<i>Sorghum </i>plants having a mutant polynucleotide encoding the large subunit of mutated acetohydroxyacid synthase protein and increased resistance to herbicides
11963498 ยท 2024-04-23
Assignee
Inventors
- Vicente Trucillo Uriarte (Buenos Aires, AR)
- Andr?s Daniel Zambelli (Buenos Aires, AR)
- Marcos Kaspar (Buenos Aires, AR)
- Pedro Alejandro Pardo (Venado Tuerto, AR)
Cpc classification
C12N9/1022
CHEMISTRY; METALLURGY
International classification
A01H6/46
HUMAN NECESSITIES
A01H1/04
HUMAN NECESSITIES
C12N15/82
CHEMISTRY; METALLURGY
Abstract
A sorghum seed comprising in its genome at least one polynucleotide encoding a polypeptide having an alanine to tyrosine substitution at position 93 of the sorghum AHAS protein large subunit. The plant has increased resistance to one or more herbicides, for example from the imidazolinone group, as compared to wild-type sorghum plants. The sorghum plant may comprise in its genome, one, two, three or more copies of a polynucleotide encoding a mutated large subunit of sorghum AHAS or a sorghum AHAS polypeptide of the invention. In this context, the sorghum plant may be tolerant to any herbicide capable of inhibiting AHAS enzyme activity. For example, the sorghum plant may be tolerant to herbicides of the imidazolinones type, such as imazethapyr, imazapir, and imazapic or to herbicides of the sulfonylurea group.
Claims
1. A method for identifying a sorghum herbicide-resistant plant, comprising: a) providing a nucleic acid sample from a non-transgenic sorghum plant; b) amplifying a region corresponding to the AHAS gene present in said nucleic acid sample from a sorghum plant; c) identifying a herbicide-resistant sorghum plant based on the presence of one mutation in the amplified nucleic acid sample, where said mutation confers resistance to herbicides from the imidazolinone group, wherein said one mutation comprises an Ala93Thr substitution in an encoded polypeptide, wherein said polypeptide has acetohydroxyacid synthase activity, and wherein the nucleic acid sample comprises SEQ ID No. 1; and d) applying one or more imidazolinone herbicides to the identified herbicide-resistant sorghum plant, wherein the sorghum plant has increased resistance to one or more imidazolinone herbicides as compared to wild-type sorghum plants.
Description
DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION OF THE INVENTION
(6) In order to obtain herbicide-tolerant plants, endogamic sorghum (Sorghum bicolor) line 80237 plants were treated with an aqueous solution of ethyl methanesulfonate (EMS). Treated seeds were planted and left for open pollination. Two hundred and seventy three M1 plants were selected and two seeds of each plant were planted in a nursery, thereby obtaining a total of 546 M2 plants. Pollen from one plant of each pair was collected and used for pollinating the other plant of the pair. M3 seeds obtained from each of the 273 pollinated M2 plants were harvested. A total of 273 furrows were planted with the M3 progeny. Fifty plants from each M3 furrow were sprayed with 100 ml L a.i./ha of imazethapyr. Sixty eight plants from the furrows showed normal growth and absence of symptoms after the treatment with herbicide and were considered as resistant to the herbicide and identified as VT09-9754. The genealogy of the resistant plants from the furrows was identified and they were designated 80237EMS2-192 (hereinafter referred to as ADV-IMI-R). Herbicide-tolerant M7 mutant plants and seeds selected from the original ADV-IMI-R mutant (designated VT11-11331-BK) were obtained and deposited with the NCIMB collection with Access No. NCIMB 41870, under the terms of the Budapest Treaty, on Oct. 12, 2011.
(7) The present invention is not limited to sorghum plants mutated with EMS. Within the scope of the present invention are sorghum plants obtained by other mutation methods, for example methods such as radiation and chemical mutagens. Herbicide-resistant mutant plants can also be obtained by means of a process of selective pressure on cells cultured with a herbicide and selection of resistant cells to generate a herbicide-resistant plant. Details of mutation and breeding methods can be found in Principles of Cultivar Development Fehr, 1993, Macmillan Publishing Company, the disclosure of which is included herein by reference.
(8) Subsequently, the effect to herbicide spraying on mutant imidazolinone-resistant plants ADV-IMI-R (original mutation) was compared to the response of endogamic sorghum line 80237 (Advanta proprietary elite line). To that end, plants were treated on the field with three herbicides belonging to the imidazolinone family: imazethapyr, imazapir, and imazapic. Four different rates were assayed: 1?, 2?, 3?, and 4? for each of the herbicides. The recommended field application rate (1?) for each herbicide is shown in Table 1.
(9) TABLE-US-00001 TABLE 1 Recommended field application rate for each herbicide Herbicide Trade name Recommended rate (1X) Imazethapyr Pivot? (BASF) 100 ml a.i./ha Imazapyr Clearsol 80 g a.i./ha DF?(BASF) Imazapic Cadre? (BASF) 50.4 g a.i./ha
(10) Ten days after spraying, all plants were assayed for dry matter (DM) in aerial tissues. The results are shown in
(11) The response of the ADV-IMI-R mutant of the invention was compared to that of endogamic line 80237. Table 2 shows the effect of different rates of imazethapyr, imazapyr, and imazapic expressed as a percentage of dry matter as compared to the untreated control (DM % Control). The disclosed values are the average of three experiments.
