PRODUCTS AND METHODS FOR THE TREATMENT OF NICOTINE DEPENDENCE
20230212533 · 2023-07-06
Inventors
- James C. Bardwell (Ann Arbor, MI, US)
- Mark Dulchavsky (Ann Arbor, MI, US)
- Frederick Stull (Ann Arbor, MI, US)
Cpc classification
C12N15/1065
CHEMISTRY; METALLURGY
C12Y117/02001
CHEMISTRY; METALLURGY
C12Y117/03003
CHEMISTRY; METALLURGY
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
International classification
Abstract
The disclosure provides variants of nicotine oxidoreductase and methods to select such variants that are unexpectedly active in the catabolic destruction of nicotine by oxidation using oxygen as electron acceptor, and catabolically active fragments thereof. Also disclosed are compositions comprising the CycN cytochrome c protein and at least one of the variant nicotine oxidoreductase holoenzymes, the fragments thereof, or a naturally occurring nicotine oxidoreductase, as well as fusion proteins comprising catalytically active nicotine oxidoreductase fragments or holoenzymes and CycN cytochrome c fragments or holoenzymes. Additionally, variants of L-6-hydroxynicotine oxidase, or catalytically active fragments thereof, are provided. Further disclosed are polynucleotides encoding such proteins, vectors comprising such polynucleotides, and host cells comprising such polynucleotides or vectors. Also provided are methods of using any of the disclosed compositions or formulations to treat nicotine dependence or reduce the risk of relapse to nicotine dependence.
Claims
1. A NicA2 nicotine oxidoreductase variant or functional fragment thereof comprising fewer than 10 amino acid substitutions, additions, or deletions from the amino acid sequence set forth in SEQ ID NO:131, wherein the NicA2 nicotine oxidoreductase variant exhibits a higher KM and/or a higher K.sub.cat for oxidizing nicotine with oxygen as electron acceptor compared to the wild-type NicA2 nicotine oxidase of SEQ ID NO:131.
2. The NicA2 nicotine oxidoreductase variant of claim 1 or a functional fragment thereof comprising 1 amino acid substitution from the amino acid sequence set forth in SEQ ID NO:131.
3. The NicA2 nicotine oxidoreductase variant of claim 1 wherein the variant comprises an amino acid sequence that varies from the wild-type sequence of SEQ ID NO:131 at one or more of positions 12, 29, 37, 39, 42, 44, 45, 46, 48, 49, 50, 51, 52, 54, 59, 62, 63, 69, 72, 73, 75, 78, 85, 92, 93, 94, 96, 98, 99, 100, 103, 104, 107, 108, 112, 114, 115, 120, 127, 129, 130, 131, 132, 133, 135, 137, 138, 145, 146, 147, 151, 152, 156, 157, 159, 160, 161, 168, 171, 172, 173, 174, 177, 180, 183, 184, 187, 188, 191, 192, 196, 198, 199, 202, 209, 210, 213, 215, 217, 221, 222, 223, 224, 225, 229, 231, 235, 239, 242, 243, 244, 245, 246, 249, 253, 258, 260, 265, 267, 270, 276, 277, 278, 280, 281, 282, 287, 291, 292, 293, 295, 296, 298, 302, 303, 306, 307, 308, 311, 314, 317, 319, 324, 330, 331, 333, 335, 337, 338, 345, 349, 351, 355, 357, 359, 364, 366, 368, 371, 373, 374, 379, 380, 381, 382, 388, 389, 390, 393, 394, 395, 398, 403, 406, 408, 411, 418, 421, 424, 426, 427, 429, 431, 432, 435, 437, 441, 442, 443, 444, 449, 454, 455, 457, 460, 461, 462, 473, 474, 476, 480, 481, 482, 483, and/or 484.
4. The NicA2 nicotine oxidoreductase variant of claim 3 wherein the variant comprises a mature NicA2 nicotine oxidoreductase comprising an amino acid sequence that varies from the wild-type sequence of SEQ ID NO:131 at one or more of positions 42, 44, 45, 46, 48, 49, 50, 51, 52, 54, 59, 62, 63, 69, 72, 73, 75, 78, 85, 92, 93, 94, 96, 98, 99, 100, 103, 104, 107, 108, 112, 114, 115, 120, 127, 129, 130, 131, 132, 133, 135, 137, 138, 145, 146, 147, 151, 152, 156, 157, 159, 160, 161, 168, 171, 172, 173, 174, 177, 180, 183, 184, 187, 188, 191, 192, 196, 198, 199, 202, 209, 210, 213, 215, 217, 221, 222, 223, 224, 225, 229, 231, 235, 239, 242, 243, 244, 245, 246, 249, 253, 258, 260, 265, 267, 270, 276, 277, 278, 280, 281, 282, 287, 291, 292, 293, 295, 296, 298, 302, 303, 306, 307, 308, 311, 314, 317, 319, 324, 330, 331, 333, 335, 337, 338, 345, 349, 351, 355, 357, 359, 364, 366, 368, 371, 373, 374, 379, 380, 381, 382, 388, 389, 390, 393, 394, 395, 398, 403, 406, 408, 411, 418, 421, 424, 426, 427, 429, 431, 432, 435, 437, 441, 442, 443, 444, 449, 454, 455, 457, 460, 461, 462, 473, 474, 476, 480, 481, 482, 483, and/or 484.
5. The NicA2 nicotine oxidoreductase variant of claim 3 wherein the variant comprises an amino acid sequence that varies from the wild-type sequence of SEQ ID NO:131 at one or more of positions 93, 104, 107, 108, 130, 132, 249, 317, 368, 379, 381, 427 or 462.
6. The NicA2 nicotine oxidoreductase variant of claim 4 wherein the variant comprises an amino acid substitution of serine for isoleucine at position 12 (S12I), G29S, S37N, T39S, T42A, R44H, A45T, A45V, S46R, V48A, K49N, G50A, G50C, G50D, G50S, G51S, F52L, Y54F, V59I, G62S, F63L, F63V, A69V, C72S, G73S, Q75H, R78G, R78H, R85C, R85H, T92A, T92I, T92S, F93L, T94A, R96H, R96S, A98E, A98S, G99D, Q100H, E103D, F104I, F104L, A107P, A107T, W108R, L112M, L112Q, P114Q, H115Y, M120I, V127M, E129Q, E129V, D130A, D130E, D130G, D130N, D130S, D130V, D130Y, P131Q, P131S, L132R, T133I, L135M, K137R, T138I, G145A, S146G, S146I, V147F, V147L, S151I, P152S, G156C, G156D, G156S, K157M, K157R, I159V, R160H, I161F, I161V, H168Q, W171C, W171R, E172G, V173A, F174C, F174I, F174V, P177L, P180L, T183I, E184G, E184K, R187L, E188D, K191M, K191N, S192C, S192I, S192N, D196H, I198F, K199R, G202D, A209T, Q210H, S213T, M215L, L217P, E221D, T222S, T223N, D224E, K225N, K225Q, P229L, V231I, F235I, F235L, G239A, Y242N, D243N, A244V, F245Y, M246T, E249G, R253S, T258A, G260A, G260S, M265I, T267I, T267S, G270C, S276C, S276N, V277I, P278Q, P278S, T280K, A281T, V282I, G287D, I291V, K292N, K292Q, K292R, T293S, D295N, D295V, D296E, 1298F, 1298V, G302A, V303A, M306V, T307P, V308L, N311S, K314Q, G317D, G317S, T319I, K324E, 1330T, K331N, G333S, L335V, K337M, G338S, V345L, L349M, R351H, F355L, D357E, Q359L, Q359E, Q359R, W364C, Q366K, Q366R, H368L, H368P, H368R, H368Y, S371R, E373K, L374M, S379N, 1380V, T381I, T381S, 1382V, 1388F, D389E, V390I, R393C, D394N, A395V, R398L, M403I, G406D, E408D, G411D, G411S, T418S, P421L, L424Q, A426T, W427L, A429V, G431D, G431S, V432M, L435Q, R437H, L441M, Q442H, A443V, A444G, L449V, E454D, T455A, N457T, H460L, A461V, N462S, A473V, G474S, E476V, L480P, L481A, L481P, S482E, 483L, and/or 484I.
7. The NicA2 nicotine oxidoreductase variant of claim 2 wherein the variant comprises the sequence set forth in any one of SEQ ID NOs:20-119.
8. The fragment of a NicA2 nicotine oxidoreductase variant of claim 1 wherein the fragment comprises a variant amino acid at a position corresponding to position 93, 104, 107, 108, 130, 132, 249, 317, 368, 379, 381, 427 or 462 of SEQ ID NO:131.
9. The NicA2 nicotine oxidoreductase variant of claim 1 wherein the K.sub.M of the variant is greater than 0.114.
10. The NicA2 nicotine oxidoreductase variant of claim 9 wherein the K.sub.M of the variant is at least 1.5.
11. The NicA2 nicotine oxidoreductase variant of claim 10 wherein the K.sub.M of the variant is 1.5-29.
12. The NicA2 nicotine oxidoreductase variant of claim 1 wherein the K.sub.cat of the variant is greater than 0.007.
13. The NicA2 nicotine oxidoreductase variant of claim 12 wherein the K.sub.cat of the variant is at least 0.132.
14. NicA2 nicotine oxidoreductase variant of claim 13 wherein the Kcat of the variant is 0.132-0.314.
15. The NicA2 nicotine oxidoreductase variant of claim 1 comprising 1 amino acid deletion from the amino acid sequence set forth in SEQ ID NO:131.
16. The NicA2 nicotine oxidoreductase variant of claim 1 comprising 1 amino acid addition from the amino acid sequence set forth in SEQ ID NO:131.
17. The NicA2 nicotine oxidoreductase variant of claim 1 wherein the amino acid sequence of the variant is at least 90% identical to the amino acid sequence set forth in SEQ ID NO:131.
18. A polynucleotide encoding the NicA2 nicotine oxidoreductase variant of claim 1.
19. The polynucleotide according to claim 18 wherein the encoded NicA2 nicotine oxidoreductase variant comprises at least one nucleotide variant relative to the wild-type nicA2 coding region of SEQ ID NO:130, wherein the at least one nucleotide variant corresponds to position 35, 85, 110, 115, 124, 131, 133, 134, 136, 143, 147, 148, 149, 151, 156, 161, 175, 184, 187, 206, 214, 217, 225, 232, 233, 235, 253, 254, 274, 275, 277, 280, 286, 287, 292, 293, 296, 300, 309, 310, 312, 319, 322, 334, 335, 339, 341, 343, 360, 379, 385, 386, 388, 389, 390, 391, 392, 395, 398, 403, 410, 413, 434, 436, 437, 439, 452, 454, 466, 467, 470, 475, 479, 481, 504, 511, 513, 515, 518, 520, 521, 530, 539, 548, 550, 551, 560, 564, 572, 573, 574, 575, 586, 592, 596, 605, 625, 630, 638, 643, 650, 663, 664, 668, 672, 673, 675, 686, 691, 703, 705, 716, 724, 727, 731, 734, 737, 746, 757, 772, 778, 779, 795, 800, 808, 826, 827, 829, 832, 833, 839, 840, 841, 844, 860, 871, 874, 875, 876, 877, 883, 884, 888, 892, 905, 908, 916, 919, 922, 932, 940, 949, 950, 956, 970, 989, 993, 997, 1003, 1010, 1012, 1033, 1045, 1052, 1065, 1071, 1075, 1076, 1092, 1096, 1097, 1102, 1103, 1113, 1117, 1120, 1136, 1138, 1141, 1142, 1144, 1162, 1167, 1168, 1177, 1180, 1184, 1193, 1209, 1217, 1224, 1231, 1232, 1252, 1254, 1262, 1271, 1276, 1280, 1286, 1291, 1292, 1294, 1304, 1310, 1321, 1326, 1328, 1331, 1345, 1362, 1363, 1370, 1379, 1382, 1385, 1386, 1418, 1420, 1427, 1439, 1440, 1441, 1442, 1443, 1444, 1445, 1446, 1447, 1448, 1449, 1450, 1451, and/or 1452 of SEQ ID NO:130.
20. The polynucleotide of claim 18 wherein the variant nucleotide corresponds to position 310, 312, 319, 388, 389, 950, 1052, 1103, 1136, 1280, 1345, 1385, and/or 1386 of SEQ ID NO:130.
21. The polynucleotide of claim 20 wherein the variant nucleotide corresponds to position 310, 312, 319, 388, 389, 950, 1103, 1345, and/or 1385 of SEQ ID NO:130.
22. The polynucleotide of claim 18 comprising a plurality of nucleotide variations at positions corresponding to positions 1439, 1440, 1441, 1442, 1444, 1445, 1446, 1447, 1449, 1450, 1451 and/or 1452 of SEQ ID NO:130.
23. The polynucleotide of claim 18 encoding the NicA2 nicotine oxidoreductase of any one of claims 2-8.
24. The polynucleotide of claim 18, wherein the polynucleotide comprises the NicA2 variant coding region sequence of nica2mut1, nicA2mut5, nicA2mut6, nicA2mut7, nicA2mut8, nicA2mut9, nicA2mut10, nicA2mut11, nicA2mut12, nicA2mut17, nicA2mut19, nicA2mut20, nicA2mut21, nicA2mut22, nicA2mut23, nicA2mut25, nicA2mut31, nicA2mut35, nicA2mut36, nicA2mut40, nicA2mut43, nicA2mut45, nicA2mut61, nicA2mut64, nicA2mut65, nicA2mut66, nicA2mut75, nicA2mut95, nicA2mut96, nicA2mutD1, nicA2mutH3, nicA2mutH4, nicA2mut101, nicA2mut105, nicA2mut106, nicA2mut112, nicA2mut113, nicA2mut117, nicA2mut118, nicA2mut119, nicA2mut123, nicA2mut130, nicA2mut136, nicA2mut137, nicA2mut138, nicA2mut144, nicA2mut145, nicA2mut146, nicA2mut147, nicA2mut149, nicA2mut152, nicA2mut155, nicA2mut158, nicA2mut160, nicA2mut163, nicA2mut167, nicA2mut169, nicA2mut173, nicA2mut174, nicA2mut175, nicA2mut177, nicA2mut179, nicA2mut180, nicA2mut183, nicA2mut189, nicA2mut191, nicA2mut192, nicA2mut194, nicA2mut198, nicA2mut201, nicA2mut202, nicA2mut204, nicA2mut208, nicA2mut210, nicA2mut214, nicA2mut216, nicA2mut217, nicA2mut219, nicA2mut220, nicA2mut223, nicA2mut228, nicA2mut229, nicA2mut232, nicA2mut233, nicA2mut234, nicA2mut237, nicA2mut239, nicA2mut240, nicA2mut2B5, nicA2mut2D5, nicA2mut2D9, nicA2mut2E3, nicA2mut2E4, nicA2mut2F2, nicA2mut2H3, nicA2mut244, nicA2mut245, nicA2mut249, nicA2mut253, nicA2mut254, nicA2mut255, nicA2mut260, nicA2mut302, nicA2mut303, nicA2mut304, nicA2mut305, nicA2mut306, nicA2mut307, nicA2mut313, nicA2mut314, nicA2mut315, nicA2mut320, nicA2mut321, nicA2mut323, nicA2mut324, nicA2mut325, nicA2mut326, or nicA2mut329.
