CACNA1H-derived tumor antigen polypeptide and use thereof

11548925 · 2023-01-10

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are a tumor antigen polypeptide having the amino acid sequence as shown in SEQ ID NO: 2 or a variant thereof; a nucleic acid encoding the same; a nucleic acid construct, an expression vector, and a host cell containing the encoding nucleic acid; and an antigen presenting cell presenting the tumor antigen polypeptide on the cell surface and an immune effector cell thereof. Also provided is the use of the polypeptide, nucleic acid, antigen presenting cell or immune effector cell in the diagnosis, prevention and treatment of cancers.

Claims

1. An isolated peptide which has the amino acid sequence shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7.

2. The peptide according to claim 1, wherein the peptide can be recognized by CD8+ T cells.

3. An isolated nucleic acid encoding the peptide according to claim 1.

4. A vaccine for treating a cancer in a patient, comprising a peptide which has the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7; wherein the vaccine further comprises an adjuvant; or the vaccine is a peptide-loaded DC vaccine, DC-CTL vaccine, or DC-CIK vaccine.

5. A method of treating a patient having a tumor, comprising: administering to a patient an effective amount of the peptide which has the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7.

6. A diagnostic and treatment method, comprising: detecting a biological sample from a patient for the presence of HLA-A0201 and a peptide which has the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7; determining the patient as having a tumor expressing both HLA-A0201 and the peptide based on the presence of HLA-A0201 and the peptide in the biological sample and; administering to the patient an effective amount of the peptide.

7. The vaccine of claim 4, wherein the cancer expresses a peptide which has the amino acid sequence shown in SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, or SEQ ID NO: 7.

8. The vaccine according to claim 7, wherein the cancer is selected from the group consisting of lung cancer, melanoma, breast cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia, and brain tumors.

9. The diagnostic and treatment method of claim 6, wherein the tumor is selected from the group consisting of lung cancer, melanoma, breast cancer, nasopharyngeal carcinoma, liver cancer, gastric cancer, esophageal cancer, colorectal cancer, pancreatic cancer, skin cancer, prostate cancer, cervical cancer, leukemia, and brain tumors.

Description

DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a graph showing the results of detecting the affinity of the peptide (SEQ ID NO: 2 TLISSLMPI) of the present invention to T2 cells by flow cytometry.

(2) FIG. 2 is a graph showing the results of specific killing of target cells presenting the peptide of the present invention by immune cells; wherein groups are as follows:

(3) T cells (SEQ ID NO: 2 TLISSLMPI)+T2 (SEQ ID NO: 1 TLISSLRPI)

(4) T cells (SEQ ID NO: 2 TLISSLMPI)+T2 (SEQ ID NO: 2 TLISSLMPI)

(5) T cells (SEQ ID NO: 3 TLISSLMPL)+T2 (SEQ ID NO: 1 TLISSLRPI)

(6) T cells (SEQ ID NO: 3 TLISSLMPL)+T2 (SEQ ID NO: 2 TLISSLMPI)

(7) T cells (SEQ ID NO: 4 TLISSLMPV)+T2 (SEQ ID NO: 1 TLISSLRPI)

(8) T cells (SEQ ID NO: 4 TLISSLMPV)+T2 (SEQ ID NO: 2 TLISSLMPI)

(9) T cells (SEQ ID NO: 5 TMISSLMPI)+T2 (SEQ ID NO: 1 TLISSLRPI)

(10) T cells (SEQ ID NO: 5 TMISSLMPI)+T2 (SEQ ID NO: 2 TLISSLMPI)

(11) T cells (SEQ ID NO: 6 TMISSLMPL)+T2 (SEQ ID NO: 1 TLISSLRPI)

(12) T cells (SEQ ID NO: 6 TMISSLMPL)+T2 (SEQ ID NO: 2 TLISSLMPI)

(13) T cells (SEQ ID NO: 7 TMISSLMPV)+T2 (SEQ ID NO: 1 TLISSLRPI)

(14) T cells (SEQ ID NO: 7 TMISSLMPV)+T2 (SEQ ID NO: 2 TLISSLMPI).

(15) FIG. 3 shows the inhibitory effect on tumor growth and mouse survival rate after immunotherapy with the peptide of the present invention; wherein FIG. 3A shows the inhibitory effect on tumor growth after treatment with an adjuvant, an adjuvant+a wild-type peptide (TLISSLRPI, SEQ ID NO: 1), or an adjuvant+a mutant peptide TLISSLMPI (SEQ ID NO: 2) or the variant peptides thereof, FIG. 3B shows the mouse survival rate after treatment with an adjuvant, an adjuvant+a wild-type peptide, or an adjuvant+a mutant peptide TLISSLMPI (SEQ ID NO: 2) or the variant peptides thereof; wherein groups are as follows:

(16) Adjuvant group

(17) Adjuvant+wild-type peptide group

(18) Adjuvant+TLISSLMPI (SEQ ID NO: 2) peptide group

(19) Adjuvant+TLISSLMPL (SEQ ID NO: 3) peptide group

(20) Adjuvant+TLISSLMPV (SEQ ID NO: 4) peptide group

(21) Adjuvant+TMISSLMPI (SEQ ID NO: 5) peptide group

(22) Adjuvant+TMISSLMPL (SEQ ID NO: 6) peptide group

(23) Adjuvant+TMISSLMPV (SEQ ID NO: 7) peptide group.