(12) TABLE-US-00002 TABLE 2 DM % Control Herbicide Rate 80237 ADV-IMI-R Untreated control 0X 100 100 Imazethapyr 1X 17 162 2X 12 175 3X 14 263 4X 23 273 Imazapyr 1X 14 139 2X 21 140 3X 14 235 4X 19 191 Imazapic 1X 22 161 2X 13 123 3X 15 244 4X 28 272
(13) These results show that the ADV-IMI-R mutant of the invention is resistant to the three tested herbicides of the imidazolinone group, even at a rate of 4?. On the contrary, the original endogamic line 80237 is clearly sensitive to all the herbicides, even when the recommended rate (1?) is applied.
(14) As can be seen, the herbicide-resistant sorghum plant of the present invention is resistant to herbicides of the imidazolinone group, such as, imazethapyr, imazapic, or imazapyr.
(15) The imidazolinone-resistant sorghum plants may be sprayed with amounts which are 4 times the recommended amounts of use of any of the group of known imidazolinone herbicides. The resistant plant may have, for example, the resistance traits as observed in plants from NCIMB 41870 seeds, or it may be a plant derived therefrom, a progeny, or other plants comprising in their genome at least one polynucleotide encoding a polypeptide having an alanine to tyrosine substitution at position 93 of the sorghum AHAS protein or at an equivalent position, said plant having increased resistance to one or more herbicides from the imidazolinone group as compared to wild-type sorghum plants.
(16) Furthermore, those of ordinary skill will recognize that such amino acid positions can vary depending on whether amino acids are added or removed, e.g., from the N-terminal end of an amino acid sequence. By equivalent position it is intended to mean a position that is within the same conserved region as the exemplified amino acid position.
(17) In the present invention the terms tolerant to a herbicide and resistant to a herbicide have the same meaning and an equivalent scope when used in relation to herbicides such as imidazolinones or sulfonylureas.
(18) The present invention provides plants, plant cells, plant tissues showing resistance to effective amounts of herbicides. By effective amounts is meant amounts of herbicide capable of inhibiting the growth of wild-type plants, plant cells or tissues but which do not produce severe effects on resistant plants, plant cells or plant tissues. An effective amount of a herbicide is the recommended amount for eliminating weeds. A wild-type plant, cell or tissue is one that does not exhibit herbicide resistance traits, for example a herbicide belonging to the group of imidazolinones or sulfonylureas. The term plant encompasses a plant in any stage, or plant parts, where said plant parts may be seeds, leaves, flowers, stems, tissues or organs, well known to a skilled botanist.
(19) In order to detect the mutation, the mutated sorghum AHAS gene of the invention which encodes a polypeptide having acetohydroxyacid synthase activity was sequenced, wherein said AHAS polypeptide or large subunit is herbicide-resistant.
(20) A comparison of the AHAS gene DNA sequence from mutated plants with the AHAS gene DNA sequences from wild-type sorghum plants identified a point mutation by which a G nucleotide at nucleotide position +277 changes into A, which distinguishes the original sorghum 80237 line (wild-type) from the ADV-IMI-R mutant of the invention. When AHAS amino acid sequences from mutant and wild-type lines were deduced it was observed that the nucleotide substitution (GCG by ACG of SEQ ID No. 1) encoded a mutated polypeptide at codon 93 and produced an alanine to tyrosine (Ala93Tyr) substitution in the polypeptide (SEQ ID No. 2) exhibiting acetohydroxyacid synthase activity and corresponds to the large subunit of sorghum AHAS protein of the mutated ADV-IMI-R line.
(21) Within the scope of the present invention are plants, plant parts, seeds, progeny thereof, transgenic plants or the like comprising a polynucleotide encoding a polypeptide having an alanine-to-tyrosine (Ala93Tyr) substitution at position 93 of said polypeptide or at an equivalent position of another AHAS enzyme belonging to different species.
(22) Within the scope of the present invention is a polynucleotide or a polypeptide having a sequence identity of at least 85%, 95%, or 98%. Sequence identity percent is determined by alignment of two amino acid sequences or two nucleotide sequences. Alignment percentage between two sequences may be calculated, for example, using the following formula:
(amount of identical positions/total amount of overlapping positions)?100
(23) Alignment percentage between two sequences is determined using different mathematical algorithms, for example, the algorithms included in the NBLAST and XBLAST programs of Altschul et al., (1990) J. Mol. Biol. 215: 403. When utilizing BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov. Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller (1988) CABIOS 4:11-17. Such an algorithm is incorporated into the ALIGN program (version 2.0), which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used. Alignment may also be performed by manual inspection.
(24) The present invention comprises polynucleotides and proteins conferring herbicide resistance. It is understood that when reference is made to a herbicide-resistant polynucleotide it means a polynucleotide encoding a herbicide-resistant AHAS protein. Herbicide-resistant AHAS proteins may be natural or mutant and they confer resistance to herbicides belonging to the group of imidazolinones or sulfonylureas.