25. A vector comprising the polynucleotide of claim 18.
26. A host cell comprising the polynucleotide of claim 18.
27. A pharmaceutical formulation comprising the NicA2 nicotine oxidoreductase variant of any one of claims 1-8 and a pharmaceutically acceptable excipient.
28. A pharmaceutical formulation comprising the polynucleotide of claim 18 and a pharmaceutically acceptable excipient.
29. The pharmaceutical formulation of claim 27 further comprising a CycN cytochrome c protein.
30. The pharmaceutical formulation of claim 27 wherein the formulation is contained in an epidermal patch, a liposome, a micelle, an implant, or a nanoparticle.
31. A method of identifying a nicotine oxidoreductase (NicA2) variant using O.sub.2 as an electron acceptor comprising: (a) culturing a host cell comprising a mutagenized coding region for NicA2 on medium comprising at least 1 mg/mL nicotine; and (b) identifying the mutagenized coding region for NicA2 in a host cell able to grow on the medium as encoding a nicotine oxidoreductase variant using O.sub.2 as an electron acceptor.
32. The method of claim 31 wherein the coding region for NicA2 is mutagenized prior to introduction into the host cell.
33. The method of claim 31 wherein the coding region for NicA2 is nicA2.
34. The method of claim 31 wherein the mutagenized coding region for NicA2 is subjected to at least one more iteration of the method of claim 32.
35. The method of claim 31 wherein the host cell is Escherichia coli or Pseudomonas putida S16.
36. The method of claim 35 wherein the host cell is Pseudomonas putida S16 comprising the partial genotype of ΔnicA2 ΔcycN or ΔcycN alone.
37. The method of claim 31 wherein the host cell comprises a coding region for either an iNicSnFR3a nicotine biosensor or an iNicSnFR3b nicotine biosensor, further wherein the host cell culture is subjected to fluorescence-activated cell sorting, further wherein the host cell comprising the coding region for the NicA2 variant using O.sub.2 as electron acceptor is identified if the fluorescence level is lower than a control.
38. The method of claim 37 wherein the control is a host cell comprising a coding region for wild-type NicA2 and a coding region for either an iNicSnFR3a nicotine biosensor or an iNicSnFR3b nicotine biosensor.
39. A method of reducing nicotine dependence in a subject comprising administering a therapeutically effective amount of (a) a composition comprising a NicA2 nicotine oxidoreductase variant comprising fewer than 10 amino acid substitutions, additions, or deletions from the amino acid sequence set forth in SEQ ID NO:131 and an excipient; or (b) a composition comprising a nicotine oxidoreductase, a cytochrome c protein, and an excipient.
40. The method of claim 39 wherein the nicotine oxidoreductase is wild-type NicA2 nicotine oxidoreductase.
41. The method of claim 39 wherein the cytochrome c protein is the CycN cytochrome c protein.
42. The method of claim 39 wherein the subject is a current smoker of a tobacco product or a former smoker of a tobacco product at risk of relapse.
43. The method of claim 39 wherein the composition is contained in an epidermal patch, a liposome, a micelle, an implant, or a nanoparticle.
44. A high throughput screen for a NicA2 nicotine oxidoreductase variant using O.sub.2 as electron acceptor comprising: (a) contacting a plurality of NicA2 nicotine oxidoreductase mutants with nicotine, 10-acetyl-3,7-dihydroxyphenoxazine, and horseradish peroxidase; (b) measuring the production of H.sub.2O.sub.2 by each variant; and (c) identifying a NicA2 nicotine oxidoreductase variant as using O.sub.2 as electron acceptor if the level of H.sub.2O.sub.2 produced is greater than the H.sub.2O.sub.2 produced by a control.
45. The method of claim 44 wherein the control is the wild-type NicA2 nicotine oxidase of SEQ ID NO:131.
Description
BRIEF DESCRIPTION OF THE DRAWING
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
DETAILED DESCRIPTION
[0048] Disclosed herein are products and methods useful in providing enzyme-based therapies to treat nicotine dependence. The disclosure provides methods to obtain nicotine oxidoreductase variants that oxidize nicotine by transferring electrons to O.sub.2 rather than the NicA2 cytochrome c protein and methods to obtain such variants, as well as L-6-hydroxynicotine oxidase variants that transfer electrons to O.sub.2 from nicotine rather than the natural substrate of L-6-hydroxynicotine, and methods to obtain such L-6-hydroxynicotine oxidase variants. Also disclosed are screening methods for such variants, the substantial number of such variants obtained from such screening, and methods of administering the variants to treat nicotine dependence. In addition, the disclosure provides methods of treating nicotine dependence comprising administering a nicotine oxidoreductase variant, such as a NicA2 nicotine oxidoreductase variant, e.g., one of the approximately 110 variants disclosed herein, or a catalytically active fragment thereof, to a patient in need, such as a current smoker or an individual at risk of becoming a smoker of a nicotine-containing product such as tobacco. Analogous treatment methods provide for the administration of a therapeutically effective amount of an L-6-hydroxynicotine oxidase variant, or catalytically active fragment thereof, to such a patient in need. Another treatment method provided by the disclosure is a method of treating nicotine dependence by administering a therapeutically effective amount of a pharmaceutical composition comprising a nicotine oxidoreductase, such as NicA2 nicotine oxidoreductase, and a CycN cytochrome c protein to such a patient in need. In some embodiments, the nicotine oxidoreductase and CycN cytochrome c protein are present in the pharmaceutical composition as a fusion protein.
[0049] The disclosure discloses and contemplates nicotine oxidoreductase variants such as NicA2 nicotine oxidoreductase variants, or catalytically active fragments thereof, that are at least 90%, 95%, 97%, 98%, 99%, or 99.5% identical to the corresponding region of the wild-type NicA2 nicotine oxidoreductase (SEQ ID NO:131). In like manner, L-6-hydroxynicotine oxidase variants according to the disclosure are at least 90%, 95%, 97%, 98%, 99%, or 99.5% identical to the corresponding region of the wild-type L-6-hydroxynicotine oxidase (SEQ ID NO:13). Similarly, polynucleotides encoding nicotine oxidoreductase variants, such as NicA2 nicotine oxidoreductase variants, of the disclosure are at least 90%, 95%, 97%, 98%, 99%, or 99.5% identical to the corresponding region of the polynucleotide encoding the wild-type nicotine oxidoreductase, such as polynucleotides of SEQ ID NO:12 or SEQ ID NO:16, and polynucleotides encoding L-6-hydroxynicotine oxidase variants of the disclosure are at least 90%, 95%, 97%, 98%, 99%, or 99.5% identical to the corresponding region of the polynucleotide encoding the wild-type L-6-hydroxynicotine oxidase, such as polynucleotides of SEQ ID NO:14 or SEQ ID NO:17.
[0050] The percent identity (i.e., percent homology) between a variant amino acid sequence and the wild-type amino acid sequence is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. Analogously, the percent identity of two polynucleotide sequences is a function of the number of identical positions share by the two polynucleotide sequences. For catalytically active fragments of nicotine oxidoreductase variants or L-6-hydroxynicotine oxidase variants, or their encoding polynucleotides, the percent identities reflect a comparison of the sequence of the fragment to the portion of the wild-type molecule that corresponds to the fragment. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm, as described below.
[0051] The percent identity between two nucleotide sequences can be determined using any algorithm known in the art, such as the GAP program in the GCG software package, using a NWSgapdna. CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6. The percent identity between two polynucleotide or amino acid sequences can also be determined using the algorithm of Meyers et al. (CABIOS, 4:11 17 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. In addition, the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J. Mol. Biol. (48):444 453 (1970)) algorithm, which has been incorporated into the GAP program in the GCG software package, using either a Blosum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
[0052] In developing the aforementioned aspects of the disclosure, we understood that enzymes almost always function in catalytic quantities and we reasoned that the NicA2 nicotine oxidoreductase needed to perform much better than seen in in vitro assays of the enzyme to enable P. putida S16 to grow on nicotine. In fact, we calculated that the actual turnover number for nicotine oxidase in vivo are estimated to be at least 500-fold faster (k.sub.cat: 1/sec; see Example 1 for details of the calculation) to enable P. putida S16 to grow on nicotine with a reported doubling time of one hour..sup.39 This realization led to further investigation, which revealed that nicotine oxidoreductase (NicA2) defied the conventional wisdom that amine oxidases are oxidized by molecular oxygen. To explore the possibility that NicA2 could be a significant component of an effective treatment for nicotine dependency and for the reduction of relapse to nicotine dependency, we biochemically characterized NicA2, including discovery of its in vivo electron acceptor. In addition, we are using protein design and directed evolution to enhance the inherent capacity of NicA2 to utilize O.sub.2 as an electron acceptor or using directed evolution to enhance the inherent capacity of 6 hydroxynicotine oxidase to degrade nicotine, followed by testing the improved variants.
[0053] NicA2 nicotine oxidoreductase belongs to the class of flavoenzymes that typically cycle their bound flavin between an oxidized and a reduced state, and require an electron acceptor to reoxidize the flavin..sup.40 Although some flavoenzymes have been shown to efficiently use oxygen as their electron acceptor, all flavin-dependent enzymes are at least slowly oxidized by molecular oxygen simply because of oxygen's strongly oxidizing redox potential. We explored the possibility that NicA2 in Pseudomonas donates its electrons not to oxygen but to a different electron acceptor. We searched for the in vivo electron acceptor of NicA2 using a biochemical approach, fractionating extracts from P. putida S16 to find proteins or small molecules that are capable of accelerating NicA2's reoxidation. We will also consider the possibility that multiple electron acceptors are involved in NicA2 reoxidation that act either sequentially or alternatively.
[0054] Flavins have the advantage of providing easily quantifiable spectroscopic signals indicating their different oxidation states. We can therefore easily monitor the oxidized form of the enzyme as it reacts with nicotine, determine the rate of that reaction, and determine if there is any product inhibition. Alternatively, we can watch the reduced enzyme react with oxygen or other electron acceptors, and determine the rates of these reactions. The simple spectroscopic assays that we developed and disclose herein allow us to monitor not just multiple turnover reoxidation reactions involving NicA2, but single turnover experiments as well. These methods are particularly useful in identifying in vivo electron acceptor(s) because the acceptor(s) should be able to rapidly react with NicA2 and thus be detectable without having to reconstruct the entire pathway.
[0055] More particularly, NicA2 receives two electrons from nicotine. In order for subsequent rounds of catalysis to continue, the two electrons retained on NicA2's FAD cofactor from nicotine oxidation must be efficiently transferred to an electron acceptor. Given NicA2's homology to flavin-dependent amine oxidases that transfer their electrons directly to O.sub.2, studies to date have assumed that O.sub.2 directly accepts the electrons from NicA2's reduced FAD.sup.9,12. However, the in vitro characterization of NicA2 using O.sub.2 as a terminal electron acceptor for the reaction revealed that NicA2 has a turnover number of 0.007 s.sup.−1 15. This turnover number is abysmally low, especially when compared with most flavin-containing amine oxidases (e.g., monoamine oxidase) that have turnover numbers of about 10-100 s.sup.−1 38. NicA2's very poor activity as an oxidase in vitro presents a major issue in developing the enzyme into a nicotine-cessation therapy: treatment has required prohibitively high doses of NicA2 to achieve symptomatic relief of nicotine-dependent behavior in rat models—up to 70 mg/kg.sup.11—which is likely a consequence of the low catalytic activity of the enzyme.
[0056] To help understand the basis for the discrepancy between NicA2's low catalytic activity in vitro and its ability to sustain rapid growth on nicotine, we conducted a search for alternative, more efficient, electron acceptors for NicA2. In this study, we demonstrate both in vivo and in vitro that a novel cytochrome c protein, named CycN, is responsible for accepting electrons from reduced NicA2 in vivo, not O.sub.2. Our demonstration that a member of the flavin-dependent amine oxidase superfamily uses a redox cofactor other than O.sub.2 as an in vivo electron acceptor opens up new avenues for the use of NicA2 in treating nicotine dependence and leads to the expectation that other members of this enzyme superfamily use alternative physiologic electron acceptors as well.
[0057] We have demonstrated that a newly identified cytochrome c, CycN, is an effective redox partner for NicA2, whereas O.sub.2 is not. That NicA2 cannot donate its electrons efficiently to oxygen indicates that NicA2 is not an oxidase as was previously thought, but should be categorized as a dehydrogenase. This makes NicA2 a notable outlier within the flavin-containing amine oxidase superfamily. We found that hydride transfer between nicotine and NicA2's FAD in the reductive half reaction occurs rapidly. This is followed by two subsequent kinetic events that may correspond to hydrolysis of N-methylmyosmine and release of the final product, pseudooxynicotine. Re-oxidation of NicA2's FADH.sub.2 by CycN in the oxidative half reaction must occur in a sequence of two electron transfer reactions, given that each molecule of CycN receives only one electron. Based on our data, electron transfer to the first CycN appears to be rate-limited by the interaction between NicA2-Fl.sub.red and CycN.sub.ox, whereas transfer of the electron to the second CycN.sub.ox seems to be limited by dissociation of the first CycN. These points are summarized in the kinetic mechanism shown in
[0058] The discovery that NicA2 is a dehydrogenase that uses CycN as an electron acceptor raised a number of interesting questions about the mechanism by which NicA2 discriminates between CycN and O.sub.2. NicA2 appears to be specific for CycN because bovine cytochrome c is a poor recipient of electrons from NicA2 containing reduced flavin, indicating that CycN contains structural features that either optimize the reactivity of its heme cofactor and/or are important for binding to NicA2. The published structures for NicA2, however, show that the isoalloxazine (the redox active portion) of NicA2's FAD cofactor is buried within the core of the protein, at least 10 Å away from the surface of the protein. Can one-electron transfers between the isoalloxazine of NicA2 and the heme of CycN span this distance, or are major conformational changes and/or radical relay networks required for electron transfer between these two redox centers to occur? NicA2's poor reactivity with O.sub.2 is even more difficult to rationalize based on the published structures, as NicA2's FAD binding site is very similar to that in a closely homologous protein that reacts rapidly with O.sub.2, 6-hydroxy-L-nicotine oxidase (6HLNO) (
[0059] Microorganisms are astonishingly versatile in their ability to thrive in conditions with only minimal nutrients. In such limiting conditions, they find ways to obtain energy and nutrients from surprising sources. For P. putida S16, CycN provides an illustration of one such adaptation. Rather than transferring electrons derived from nicotine from NicA2 directly to O.sub.2, which would simultaneously waste valuable reducing equivalents and create reactive oxygen species like H.sub.2O.sub.2, electrons are shuttled from NicA2 to CycN instead. However, cytochrome c proteins are not known as terminal electron acceptors. Thus, the electrons obtained by CycN from nicotine oxidation must then be passed to another electron acceptor to enable continued turnover by NicA2. Where these electrons are transferred, and their eventual fate, is unknown. Other Pseudomonas subspecies conduct aerobic respiration through an electron transport chain.sup.23,24, and P. putida S16 seems to contain the same machinery (
[0060] NicA2 has been investigated as a potential intravenous medication for treating nicotine dependence in rats.sup.10,11, but a prohibitively large amount of protein has been required to achieve effective treatment—at least 10 mg/kg daily.sup.11, considerably more than is feasible for injection into humans. The average adult weighs 62 kg. This would necessitate daily injections of more than a half a gram of protein, which is an exorbitant amount. For this reason, there is interest in generating a NicA2 variant with increased in vitro turnover rate with nicotine. One avenue for enhancing therapeutic nicotine turnover resulting from our work may be to co-administer CycN alongside NicA2. Another option would be to engineer the enzyme to enhance its ability to use O.sub.2 as an electron acceptor. This may be possible given that NicA2 belongs to an enzyme family where most members react rapidly with O.sub.2, and the data disclosed herein relating to the large number of such variants obtained to date, realizes that possibility. The aforementioned medium-throughput screen of NicA2 variants attempted to do just that.sup.12. Performing site-saturation mutagenesis of the active site of NicA2, Thisted et al. discovered a number of mutations that allowed for an increased turnover rate of nicotine with oxygen as the electron acceptor..sup.12 Their best variant provided 19 times the activity of wild-type. This is a modest increase given that NicA2 can re-oxidize at more than 45,000 times the rate of re-oxidation with O.sub.2 when provided its physiologic electron acceptor, and indicates that activity with O.sub.2 could be further improved.