(24) FIG. 4 shows the inhibitory effect on tumor growth and mouse survival rate after immunotherapy with the peptide of the present invention; wherein FIG. 4A shows the inhibitory effect on tumor growth after treatment with DC loaded with a wild-type peptide, or DC loaded with a mutant peptide (TLISSLMPI (SEQ ID NO: 2)) or the variant peptides thereof, FIG. 4B shows the mouse survival rate after treatment with DC loaded with a wild-type peptide, or DC loaded with a mutant peptide TLISSLMPI (SEQ ID NO: 2) or the variant peptides thereof; wherein groups are as follows:

(25) DC loaded with wild-type peptide group

(26) DC loaded with TLISSLMPI (SEQ ID NO: 2) peptide group

(27) DC loaded with TLISSLMPL (SEQ ID NO: 3) peptide group

(28) DC loaded with TLISSLMPV (SEQ ID NO: 4) peptide group

(29) DC loaded with TMISSLMPI (SEQ ID NO: 5) peptide group

(30) DC loaded with TMISSLMPL (SEQ ID NO: 6) peptide group

(31) DC loaded with TMISSLMPV (SEQ ID NO: 7) peptide group.

(32) FIG. 5 shows the inhibitory effect on tumor growth and mouse survival rate after immunotherapy with the peptide of the present invention; wherein FIG. 5A shows the inhibitory effect on tumor growth after treatment with DCs infected with lentivirus vector carrying a wild-type peptide (TLISSLRPI (SEQ ID NO: 1)), or a mutant peptide (TLISSLMPI (SEQ ID NO: 2)) or the variant peptides thereof; FIG. 5B shows the mouse survival rate after treatment with DCs infected with lentivirus vector carrying a wild-type peptide (TLISSLRPI (SEQ ID NO: 1)), or a mutant peptide (TLISSLMPI (SEQ ID NO: 2)) or the variant peptides thereof; wherein groups are as follows:

(33) DC infected with pHBLV-Puro-wild-type gene

(34) DC infected with pHBLV-Puro-TLISSLMPI (SEQ ID NO: 2) gene

(35) DC infected with pHBLV-Puro-TLISSLMPL (SEQ ID NO: 3) gene

(36) DC infected with pHBLV-Puro-TLISSLMPV (SEQ ID NO: 4) gene

(37) DC infected with pHBLV-Puro-TMISSLMPI (SEQ ID NO: 5) gene

(38) DC infected with pHBLV-Puro-TMISSLMPL (SEQ ID NO: 6) gene

(39) DC infected with pHBLV-Puro-TMISSLMPV (SEQ ID NO: 7) gene.

(40) FIG. 6 shows the inhibitory effect on tumor growth and mouse survival rate after immunotherapy with the peptide of the present invention; wherein FIG. 6A shows the inhibitory effect on tumor growth after treatment with DC loaded with a wild-type peptide (TLISSLRPI (SEQ ID NO: 1))+CTL, or DC loaded with a mutant peptide (TLISSLMPI (SEQ ID NO: 2)) or the variant peptides thereof+CTL, FIG. 6B shows the mouse survival rate after treatment with DC loaded with a wild-type peptide (TLISSLRPI (SEQ ID NO: 1))+CTL, or DC loaded with a mutant peptide (TLISSLMPI (SEQ ID NO: 2)) or the variant peptides thereof+CTL; wherein groups are as follows:

(41) DC loaded with wild-type peptide+CTL

(42) DC loaded with TLISSLMPI (SEQ ID NO: 2) peptide+CTL

(43) DC loaded with TLISSLMPL (SEQ ID NO: 3) peptide+CTL

(44) DC loaded with TLISSLMPV (SEQ ID NO: 4) peptide+CTL

(45) DC loaded with TMISSLMPI (SEQ ID NO: 5) peptide+CTL

(46) DC loaded with TMISSLMPL (SEQ ID NO: 6) peptide+CTL

(47) DC loaded with TMISSLMPV (SEQ ID NO: 7) peptide+CTL.

DETAILED DESCRIPTION

(48) In order to facilitate understanding of the present invention, the following examples are exemplified in the present invention. It should be understood by those skilled in the art that the examples are only to facilitate the understanding of the present invention and should not be construed as specific limitations to the present invention.

Example 1 Affinity Prediction of the Mutant Peptides of the Present Invention

(49) Affinity of the peptides was predicted by the following procedure:

(50) Based on the selected HLA allele type, affinity of the peptides was predicted by using a self-developed “software for predicting the binding ability of a mutant peptide based on tumor DNA and RNA sequencing” (software copyright number: 2016SR002835). The prediction results were expressed as IC50 score. An IC50 of less than 500 indicated that the peptide had an affinity, and an IC50 of less than 50 indicated that the peptide had a high affinity.