(25) Inheritance of resistance to imidazolinones, for example imazethapyr, was assessed in a segregating F2 sorghum population generated by crossing an imazethapyr susceptible line with the ADV-IMI-R mutant. The F2 plants thus obtained were sprayed with imazethapyr (Pivot?, BASF) at a rate of 3?, 20 days in stage V6 after emergence and phenotypic symptoms were assessed 10 days after treatment. The results are provided in Table 3.
(26) TABLE-US-00003 TABLE 3 Distribution of plants based on phenotypic rating Phenotype Phenotypic rating Amount of F2 progeny No damage 1 50 Chlorotic 2 84 Death 3 43 177
(27) The results show that the F2 plant population could be classified based on visual symptoms according to a phenotype scoring that allowed for grouping individuals into three phenotypic categories: plants with no damage, chlorotic plants and dead plants.
(28) Sequencing showed that the herbicide-tolerant sorghum mutant of the invention had a point mutation in the polypeptide having acetohydroxyacid synthase activity or the large subunit of AHAS protein. The nucleotide sequence set forth in SEQ ID No. 1 shows that nucleotide G is changed to A at nucleotide position +277 (corresponding to codon 93) which distinguishes the sorghum original endogamic line 80237 (susceptible to herbicides) from the induced ADV-IMI-R mutant of the invention. This molecular marker was designated SNP-SbAHAS.
(29) In order to determine the usefulness of the SNP-SbAHAS marker for detecting potentially herbicide-resistant plants, plant parts or seeds, 177 plants from an F2 population generated by crossing the herbicide-resistant ADV-IMI-R mutant (selection VT09-9754-48-6-BK) with the herbicide-susceptible endogamic line 90523 (herein designated population ADV-IMI-R?90523 F2) were tested.
(30) Those skilled in the art may, in view of the disclosure of the SNP-SbAHAS marker and its use, identify herbicide-resistant plants, for example to herbicides belonging to the group of imidazolinones and/or sulfonylureas, e.g., imazethapyr, imazapic, or the like. The identification method may be, in addition to the method described herein, any other known method, see for example ASA (Soleimani et al., (2003) Plant Mol Biol Rep 21: 281-288), PAMSA (Daudet et al., (2007) Plant Mol Biol Rep 25: 1-9), SSCP (Germano and Klein (1999) Theor Appl Genet 99: 37-49) or TagMan? (Jones et al., (2008) Pest Management Science 64: 12-15).
(31) The correlation between resistance phenotypes and the number of mutant alleles was analyzed using the SNP-SbAHAS marker. To that end, chlorosis and death phenotypes of individual plants from the F2 progeny (ADV-IMI-R?90523) were studied after spraying with imazethapyr. Concomitantly, the genotype of the SNP-SbAHAS marker was studied. The results are shown in Table 4. The correlation between the molecular marker SNP-SbAHAS and resistance to imazethapyr (measured as a rating of phenotypes) was determined using the Chi-square Independence test. The test resulted in a probability p=1.948e.sup.?46 indicative of a highly significant correlation between the induced mutation in the AHAS gene (genotyped using the specific SNP-SbAHAS marker) and resistance to imazethapyr in accordance with phenotype and genotype co-segregation.
(32) TABLE-US-00004 TABLE 4 Phenotypes and ratings of resistance to Imazethapyr for the ADV-IMI-R ? 90523 F2 progeny based on the analysis of SNP-SbAHAS. A/A homozygous AHAS mutant; A/G heterozygous; G/G wild-type homozygous Amount of F2 individuals for each genotype Phenotype Phenotypic score A/A A/G G/G No damage 1 37 13 50 Chlorotic 2 1 83 84 Death 3 43 43 38 96 43 177
(33) Further, genetic mapping of herbicide-resistance and the specific SNP-SbAHAS marker was carried out. Based on the sorghum AHAS sequence disclosed in GenBank (Access No. GM663363.1, SEQ ID No. 4), a BLAST analysis was carried out to match Sorghum bicolor DNA sequence with the Phytozome database (http://www.phytozome.net/search.php). The results shown in
(34) usda.gov/psgd/sorghum/2009SorghumSEAMs_LBKARS.xls)
(35) With the results of this procedure it was possible to genetically map both the SNP-SbAHAS marker and the resistant phenotype, showing that the resistance to imidazolinones and the specific SNP-SbAHAS marker were located in chromosome 4 flanked by the previously identified SSRs in chromosome 4 of Sorghum bicolor (
(36) The polynucleotide of the invention (SEQ ID No. 1) may be introduced in plants for obtaining transgenic plants. There are different methods for introducing a polynucleotide in plants, particularly in plants of agronomic interest, e.g., corn, soybean, sorghum, wheat, sugarcane, flax, sunflower or other plants; vegetables, trees, or ornamental plants. Methods for introducing polynucleotides to obtain transgenic plants are well-known in the art, and recombinant methods may also be used.