[0061] The disclosed subject matter will be better understood by referring to the following Examples.
EXAMPLES
Example 1
[0062] Materials and Methods
[0063] Strains and Culture Conditions
[0064] Pseudomonas putida S16 was obtained from ATCC. Culture was performed in lysogeny (i.e., Luria Bertani) broth (LB) media unless otherwise specified. M9-nicotine media was made with the following: 6 g/L Na.sub.2HPO.sub.4, 3 g/L KH.sub.2PO.sub.4, 1 mM Mg SO.sub.4, 0.1 mM CaCl.sub.2), 1 μg/mL thiamine, and 1 g/L nicotine. M9-nicotine agar was made with the same recipe, with an additional 15 g/L bacto-agar (Thermo Fisher Scientific). All liquid cultures were inoculated from single colonies struck out onto selective media. Escherichia coli BL21 (DE3) was used for protein expression. Protein expression media (PEM) contains 12 g L.sup.−1 tryptone, 24 g L.sup.−1 yeast extract, 50.4 g L.sup.−1 glycerol, 2.13 g L.sup.−1 K.sub.2HPO.sub.4, and 12.54 g L.sup.−1 KH.sub.2PO.sub.4.
[0065] Construction of Vectors
[0066] Standard cloning techniques were used. pEC86 helper vector was obtained from the Culture Collection of Switzerland. pJN105 vector was obtained as a gift from Ute Römling (Karolinska Institute). Genes codon optimized for expression in E. coli were purchased from Genscript for cycN and nicA2 and cloned via restriction digest into pET28a, pJN105, or pET22b vectors. The nicA2 gene, including its N-terminal signal sequence, was cloned into pET28a containing an N-terminal His-SUMO tag. For the complementation experiments, full-length cycN, including its native signal sequence, was cloned into pJN105. For protein expression and purification, the sequence for mature cycN lacking its signal sequence was cloned downstream of the pelB leader sequence in pET22b.
[0067] Estimating NicA2 Turnover Rate In Vivo
[0068] When grown on nicotine as its sole carbon and nitrogen source, P. putida S16 obtains nearly all of its biomass from this metabolite. Using the known values for doubling time, bacterial mass, and the amount of nicotine that must be turned over to sustain growth, we can estimate the minimal nicotine turnover rate for NicA2. A single bacterium's carbon and nitrogen content has a mass of about 0.3 pg, P. putida S16 doubles in about 90 minutes when grown on nicotine.sup.7, and nicotine has a molecular weight of 162 g mol.sup.−1. Therefore, each bacterium must turn over 2×10.sup.−15 mol of nicotine to double its mass. Assuming that NicA2 accounts for no more than 5% of total cell mass, there can be no more than 2.8×10.sup.−19 mol of NicA2 expressed for a single cell. We thus estimate the NicA2 in vivo turnover rate as 2×10.sup.−15 mol nicotine degraded by 2.8×10.sup.−19 mol NicA2 in 90 minutes, resulting in a turnover rate of about 1.3 s.sup.−1.
[0069] NicA2 Expression and Purification
[0070] The pET28a-based expression vector for NicA2 was transformed into E. coli BL21 (DE3) cells and grown in 4 L PEM at 37° C. with shaking to an OD.sub.600 of 1.0. The temperature was then lowered to 20° C. and expression was induced with 100 μM IPTG. The culture was grown overnight at 20° C. After harvesting, the cells were lysed at 4° C. by sonication in 50 mM Tris HCl, 400 mM NaCl, 15 mM imidazole, 10% glycerol, pH 8.0 (lysis buffer) with DNase I and cOmplete™ protease inhibitor cocktail. The lysate was cleared by centrifugation and the supernatant was loaded on three 5 mL HisTrap columns pre-equilibrated in lysis buffer. The columns were washed with 20 mL lysis buffer, then 20 mL lysis buffer+20 mM imidazole, and NicA2 was then eluted in lysis buffer+0.5 M imidazole. NicA2 was then exchanged into 40 mM Tris-HCl, pH 8+0.25 M NaCl in the presence of Ubiquitin-like-specific protease 1 (ULP1) to cleave off the His-SUMO tag and subsequently passed over the HisTrap column again in 25 mM Tris HCl, pH 8+0.2 M NaCl to remove the His-SUMO tag. Protein was then exchanged into 25 mM Tris pH 8.5 and loaded onto three 5 mL HiTrap Q columns equilibrated with the same buffer. NicA2 was eluted by salt gradient using 25 mM Tris pH 8.5+1 M NaCl. Fractions containing NicA2 were concentrated, then run over a HiLoad Superdex 200 column in 40 mM HEPES 100 mM NaCl pH 7.4. Purified protein was concentrated and flash frozen, then stored at −80° C. until use.
[0071] CycN Expression and Purification
[0072] The methods in enzymology subsection of the cited Londer reference, which describes the expression and purification of cytochromes c, was followed.sup.56. Antibiotic selection was maintained with chloramphenicol 17 μg mL.sup.−1 and ampicillin 50 μg mL.sup.−1 throughout. All incubations were performed at 30° C. E. coli BL21 (DE3) cells were transformed with both pEC86 helper vector and pET22b-cycN for periplasmic expression. A single colony of the resulting transformation was inoculated into overnight culture, then subcultured into 3L PEM and incubated at 200 rpm. Cultures were grown to a density of OD 0.6-0.8, then induced with 10 μM IPTG. Cells were left to express overnight for 18-22 hours. Red pellets were visible after spinning down at 4,000 g for 20 minutes.
[0073] Pellets were immediately resuspended for periplasmic extraction by osmotic shock in ice-cold osmotic shock buffer (0.5 M sucrose, 0.2 M Tris HCl, pH 8.0, and 0.5 mM EDTA), 50 mL buffer per L of culture. 33 mL ice-cold water was added after resuspension, and the resulting mixture was incubated on ice with gentle shaking for 2 hours. Suspensions were spun down at 12,000 g for 20 minutes, and the red supernatant saved. These supernatants were dialyzed against 4 L of 30 mM sodium citrate+38 mM Na.sub.2HPO.sub.4 pH 4.0 overnight, then dialyzed into an additional 4 L of 25 mM NaH.sub.2PO.sub.4 at pH 4.0. The next day, samples were loaded onto a HiTrap SP HP cation exchange column (GE Life Sciences) equilibrated in the same buffer, and eluted against 25 mM NaH.sub.2PO.sub.4, pH 4.0+1 M NaCl in a salt gradient. Final cleanup was performed by running over a HiLoad Superdex 75 size exclusion column equilibrated in 40 mM HEPES 100 mM NaCl pH 7.4. Purified protein was flash frozen and stored at −80° C. until use.
[0074] Construction of Mutant Libraries
[0075] The nucleotide sequence of nicA2 codon optimized for E. coli was used as the substrate for an error-prone PCR reaction using the commercially available Genemorph II kit. In this process, nucleotide mutations are dispersed randomly along the coding sequence of nicA2 over the course of a polymerase chain reaction (PCR). The product of this PCR is a mixture of nicA2 derived genes with a variety of different mutations. These mutant libraries were cloned into the plasmid backbone pJN105 using standard molecular biology techniques for expression in Pseudomonas putida S16. Additionally, mutant libraries were purchased already cloned into pJN105 from GENEWIZ (South Plainfield, N.J.).
[0076] Selection of Mutant Libraries
[0077] The pJN105-nicA2 mutant libraries constructed above were transformed into Pseudomonas putida S16 ΔcycN via electroporation. The resulting transformants were plated onto M9 agarose plates with nicotine as the sole carbon source, or inoculated into M9 liquid media with nicotine as the sole carbon source, to enrich for nicA2 mutants with increased oxygen-dependent nicotine degrading activity. Clones isolated from this selection were inoculated into LB medium supplemented with gentamycin, and their respective pJN105-nicA2 plasmids were isolated. These plasmids were subjected to Sanger sequencing to determine the nucleotide sequences of nicA2 variants with increased oxygen-dependent activity. The amino acid sequences of the encoded NicA2 protein variants were inferred from the encoding polynucleotide sequences.
[0078] Generation of cycN Knockout
[0079] A cycN knockout was generated by two-step allelic exchange according to the protocol established by Hmelo et al..sup.18 Briefly, PCR of P. putida S16 genomic DNA was used to amplify regions upstream and downstream of cycN using the listed primers (Table 1) for “up” and “down” fragments, partially including the start and end of the gene. An additional PCR reaction assembled the fragments together, creating a substrate for homologous recombination against the P. putida S16 genome. This was cloned into pEX18-Gm vector by restriction digest. Upon recombining, the P. putida S16 homologous fragment inserts next to the cycN gene along with the pEX18-Gm sequence containing a gentamycin marker and sacB marker for sucrose counterselection. pEX18-Gm cannot replicate in P. putida S16, and gentamycin resistance can only be passed on in this strain by genomic integration. Therefore, by first selecting for gentamycin resistance, we generate clones with the integrated genomic marker. Then, counterselecting by plating onto sucrose afterward, we select for clones that undergo a secondary recombination event, removing remaining pEX18-Gm sequence with sacB and the majority of cycN coding sequence, resulting in a scarless knockout. pEX18-Gm was electroporated into the mating strain E. coli S17. Both E. coli S17 and P. putida S16 strains were grown at 30° C. until an OD.sub.600 of 1.0 was reached, at which point 5 mL of culture was spun down and resuspended in 1 mL LB. An equal mixture of each strain, 200 μL each, was then spotted onto an LB agar plate for mating overnight at 30° C. The next day, the spot was scraped and washed three times with 1 mL 150 mM NaCl. The resulting washed cells were resuspended in 500 μL 150 mM NaCl, and serial dilutions were plated on M9 salts+0.4% glucose+25 μg mL.sup.−1 gentamycin plates for selection of Pseudomonas with genomic integration of antibiotic marker. This resulted in more than 100 colonies, 8 of which were re-streaked onto 20% sucrose no-salt LB agar for secondary selection. This resulted in many single colonies, 16 of which were chosen for colony PCR screening using the listed verification primers (see Table 1—Primers), identifying which colonies successfully lost cycN by elimination through recombination. Three colonies appeared positive by size of PCR band; these were then gel extracted and submitted for Sanger sequencing, confirming the location and fidelity of knockouts.
TABLE-US-00001 TABLE 1 Primers SEQ ID Name Sequence NO CycN_del_ TCCTCTAACTGAAACTT 1 down_F TTGAAAG CycN_del_ ATCCGGGGATCCGCTCT 2 down_R TTTGACATTATCCTCTG CycN_del_ ATCCGGGAATTCGTTCATG 3 up_F TTAAGCAGAATCTCG CycN_del_ CTTTCAAAAGTTTCAGTTA 4 up_R GAGGACGCTTGTTTCATTT TTTATCCTC CycN_ GATTCATCAAAGAGGGGCAG 5 verify_F CycN_ GTATTCGTTACAGGCAGAGC 6 verify_R
[0080] Phenotyping Wild-Type, Knockout, and Complemented P. putida S16
[0081] Single colonies of each strain grown from LB agar plates were streaked onto M9 salts+1 mg mL.sup.−1 nicotine plates to examine for growth. Only the wild type (WT) grew well on these plates. WT and ΔcycN strains were grown overnight in LB media and electroporated with pJN105 empty vector and pJN105-cycN for the complementation assay. These were plated onto LB+25 μg mL.sup.−1 gentamycin selection plates. Single colonies from these plates were then streaked onto fresh plates containing M9 salts+1 mg mL.sup.−1 nicotine, additionally supplemented with 25 μg mL.sup.−1 gentamycin and 0.01% arabinose to observe for growth at 30° C. for 2-5 days. To increase the stringency of the selection lower levels of arabinose were used. We also were able to perform the selection in liquid culture contained in a bioreactor.
[0082] In Vitro Assays
[0083] The buffer used in all in vitro experiments was 40 mM HEPES-KOH, pH 7.5, 100 mM NaCl, 10% glycerol. NicA2 is in its fully oxidized form under ambient conditions in the absence of nicotine. The absorbance spectrum of oxidized FAD was used to determine the concentration of NicA2, using an extinction coefficient of 11,300 M.sup.−1 cm.sup.−1 at 450 nm. 20 μM NicA2 was combined with 40 μM nicotine and rapidly transferred to an absorbance cuvette to measure reduction of NicA2 under ambient conditions.
[0084] CycN was fully oxidized by addition of 5 mM ferricyanide. Excess ferricyanide was then exchanged out of the sample by running over a PD-10 desalting column before use. Concentrations of CycN were determined using the extinction coefficient of oxidized cytochrome c at 410 nm (101,600 M.sup.−1 cm.sup.−1). NicA2 and CycN were observed for characteristic spectrophotometric changes in a Shimadzu UV-1900 UV-VIS spectrophotometer. 3.75 μM CycN was combined with either 100 μM nicotine alone, 30 nM NicA2 alone, or both together and monitored for change between 250-600 nm. The same assay was performed with bovine cytochrome c (Sigma-Aldrich), except that the concentration of bovine cytochrome c was 6.84 μM. The bovine cytochrome c assay was monitored for change in absorbance in the same region (250-600 nm) for 15 minutes. Oxidized CycN was additionally titrated with increasing amounts of sodium dithionite to achieve a fully reduced state, with absorbance scans taken at each titration step.