(51) The wild-type peptide TLISSLRPI (SEQ ID NO: 1), the mutant peptide TLISSLMPI (SEQ ID NO: 2) of the present invention and the five variant peptides of the mutant peptide TLISSLMPI (SEQ ID NO: 2) (also belonging to the present invention) were obtained by standard solid phase synthesis and purified by reverse phase HPLC. The purity (>90%) and identity of the peptide were determined by HPLC and mass spectrometry, respectively. The affinity of the wild-type peptide and several mutant peptides of the present invention to HLA-A0201 was predicted by using the software for predicting the binding ability of a mutant peptide based on tumor DNA and RNA sequencing, and the prediction scores were shown in Table 1 below.

(52) TABLE-US-00001 TABLE 1 Affinity prediction results of the peptides to HLA-A0201 Mutant Peptides IC50 (nM) Wild-type Peptide IC50 (nM) TLISSLMPI 3.28 TLISSLRPI 3.39 (SEQ ID NO: 2) TLISSLMPL 3.18 — — (SEQ ID NO: 3) TLISSLMPV 2.86 — — (SEQ ID NO: 4) TMISSLMPI 2.67 — — (SEQ ID NO: 5) TMISSLMPL 2.49 — — (SEQ ID NO: 6) TMISSLMPV 2.24 — — (SEQ ID NO: 7)

(53) It can be seen from Table 1 that as predicted by the computer software, the IC50 scores of the mutant peptides of the present invention were less than 50 nM, indicating that the mutant peptides of the present invention had a high affinity to HLA-A0201.

Example 2 Affinity Verification of the Mutant Peptides of the Present Invention to T2 Cells

(54) According to the manner described in Example 1, the wild-type peptide TLISSLRPI (SEQ ID NO: 1), the peptide TLISSLMPI (SEQ ID NO: 2) of the present invention and the SEQ ID NO: 2_TLISSLMPI's five variant peptides were obtained; 2×10.sup.5 T2 cells (a lymphocyte, tumor cell line, expressing HLA-A0201; T2 cell is a cell strain that is deficient in an antigen peptide transporter (TAP) that is essential for endogenous antigen presentation pathway, and is a hybridoma cell from HLA-A2-positive T and B lymphocytess, and can be used to study the affinity of a peptide to HLA-A2 and the interaction of T cells with MHC-I molecule; ATCC Cat. No.: CRL-1992™) were resuspended into a 24-well plate with 500 μl of serum-free IMDM medium. 10 μg/ml of each peptide as described above was added, and human β2 microglobulin (at a final concentration of 3 μg/ml) was added and cultured overnight in an incubator (37° C., 5% CO.sub.2). Two replicate wells were set up for each group. T2 cells without the addition of a peptide were used as a background control (i.e., blank), and the group added with the CMV peptide (NLVPMVATV (SEQ ID NO: 15)) was used as a positive control.

(55) Cells were collected by centrifugation of the cell culture at 200 g for 5 minutes. The collected cells were washed twice with PBS, and then directly incubated with FITC-conjugated anti-HLA-A 0201 monoclonal antibody at 4° C. for 30 minutes. The mean fluorescence intensity (MFI) was then detected and analyzed by flow cytometer (BD FACSJazz™) and its software. The fluorescence index (FI) was calculated by using the following formula:
FI=[MFI.sub.sample−MFI.sub.background]/MFI.sub.background;

(56) Wherein, the MFI.sub.background represents a value without peptide; FI>1.5 indicates that the peptide has a high affinity for HLA-A0201 molecule, 1.0<FI<1.5 indicates that the peptide has a medium affinity for HLA-A0201 molecule, and 0.5<FI<1.0 indicates that the peptide has a low affinity for HLA-A0201 molecule.

(57) The affinity detection results of the respective peptides described above to HLA-A 0201 were shown in Table 2 below.

(58) TABLE-US-00002 TABLE 2 Affinity detection results of the peptides to HLA-A0201 Concentration of Average the added fluorescence Sample peptide intensity FI TLISSLRPI 100 μM 672.3 1.99 (SEQ ID NO: 1) TLISSLMPI 100 μM 682.7 2.04 (SEQ ID NO: 2) TLISSLMPL 100 μM 692.4 2.08 (SEQ ID NO: 3) TLISSLMPV 100 μM 713.6 2.18 (SEQ ID NO: 4) TMISSLMPI 100 μM 701.3 2.12 (SEQ ID NO: 5) TMISSLMPL 100 μM 763.9 2.40 (SEQ ID NO: 6) TMISSLMPV 100 μM 776.5 2.46 (SEQ ID NO: 7) blank  0 μM 224.6 0 CMV 100 μM 656.7 1.92

(59) It can be seen from Table 2 that, through the affinity verification, the FI of the blank group was 0, and the FI of the CMV peptide which was used as a positive control was 1.92, both of which were normal; while the FIs of the wild-type peptide and the mutant peptides of the present invention were both greater than 1.5, further demonstrating that the wild-type peptide and the mutant peptides of the present invention were all highly affinitive.