(37) There are different methods for plant transformation, for example using vectors (An, G. et al., (1986) Plant Pysiol., 81: 301-305; Fry, J., et al., (1987) Plant Cell Rep., 6: 321-325; Block, M. (1988) Theor. Appl Genet., 76: 767-774; Hinchee, et al., (1990) Stadler. Genet. Symp., 203212.203-212; Barcelo, et al., (1994) Plant J., 5: 583-592; Becker, et al., (1994) Plant J., 5: 299-307; Borkowska et al., (1994) Acta Physiol Plant., 16: 225-230; Christou, et al., (1992) Trends Biotechnol., 10: 239-246; D'Halluin, et al., (1992) Bio/Technol., 10: 309-314; Dhir, et al., (1992) Plant Physiol., 99: 81-88; Casas et al., (1993) Proc. Nat. Acad Sci. USA 90: 11212-11216; Dong, J. A. and Mchughen, A. (1993) Plant Sci., 91: 139-148; Golovkin, et al., (1993) Plant Sci., 90: 41-52; Guo Chin Sci., Bull., 38: 2072-2078; Asano, et al., (1994) Plant Cell Rep., 13; Christou, P. (1994) Agro. Food. Ind. Hi Tech., 5: 17-27; Eapen et al., (1994) Plant Cell Rep., 13: 582-586; Hartman, et al., (1994) Bio-Technology 12: 919923; Christou, P. (1993) In Vitro Cell. Dev. Biol.-Plant; 29P: 119-124; Davies, et al., (1993) Plant Cell Rep., 12: 180-183; Ritala, et al., (1994) Plant. Mol. Biol. 24:317-325; and Wan, Y. C. and Lemaux, P. G. (1994) Plant Physiol., 104:3748).
(38) Some methods for transforming plants and genetic engineering techniques are described in Sambrook, et al., (1989) Molecular cloning, A laboratory manual, Cold Spring Harbor Press, Plainview, N.Y.; Ausubel F M, et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, N.Y.
(39) The vector may also be introduced using ballistic particle acceleration techniques such as described in U.S. Pat. No. 4,945,050 and Casas el. al., Proc. Natl. Sci., USA, 90: 11212, 1993
(40) Plants transformed, for example, with the polynucleotide of the invention express herbicide-resistant AHAS proteins and exhibit resistance traits to herbicides such as imidazolinones and/or sulfonylureas. By herbicide-resistant AHAS proteins are meant proteins exhibiting an AHAS activity which is higher than that of wild-type AHAS activity when in the presence of a herbicide interfering with AHAS activity at concentrations at which the herbicide interferes with AHAS activity of the wild-type AHAS protein.
(41) The polynucleotide sequence of the invention may be included in an expression cassette for expressing the resistant AHAS protein in a plant of interest, for example of agronomic interest. The cassette comprises a regulatory sequence operably linked, e.g., to at least one promoter. Promoters are well known in the art, and may be, e.g., constitutive, inducible, tissue-specific, chloroplast-specific promoters, all of them being functional in plants. The cassette further comprises transcriptional termination sequences known in the art. The cassette may comprise various regulatory sequences in order to improve expression efficiency of the herbicide-resistant AHAS polynucleotide, for example enhancers such as introns, viral sequences or the like; or may comprise other polynucleotide sequences of interest different from the polynucleotide of the invention, bound or not to said polynucleotide; or leader sequences.
(42) Promoters include, but are not limited to, constitutive, inducible, tissue- or organelle-specific promoters, such as the 35S promoter, a wound- or chemical-inducible promoter, a heat shock promoter, a tetracycline-inducible promoter or the like (Chao et. al. 1999, Plant Physiol., 120: 979; U.S. Pat. Nos. 5,187,267, 5,057,422.
(43) Also known by those skilled in the art are suitable transcription terminators which may be of use in plants, see, e.g., Odell, et al., 1985, Nature 313: 810; Sanfacon, et. al., Genes Dev., 5: 141, 1990; Munroe, et al., 1990 Gene 91: 151; Rosenberg et al., 1987, Gene 56: 125; Joshi, et al., Nucleic Acid Res., 15: 9627, 1987.
(44) Operably linked is intended to refer to a functional linkage between a promoter and a second sequence. The promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. The term operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame. The cassette may be a multiple expression cassettes.
(45) The polynucleotide of the invention may be attached to other polynucleotides in the form of a fusion of polynucleotides or separately. The other polynucleotide(s) may encode, e.g., herbicide-resistant, insect-resistant or other plant parts which are well-known by those skilled in the art.
(46) To improve expression in plants, the polynucleotide of the invention may be modified, for example by including plant-preferred codons, deleting sequences such as introns or deleterious sequences. Also, within the scope of the present invention is a polynucleotide encoding the resistant AHAS polypeptide of the invention which has been mutated, and exhibits, e.g., deletions or insertions or other mutations different from the one described herein. By mutated polynucleotide is meant a polynucleotide having permanent changes in its nucleotide sequence.
(47) The polynucleotide of the invention may be altered by substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. Methods for mutagenesis and nucleotide sequence alterations are well known in the art (Kunkel (1985) Proc. Natl. Acad. Sci., USA 82: 488-492; Kunkel et al., (1987) Methods in Enzymol., 154: 367-382; Walker and Gaastra, eds., (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Amino acid substitutions that do not affect biological activity of the protein of interest may be found in Dayhoff et al., (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), herein incorporated by reference.
(48) The DNA comprising the AHAS polynucleotide of the invention may be introduced in different plants as part of a vector. The choice of a suitable vector depends on the method intended to be used for the transformation and the plant to be transformed. Those skilled in the art are well aware of different vectors, e.g., Ti and/or Ri. T-DNA is also used as flanking regions for integrating Ti or Ri vectors (WO 84/02913, Herrera-Estrella et al., 1983, Nature 303: 209; Horsch et al., 1984, Science 223: 496; Fraley et. al., 1983, Proc. Natl. Acad. Sci, USA 80: 4803.