[0085] Nicotine Degradation Assay
[0086] This assay was performed to determine both the amount of nicotine degraded and the concentration of NicA2 enzyme in cultures of P. putida S16 grown in the presence of nicotine. Both wild-type and ΔcycN strains were grown overnight in LB. The next day, these cultures were diluted to OD 0.1 in 5 mL M9 salts+0.4% glycerol and allowed to grow for 2 hours. At this time point, nicotine was added to a final concentration of 1 mg mL.sup.−1 in each sample. The point of nicotine addiction was considered time=0. From then on, the cultures were sampled at 2, 4, 8, 24, and 49 hours. 200 μL of culture was extracted at each time point and spun down at 16,000 g for 10 minutes. The supernatant was isolated, and 100 μL supernatant was mixed with 300 μL methanol to prepare HPLC samples. The cell pellet was resuspended in 100 μL Bacterial Protein Extraction Reagent (B-PER; Thermo Fisher) and allowed to incubate at room temperature for 15 minutes to complete lysis. After this time had elapsed, 25 μL of 5× reducing gel loading buffer was added to each sample.
[0087] Samples for HPLC were further clarified by spinning at 16,000 g for 30 minutes. 100 μL of each clarified sample was placed into autosampler vials. These were injected, then separated, for analysis using a Vydac C18 4.6×250 mm column (Catalog: 218TP54) and an isocratic water+0.1% TFA mobile phase. A nicotine standard concentration gradient from 10 mM down to 1 μM was run. 10 μL of standards and experimental samples were injected for analysis. Samples and standards were within the linear range of detection, and the absorbance peaks were integrated for quantification.
[0088] Samples for western blot analysis were boiled for 5 minutes. Protein standards of purified NicA2 were prepared at known concentrations from 1 μM to 1 nM. 10 μL of each sample and standard were loaded onto a Bio-Rad 12% SDS-reducing gel and run at 150 V until completion. The gel was transferred to nitrocellulose blot via the Trans-Blot Turbo system (Bio-Rad). Blots were blocked in 5% milk TBST and stained with 1:10,000 rabbit-derived NicA2 antisera (Pacific Immunology) overnight at 4° C. Blots were washed with 5% milk TBST three times, and then incubated with 1:20,000 goat anti-rabbit IR800 dye (LI-COR Biosciences) for 2 hours at room temperature. Membranes were washed with TBST and then imaged using a LI-COR Odyssey Clx. Protein bands were quantified using LI-COR Odyssey software, and the NicA2 standard curve was used to determine the linear range of detection and concentration of NicA2 at each time point from the experiment.
[0089] Transient Kinetics
[0090] All stopped-flow experiments were performed in 40 mM HEPES-KOH, pH 7.5, 100 mM NaCl, 10% glycerol at 4° C. NicA2 and CycN solutions were made anaerobic in glass tonometers by repeated cycles with vacuum and anaerobic argon.sup.42. When needed, NicA2's FAD was reduced in the anaerobic tonometer by titrating with a dithionite solution housed in a gas-tight Hamilton syringe. The dithionite solution was slowly added up to the point where NicA2's flavin reached the fully-reduced hydroquinone state, and the redox status of the flavin was spectrophotometrically monitored during the titration using a Shimadzu UV-1900 UV-VIS spectrophotometer. Nicotine-containing buffer solutions were made anaerobic by sparging for at least 10 minutes with anaerobic argon. Buffer containing O.sub.2 at specific concentrations was prepared by sparging different O.sub.2/N2 gas ratios through buffer in a gas-tight syringe for at least 15 minutes at room temperature. The various O.sub.2/N2 gas ratios were prepared from O.sub.2 and N2 gas cylinders using a Maxtec MaxBlend 2 gas mixer, and the dissolved O.sub.2 concentration in the buffer solution was calculated using a Henry's law constant for O.sub.2 of 770 atm M.sup.−1.
[0091] Stopped-flow experiments were conducted using a TgK Scientific SF-61 DX2 KinetAsyst stopped-flow instrument that had been previously equilibrated with a glucose/glucose oxidase solution to make the internal components of the system anaerobic. About 30 μM NicA2 (concentration before mixing) was loaded onto the instrument and mixed with substrate (nicotine, O.sub.2, or CycN) at a range of concentrations. The reaction of NicA2-Fl.sub.red with O.sub.2 was monitored using the instrument's multi-wavelength CCD detector (1.6 ms data interval time). The single wavelength detector was used for the reaction of NicA2-Fl.sub.ox with nicotine because the first phase in the reaction was too fast to get sufficient data coverage when using the CCD detector. The reaction of NicA2-Fl.sub.red with CycN was monitored using both the CCD detector and the single wavelength detector, but only the single wavelength data were used for determining rate constants due to the superior data density of the single wavelength measurements. Kinetic traces were fit to sums of exponentials using KaleidaGraph (Synergy Software) to determine observed rate constants.
Example 2
[0092] NicA2 Reacts Poorly with O.sub.2
[0093] The flavin cofactor contained in the nicotine-degrading enzyme NicA2 provided a convenient spectrophotometric readout for NicA2's oxidation status simply by monitoring the UV-visible (UV-VIS) absorbance spectrum of this enzyme in the region of 300-500 nm′. In the absence of nicotine, NicA2 has an absorbance spectrum typical for oxidized FAD (
[0094] Like most flavin-dependent enzymes, the catalytic cycle of NicA2 can be divided up into half reactions. In the reductive half reaction, NicA2 containing oxidized FAD (NicA2-Fl.sub.ox) is reduced by reacting with nicotine to form N-methylmyosmine. In the oxidative half reaction, NicA2 containing FADH.sub.2 (NicA2-Fl.sub.red) is oxidized by reacting with O.sub.2. To quantitatively define the extent that NicA2-Fl.sub.red oxidation by O.sub.2 limits the consumption of nicotine by NicA2, we decided to examine each of these individual half reactions by performing stopped-flow experiments. We first measured the kinetics of NicA2-Fl.sub.ox reduction by nicotine in the reductive half reaction under anaerobic conditions. Reduction of NicA2-Fl.sub.ox's FAD by nicotine was extremely fast (
[0095] We next monitored the reaction of NicA2-Fl.sub.red with O.sub.2 in the oxidative half reaction via stopped-flow experiments. NicA2-Fl.sub.red was made in an anaerobic glass tonometer by titrating NicA2-Fl.sub.ox with a dithionite solution until NicA2's FAD was fully reduced to FADH.sub.2 (monitored using the absorbance spectrum of the flavin). Dithionite was used for reduction rather than nicotine to study the oxidative half reaction in the absence of any reaction products. During the dithionite titration, NicA2's FAD first populated a form with a UV-VIS spectrum resembling a neutral flavin semiquinone before reaching a spectrum consistent with the fully reduced FADH.sub.2 state (
Example 3
[0096] Identification of the NicA2 Physiologic Electron Acceptor CycN
[0097] There is an obvious discrepancy between NicA2's slow turnover in vitro when using O.sub.2 and P. putida S16's robust growth on nicotine. P. putida S16 is able to grow with a doubling time of about 90 minutes using nicotine as its sole carbon and nitrogen source.sup.7. At the established in vitro catalytic rate of NicA2 using O.sub.2.sup.10, it is impossible to accumulate enough biomass from nicotine to sustain growth at this observed doubling time. Even if 5% of P. putida S16's biomass were to be made up of the NicA2 enzyme, we calculate that this enzyme must be functioning at a catalytic rate of at least 1 s.sup.−1 in vivo to support a doubling time of 90 minutes (see Example 1, Estimating NicA2 turnover rate in vivo). This implies that NicA2 is catalyzing nicotine turnover faster in vivo than it does in vitro using O.sub.2 as an electron acceptor, which indicates that NicA2 is likely using a different electron acceptor in vivo.
[0098] While searching the published genome of P. putida S16, we noticed that just downstream of nicA2, embedded within the same regulatory operon, is a poorly annotated open reading frame (PPS_RS28240) not previously noted in papers characterizing the nicotine degradation pathway (
Example 4
[0099] P. putida S16 ΔcycN Strain is Unable to Grow on Nicotine
[0100] If CycN is indeed the physiological electron acceptor for NicA2, there should be a significant growth phenotype on nicotine for a ΔcycN strain. To test this view, we generated an in-frame deletion of cycN in P. putida S16 and assessed this deletion for its ability to grow on nicotine.sup.18. Both the ΔcycN and wild-type (WT) strains grew similarly well on rich media (LB agar). When plated onto M9 salts agar supplemented with nicotine as the sole carbon and nitrogen source, however, there was a very clear phenotype for the ΔcycN strain (
[0101] The growth phenotype of P. putida S16 ΔcycN on nicotine indicates that CycN is important for nicotine metabolism. To support the idea that this phenotype is due to a loss of NicA2's capacity to metabolize nicotine rather than, for instance, the absence of NicA2 itself in this strain, we sought to estimate the catalytic activity of NicA2 in vivo for both WT and P. putida S16 ΔcycN. To accomplish this, we used an approach that couples high-performance liquid chromatography (HPLC) with quantitative western blotting. WT and P. putida S16 ΔcycN cultures were first grown in minimal media with glycerol as the sole carbon source, and then supplemented with nicotine. At multiple time points after adding nicotine, culture samples were subjected to western blot analysis with an anti-NicA2 antibody and analyzed by HPLC to determine the concentration of nicotine remaining. The expression of NicA2 induced by nicotine was comparable in both strains (
Example 5
[0102] CycN is Reduced by NicA2
[0103] Flavin-dependent dehydrogenases are known to transfer their electrons to a variety of small molecules and protein clients, including cytochromes c.sup.19,20. To further probe the relationship between NicA2 and CycN, we recombinantly expressed and purified both enzymes from E. coli and characterized their in vitro electron-transfer activities. Similar to how absorbance spectra provide a readout of flavin oxidation states, there are spectral signatures typically associated with the redox status for heme in cytochrome c as well.sup.21. We used these spectral differences as a readout to determine if NicA2 can transfer electrons from nicotine to CycN. Upon incubation of oxidized CycN with excess nicotine and a catalytic amount of NicA2, we observed a characteristic increase and shift of Soret banding pattern was observed, which indicated that CycN had become reduced (
Example 6
[0104] NicA2-Fl.sub.red is Rapidly Reoxidized by CycN
[0105] We next wanted to measure how fast electrons are transferred from NicA2-Fl.sub.red to oxidized CycN (CycN.sub.ox) in vitro. To determine this, we performed stopped-flow experiments by anaerobically mixing 15 μM NicA2-Fl.sub.red with an excess of CycN.sub.ox and monitored the changes in absorbance over time using the instrument's multi-wavelength detector. Electron transfer between NicA2-Fl.sub.red and CycN.sub.ox appeared to be very rapid, being complete in under one second. The absorbance changes were dominated by the signals associated with reduction of CycN.sub.ox's heme from the Fe.sup.3+ to the Fe.sup.2+ state (CycN.sub.red) (
[0106] The stopped-flow traces at 542 nm using an excess of CycN.sub.ox could be fit with a double exponential function. The k.sub.obs for the first phase increased linearly with the CycN.sub.ox concentration, indicating that this phase reports on the bimolecular association of NicA2-Fl.sub.red with CycN.sub.ox. Fitting the plot to a line yielded a bimolecular rate constant for the interaction of 1.3±0.2×10.sup.6 M.sup.−1s.sup.−1. Strikingly, this is about four orders of magnitude greater than the value for the oxidation of NicA2-Fl.sub.red by O.sub.2 (which is 27 M.sup.−1s.sup.−1). The fact that this phase is bimolecular indicates that electron transfer between CycN.sub.ox and NicA2-Fl.sub.red is rate-limited by the association between the two proteins; electron transfer between the two redox centers must therefore be extremely rapid after the complex has formed. The k.sub.obs for the second phase appeared invariant at ˜5.5 s.sup.−1 independent of the CycN.sub.ox concentration used (
Example 7
[0107] NicA2-Fl.sub.red Reacts Poorly with Bovine Cytochrome c
[0108] Our discovery that CycN is the physiological electron acceptor for NicA2 raised a question—is reactivity with NicA2 specific to CycN or will any cytochrome c perform this function? Bovine mitochondrial cytochrome c (43% sequence identity to CycN), a commonly used model protein for studying the function of the electron transport chain, was tested as an electron acceptor for NicA2. The bovine mitochondrial cytochrome c was not efficiently reduced by this system (
[0109] Disclosed herein is experimental evidence that NicA2 is a flavin-dependent dehydrogenase that uses CycN as its redox partner. Applying the lessons learned from NicA2 more generally, members of the flavin-dependent amine oxidase family are assumed to undergo oxidation by O.sub.2 in vivo, and typically readily re-oxidize with molecular oxygen in vitro.sup.3. Without wishing to be bound by theory, the fact that NicA2 is able to transfer electrons to a cytochrome c protein prompts reconsideration of this generalized mechanism and raises the possibility that other members of this family use alternative physiologic electron acceptors. When amine oxidases use O.sub.2 as a terminal electron acceptor, reactive oxygen species such as H.sub.2O.sub.2 or superoxide are released as a byproduct. Given the deleterious effect of these reactive oxygen species, it may be more desirable to shunt electrons down another path in vivo, as we have shown occurs with NicA2 in P. putida S16. Furthermore, just because an amine oxidase can rapidly be oxidized by O.sub.2 in vitro does not necessarily mean that it uses O.sub.2 as its electron acceptor in vivo. In this regard, there is recent evidence for the existence of one such example in mitochondria. Human monoamine oxidases (MAOs) A and B are prominent drug targets with important neuroregulatory functions. They are bound to the outer mitochondrial membrane by a transmembrane tail anchor, with different isoforms on either the cytosolic or intermembrane space leaflets.sup.26-28. The reason for this mitochondrial localization of monoamine oxidases has been an open question since their discovery. In their presumed catalytic cycle, MAOs are thought to be re-oxidized by molecular oxygen, producing H.sub.2O.sub.2 or other potentially damaging oxidants.sup.29. Recent work, however, has demonstrated that human monoamine oxidases are not creating H.sub.2O.sub.2 as previously thought, and instead seem to be transferring electrons from amine oxidation to complex IV of the electron transport chain.sup.30. Given that cytochrome c also exists in the mitochondrial intermembrane space, it may be the link facilitating electron transfer to the electron transport chain—bypassing the harmful reactive oxygen species produced when flavins are re-oxidized by O.sub.2. For this reason, it is critical to re-evaluate the mechanistic paradigm of these enzymes. MAOs are frequent targets for in vitro drug studies, and it may be that they are deprived of vital redox cofactors in these studies, inaccurately skewing the result of turnover or inhibition assays.