Example 3 In Vitro Stimulation and Expansion of CD8+ T Cells by the Mutant Peptides of the Present Invention

(60) 2×10.sup.7 PBMC cells were taken from the subtype HLA-A0201-positive volunteers. Mononuclear cells were isolated by an adherence method (adhering for 3 h), and CD8+ T cells were isolated by using CD8 magnetic beads. Adherent mononuclear cells were induced into immature DCs with GM-CSF (1000 U/ml) and IL-4 (1000 U/ml), and further induced into peptide-specific mature DCs with IFN-γ (100 U/ml), CD40L (100 U/ml) and each of the mutant peptide TLISSLMPI (SEQ ID NO: 2) of the present invention and the five variant peptides thereof. The mature DCs loaded with peptides were irradiated, co-cultured with CD8+ T cells from volunteers, and IL-21 was added. After 3 days, IL-2 and IL-7 were supplemented. Afterwards, IL-2 and IL-7 were again supplemented on day 5 and day 7, respectively (the final concentrations of IL-21, IL-2 and IL-7 were 30 ng/ml, 5 ng/ml and 10 ng/ml, respectively). The co-cultured cells were counted on day 10 and subsequently subjected to ELISPOTs and LDH tests. The counting results were shown in Table 3 below.

(61) TABLE-US-00003 TABLE 3 Cell counting results after culture Total number of cells in Total number of cells in the well before culture the well after culture TLISSLMPI 2.5 × 10{circumflex over ( )}6 1.32 × 10{circumflex over ( )}7 (SEQ ID NO: 2) TLISSLMPL 2.5 × 10{circumflex over ( )}6 1.37 × 10{circumflex over ( )}7 (SEQ ID NO: 3) TLISSLMPV 2.5 × 10{circumflex over ( )}6 1.63 × 10{circumflex over ( )}7 (SEQ ID NO: 4) TMISSLMPI 2.5 × 10{circumflex over ( )}6 1.46 × 10{circumflex over ( )}7 (SEQ ID NO: 5) TMISSLMPL 2.5 × 10{circumflex over ( )}6 1.76 × 10{circumflex over ( )}7 (SEQ ID NO: 6) TMISSLMPV 2.5 × 10{circumflex over ( )}6 1.87 × 10{circumflex over ( )}7 (SEQ ID NO: 7)

(62) It can be seen from Table 3 that after 10 days of culture, the cells proliferated significantly, and the expansion fold of the total number of cells was between 5-7 folds, indicating that the addition of the peptides of the present invention can significantly stimulate the expansion of CD8+ T cells.

Example 4 Activation of a CD8+ T Cell Immune Response by the Mutant Peptides of the Present Invention as Verified by ELISPOTs

(63) In this example, a ELISPOTs detection kit (Cat. No.: 3420-4AST-10, MABTECH) was used to verify the activation of an immune response of CD8+ T cells by the peptides of the present invention.

(64) Principle of the ELISPOTs detection method is as follows: CD8+ T cells can specifically recognize the complex of HLA-A0201 and a peptide. The population of T cells recognizing the complex of the peptide and HLA-A0201 is varying, depending on the peptide sequence. Since T2 cells express HLA-A0201, CD8+ T cells can specifically recognize the T2 cells loaded with a peptide. After specific recognition of the complex of HLA-A0201 and the peptide, peptide-specific CD8+ T cells can be activated again to secrete IFN-γ interferon. The IFN-γ interferon secreted by the activated CD8+ T cells can be captured by antibodies on the ELISPOTs plate. Finally, the enzyme-conjugated antibody that recognizes IFN-γ can degrade the substrate through the enzyme conjugated thereto and develop color, eventually producing spots. The number of spots represents the number of cells that are activated to secrete IFN-γ interferon.

(65) The cultured cells from Example 3 were added, along with T2 cells loaded with the mutant peptide TLISSLMPI (SEQ ID NO: 2) of the present invention and the wild-type peptide TLISSLRPI (SEQ ID NO: 1), respectively, into ELISPOTs plates, and cultured for 20 h, and then a ELISPOTs detection was performed (see the kit instruction). Finally, the spots produced by the ELISPOTs detection were counted.

(66) The peptide was determined to have immunogenicity when the number of spots of the tested peptide/the number of spots of an unrelated peptide>2; that is, if the number of spots caused by the tested peptide is more than twice than that of an unrelated peptide, the tested peptide is determined to have immunogenicity.

(67) ELISPOTs detection results of the respective peptides described above were shown in Table 4 below.