(49) The vector may comprise an expression cassette and other nucleotide sequences, for example selectable markers such as markers conferring resistance to antibiotics or herbicides and sequences for driving the expression of polynucleotide(s) of interest in plants, e.g., the AHAS large subunit polypeptide of SEQ ID No. 2.
(50) A vector comprising a polynucleotide encoding the resistant AHAS polypeptide of the invention may be useful for obtaining a transgenic plant which is resistant to herbicides of the type of imidazolinones and sulfonylureas. The transformed plants may be any type of plants such as dicots and monocots, among which are, without limitation, plants of agronomic interest such as sorghum (Sorghum bicolor, Sorghum vulgare), maize (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), millet (Pennisetum glaucum), (Panicum miliaceum), (Setaria italica), (Eleusine coracana), sunflower (Helianthus annuus), wheat (Triticum aestivum, T. Turgidum ssp. durum), soybean (Glycine max), tobacco (Nicotiana tabacum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Coffea spp.), coconut (Cocos nucifera), safflower (Carthamus tinctorius), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Persea americana), olive (Olea europaea), cashew (Anacardium occidentale), almond (Prunus amygdalus), sugar beets (Beta vulgaris), potato (Solanum tuberosum), sugarcane (Saccharum spp.), vegetables, ornamentals, and trees. Preferably, the plant of the present invention is sorghum.
(51) The invention is further described by the following numbered paragraphs:
(52) 1. A sorghum plant comprising in its genome at least one polynucleotide, wherein said polynucleotide encodes a polypeptide having an alanine to tyrosine substitution at position 93 of the large subunit of sorghum AHAS protein, said plant having increased resistance to one or more herbicides as compared to wild-type sorghum plants.
(53) 2. The sorghum plant according to paragraph 1, wherein the herbicide is selected from the group consisting of imidazolinone and sulfonylurea
(54) 3. The sorghum plant according to paragraph 2, wherein the imidazolinone herbicide is selected from the group consisting of imazethapyr, imazapir, and imazapic.
(55) 4. The sorghum plant according to paragraph 1, wherein at least one polynucleotide comprises SEQ ID No. 1.
(56) 5. The sorghum plant according to paragraph 1, wherein the encoded polypeptide comprises SEQ ID No. 2.
(57) 6. The sorghum plant according to paragraph 1, comprising a mutation in the AHAS gene as set forth in NCIMB 41870.
(58) 7. The sorghum plant according to paragraph 1, wherein said sorghum plant comprises increased resistance traits to one or more herbicides of the imidazolinone group as the resistance set forth for NCIMB 41870.
(59) 8. The sorghum plant according to any of paragraphs 6 and 7, wherein said sorghum plant with increased resistance to one or more herbicides is useful for introducing the resistance trait by introgression into another sorghum plant.
(60) 9. The sorghum plant according to paragraph 1, wherein said plant is transgenic.
(61) 10. The sorghum plant according to paragraph 1, wherein said plant is non-transgenic.
(62) 11. A herbicide-resistant sorghum plant comprising the resistance traits of NCIMB 41870, wherein the sorghum plant is selected from the group consisting of a plant such as NCIMB 41870, a progeny of the NCIMB 41870 plant, an NCIMB 41870 mutant plant and a progeny of the NCIMB 41870 mutant.
(63) 12. The sorghum plant according to paragraph 11, wherein the herbicide belongs to the group of imidazolinones.
(64) 13. The sorghum plant according to paragraph 11, wherein said plant is transgenic.
(65) 14. The sorghum plant according to paragraph 11, wherein said plant is non-transgenic.
(66) 15. A sorghum seed, comprising in its genome at least one polynucleotide, wherein said polynucleotide encodes a polypeptide having an alanine to tyrosine substitution at position 93 of the large subunit of sorghum AHAS protein.
(67) 16. The seed according to paragraph 15, wherein said seed generates a plant having increased resistance to one or more herbicides from the group of imidazolinones as compared to wild-type sorghum plants.
(68) 17. The seed according to paragraph 15, wherein said seed comprises a mutation in the AHAS gene as shown in the deposited seed NCIMB 41870.
(69) 18. A seed of a plant according to any of paragraph 1 to 10.
(70) 19. A seed of the plant according to any of paragraphs 11 to 14.
(71) 20. A method for identifying a herbicide-resistant plant, comprising: a) providing a nucleic acid sample from a sorghum plant; b) amplifying a region corresponding to the AHAS gene present in said nucleic acid sample from a sorghum plant; c) identifying a herbicide-resistant plant based on the presence of at least one mutation in the amplified nucleic acid sample, where said mutation confers resistance to herbicides from the imidazolinone group.
(72) 21. The method according to paragraph 20, wherein the nucleic acid sample comprises at least one mutation such as the mutation present in NCIMB 41870.
(73) 22. The method according to paragraph 20, wherein said at least one mutation comprises an Ala93Tyr substitution in the encoded polypeptide, wherein said polypeptide has acetohydroxyacid synthase activity.
(74) 23. The method according to paragraph 20, wherein the nucleic acid sample comprises SEQ ID No. 1.