Example 8
[0110] NicA2 Protein Design and Directed Evolution
[0111] To increase the versatility and robustness of the disclosed technology for treating nicotine dependence and reducing relapse to nicotine dependence, protein design and directed evolution are used to modify NicA2 to yield an enzyme with improved pharmacokinetic and pharmacodynamic properties when using, e.g., O.sub.2 as an electron acceptor. This approach is expected to yield therapies that are simple and cost-effective because only the modified NicA2 needs to be administered. Moreover, such therapies are valuable in situations where administration of alternative electron acceptors such as CycN or other cytochrome c proteins are contra-indicated.
[0112] For protein design to be effective, we need to know how to manipulate the structure of the protein to alter its electron acceptor specificity. Nature frequently evolves the protein environment surrounding the flavin cofactor to tune its reactivity with oxygen and the evolutionary rules that govern this control are starting to be understood.sup.49. Nicotine oxidase, given it very low k.sub.cat with oxygen, appears to have evolved to suppress its ability to utilize oxygen as a final electron acceptor. Structural comparisons between nicotine oxidase and related enzymes will be used to understand why nicotine oxidase reacts so poorly with oxygen. For example, a simple comparison between nicotine oxidase and the structurally related L-6-hydroxynicotine oxidase (3NG7), which reacts with oxygen with a k.sub.cat of 78/sec.sup.38 (11,000 fold faster than NicA2 does), shows that a channel, which is conserved across several flavin-dependent oxidases and apparently allows oxygen access to the flavin adenine dinucleotide at the active site of 3NG7, is blocked by a lysine in nicotine oxidase (
[0113] To assist us in altering the substrate specificity of these enzymes we will use directed evolution..sup.50-54 Directed evolution has the advantage of not requiring the same detailed level of knowledge about the protein as protein design. It does, however, require a high throughput assay to rapidly screen a library of NicA2 mutants to find those that show enhanced activity in the presence of oxygen or screen through hydroxynicotine oxidase libraries to find those that can effectively utilize nicotine. To achieve this goal, we developed a genetic selection that exploits the fact that nicotine is toxic to E. coli. Libraries of engineered NicA2 or hydroxynicotine oxidase variants are transformed into E. coli and then selected for growth on a nicotine concentration where the activity of the wild-type enzyme is insufficient to allow growth. Plasmid DNA is isolated from the survivors, further mutated and, following re-transformation, subjected to second and third rounds of selection to further enhance nicotine resistance in the presence of oxygen. In addition to using nicotine toxicity as a genetic selection, NicA2 variants catalyzing the oxidation of nicotine using O.sub.2 as electron acceptor can be selected in CycN.sup.−Pseudomonas putida S16, as described in greater detail below. In some embodiments, the CycN.sup.− is a partial or complete deletion of the gene encoding CycN, while other embodiments involve at least one missense or nonsense mutation of the wild-type gene for CycN. Variants are characterized biochemically and tested in the C. elegans nicotine addiction model, as outlined below..sup.35
[0114] The nematode C. elegans is a popular genetic model for neuroscience research due to its small and well-annotated nervous system and amenability to genetic manipulation. It is known that C. elegans exhibits a variety of behavioral responses to nicotine, including acute response, adaptation, withdrawal, and sensitization..sup.47 Specifically, acute nicotine treatment stimulates locomotion. Repeated administration of nicotine sensitizes C. elegans to nicotine, and long-term treatment elicits tolerance to the drug. Nicotine-adapted worms exhibit hyperlocomotion when placed in a nicotine-free environment, a withdrawal response to nicotine. These nicotine responses require the same nicotinic acetylcholine receptors that are known to be critical for nicotine dependence in mammals. Thus, the behavioral responses induced by nicotine and the underlying molecular target of nicotine in C. elegans parallel those observed in mammals. These features, together with its short generation time, easy handling, and facile genetics make C. elegans a convenient model for studying nicotine dependence.
[0115] To test NicA2 and its variants in C. elegans, focus is placed on their effects on nicotine intoxication and withdrawal responses. NicA2 and its variants are expressed as transgenes in C. elegans and then acute nicotine responses and withdrawals are tested using standard protocols as described.sup.47 As an initial test, NicA2 is expressed in all worm tissues using the ubiquitous promotor eft-3 or sur-5. It has previously been shown that nicotine acts on a group of command interneurons to exert its effect on worm locomotion.sup.47 and references therein. Thus, the nmr-1 promoter is used to express NicA2 specifically in these command interneurons. Although nicotine can act both outside and inside the neurons, more efficient oxidation of nicotine by NicA2 may be achieved extracellularly. Therefore, a signal peptide is attached to NicA2 and the fusion is expressed as a secreted protein in worms to determine whether a secreted form works more efficiently. Alternatively, recombinant NicA2 and its variants are injected into the worm body cavity by microinjection. If the electron acceptor is a small molecule, its effect is tested by microinjection, provided in the worm media or within the bacteria used to feed the worm. Because E. coli is commonly used to feed C. elegans this opens up the possibility of using various genetically manipulated strains of E. coli that contain either small molecules or proteins. If the electron acceptor is a peptide, it can also be expressed as a transgene in the worm. Thus, a platform to test the ability of various NicA2 variants to antagonize nicotine dependence in an in vivo setting is provided. In accordance with the technology disclosed herein, a combination of classical flavin biochemistry and laboratory evolution is used to first enhance the utility of a promising nicotine dependence treatment and then to verify that it works in a worm model.
[0116] Consistent with the foregoing description, the disclosure provides materials and methods relating to NicA2 variants able to efficiently use O.sub.2 as electron acceptor and to variants of the structurally related LHNO flavin enzyme able to oxidize nicotine. The protein matrix surrounding NicA2's FAD is suppressing the innate ability of FAD to react with O.sub.2. Notably, NicA2 belongs to the monoamine oxidase structural family of flavin-dependent enzymes; members of this class of enzyme usually react very rapidly with O.sub.2, making NicA2 an anomaly among the monoamine oxidase family. For example, L-6-hydroxynicotine oxidase (LHNO), which has structural and sequence (30% identity) homology to NicA2 (
[0117] Nicotine Toxicity and Genetic Mutations as Selective Pressures
[0118] Directed evolution is a powerful means to improve enzyme function. By randomly mutating an enzyme and then selecting for improved performance.sup.62, we can exploit the principles of evolution to rapidly generate a variant of NicA2 with drastically improved O.sub.2-dependent activity. The experiments are performed using the fast-growing model organism, Escherichia coli, which permits evaluation of many variants of NicA2 for performance-enhancing mutations. We have established that nicotine is toxic to E. coli at a level of about 1 mg/mL or higher. We have also determined that pseudooxynicotine, the product from nicotine oxidation catalyzed by NicA2, is non-toxic to E. coli up to at least 5 mg/mL. This effectively makes nicotine an antibiotic against E. coli. Thus, a vector borne copy of the nicA2 coding region is mutagenized using any known technique for mutagenesis and the mutant library is transformed into E. coli, where selection is applied by culturing the transformed cells on media containing at least 1 mg/mL nicotine. NicA2 variant expression should confer resistance to nicotine toxicity that is dependent on the O.sub.2-dependent performance of the NicA2 variant. This nicotine toxicity towards E. coli provides a selection to identify NicA2 variants with enhanced nicotine oxidase activity. Identification of these variants is expected to reveal the molecular determinants of wild-type NicA2's low O.sub.2-dependent activity.
[0119] In addition to performing a selection in E. coli based on toxicity of nicotine to this organism, we can also use a genetically modified P. putida S16 ΔnicA2 ΔcycN or ΔcycN alone strain to accomplish selection of O.sub.2-utilizing nicA2 variants. When P. putida S16 ΔnicA2 ΔcycN or ΔcycN alone is grown on media containing nicotine as its sole carbon and/or nitrogen source, growth is directly limited by the ability of the organism to degrade nicotine. Upon transforming this strain with a vector-borne copy of nicA2, the organism may grow only as quickly as reaction of NicA2 with O.sub.2 allows, as CycN is not available in the knockout strain to accept electrons from nicotine oxidation. Wild-type nicA2 results in very slow growth (
[0120] Another strategy for developing nicotine cessation therapeutics employs a directed evolution approach to enhance the capacity of L-6-hydroxynicotine oxidase to use nicotine as a substrate, using similar selections. Mutagenesis of a coding region for LHNO followed by transformation into E. coli or P. putida S16 ΔnicA2 ΔcycN or ΔcycN alone and selection on nicotine medium is expected to result in LHNO variants able to oxidize nicotine using O.sub.2, the native electron acceptor for LHNO-catalyzed redox reactions.
[0121] As disclosed above, the poor O.sub.2 reactivity of NicA2 is addressed using directed evolution from two different angles—engineering NicA2 to react better with O.sub.2 and evolving L-6-hydroxynicotine oxidase (LHNO) to use nicotine as a substrate. Both strategies are expected to generate a more potent O.sub.2-dependent nicotine-degrading enzyme useful in tobacco-cessation therapies. For NicA2, the selective pressure of nicotine toxicity on E. coli is exploited to objectively interrogate the importance of all components of the enzyme on its ability to react with O.sub.2. For LHNO, the increase in UV absorbance (e.g., absorbance at 280-300 nm) that occurs when nicotine is converted to pseudooxynicotine is used as the readout in an evolutionary screen. The screen will allow us to probe the importance of individual residues involved in substrate binding on the reactivity with O.sub.2, as nicotine binding and O.sub.2 reactivity may be inversely linked. This approach will identify how natural selection has suppressed the reactivity of NicA2's FAD with O.sub.2, even though it belongs to the monoamine oxidase structural family of enzymes that usually react rapidly with O.sub.2.
[0122] Rather than relying on potentially imperfect guidance provided by comparing structures, every component of NicA2's 445-amino-acid sequence (mature size) is evaluated for its impact on suppressing the reactivity of NicA2's FAD with O.sub.2. This requires a high-throughput assay that can be used to rapidly screen through NicA2 mutants to identify ones that react rapidly with O.sub.2. To avoid enhancing the reactivity with O.sub.2 at the expense of reacting with nicotine, the inherent toxicity of nicotine towards E. coli is used as a selective readout in order to screen through large numbers of NicA2 variants for the ability to react rapidly with both O.sub.2 and nicotine. Notably, E. coli's aerobic respiratory chain lacks a diffusible cytochrome c, instead using quinones to link the flow of electrons from dehydrogenases to terminal oxidases. This fact reduces the possibility that NicA2 variants are identified in the selection that couple nicotine oxidation to the electron transport chain instead of using O.sub.2 as the electron acceptor. The GeneMorph II Random Mutagenesis Kit (Agilent®) and passage through the XL-1 Red E. coli mutator strain (Agilent®) are used as parallel, independent strategies for generating a library of NicA2 mutants in a pBAD expression vector (Copp et al., 2014; Guzman et al., 1995). Both methods of generating random mutant libraries are embodied in commercially available kits. The library of NicA2 expression constructs is then transformed into E. coli and selected for growth on concentrations of nicotine under aerobic conditions where the wild-type enzyme is unable to detoxify the nicotine and allow for growth. Plasmids from colonies that survive are isolated and retransformed into a clean strain background to verify that the enhanced nicotine tolerance is specifically due to the NicA2 variant and not mutations in the host background. After subsequently identifying the performance-enhancing mutation(s), they are run through additional rounds of mutagenesis and selection on even higher nicotine concentrations until the most potent O.sub.2-dependent nicotine-consuming NicA2 variant is reached. Variants that confer improved nicotine resistance on E. coli are purified and characterized by stopped-flow analyses to quantitatively determine the improvement in their performance.
[0123] Evolve LHNO to Use Nicotine as a Substrate
[0124] NicA2 and LHNO, with highly similar substrates, reactions, and structures, nevertheless have drastically different rates of reacting with O.sub.2. While the amino acid environments of the FAD prosthetic groups are highly similar for the two enzymes, their substrate binding sites have a number of differences that enable them to discriminate between L-nicotine and L-6-hydroxynicotine (
[0125] A comparison of the substrate-protein interaction maps of LHNO and NicA2 reveals how LHNO may discriminate between L-6-hydroxynicotine and L-nicotine (
[0126] Additionally, if CycN is, as expected, the physiological electron acceptor, then a ΔnicA2ΔcycN double deletion strain of P. putida S16 is used as the host organism in a selection to identify NicA2 variants with improved O.sub.2-dependent activity. ΔnicA2ΔcycN P. putida S16 expressing wild-type NicA2 from a plasmid will be unable to grow, or will grow poorly because nicotine turnover should only be possible by using O.sub.2 as the electron acceptor in this strain when cultured on media containing nicotine as the sole carbon and nitrogen source. NicA2 variants expressed from the plasmid-based library with an enhanced ability to use O.sub.2 are identifiable as displaying faster growth and a correspondingly larger colony size on nicotine media plates. Another experimental strategy takes advantage of a recently developed GFP-based nicotine biosensor.sup.58. This biosensor specifically recognizes nicotine, displaying low fluorescence in the absence of nicotine and high GFP fluorescence when bound to nicotine. The library of NicA2 variants in E. coli is co-expressed with this nicotine biosensor in the presence of nicotine and then fluorescence-activated cell sorting is used to rapidly screen through the library of NicA2 expressers to identify cells with lower GFP-fluorescence, corresponding to higher nicotine oxidase activity. Yet another experimental strategy makes use of the same readout that used for enhancing the nicotine specificity of LHNO, i.e., the increase in UV absorbance that accompanies the conversion of nicotine to pseudooxynicotine. This spectrophotometric readout is used, e.g., in 96-well plate assays. To accommodate the relatively low throughput of this assay, mutagenesis libraries may be focused on targeted NicA2 residues in the active site and those that line solvent-access channels (identified using CAVER; Jurcik et al., 2018).
[0127] The experiments are expected to identify the structural features of NicA2 that are responsible for restricting its FAD's ability to react with O.sub.2. Furthermore, we expect to identify LHNO variants that are potent nicotine oxidase enzymes without compromising the ability of the wild-type enzyme to react rapidly with O.sub.2. The performance-enhanced enzyme variants overcome the limitations of previously developed enzyme-based tobacco-cessation therapies—namely, the excessively high doses of enzyme needed due to the low O.sub.2-dependent nicotine oxidase activity of the wild-type enzymes. The enzyme variants are expected to result in enzyme-based tobacco-cessation therapeutics.
