 mM ZnCl.sub.2, and 1000 ?M CDP-Star).

    [0596] All other reactions in FIG. 8F were performed in the absence of CeCl.sub.3 and PbCl.sub.2. Reactions contained either 20 mM (columns 2, 5, 6, and 8) or 200 mM (columns 1, 3, 4, and 7) KCl, 62.5 ?M (columns 3, 5, 7, and 8) or 1000 nM (columns 1, 2 4, and 6) CDP-Star, 1 ?M (columns 1, 2, 3, and 5) or 30 ?M (columns 4, 6, 7, and 8) deoxyribozyme, 0.65 mM ZnCl.sub.2 (columns 1-8), 15% DMSO (columns 1-8) and 20 mM HEPES, pH 7.4 (columns 1-8).

    [0597] The y axis shows the rate enhancement of light production (the amount of light produced in the presence of deoxyribozyme divided by the amount of light produced in the absence of deoxyribozyme).

    [0598] For all panels, points show the average of at least three experiments.