(75) 24. The method according to paragraph 22, wherein the polypeptide comprises SEQ ID No. 2.
(76) 25. The method according to paragraph 20 wherein the plant is a monocot.
(77) 26. The method according to paragraph 20 wherein the plant is a dicot.
(78) 27. The method according to paragraph 20 wherein the plant is a transgenic plant.
(79) 28. The method according to paragraph 20, wherein the plant is a non-transgenic plant.
(80) 29. The method according to paragraph 20, wherein the herbicide is selected from the group of imidazolinones and sulfonylureas.
(81) 30. A method of weed control in close proximity to crop plants, comprising applying an effective amount of a herbicide from the group of imidazolinones or sulfonylurea to weed and crop plants.
(82) 31. The method according to paragraph 30, wherein the imidazolinone herbicide is selected from the group consisting of imazethapyr, imazapic, and imazapyr.
(83) 32. The method according to paragraph 30, wherein the crop plant is selected from the group consisting of a) a sorghum plant comprising in its genome at least one polynucleotide, wherein said polynucleotide encodes a polypeptide having an alanine to tyrosine substitution at position 93 of the sorghum AHAS protein, wherein said plant has increased resistance to one or more herbicides from the group of imidazolinone or sulfonylurea as compared to wild-type sorghum plants; b) a sorghum plant comprising a mutation in the AHAS gene such as in NCIMB 41870; c) a sorghum plant comprising increased resistance traits to one or more herbicides from the group of imidazolinone or sulfonylurea such as the resistance shown by NCIMB 41870. d) a plant, progeny, derivative or mutant of sorghum plants a) to c).
(84) 33. A polynucleotide, comprising a nucleotide sequence selected from the group consisting of: a) the nucleotide sequence set forth in SEQ ID No. 1, b) a nucleotide sequence encoding the polypeptide set forth in SEQ ID No. 2; c) a nucleotide sequence encoding a polypeptide having at least 95% sequence identity to amino acid sequence SEQ ID No. 2, wherein the polypeptide has herbicide-resistant AHAS activity; d) a nucleotide sequence having at least 85% identity to the nucleotide sequence set forth in SEQ ID No. 1, wherein the nucleotide sequence encodes a polypeptide comprising a large subunit of AHAS and exhibits herbicide-resistant AHAS activity; e) a nucleotide sequence fully complementary to one of nucleotide sequences a) to (d).
(85) 34. The polynucleotide according to paragraph 33, wherein said polynucleotide encodes a polypeptide comprising an Ala93Tyr substitution in the large subunit of AHAS.
(86) 35. An expression cassette comprising, operably linked thereto, the nucleotide sequence of paragraph 33.
(87) 36. The expression cassette according to paragraph 35, further comprising at least one promoter that drives the expression of the polynucleotide.
(88) 37. The expression cassette according to paragraph 36, wherein the promoter is selected from the group comprising promoters for expression in plants, bacteria, fungi, animal cells and protozoa. 38. A cell transformed with the expression cassette of paragraph 35.
(89) 39. The cell according to paragraph 38, wherein said cell is selected from the group consisting of bacteria, fungi, yeast, plant cells, and animal cells.
(90) 40. A transformation vector having a polynucleotide which comprises a nucleotide sequence selected from the group of: a) the nucleotide sequence set forth in SEQ ID No. 1, b) a nucleotide sequence encoding the polypeptide set forth in SEQ ID No. 2; c) a nucleotide sequence encoding a polypeptide having at least 95% sequence identity to amino acid sequence SEQ ID No. 2, wherein the polypeptide exhibits herbicide-resistant AHAS activity; d) a nucleotide sequence having at least 85% identity to the nucleotide sequence set forth in SEQ ID No. 1, wherein the nucleotide sequence encodes a polypeptide comprising a large subunit of AHAS and exhibits herbicide-resistant AHAS activity; e) a nucleotide sequence fully complementary to one of the nucleotide sequences a) to (d); wherein the vector further comprises a selectable gene, at least one promoter operably linked to the nucleotide sequence capable of driving the expression of said nucleotide sequence.
(91) 41. Use of the vector of paragraph 40, for transforming cells selected from the group comprising bacteria, fungi, yeast, plant cells and animal cells.
(92) 42. A transformed plant, wherein said plant comprises at least one promoter integrated in its genome, which is operably linked to a polynucleotide selected from the group comprising: a) the nucleotide sequence set forth in SEQ ID No. 1, b) a nucleotide sequence encoding the polypeptide set forth in SEQ ID No. 2; c) a nucleotide sequence encoding a polypeptide having at least 95% sequence identity to amino acid sequence SEQ ID No. 2, wherein the polypeptide exhibits herbicide-resistant AHAS activity; d) a nucleotide sequence having at least 85% identity to the nucleotide sequence set forth in SEQ ID No. 1, wherein the nucleotide sequence encodes a polypeptide comprising a large subunit of AHAS and exhibits herbicide-resistant AHAS activity; e) a nucleotide sequence fully complementary to one of the nucleotide sequences a) to (d); wherein the vector further comprises a selectable gene, at least one promoter operably linked to the nucleotide sequence capable of driving the expression of said nucleotide sequence.