(68) TABLE-US-00004 TABLE 4 Secretion of IFN-γ interferon by specific CD8+ T cells stimulated by a peptide Peptide and Number its variants of spots Number of Fold capable in the mutant spots in the (tested/ of activating peptide wild-type wild- T cells group peptide group type) Conclusion TLISSLMPI 306 33 9.27 immunogenic (SEQ ID NO: 2) TLISSLMPL 317 37 8.57 immunogenic (SEQ ID NO: 3) TLISSLMPV 325 41 7.93 immunogenic (SEQ ID NO: 4) TMISSLMPI 321 27 11.88 immunogenic (SEQ ID NO: 5) TMISSLMPL 338 39 8.67 immunogenic (SEQ ID NO: 6) TMISSLMPV 345 35 9.86 immunogenic (SEQ ID NO: 7)

(69) It can be seen from Table 4 that the peptide of the present invention and its variants are immunogenic and can specifically activate a CD8+ T cell immune response.

Example 5 Specific Killing Activity of CD8+ T Cells Against Target Cells Presenting the Peptide of the Present Invention as Demonstrated by a LDH Release Assay

(70) The cells cultured in Example 3 were co-cultured with T2 cells loaded with the mutant peptides of the present invention or the wild-type peptide or without a peptide. A maximum release well, a volume correction well, a medium control well, a spontaneous release well and control wells for example at different effector-to-target ratios (ratios of T cells to T2 cells) were set in this experiment. Three replicate wells were set for each group. After 4 h, 50 μl of the co-culture supernatant was taken out and added to 50 μl of LDH substrate mixture to catalyze the reaction of LDH substrate. Finally, the plates were read at a wavelength of 490 nm, with a reference wavelength of 680 nm, and the killing activity against target cells T2 was calculated based on the control wells. The test results were shown in FIG. 2 and Table 5 below.

(71) The formula for calculating the killing activity is:
Killing efficiency (%)=(test well−spontaneous release of effector cells−spontaneous release of target cells+medium well)/(maximum release of target cells−volume correction well−spontaneous release of target cells+medium well)×100%

(72) TABLE-US-00005 TABLE 5 Specific recognition and killing of target cells presenting test peptides by T cells effector- effector- to-target to-target Group ratio (1:1) ratio (10:1) T cells (SEQ ID NO: 2 TLISSLMPI) + 2.23% 4.23% T2 (SEQ ID NO: 1 TLISSLRPI) T cells (SEQ ID NO: 2 TLISSLMPI) + 7.96% 38.89% T2 (SEQ ID NO: 2 TLISSLMPI) T cells (SEQ ID NO: 3 TLISSLMPL) + 3.12% 5.71% T2 (SEQ ID NO: 1 TLISSLRPI) T cells (SEQ ID NO: 3 TLISSLMPL) + 8.23% 39.66% T2 (SEQ ID NO: 2 TLISSLMPI) T cells (SEQ ID NO: 4 TLISSLMPV) + 2.57% 4.73% T2 (SEQ ID NO: 1 TLISSLRPI) T cells (SEQ ID NO: 4 TLISSLMPV) + 8.56% 43.82% T2 (SEQ ID NO: 2 TLISSLMPI) T cells (SEQ ID NO: 5 TMISSLMPI) + 2.85% 5.13% T2 (SEQ ID NO: 1 TLISSLRPI) T cells (SEQ ID NO: 5 TMISSLMPI) + 8.33% 41.16% T2 (SEQ ID NO: 2 TLISSLMPI) T cells (SEQ ID NO: 6 TMISSLMPL) + 3.13% 5.83% T2 (SEQ ID NO: 1 TLISSLRPI) T cells (SEQ ID NO: 6 TMISSLMPL) + 9.12% 45.23% T2 (SEQ ID NO: 2 TLISSLMPI) T cells (SEQ ID NO: 7 TMISSLMPV) + 3.51% 6.31% T2 (SEQ ID NO: 1 TLISSLRPI) T cells (SEQ ID NO: 7 TMISSLMPV) + 9.32% 47.35% T2 (SEQ ID NO: 2 TLISSLMPI)

(73) It can be seen from the results of FIG. 2 and Table 5 that, at an effector-to-target ratio of 1:1 or 1:10, the activated T cells by the mutant peptide TLISSLMPI (SEQ ID NO: 2) of the present invention or the variant peptides thereof were capable of killing T2 cells presenting the mutant peptide, but not the T2 cells presenting a wild-type peptide, further demonstrating that the mutant peptides of the present invention were capable of specifically killing target cells presenting the mutant peptide TLISSLMPI (SEQ ID NO: 2).