Example 9
[0128] NicA2 Protein Variants
[0129] To increase the versatility and robustness of the disclosed technology for treating nicotine dependence and reducing relapse to nicotine dependence, protein design and directed evolution were used to modify NicA2 to yield an enzyme with improved pharmacokinetic and pharmacodynamic properties when using, e.g., O.sub.2 as an electron acceptor. This approach yielded therapies that are simple and cost-effective because only the modified NicA2 needs to be administered. Moreover, such therapies are valuable in situations where administration of alternative electron acceptors such as CycN or other cytochrome c proteins are contra-indicated.
[0130] For protein design to be effective, we needed to know how to manipulate the structure of the protein to alter its electron acceptor specificity. Nature frequently evolves the protein environment surrounding the flavin cofactor to tune its reactivity with oxygen and the evolutionary rules that govern this control are starting to be understood.sup.49. Nicotine oxidoreductase, given its very low k.sub.cat with oxygen, appears to have evolved to suppress its ability to utilize oxygen as a final electron acceptor. Structural comparisons between nicotine oxidoreductase and related enzymes was used to understand why nicotine oxidoreductase reacts so poorly with oxygen. For example, a simple comparison between nicotine oxidoreductase and the structurally related L-6-hydroxynicotine oxidase (3NG7), which reacts with oxygen with a k.sub.cat of 78/sec.sup.38 (11,000 fold faster than NicA2 does), showed that a channel, which is conserved across several flavin-dependent oxidases and apparently allows oxygen access to the flavin adenine dinucleotide at the active site of 3NG7, is blocked by a lysine in nicotine oxidase (
[0131] To assist us in altering the substrate specificity of this enzyme we have used directed evolution..sup.50-54 Directed evolution has the advantage of not requiring the same detailed level of knowledge about the protein as protein design. It does, however, require a high throughput assay to rapidly screen a library of NicA2 mutants to find those that show enhanced activity in the presence of oxygen. To achieve this goal, we developed a genetic selection that exploits the fact that nicotine is toxic to E. coli. Libraries of engineered NicA2 variants are transformed into E. coli and then selected for growth on a nicotine concentration where the activity of the wild-type enzyme is insufficient to allow growth. Plasmid DNA was isolated from the survivors, further mutated and, following re-transformation, subjected to second and third rounds of selection to further enhance nicotine resistance in the presence of oxygen. In addition to using nicotine toxicity as a genetic selection, NicA2 variants catalyzing the oxidation of nicotine using O.sub.2 as electron acceptor were selected in CycN.sup.− Pseudomonas putida S16, as described in greater detail below. In some embodiments, the CycN.sup.− was a partial or complete deletion of the gene encoding CycN, while other embodiments involved at least one missense or nonsense mutation of the wild-type gene for CycN. Variants were characterized biochemically.
[0132] Consistent with the foregoing description, the disclosure provides materials and methods relating to NicA2 variants able to efficiently use O.sub.2 as electron acceptor. The protein matrix surrounding NicA2's FAD is suppressing the innate ability of FAD to react with O.sub.2. Notably, NicA2 belongs to the monoamine oxidase structural family of flavin-dependent enzymes; members of this class of enzyme usually react very rapidly with O.sub.2, making NicA2 an anomaly among the monoamine oxidase family. For example, L-6-hydroxynicotine oxidase (LHNO), which has structural and sequence (30% identity) homology to NicA2 (
[0133] Nicotine Toxicity and Genetic Mutations as Selective Pressures
[0134] Directed evolution is a powerful means to improve enzyme function. By randomly mutating an enzyme and then selecting for improved performance.sup.62, we exploited the principles of evolution to rapidly generate a variant of NicA2 with drastically improved O.sub.2-dependent activity. The experiments were performed using the fast-growing model organism, Escherichia coli, which permitted evaluation of many variants of NicA2 for performance-enhancing mutations. We have established that nicotine is toxic to E. coli at a level of about 1 mg/mL or higher. We have also determined that pseudooxynicotine, the product from nicotine oxidation catalyzed by NicA2, is non-toxic to E. coli up to at least 5 mg/mL. This effectively makes nicotine an antibiotic against E. coli. Thus, a vector-borne copy of the nicA2 coding region is mutagenized using any known technique for mutagenesis and the mutant library is transformed into E. coli, where selection is applied by culturing the transformed cells on media containing at least 1 mg/mL nicotine, yielding NicA2 variants able to survive the selection, as shown by the results disclosed herein. NicA2 variant expression should confer resistance to nicotine toxicity that is dependent on the O.sub.2-dependent performance of the NicA2 variant. This nicotine toxicity towards E. coli provides a selection to identify NicA2 variants with enhanced nicotine oxidase activity. Identification of these variants is expected to reveal the molecular determinants of wild-type NicA2's low O.sub.2-dependent activity.
[0135] In addition to performing a selection in E. coli based on toxicity of nicotine to this organism, we also used a genetically modified P. putida S16 ΔnicA2 ΔcycN or ΔcycN alone strain to accomplish selection of O.sub.2-utilizing nicA2 variants. When P. putida S16 ΔnicA2 ΔcycN or ΔcycN alone was grown on media containing nicotine as its sole carbon and/or nitrogen source, growth was directly limited by the ability of the organism to degrade nicotine. Upon transforming this strain with a vector-borne copy of nicA2, the organism may grow only as quickly as reaction of NicA2 with O.sub.2 allows, as CycN is not available in the knockout strain to accept electrons from nicotine oxidation. Wild-type nicA2 resulted in very slow growth (
TABLE-US-00002 TABLE 2 NicA2 variant SEQ ID NO Amino acid substitutions (single-letter code) Nica2mut1 35 D243N.sup.1, K314Q, H368R NicA2mut5 36 W427L, A443V NicA2mut6 67 G62S, Q75H, R78G, T92S, H368R NicA2mut7 90 D130V, V147L, G156S, T267S, G411D NicA2mut8 44 R96S, D130G NicA2mut9 63 D130V, I161V, E188D NicA2mut10 77 G50D, T92I, L480P, L481A, S482E, 483L, 484I NicA2mut11 51 A107T, P177L, K292Q NicA2mut12 45 H115Y, T258A NicA2mut17 68 G29S, F104I, T223N, M265I NicA2mut19 52 C72S, L217P, V308L NicA2mut20 53 R85C, P114Q, G411D NicA2mut21 40 S37N, Q359R, H368R NicA2mut22 59 D130G, G431D, A461V NicA2mut23 75 T94A, P131S, A281T, G302A NicA2mut25 76 D130E, D224E, R351H, G431S NicA2mut31 50 Q75H, A429V NicA2mut35 89 T138I, F174I, D295V, H368Y, T455A NicA2mut36 32 T39S NicA2mut40 60 T133I, L135M, G474S NicA2mut43 41 W364C, Q442H NicA2mut45 49 Q75H NicA2mut61 48 R253S, K337M NicA2mut64 79 E172G, G338S, V390I, H460L NicA2mut65 91 S46R, A107P, V277I, I298F, E476V NicA2mut66 46 T381I, A444G NicA2mut75 34 D130N NicA2mut95 96 F63V, R96H, D130N, V277I, S379N, L480P, L481A, S482E, 483L, 484I NicA2mut96 33 H368R, L435Q NicA2mutD1 23 G145A, S192I, Q359L, Q366R, S379N NicA2mutH3 24 R96S, F104L, M120I, H368R NicA2mutH4 22 P131S, K225Q, A461V NicA2mut101 64 A45T, Q366K, I380V NicA2mut105 65 E129Q, D130N, S151I, R160H NicA2mut106 42 G287D, R351H NicA2mut112 47 A98E, D130A NicA2mut113 43 E103D, E184K NicA2mut117 78 P180L, A244V, T258A, N462S NicA2mut118 62 K137R, L217P, N457T NicA2mut119 69 S276N, K292N, K324E, R351H NicA2mut123 61 Q75H, P131S, P152S, I159V NicA2mut130 70 P131S, V277I, V282I NicA2mut136 54 G50C, R393C NicA2mut137 92 V48A, F104L, D130Y, T267I, L435Q NicA2mut138 37 S146G, H368R, V432M NicA2mut144 93 D130G, P131Q, S192N, M306V, A473V NicA2mut145 81 D130G, K157M, V173A, K191M NicA2mut146 82 R85H, P229L, R351H, R437H NicA2mut147 84 G156C, T267S, W427L NicA2mut149 31 H368R NicA2mut152 83 T267I, W427L NicA2mut155 38 D130G, S379N NicA2mut158 71 W108R, D130Y, T183I, M403I NicA2mut160 94 T39S, K157R, I161F, M246T, H368L, E373K NicA2mut163 55 L135M, H368R, L449V NicA2mut167 85 D130G, D196H, M246T, K331N NicA2mut169 72 G50A, L217P, G260A, V345L NicA2mut173 66 D130N, V303A, N311S, A395V NicA2mut174 80 T42A, R78H, D130V, K225N, F245Y NicA2mut175 39 F104L, G317D, H368R NicA2mut177 21 G145A, S192I, Q359L, Q366R, S379N NicA2mut179 86 F104L, D130G, G270C, R393C NicA2mut180 95 G156D, H168Q, K292R, K324E, R351H NicA2mut183 73 W108R, D130Y, K337M, R398L NicA2mut189 56 G333S, R351H, L424Q NicA2mut191 97 F104I, D130G, G156D, K199R, D295N, T381S NicA2mut192 87 G99D, D130V, E454D NicA2mut194 57 F174V, G260S, W427L NicA2mut198 74 E249G, H368R NicA2mut201 88 D130G, R187L, V231I, Y242N, E408D NicA2mut202 58 A45V, D130V, I388F NicA2mut204 30 A107T, D130V, I330T NicA2mut208 29 G411D, W427L NicA2mut210 28 G50D, A98S, A426T, W427L NicA2mut214 27 F104I, D130G, G156D, K199R, D295N, T381S NicA2mut216 26 R44H, F104L, V147F, G156C, G317D, H368R, I382V NicA2mut217 25 D130G, S379N NicA2mut219 118 K157R, I161F, M246T, H368R, L449V NicA2mut220 117 V48A, F104L, D130Y, M246T, H368L, E373K, L441M NicA2mut223 116 W171C, D243N, Q366R, S379N, D394N NicA2mut228 115 K314Q, H368RI, N462S NicA2mut229 114 F104I, D130G, G156D, K199R, A209T, F355L, H368Y NicA2mut232 113 F174V, G260S, H368P, W427L NicA2mut233 112 F174V, G260S, W427L NicA2mut234 111 F104L, G317D, D357E, H368R NicA2mut237 110 W108R, D130Y, T183I, G202D, S379N NicA2mut239 109 F104I, D130A NicA2mut240 108 F104L, D130G, E184G, M246T, P278S, I291V NicA2mut2B5 100 A107T, P114Q, G317D, H368R, D389E, N462S NicA2mut2D5 99 K49N, F93L, F104L, V127M, D130S, L132R, F174C, T319I, E454D NicA2mut2D9 104 T92A, F174V, E249G, A281T, I298V, F355L, H368R, E454D NicA2mut2E3 98 A107T, D130G, T267I, L335V, N462S NicA2mut2E4 101 F104I, G317D, H368R, N462S NicA2mut2F2 102 Q100H, A107T, L112Q, H115Y, H368R NicA2mut2H3 103 S12I, A107T, D130G, T267I, N462S NicA2mut244 107 G50S, F104L, A107T, D130G, G156D, S192C, F235L, G239A, A426T, L435Q NicA2mut245 106 F104L, D130G, V231I, L335V, L349M, N462S NicA2mut249 105 A69V, A107T, D130Y, K199R, P278Q, D295N, T381S NicA2mut253 119 F104L, G317D, H368R, L449V, N462S NicA2mut254 121 A107T, D130G, T267I, N462S NicA2mut255 122 F104L, G317D, H368R, L449V, N462S NicA2mut260 120 F104L, G317D, H368R, L449V, N462S, L481P, S482E, 483L, 484I NicA2mut302 123 A107T, L112M, D357E, H368R, G406D, L449V, N462S NicA2mut303 124 Y54F, V59I, F63L, A107T, V127M, D130S, L132R, F235I, T280K, G317D NicA2mut304 125 V48A, F52L, F104L, W171R, E249G, H368R, T381S, N462S NicA2mut305 126 F93L, F104L, V127M, D130S, L132R, S213T, T222S, A281T, L374M, M403I NicA2mut306 127 F93L, F104L, V127M, D130S, L132R, I198F, K331N NicA2mut307 128 F104L, A107T, S146I, G317D, H368R, L449V, N462S NicA2mut313 129 F104L, E129V, S192N, E249G, G317D, H368R, T381S, N462S NicA2mut314 132 G51S, G73S, R96S, F104L, A107T, L112M, E249G, S276C, H368R, G411S, N462S NicA2mut315 133 A107T, L112M, F235Y, G260S, A339V, Q359R, H368R, N462S NicA2mut320 134 F104L, A107T, D130S, T319I, L449V, N462S, L480P, L481A, S482E, 483L, 484I NicA2mut321 135 F104L, A107T, S146I, K191N, Q210H, G317D, H368R, L449V, N462S NicA2mut323 136 F104L, A107T, D130S, M215L, E221D, T319I, L449V, N462S NicA2mut324 137 F104L, D130N, H368R, N462S NicA2mut325 138 D130G, D296E, G317S, Q359E, S371R, S379N, T418S, L449V NicA2mut326 139 F104L, D130S, H368R, N462S NicA2mut329 140 F104L, A107T, D130S, T293S, T307P, T319I, L449V, N462S .sup.1D243N: Aspartic acid substitution for Asparagine at position 243 of NicA2.
[0136] Isolated colonies from the above selection contained variants of NicA2 with improved O.sub.2-dependent nicotine-degrading activity (
[0137] The resulting nicA2 polynucleotide variants contained the wild-type nicA2 polynucleotide sequence of SEQ ID NO:130, with single nucleotide substitutions relative to that wild-type sequence at the position(s) indicated in Table 3.