(93) 43. The plant according to paragraph 42, wherein the promoter is selected from the group consisting of a tissue-specific promoter and a chloroplast-specific promoter.
(94) 44. The plant according to paragraph 42, wherein the plant is a monocot.
(95) 45. The plant according to paragraph 42, wherein the plant is a dicot.
(96) 46. The plant according to paragraph 44, wherein the plant is selected from the group consisting of sorghum, corn, rice, and wheat.
(97) 47. The plant according to paragraph 45, wherein the plant is selected from the group consisting of soybean and oilseed rape.
(98) 48. The plant according to paragraph 42, wherein said plant comprises increased herbicide resistance as compared to the non-transformed plant.
(99) 49. The plant according to paragraph 42, wherein the herbicide is selected from the group consisting of imidazolinones and sulfonylureas.
(100) 50. A method for obtaining a herbicide-resistant plant or a plant with increased herbicide resistance, wherein said method comprises i) transforming a plant cell with an expression cassette or vector comprising a polynucleotide having a nucleotide sequence selected from the group of a) the nucleotide sequence set forth in SEQ ID No. 1; b) a nucleotide sequence encoding the polypeptide set forth in SEQ ID No. 2; c) a nucleotide sequence encoding a polypeptide having at least 95% sequence identity to amino acid sequence SEQ ID No. 2, wherein the polypeptide exhibits herbicide-resistant AHAS activity; d) a nucleotide sequence having at least 85% identity to the nucleotide sequence set forth in SEQ ID No. 1, wherein the nucleotide sequence encodes a polypeptide comprising a large subunit of AHAS and exhibits herbicide-resistant AHAS activity; and e) a nucleotide sequence fully complementary to one of the nucleotide sequences a) to d), wherein the expression cassette further comprises at least one promoter operably linked to the polynucleotide, wherein said promoter drives the expression of said polynucleotide; ii) regenerating the plant cell to obtain a herbicide-resistant plant.
(101) 51. The method according to paragraph 50, wherein the promoter comprises a plant tissue-specific promoter.
(102) 52. The method according to paragraph 50, wherein the promoter comprises a chloroplast specific promoter.
(103) 53. The method according to paragraph 50, wherein the herbicide is selected from the group consisting of imidazolinone and sulfonylurea.
(104) 54. The method according to paragraph 53, wherein the imidazolinone herbicide is selected from the group comprising imazethapyr, imazapic, and imazapyr.
(105) 55. The method according to paragraph 50 wherein the plant is a monocot.
(106) 56. The method according to paragraph 50 wherein the plant is a dicot.
(107) 57. The method according to paragraph 55, wherein the plant is selected from the group consisting of sorghum, corn, rice, and wheat.
(108) 58. The method according to paragraph 56, wherein the plant is selected from the group consisting of soybean and oilseed rape.
(109) 59. The method according to paragraph 50, wherein said plant comprises increased herbicide resistance as compared to the non-transformed plant.
(110) 60. The method according to paragraph 50, wherein said plant comprises the large subunit of AHAS and exhibits herbicide-resistant AHAS activity.
(111) This invention is better illustrated in the following examples, with should not be construed as limiting its scope. On the contrary, it should be clearly understood that other embodiments, modifications and equivalents of the invention may be possible after reading the present description, which someone skilled in the art could suggest without departing from the spirit of the present invention and/or the scope of the appended claims.
EXAMPLES
Example 1
(112) Mutagenesis of Endogamic Sorghum Line 80237 and Selection of Imidazolinone-Resistant Mutant 80237EMS2-192
(113) Thirty two thousand pre-germinated sorghum seeds from endogamic line 80237 were dipped into an aqueous solution of 0.05% v/v ethyl methanesulfonate (EMS) for 16 hours. Treated seeds were planted at the Experimental Station of Advanta Seeds in Venado Tuerto, Province of Santa Fe, Argentina, plot No. 1 (33? 41 47 S; 61? 58 45 W) on Dec. 21, 2007, and they were left for open pollination.
(114) A total of 273 M1 plants were selected and two seeds from each plant were planted on May 23, 2008, at the Experimental Station of Advanta Seeds in Oran, Province of Salta, Argentina (22? 49 37 S; 64? 20 14 W) in a nursery and a total of 546 M2 plants was obtained. Pollen from one plant of each pair was collected and used for pollinating the other plant of the pair. M3 seeds obtained from each of the 273 pollinated M2 plants were harvested. A total of 273 furrows of M3 progeny were planted on Dec. 16, 2008, in Venado Tuerto and 50 plants from each M3 furrow were sprayed with 100 ml L a.i./ha of imazethapyr on Dec. 23, 2008. Sixty eight plants from the furrows showed normal growth and absence of symptoms after treatment with herbicide and were considered resistant to the herbicide and identified as VT09-9754. The genealogy of the resistant plants from the furrows was identified and they were designated 80237EMS2-192 (hereinafter referred to as ADV-IMI-R).
(115) The generational history is shown in Table 5.