Example 6 Construction and Packaging of Recombinant Lentiviruses of the Mutant Peptide TLISSLMPI (SEQ ID NO: 2) and the Variant Peptides Thereof

(74) The following DNA sequences were synthesized: “ACGCTGATATCATCACTCAGGCCCATT” (SEQ ID NO: 8), encoding the wild-type peptide TLISSLRPI (SEQ ID NO: 1); “ACGCTGATATCATCACTCATGCCCATT” (SEQ ID NO: 9), encoding the mutant peptide TLISSLMPI (SEQ ID NO: 2); “ACGCTGATATCATCACTCATGCCCCTG” (SEQ ID NO: 10), encoding the SEQ ID NO: 2 TLISSLMPI's variant peptide TLISSLMPL (SEQ ID NO: 3); “ACGCTGATATCATCACTCATGCCCGTC” (SEQ ID NO: 11), encoding the SEQ ID NO: 2 TLISSLMPI's variant peptide TLISSLMPV (SEQ ID NO: 4); “ACGATGATATCATCACTCATGCCCATT” (SEQ ID NO: 12), encoding the SEQ ID NO: 2 TLISSLMPI's variant peptide TMISSLMPI (SEQ ID NO: 5); “ACGATGATATCATCACTCATGCCCCTG” (SEQ ID NO: 13), encoding the SEQ ID NO: 2 TLISSLMPI's variant peptide TMISSLMPL (SEQ ID NO: 6); and “ACGATGATATCATCACTCATGCCCGTC” (SEQ ID NO: 14), encoding the SEQ ID NO: 2_TLISSLMPI's variant peptide TMISSLMPV (SEQ ID NO: 7). The wild-type peptide TLISSLRPI (SEQ ID NO: 1), the mutant peptide TLISSLMPI (SEQ ID NO: 2) and the mutant peptide SEQ ID NO: 2 TLISSLMPI's variant peptides were constructed into the lentiviral vector pHBLV-Puro, respectively, to name as pHBLV-Puro-TLISSLRPI (SEQ ID NO: 1), pHBLV-Puro-TLISSLMPI (SEQ ID NO: 2), pHBLV-Puro-TLISSLMPL (SEQ ID NO: 3), pHBLV-Puro-TLISSLMPV (SEQ ID NO: 4), pHBLV-Puro-TMISSLMPI (SEQ ID NO: 5), pHBLV-Puro-TMISSLMPL (SEQ ID NO: 6) and pHBLV-Puro-TMISSLMPV (SEQ ID NO: 7), respectively. The seven lentiviral constructs were co-transfected into 293T cells with helper plasmids pSPAX2 and pMD2G for packaging, and lentiviruses of the wild-type peptide TLISSLRPI (SEQ ID NO: 1), the mutant peptide TLISSLMPI (SEQ ID NO: 2) and the mutant peptide's variant peptides were obtained.

Example 7 Establishment of a Human Lung Cancer Cell Line Expressing the Mutant Peptide TLISSLMPI (SEQ ID NO: 2

(75) The human non-small cell lung adenocarcinoma cell line NCI-H2087 which was HLA-A*0201 positive was purchased from ATCC. The cells were cultured in DMEM medium containing 10% fetal bovine serum, 100 U/mL penicillin and 100 U/ml streptomycin in an incubator at 37° C., 5% CO.sub.2. The lentivirus of TLISSLMPI (SEQ ID NO: 2) as packaged in Example 6 was transfected into the H2087 cell line. Transfected cells were continuously screened by using antibiotic puromycin to finally establish a H2087 cell line expressing TLISSLMPI (SEQ ID NO: 2) peptide which was named as H2087-TLISSLMPI (SEQ ID NO: 2) cell line.

Example 8 Human Immune Reconstitution in NOD SCID Mice

(76) 600-900 ml of anticoagulated peripheral blood was collected from healthy volunteers for isolating peripheral blood mononuclear cells (PBMCs) via Ficoll. Cells were collected for use. 2×10.sup.7 PBMCs per 0.5 ml was intraperitoneally injected into each of 300 NOD SCID mice without immune leakage to perform human immune reconstitution in NOD SCID mice. After 4 weeks, the mice were selected to be inoculated with the human lung cancer cell line.

Example 9 Establishment of a Subcutaneous Xenograft Model of H2087-TLISSLMPI (SEQ ID NO: 2

(77) The human non-small cell lung adenocarcinoma cell line H2087-TLISSLMPI (SEQ ID NO: 2) as established in Example 7 was cultured in DMEM medium containing 10% fetal bovine serum, 100 U/mL penicillin and 100 U/mL streptomycin in an incubator at 37° C., 5% CO.sub.2. H2087-TLISSLMPI (SEQ ID NO: 2) tumor cells were collected, centrifuged at 1500 rpm for 5 min, and washed 3 times with sterile physiological saline. The tumor cells were diluted appropriately. To 40 μl of cell suspension was added 10 μl of 0.4% phenol blue for staining and microscopically counting cells. A tumor cell suspension at a concentration of 1*10.sup.8 cells/ml was prepared. 100 μl of the tumor cell suspension was inoculated subcutaneously into a NOD/SCID mouse or an immune-reconstituted NOD/SCID mouse. After inoculation, the inoculation site was daily observed for the presence or absence of an infection. It was also observed whether there was a spontaneous regression after tumor growth. The long diameter a and the short diameter b of the tumor were measured with a vernier caliper every 2-3 days and the size of the tumor was calculated as a*b*b/2. The mice and tumors were weighed and recorded every day. After 7 days, a tumor with about the size of a grain of rice could be touched under the skin of mouse. At this time, the H2087-TLISSLMPI (SEQ ID NO: 2) subcutaneous tumor model NOD/SCID mice were treated with DC-CTL vaccines. The H2087-TLISSLMPI (SEQ ID NO: 2) subcutaneous tumor model NOD/SCID mice that had been subjected to immune reconstitution for 4 weeks were treated with a peptide+complete Freund's adjuvant, or a peptide+DC vaccine, or lentivirus-infected DC vaccine, and DC-CTL vaccine, respectively. The tumor volume and the survival rate of mice were recorded every 2 days.