TABLE-US-00003 TABLE 3 Polynucleotide Variant Variant Nucleotides nica2mut1 G727A, A940C, A1103G nicA2mut5 G1280T, C1328T nicA2mut6 G184A, G225T, C232G, A274T, A1103G nicA2mut7 A389T, G439C, G466A, C800G, G1232A nicA2mut8 C286A, A389G nicA2mut9 A389T, A481G, A564T nicA2mut10 G149A, C275T, T1439C, G1440T, C1441G, T1442C, G1443T, A1444G, G1445A, C1446G, T1447C, A1448T, A1449A, 1450A, 1451T, 1452C nicA2mut11 G319A, C530T, A874C nicA2mut12 C343T, A772G nicA2mut17 G85A, T310A, C668A, G795A nicA2mut19 T214A, T650C, G922T nicA2mut20 C253T, C341A, G1232A nicA2mut21 G110A, A1076G, A1103G nicA2mut22 A389G, G1292A, C1382T nicA2mut23 A280G, C391T, G841A, G905C nicA2mut25 T390G, T672A, G1052A, A1291A nicA2mut31 G225T, C1286T nicA2mut35 C413T, T520A, A884T, C1102T, A1363G nicA2mut36 A115T nicA2mut40 C398T, C403A, G1420A nicA2mut43 G1092T, A1326T nicA2mut45 G225T nicA2mut61 C757A, A1010T nicA2mut64 A515G, G1012A, G1168A, A1379T nicA2mut65 A136C, G319C, G829A, A892T, A1427T nicA2mut66 C1142T, C1331G nicA2mut75 G388A nicA2mut95 T187G, G287A, G388A, G829A, G1136A, T1439C, G1440T, C1441G, T1442C, G1443T, A1444G, G1445A, C1446G, T1447C, A1448T, A1449A, 1450A, 1451T, 1452C nicA2mut96 A1103G, T1304A nicA2mutD1 G434C, G575T, A1076T, A1097G, G1136A nicA2mutH3 C286A, C312A, G360T, A1103G nicA2mutH4 C391T, A673C, C1382T nicA2mut101 G133A, C1096A, A1138G nicA2mut105 G385C, G388A, G452T, G479A nicA2mut106 G860A, G1052A nicA2mut112 C293A, A389C nicA2mut113 G309C, G550A nicA2mut117 C539T, C731T, A772G, A1385G nicA2mut118 A410G, T650C, A1370C nicA2mut119 G827A, A876C, A970G, G1052A nicA2mut123 G225T, C391T, C454T, A475G nicA2mut130 C391T, G829A, G844A nicA2mut136 G148T, C1177T nicA2mut137 T143C, T310C, G388T, C800T, T1304A nicA2mut138 A436G, A1103G, G1294A nicA2mut144 A389G, C392A, G575A, A916G, C1418T nicA2mut145 A389G, A470T, T518C, A572T nicA2mut146 G254A, C686T, G1052A, G1310A nicA2mut147 G466T, C800G, G1280T nicA2mut149 A1103G nicA2mut152 C800T, G1280T nicA2mut155 A389G, G1136A nicA2mut158 T322C, G388T, C548T, G1209C nicA2mut160 A115T, A470G, A481T, T737C, A1103C, G1117A nicA2mut163 C403A, A1103G, C1345G nicA2mut167 A389G, G586C, T737C, A993T nicA2mut169 G149C, T650C, G779C, G1033T nicA2mut173 G388A, T908G, A932G, C1184T nicA2mut174 A124G, G233A, A389T, G675C, T734A nicA2mut175 T310C, G950A, A1103G nicA2mut177 G434C, G575T, A1076T, A1097G, G1136A nicA2mut179 T310C, A389G, G808T, C1177T nicA2mut180 G467A, C504A, A875G, A970G, G1052A nicA2mut183 T322C, G388T, A1010T, G1193T nicA2mut189 G997A, G1052A, T1271A nicA2mut191 T310A, A389G, G467A, A596G, G883A, C1142G nicA2mut192 G296A, A389T, A1362T nicA2mut194 T520G, G778A, G1280T nicA2mut198 A746G, A1103G nicA2mut201 A389G, G560T, G691A, T724A, G1224T nicA2mut202 C134T, A389T, A1162T nicA2mut204 G319A, A389T, T989C nicA2mut208 G1232A, G1280T nicA2mut210 G149A, G292T, G1276A, G1280T nicA2mut214 T310A, A389G, G467A, A596G, G883A, A1141T nicA2mut216 G131A, T310C, G439T, G466T, G950A, A1103G, A1144G nicA2mut217 A389G, G1136A nicA2mut219 A470G, A481T, T737C, A1103G, C1345G nicA2mut220 T143C, T310C, G388T, T737C, A1103C, G1117A, C1321A nicA2mut223 G513C, G727A, A1097G, G1136A, G1180A nicA2mut228 A940C, A1103G, A1385G nicA2mut229 T310A, A389G, G467A, A596G, G625A, T1065A, C1102T nicA2mut232 T520G, G778A, A1103C, G1280T nicA2mut233 T520G, G778A, G1280T nicA2mut234 T310C, G950A, T1071A, A1103G nicA2mut237 T322C, G388T, C548T, G605A, G1136A nicA2mut239 T310A, A389C nicA2mut240 C312A, A389G, A551G, T737C, C832T, A871G nicA2mut2B5 G319A, C341A, G950A, A1103G, C1167A, A1385G nicA2mut2D5 A147C, T277C, T310C, G379A, G388T, A389C, T395G, T521G, C956T, A1362T nicA2mut2D9 A274G, T520G, A746G, G841A, A892G, T1065A, A1103G, A1362T nicA2mut2E3 G319A, A389G, C800T, C1003G, A1385G, C1386T nicA2mut2E4 T310A, G950A, A1103G, A1385G nicA2mut2F2 A300T, G319A, T335A, C343T, A1103G nicA2mut2H3 G35A, G319A, A389G, C800T, A1385G, C1386T nicA2mut244 G148A, T310C, G319A, A389G, G467A, A574T, T705A, G716C, G1276A, T1304A nicA2mut245 T310C, A389G, G691A, C1003G, C1045A, A1385G nicA2mut249 C206T, G319A, G388T, A596G, C833A, G883A, C1142G nicA2mut253 C312A, G950A, A1103G, C1345G, A1385G nicA2mut254 G319A, A389G, C800T, A1385G nicA2mut255 C312A, G950A, A1103G, C1345G, A1385G, C1386T nicA2mut260 T310C, G950A, A1103G, C1345G, A1385G, T1442C, G1443T, A1444G, G1445A, C1446G, T1447C, A1448T, A1449A, 1450A, 1451T, 1452C nicA2mut302 G319A, C334A, T1071A, A1103G, G1217A, C1345G, A1385G nicA2mut303 A161T, G175A, T187C, G319A, G379A, G388T, A389C, T395G, T703A, C839A, C840A, G950A, G1224T, C1262T nicA2mut304 T143C, C156A, T310C, T511C, A746G, A1103G, C1142G, A1385G nicA2mut305 T277C, T310C, G379A, G388T, A389C, T395G, G638C, A664T, G841A, C1120A, G1209C nicA2mut306 T277C, C312A, G379A, G388T, A389C, T395G, A592T, A993T nicA2mut307 T310C, G319A, G437T, G950A, A1103G, C1345G, A1385G, C1386T nicA2mut313 T310C, A386T, G575A, A746G, G950A, A1103G, A1141T, A1385G, C1386T nicA2mut314 G151A, G217A, C286A, C312A, G319A, C334A, A746G, A826T, A1103G, G1231A, A1385G nicA2mut315 G319A, C334A, F235Y, G778A, A339V, A1076G, A1103G, A1385G nicA2mut320 T310C, G319A, G388T, A389C, C956T, C1345G, A1385G, C1386T, T1439C, G1440T, C1441G, T1442C, G1443T, A1444G, G1445A, C1446G, T1447C, A1448T, A1449A, 1450A, 1451T, 1452C nicA2mut321 C312A, G319A, G437T, G573T, G630T, G950A, A1103G, C1345G, A1385G, C1386T nicA2mut323 C312A, G319A, G388T, A389C, A643T, G663T, C956T, C1345G, A1385G, C1386T nicA2mut324 C312A, G388A, A1103G, A1385G nicA2mut325 A389G, C888G, G949A, C1075G, C1113G, G1136A, A1252T, C1254A, C1345G nicA2mut326 T310C, G388T, A389C, A1103G, A1385G nicA2mut329 C312A, G319A, G388T, A389C, A877T, A919C, C956T, C1345G, A1385G, C1386T
[0138] As disclosed above, the poor O.sub.2 reactivity of NicA2 was addressed using directed evolution to engineer NicA2 to react better with O.sub.2. This strategy has generated a more potent O.sub.2-dependent nicotine-degrading enzyme useful in tobacco-cessation therapies. For NicA2, the selective pressure of nicotine toxicity on E. coli, or use of a genetically modified P. putida S16 ΔnicA2 ΔcycN strain, was exploited to objectively interrogate the importance of all components of the enzyme on its ability to react with O.sub.2. These selections have allowed us to probe the importance of individual residues involved in substrate binding on the reactivity with O.sub.2, as nicotine binding and O.sub.2 reactivity may be inversely linked. This approach has contributed to our understanding of how natural selection has suppressed the reactivity of NicA2's FAD with O.sub.2, even though it belongs to the monoamine oxidase structural family of enzymes that usually react rapidly with O.sub.2.
[0139] Rather than relying on potentially imperfect guidance provided by comparing structures, every component of NicA2's 445-amino-acid sequence (mature size) was evaluated for its impact on suppressing the reactivity of NicA2's FAD with O.sub.2. This required a high-throughput assay that was used to rapidly screen through NicA2 mutants to identify ones that react rapidly with O.sub.2. To avoid enhancing the reactivity with O.sub.2 at the expense of reacting with nicotine, the inherent toxicity of nicotine towards E. coli was used as a selective readout in order to screen through large numbers of NicA2 variants for the ability to react rapidly with both O.sub.2 and nicotine. Notably, E. coli's aerobic respiratory chain lacks a diffusible cytochrome c, instead using quinones to link the flow of electrons from dehydrogenases to terminal oxidases. This fact reduced the possibility that NicA2 variants were identified in the selection that coupled nicotine oxidation to the electron transport chain instead of using O.sub.2 as the electron acceptor. The GeneMorph II Random Mutagenesis Kit (Agilent®) and passage through the XL-1 Red E. coli mutator strain (Agilent®) were used as parallel, independent strategies for generating a library of NicA2 mutants in a pBAD expression vector (Copp et al., 2014; Guzman et al., 1995). Both methods of generating random mutant libraries are embodied in commercially available kits. The library of NicA2 expression constructs was then transformed into E. coli and selected for growth on concentrations of nicotine under aerobic conditions where the wild-type enzyme was unable to detoxify the nicotine and allow for growth. Plasmids from colonies that survived were isolated and retransformed into a clean strain background to verify that the enhanced nicotine tolerance was specifically due to the NicA2 variant and not to mutations in the host background. After subsequently identifying the performance-enhancing mutation(s), they were run through additional rounds of mutagenesis and selection on even higher nicotine concentrations until the most potent O.sub.2-dependent nicotine-consuming NicA2 variant(s) was reached. Variants that conferred improved nicotine resistance on E. coli were purified and characterized by stopped-flow analyses to quantitatively determine the improvement in their performance. The resulting variants, and the nature of the amino acid variations, are presented in Table 2 and can be confirmed by inspection of the sequences identified in Table 2 and in the sequence listing.
[0140] Additionally, if CycN is, as expected, the physiological electron acceptor, then a ΔnicA2ΔcycN double deletion or ΔcycN single deletion strain of P. putida S16 was available for use as the host organism in a selection to identify NicA2 variants with improved O.sub.2-dependent activity. ΔcycN P. putida S16 expressing wild-type NicA2 from a plasmid is unable to grow, or grows poorly because nicotine turnover should only be possible by using O.sub.2 as the electron acceptor in this strain when cultured on media containing nicotine as the sole carbon and nitrogen source. NicA2 variants expressed from the plasmid-based library with an enhanced ability to use O.sub.2 are identifiable as displaying faster growth and a correspondingly larger colony size on nicotine media plates. Another experimental strategy takes advantage of a recently developed GFP-based nicotine biosensor.sup.58. This biosensor specifically recognizes nicotine, displaying low fluorescence in the absence of nicotine and high GFP fluorescence when bound to nicotine. The library of NicA2 variants in E. coli is co-expressed with this nicotine biosensor in the presence of nicotine and then fluorescence-activated cell sorting is used to rapidly screen through the library of NicA2 expressers to identify cells with lower GFP-fluorescence, corresponding to higher nicotine oxidase activity. Yet another experimental strategy makes use of the increase in UV absorbance that accompanies the conversion of nicotine to pseudooxynicotine. This spectrophotometric readout is used, e.g., in 96-well plate assays. To accommodate the relatively low throughput of this assay, mutagenesis libraries may be focused on targeted NicA2 residues in the active site and those that line solvent-access channels (identified using CAVER; Jurcik et al., 2018).
[0141] The experiments are expected to identify the structural features of NicA2 that are responsible for restricting its FAD's ability to react with O.sub.2. The performance-enhanced enzyme variants overcome the limitations of previously developed enzyme-based tobacco-cessation therapies—namely, the excessively high doses of enzyme needed due to the low O.sub.2-dependent nicotine oxidase activity of the wild-type enzymes. The enzyme variants disclosed herein are enzyme-based tobacco-cessation therapeutics useful in methods of treating nicotine dependence or use.