Example 10 Treatment Regimen with Peptide Vaccines

(78) The H2087-TLISSLMPI (SEQ ID NO: 2) subcutaneous tumor model NOD/SCID mice that had been subjected to immune reconstitution for 4 weeks were randomly divided into 8 groups: adjuvant+wild-type peptide group, adjuvant group, adjuvant+TLISSLMPI (SEQ ID NO: 2) peptide group, and groups of adjuvant+each of the SEQ ID NO: 2 TLISSLMPI's 5 variant peptides, with 6 mice per group. The first immunization dose of the peptides described above was 100 μg/mouse. Each of the peptides was resuspended in PBS, mixed with 150 μl of Freund's complete adjuvant per mouse, and then adjusted with PBS to 300 μl per mouse, and injected subcutaneously at two points on the back. After 2 weeks, the same dose was used for booster immunization (using a complete Freund's adjuvant for the first one, and using an incomplete Freund's adjuvant for the others), with a total of 4 immunizations. The general characteristics including mental state, activity, response, diet, body weight and tumor growth of the tumor-bearing mice were observed daily. The longest diameter (a) and the shortest diameter (b) of a tumor were measured with a vernier caliper every 2 days. Tumor volume was calculated as: ½×length×width.sup.2. The results were shown in FIG. 3. The results showed that, as compared to the adjuvant alone group and the wild-type peptide group, TLISSLMPI (SEQ ID NO: 2) or its variant forms+Freund's adjuvant effectively inhibited tumor growth and prolonged the survival period of mice. The formula for calculating the survival period was as follows: survival rate within a certain period of time=surviving mice within this period of time/(surviving mice within this period of time+dead mice within this period of time)*100%.

Example 11 Preparation of a DC Peptide Vaccine and Treatment Regimen Using this Vaccine

(79) 100-150 ml of anticoagulated peripheral blood was collected from healthy volunteers for isolating peripheral blood mononuclear cells via Ficoll. PBMCs were collected, resuspended in RPMI 1640 medium at 2-3×10.sup.6 cells/ml, and incubated at 37° C. for 2 h. The adherent cells which were DCs were induced into mature DCs with 1000 U/ml GM-CSF, 1000 U/ml IL-4, 100 U/ml IFN-γ and 100 U/ml CD40L. Mature DCs were harvested, and then wild-type peptide, the mutant peptide TLISSLMPI (SEQ ID NO: 2) and the SEQ ID NO: 2 TLISSLMPI's five variant peptides (at a concentration of 10 μg/ml) were added respectively, co-incubated for 4 hours and then washed with physiological saline for three times. The DCs loaded with a peptide were adjusted to (4.0±0.5)×10.sup.7 cells/ml with physiological saline for subsequent experiments.

(80) Tumor-bearing mice were randomly divided into 7 groups: DC loaded with wild-type peptide group, DC loaded with the mutant peptide TLISSLMPI (SEQ ID NO: 2) group, and groups of DC loaded with each of the SEQ ID NO: 2_TLISSLMPI's 5 variant peptides, with 6 mice per group. Cell suspensions of the DCs loaded with wild-type peptide, the DCs loaded with the mutant peptide TLISSLMPI (SEQ ID NO: 2), and the DCs loaded with each of the SEQ ID NO: 2 TLISSLMPI's 5 variant peptides were prepared. 0.1 ml was injected intracutaneously into each side of the inner thigh near groin of the tumor-bearing mouse once a week. For each group, the dose was (4.0±0.5)×10.sup.6 cells/injection, and a total of 2 injections was performed. After injection, vital signs of the mice were observed, and the vertical and horizontal dimensions of tumors were measured with a vernier caliper every two days. Tumor volume was calculated as follows: tumor volume=½×length×width.sup.2. At the same time, the changes in body weight and survival of the mice were recorded. The results were shown in FIG. 4. The results in FIG. 4 showed that, compared to the group of DC vaccine loaded with wild-type peptide, DC vaccines loaded with TLISSLMPI (SEQ ID NO: 2) or the variant peptides thereof significantly prolonged survival period of mice and slowed down tumor growth in mice.

Example 12 Preparation of a DC Vaccine by Injection with Recombinant Lentivirus Containing a Peptide Gene and Treatment Regimen Using this Vaccine

(81) 100-150 ml of anticoagulated peripheral blood was collected from healthy volunteers for isolating peripheral blood mononuclear cells via Ficoll. PBMCs were collected, and incubated at 37° C. for 2 h. Non-adherent cells were washed away and DCs were cultured with recombinant human granulocyte-macrophage colony-stimulating factor (rhGM-CSF) and recombinant human interleukin-4 (rhIL-4). On day 5 of culturing, half of the medium was replaced and the cell density was adjusted to 1*10.sup.6 cell/ml; solutions of recombinant lentiviruses of the wild-type peptide TLISSLRPI (SEQ ID NO: 1), the mutant peptide TLISSLMPI (SEQ ID NO: 2) or the SEQ ID NO: 2_TLISSLMPI's five variant peptides (as constructed in Example 6) were added at an appropriate amount. After 24 h, the virus-containing culture medium was removed, and a culture medium containing 50 ng/ml rhIL-4, 100 ng/ml rh GM-CSF, 100 U/ml IFN-γ and 100 U/ml CD40L was added for culturing in an incubator at 37° C., 5% CO.sub.2. After 16 h, the DCs were adjusted to (4.0±0.5)×10.sup.7 cells/ml for subsequent experiments.

(82) Tumor-bearing mice were randomly divided into 7 groups: wild-type peptide-DC group, TLISSLMPI (SEQ ID NO: 2) peptide-DC group, and groups of each of the SEQ ID NO: 2 TLISSLMPI's 5 variant peptides-DC, with 6 mice per group. Cell suspensions of the DCs loaded with wild-type peptide, the DCs loaded with the mutant peptide TLISSLMPI (SEQ ID NO: 2), and the DCs loaded with each of the SEQ ID NO: 2 TLISSLMPI's 5 variant peptides were prepared. 0.1 ml was injected intracutaneously into each side of the inner thigh near groin of the immune-reconstituted tumor-bearing mouse once a week. For each group, the dose was (4.0±0.5)×10.sup.6 cells/injection, and a total of 2 injections was performed. After injection, vital signs of the mice were observed, and the vertical and horizontal dimensions of tumors were measured with a vernier caliper every two days. Tumor volume was calculated as follows: tumor volume=½×length×width.sup.2. At the same time, the changes in body weight and survival of the mice were recorded. The results were shown in FIG. 5 which showed that the DC vaccines infected with recombinant lentivirus containing gene of the mutant peptide TLISSLMPI (SEQ ID NO: 2) or its five variant peptides had significant tumor-suppressing effects and prolonged the survival period of mice compared to the group of wild-type peptide which had no effect on this tumor.

Example 13 Preparation of a Peptide-Specific CTL Vaccine and a In Vivo Treatment Regimen Using this Vaccine

(83) 100-150 ml of anticoagulated peripheral blood was collected from healthy volunteers for isolating peripheral blood mononuclear cells via Ficoll. PBMCs were collected, resuspended in RPMI 1640 medium at 2-3×10.sup.6 cells/ml, and incubated at 37° C. for 2 h. The non-adherent cells, which were peripheral blood lymphocytes (PBLs), were pipetted.

(84) The collected PBLs were subjected to magnetic bead sorting to obtain CD8+ T cells, which were sensitized by co-incubation with DCs loaded with the wild-type peptide, DCs loaded with the mutant peptide TLISSLMPI (SEQ ID NO: 2) and its five variant peptides at a cell ratio of DCs:CD8+ T cells=1:4. 500 IU/ml of IL-2 and 50 ng/ml of IL-7 were added to the medium to co-incubate in an incubator at 37° C., 5% CO.sub.2, and cell counting was performed after 1 week of culturing; a second round of stimulation was performed at week 2 by adding DCs loaded with TLISSLMPI (SEQ ID NO: 2) peptide, DCs loaded with the SEQ ID NO: 2_TLISSLMPI's five variant peptides, or DCs loaded with the wild-type peptide, and 500 IU/ml of IL-2. The same procedure was carried out at week 3. Thus, three rounds of stimulation were performed. Medium was appropriately added during culturing. The number of lymphocytes was counted and a cell proliferation index (PI) was calculated on days 0, 7, 14, and 21 of culture, respectively. PI=number of cells after expansion/number of cells inoculated. On day 7 after the third stimulation (i.e., day 21 of culture), cells, i.e., cytotoxic T lymphocytes (CTLs) were harvested. The cells were resuspended in physiological saline to a volume of 0.2 ml, and were reinfused through tail vein at about 1×10.sup.8 cells per tumor model mouse. After injection, vital signs of the mice were carefully observed and the vertical and horizontal dimensions of the tumors were measured with a vernier caliper every 2 days.

(85) The results were shown in FIG. 6. The results in FIG. 6 showed that, compared to the wild-type peptide group, the DC-CTL vaccines that were activated by the mutant peptide TLISSLMPI (SEQ ID NO: 2) or the five variant peptides thereof had significant tumor-suppressing effects and prolonged the survival period of mice.

(86) The Applicant states that the method of the present invention and application and effects thereof are illustrated through the above examples, however, the present invention is not limited thereto. Those skilled in the art should understand that, for any improvement of the present invention, the equivalent replacement of the products of the present invention, the addition of auxiliary components, and the selection of specific modes, etc., will all fall within the scope of protection and the scope of disclosure of the present invention.