REFERENCES
[0142] 1. Massey V. The Chemical and Biological Versatility of Riboflavin. Biochem Soc Trans. 2000; 28(4):283. doi:10.1042/0300-5127:0280283 [0143] 2. EI-Gebali S, Mistry J, Bateman A, et al. The Pfam protein families database in 2019. Nucleic Acids Res. 2019; 47(D1):D427-D432. doi:10.1093/nar/gky995 [0144] 3. Fitzpatrick P F. Oxidation of amines by flavoproteins. Arch Biochem Biophys. 2010; 493(1):13-25. doi:10.1016/j.abb.2009.07.019 [0145] 4. Margarita A. Tararina K N A. Bioinformatic Analysis of the Flavin-Dependent Amine Oxidase Superfamily: Adaptations for Substrate Specificity and Catalytic Diversity. Neurosci Biobehav Rev. 2020:100632. doi:10.1016/j.neubiorev.2019.07.019 [0146] 5. Binda C, Mattevi A, Edmondson D E. Structure-function relationships in flavoenzyme-dependent amine oxidations: A comparison of polyamine oxidase and monoamine oxidase. J Biol Chem. 2002; 277(27):23973-23976. doi:10.1074/jbc.R200005200 [0147] 6. Tang H, Wang L, Meng X, et al. Novel nicotine oxidoreductase-encoding gene involved in nicotine degradation by Pseudomonas putida strain S16. Appl Environ Microbiol. 2009; 75(3):772-778. doi:10.1128/AEM.02300-08 [0148] 7. Tang H, Wang L, Wang W, et al. Systematic Unraveling of the Unsolved Pathway of Nicotine Degradation in Pseudomonas. PLoS Genet. 2013; 9(10). doi:10.1371/journal.pgen.1003923 [0149] 8. Fitzpatrick P F. The enzymes of microbial nicotine metabolism. Beilstein J Org Chem. 2018; 14:2295-2307. doi:10.3762/bjoc.14.204 [0150] 9. Tararina M A, Xue S, Smith L C, et al. Crystallography Coupled with Kinetic Analysis Provides Mechanistic Underpinnings of a Nicotine-Degrading Enzyme. Biochemistry. 2018; 57(26):3741-3751. doi:10.1021/acs.biochem.8b00384 [0151] 10. Xue S, Schlosburg J E, Janda K D. A new strategy for smoking cessation: Characterization of a bacterial enzyme for the degradation of nicotine. J Am Chem Soc. 2015; 137(32):10136-10139. doi:10.1021/jacs.5b06605 [0152] 11. Pentel P R, Raleigh M D, LeSage M G, et al. The nicotine-degrading enzyme NicA2 reduces nicotine levels in blood, nicotine distribution to brain, and nicotine discrimination and reinforcement in rats. BMC Biotechnol. 2018; 18(1):1-14. doi:10.1186/s12896-018-0457-7 [0153] 12. Thisted T, Biesova Z, Walmacq C, et al. Optimization of a nicotine degrading enzyme for potential use in treatment of nicotine addiction. BMC Biotechnol. 2019; 19(1):1-16. doi:10.1186/s12896-019-0551-5 [0154] 13. Kallupi M, Xue S, Zhou B, Janda K D, George O. An enzymatic approach reverses nicotine dependence, decreases compulsive-like intake, and prevents relapse. Sci Adv. 2018; 4(10):eaat4751. doi:10.1126/sciadv.aat4751 [0155] 14. Benowitz N L. Nicotine addiction. N Engl J Med. 2010; 362(24):2295. doi:10.1056/NEJMra0809890 [0156] 15. Tararina M A, Janda K D, Allen K N. Structural Analysis Provides Mechanistic Insight into Nicotine Oxidoreductase from Pseudomonas putida. Biochemistry. 2016; 55(48):6595-6598. doi:10.1021/acs.biochem.6b00963 [0157] 16. Yu H, Tang H, Wang L, Yao Y, Wu G, Xu P. Complete genome sequence of the nicotine-degrading Pseudomonas putida strain S16. J Bacteriol. 2011; 193(19):5541-5542. doi:10.1128/JB.05663-11 [0158] 17. Almagro Armenteros J J, Tsirigos K D, Sonderby C K, et al. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat Biotechnol. 2019; 37(4):420-423. doi:10.1038/541587-019-0036-z [0159] 18. Hmelo L R, Borlee B R, Almblad H, et al. Precision-engineering the Pseudomonas aeruginosa genome with two-step allelic exchange. Nat Protoc. 2015; 10(11):1820-1841. doi:10.1038/nprot.2015.115 [0160] 19. Leferink N G H, Van Den Berg W A M, Van Berkel W J H. L-Galactono-γ-lactone dehydrogenase from Arabidopsis thaliana, a flavoprotein involved in vitamin C biosynthesis. FEBS J. 2008; 275(4):713-726. doi:10.1111/j.1742-4658.2007.06233.x [0161] 20. Kuwahara T, White R A, Agosin M. A cytosolic flavin-containing enzyme catalyzing reduction of cytochrome c in Trypanosoma cruzi: Kinetic studies with cytochrome c as substrate. Arch Biochem Biophys. 1985; 241(1):45-49. doi:10.1016/0003-9861(85)90359-5 [0162] 21. Butt W D, KeilinN D. Absorption spectra and some other properties of cytochrome c and of its compounds with ligands. Proc R Soc Lond B Biol Sci. 1962; 156(November):429-458. doi:10.1098/rspb.1962.0049 [0163] 22. Henderson Pozzi M, Fitzpatrick P F. A lysine conserved in the monoamine oxidase family is involved in oxidation of the reduced flavin in mouse polyamine oxidase. Arch Biochem Biophys. 2010; 498(2):83-88. doi:10.1016/j.abb.2010.04.015 [0164] 23. Ugidos A, Morales G, Rial E, Williams H D, Rojo F. The coordinate regulation of multiple terminal oxidases by the Pseudomonas putida ANR global regulator. Environ Microbiol. 2008; 10(7):1690-1702. doi:10.1111/j.1462-2920.2008.01586.x [0165] 24. Arai H. Regulation and function of versatile aerobic and anaerobic respiratory metabolism in Pseudomonas aeruginosa. Front Microbiol. 2011; 2(MAY):1-13. doi:10.3389/fmicb.2011.00103 [0166] 25. McDonald C A, Fagan R L, Collard F, Monnier V M, Palfey B A. Oxygen reactivity in flavoenzymes: Context matters. J Am Chem Soc. 2011; 133(42):16809-16811. doi:10.1021/ja2081873 [0167] 26. Wang J, Edmondson D E. Topological probes of monoamine oxidases A and B in rat liver mitochondria: Inhibition by TEMPO-substituted pargyline analogues and inactivation by proteolysis. Biochemistry. 2011; 50(13):2499-2505. doi:10.1021/bi101722b [0168] 27. Zhuang Z, Marks B, McCauley R B. The insertion of monoamine oxidase A into the outer membrane of rat liver mitochondria. J Biol Chem. 1992; 267(1):591-596. [0169] 28. Russell S M, Davey J, Mayer R J. The vectorial orientation of human monoamine oxidase in the mitochondrial outer membrane. Biochem J. 1979; 181(1):7-14. doi:10.1042/bj1810007 [0170] 29. Gaweska H, Fitzpatrick P F. Structures and Mechanism of the Monoamine Oxidase Family. 2012; 2(5):365-377. doi:10.1515/BMC.2011.030.Structures [0171] 30. Graves S M, Xie Z, Stout K A, et al. Dopamine metabolism by a monoamine oxidase mitochondrial shuttle activates the electron transport chain. Nat Neurosci. 2020; 23(1):15-20. doi:10.1038/s41593-019-0556-3 [0172] 31. Howe G K, Clapp R W. Are we winning or losing the war on cancer? Deciphering the propaganda of NCI's 33-year war. New Solut. 2004; 14(2):109-24. PMID: 17208743. [0173] 32. U.S. Department of Health and Human Services. The Health Consequences of Smoking: 50 Years of Progress. A Report of the Surgeon General. Atlanta, Ga.: U.S. Department of Health and Human Services, Centers for Disease Control and Prevention, National Center for Chronic Disease Prevention and Health Promotion, Office on Smoking and Health, 2014. [0174] 33. Benowitz N L. Nicotine addiction. N Engl J Med. 2010 Jun. 17; 362(24):2295-303. doi: 10.1056/NEJMra0809890. Review. PMID: 20554984 [0175] 34. Birge M, Duffy S, Miler J A, Hajek P. What Proportion of People Who Try One Cigarette Become Daily Smokers? A Meta-Analysis of Representative Surveys. Nicotine Tob Res. 2018 Nov. 15; 20(12):1427-1433. doi: 10.1093/ntr/ntx243. PMID: 29126298. [0176] 35. Kallupi M, Xue S, Zhou B, Janda K D, George O. An enzymatic approach reverses nicotine dependence, decreases compulsive-like intake, and prevents relapse. Sci Adv. 2018 Oct. 17; 4(10):eaat4751. doi: 10.1126/sciadv.aat4751. eCollection 2018 October PMID: 30345354. [0177] 36. Yu H, Tang H, Wang L, Yao Y, Wu G, Xu P. Complete genome sequence of the nicotine-degrading Pseudomonas putida strain S16. J Bacteriol. 2011 October; 193(19):5541-2. doi: 10.1128/JB.05663-11. PMID: 21914868. [0178] 37. Xue S, Schlosburg J E, Janda K D. A New Strategy for Smoking Cessation: Characterization of a Bacterial Enzyme for the Degradation of Nicotine. J Am Chem Soc. 2015 Aug. 19; 137(32):10136-9. doi: 10.1021/jacs.5b06605. Epub 2015 Aug. 6. PMID: 26237398. [0179] 38. Fitzpatrick P F, Chadegani F, Zhang S, Roberts K M, Hinck C S. Mechanism of the Flavoprotein L-Hydroxynicotine Oxidase: Kinetic Mechanism, Substrate Specificity, Reaction Product, and Roles of Active-Site Residues. Biochemistry. 2016 Feb. 2; 55(4):697-703. doi: 10.1021/acs.biochem.5b01325. Epub 2016 Jan. 15. PMID: 26744768. [0180] 39. Wang S N, Xu P, Tang H Z, Meng J, Liu X L, Huang J, Chen H, Du Y, Blankespoor H D. Biodegradation and detoxification of nicotine in tobacco solid waste by a Pseudomonas sp. Biotechnol Lett. 2004 October; 26(19):1493-6. PMID: 15604785. [0181] 40. Fagan, R. L. & Palfey, B. A. in Comprehensive Natural Products Chemistry II, Vol 7: Cofactor Biosynthesis and Enzymology (ed. Begley, T. P.) 37-113 (Elsevier Ltd., 2010). [0182] 41. Bader M, Muse W, Ballou D P, Gassner C, Bardwell J C. Oxidative protein folding is driven by the electron transport system. Cell. 1999 Jul. 23; 98(2):217-27. PMID: 10428033. [0183] 42. Regeimbal J, Gleiter S, Trumpower B L, Yu C A, Diwakar M, Ballou D P, Bardwell J C. Disulfide bond formation involves a quinhydrone-type charge-transfer complex. Proc Natl Acad Sci USA. 2003 Nov. 25; 100(24):13779-84. Epub 2003 Nov. 11. PMID: 14612576. [0184] 43. Tararina M A, Janda K D, Allen K N. Structural Analysis Provides Mechanistic Insight into Nicotine Oxidoreductase from Pseudomonas putida. Biochemistry. 2016 Dec. 6; 55(48):6595-6598. Epub 2016 Nov. 18. PMID: 27933790. [0185] 44. Berks B C. The twin-arginine protein translocation pathway. Annu Rev Biochem. 2015; 84:843-64. doi: 10.1146/annurev-biochem-060614-034251. Epub 2014 Dec. 8.
[0186] Review. PMID: 25494301. [0187] 45. Teufel R, Miyanaga A, Michaudel Q, Stull F, Louie G, Noel J P, Baran P S, Palfey B, Moore B S. Flavin-mediated dual oxidation controls an enzymatic Favorskii-type rearrangement. Nature. 2013 Nov. 28; 503(7477):552-556. doi: 10.1038/nature12643. Epub 2013 Oct. 27. PMID: 24162851. [0188] 46. Stull F W, Bernard S M, Sapra A, Smith J L, Zuiderweg E R, Palfey B A. Deprotonations in the Reaction of Flavin-Dependent Thymidylate Synthase. Biochemistry. 2016 Jun. 14; 55(23):3261-9. doi: 10.1021/acs.biochem.6b00510. Epub 2016 Jun. 2. PMID: 27214228. [0189] 47. Feng Z, Li W, Ward A, Piggott B J, Larkspur E R, Sternberg P W, Xu X Z. A C. elegans model of nicotine-dependent behavior: regulation by TRP-family channels. Cell. 2006 Nov. 3; 127(3):621-33. PMID: 17081982 [0190] 48. Rauthan M, Gong J, Liu J, Li Z, Wescott S A, Liu J, Xu X Z S. MicroRNA Regulation of nAChR Expression and Nicotine-Dependent Behavior in C. elegans. Cell Rep. 2017 Nov. 7; 21(6):1434-1441. doi: 10.1016/j.celrep.2017.10.043. PMID: 29117550 [0191] 49. Mattevi A. To be or not to be an oxidase: challenging the oxygen reactivity of flavoenzymes. Trends Biochem Sci. 2006 May; 31(5):276-83. Epub 2006 Apr. 5. Review. PMID: 16600599. [0192] 50. Quan S, Wang L, Petrotchenko E V, Makepeace K A, Horowitz S, Yang J, Zhang Y, Borchers C H, Bardwell J C. Super Spy variants implicate flexibility in chaperone action. Elife. 2014; 3:e01584. doi: 10.7554/eLife.01584. Epub 2014 Feb. 4. PMID: 24497545. [0193] 51. Quan S, Koldewey P, Tapley T, Kirsch N, Ruane K M, Pfizenmaier J, Shi R, Hofmann S, Foit L, Ren G, Jakob U, Xu Z, Cygler M, Bardwell J C. Genetic selection designed to stabilize proteins uncovers a chaperone called Spy. Nat Struct Mol Biol. 2011 March; 18(3):262-9. doi: 10.1038/nsmb.2016. Epub 2011 Feb. 13. PMID: 21317898. [0194] 52. Pan J L, Sliskovic I, Bardwell J C. Mutants in DsbB that appear to redirect oxidation through the disulfide isomerization pathway. J Mol Biol. 2008 Apr. 11; 377(5):1433-42. doi: 10.1016/j.jmb.2008.01.058. Epub 2008 Jan. 31. PMID: 18325532. [0195] 53. Masip L, Pan J L, Haldar S, Penner-Hahn J E, DeLisa M P, Georgiou G, Bardwell J C, Collet J F. An engineered pathway for the formation of protein disulfide bonds. Science. 2004 Feb. 20; 303(5661):1185-9. PMID: 14976313. [0196] 54. Bader M W, Hiniker A, Regeimbal J, Goldstone D, Haebel P W, Riemer J, Metcalf P, Bardwell J C. Turning a disulfide isomerase into an oxidase: DsbC mutants that imitate DsbA. EMBO J. 2001 Apr. 2; 20(7):1555-62. PMID: 11285220. [0197] 55. Feng Z, Li W, Ward A, Piggott B J, Larkspur E R, Sternberg P W, Xu X Z. A C. elegans model of nicotine-dependent behavior: regulation by TRP-family channels. Cell. 2006 Nov. 3; 127(3):621-33. PMID: 17081982. [0198] 56. Londer, Y. Y. Expression of recombinant cytochromes c in E. coli. Methods Mol. Biol. 705, 123-150 (2011). [0199] 57. Corpet, F. Multiple sequence alignment with hierarchical clustering. Nucleic Acids Res. 16, 10881-10890 (1988). [0200] 58. Shivange et al., Determining the pharmacokinetics of nicotinic drugs in the endoplasmic reticulum using biosensors, J. Gen. Physiol. 151, 738-757 (2019). [0201] 59. Laskowski R A, Swindells M B. LigPlot+: multiple ligand-protein interaction diagrams for drug discovery, J. Chem. Inf. Model 51, 2778-2786 (2011). [0202] 60. Chaiyen P, Fraaije M W, Mattevi A. The enigmatic reaction of flavins with oxygen. Trends Biochem Sci. 37(9):373-80 (2012) [0203] 61. Romero E, Gómez Castellanos J R, Gadda G, Fraaije M W, Mattevi A. Same substrate, many reactions: oxygen activation in flavoenzymes. Chem Rev. 2018; 118(4):1742-1769. [0204] 62. Romero P A, Arnold F H. Exploring protein fitness landscapes by directed evolution. Nat Rev Mol Cell Biol. 2009; 10(12):866-76.
[0205] Each of the references cited herein is hereby incorporated by reference in its entirety, or in relevant part, as would be apparent from the context of the citation.
[0206] The disclosed subject matter has been described with reference to various specific embodiments and techniques. It should be understood, however, that many variations and modifications may be made while remaining within the spirit and scope of the disclosed subject matter.