(116) TABLE-US-00005 TABLE 5 LOCATION- FURROW- GENERA- PLANTING SELECTION TION GENEALOGY DATE OR08-323-192 M3 80237EMS2-192 May 23, 2008 VT09-9754-47 M4 80237EMS2-192-47 Dec. 16, 2008 OR09-1305-1 M5 80237EMS2-192-47-1 May 28, 2009 VT10-12793- M6 80237EMS2-192-47-1 Dec. 15, 2009 2R VT11-11331- M7 80237EMS2-192-47-1-2- Dec. 7, 2010 BK (R) OR: Oran; VT: Venado Tuerto
Example 2
(117) Analysis of Response Rate to Treatment With Imidazolinones in Resistant ADV-IMI-R Mutant as Compared to the Original Sorghum Endogamic Line 80237
(118) Sorghum line 80237 (Advanta's proprietary elite line) and imidazolinone-resistant ADV-IMI-R mutant of the present invention (original mutation) were sprayed on the field with three herbicides from the group of imidazolinones: imazethapyr, imazapyr, and imazapic. Four different rates were assayed for each of the herbicides: 1?, 2?, 3?, and 4? (being 1? the recommended application rate) (see Table 1 above):
(119) Field experiments were carried out in Venado Tuerto, and planting took place on Dec. 1, 2010. The herbicide was sprayed 20 days after emergence (stage V6). All treatments were compared to their respective untreated controls. The experimental design consisted of plots divided into 3 replicates (main plot: treatment with herbicide; sub-plots: line).
(120) Ten days after spraying, all plants were assayed for dry matter (DM) in aerial tissues. Herbicide response was assessed as a DM percentage in aerial tissue of the respective untreated control.
(121) Thus, the line sensitive to herbicides i for each rate j was expressed as:
DM.sub.ij% Control=(DM.sub.ij*100)/DM Control
DM.sub.ij% Control is the mean value of 3 experiments for each treatment from each line.
Example 3
(122) Sequencing of a Sorghum AHAS Gene Encoding the Mutated Polypeptide of the Invention Having Acetohydroxyacid Synthase Activity and Which is Imidazolinone-Resistant
(123) Sequencing studies were made on leaf tissue from ADV-IMI-R mutant (VT11-11331-BK selection) and wild-type endogamic line 80237. Genomic DNA was isolated and resuspended in water at a final concentration of 100 ng/?l. Sequencing of the acetohydroxyacid synthase (AHAS) gene from ADV-IMI-R mutant and from sorghum line 80237, specific primers were designed for amplification by the polymerase chain reaction (PCR) based on the sorghum AHAS sequence disclosed in GenBank under Access No. GM663363.1. The primers were designed so as to generate 5 overlapping DNA segments (amplicons) representing the complete AHAS coding sequence. Sequences of designed primers are:
(124) TABLE-US-00006 1.sup.stamplicon(544bp) SbAHAS-F1 CTCGCGCCGCCTCCGAGA (SEQIDNo.5) SbAHAS-R1 ATGCGCCGCGGAACCTGT (SEQIDNo.6) 2.sup.ndamplicon(579bp) SbAHAS-F2 TGCTCGACTCCGTCC (SEQIDNo.7) SbAHAS-R2 CATCAAACCGCACACC (SEQIDNo.8) 3.sup.rdamplicon(511bp) SbAHAS-F3 ATGCATGGCACGGTG (SEQIDNo.9) SbAHAS-R3 CAGCAGCCGGCAAAC (SEQIDNo.10) 4.sup.thamplicon(529bp) SbAHAS-F4 CACAGGTGTTGGGCA (SEQIDNo.11) SbAHAS-R4 CTTGAAAGCCCCACCA (SEQIDNo.12) 5.sup.thamplicon(666bp) SbAHAS-F5 GGAGCTAGCTATGATCCGAA (SEQIDNo.13) SbAHAS-R5 CAGAACCACTGCATAGCA (SEQIDNo.14)
(125) The PCR mixture had a final volume of 25 ?l and the following components: 1? reaction buffer (Invitrogen) 0.2 mM dNTPs (GE Healthcare), 2.5 mM MgCl.sub.2 (Invitrogen), 0.2 ?M of each primer, 0.5 ?l Platinum Taq (5 U/?l) (Invitrogen) and 100 ng of genomic DNA. The PCR reaction was performed in a GeneAmp PCR System 9700 thermocycler (Perkin-Elmer) and amplification conditions were as follows: a step of initial denaturation at 94? C. for 1 minute followed by 35 cycles at 94? C. for 45 seconds, 57? C. for 45 seconds, and 72? C. for 70 seconds, and a final elongation step at 72? C. for 10 minutes.
(126) No amplification products were obtained when the SbAHAS-F1 and SbAHAS-R1OLD1-R2 primers were used, both with ADV-IMI-R products as well as the original sorghum line 80237.
(127) In order to overcome this problem, two new primers were designed to generate a sixth amplicon:
(128) TABLE-US-00007 6.sup.thamplicon SbAHAS-F1-2 TCGAGGCTCTTGAGCGCTG (6289bp) (SEQIDNo.15) SbAHAS-R1-2 ATGCGCCGCGGAACCTGT (SEQIDNo.16)
(129) The same PCR conditions as those described above were used to obtain the 6.sup.th amplicon.
(130) Two ?l of each DNA product resulting from amplification by PCR were examined by agarose gel electrophoresis to analyze fragment sizes and estimated DNA concentration with reference to the molecular weight marker Low DNA Mass Ladder (Invitrogen). The remaining PCR products were purified using Wizard? SV gel (Promega) and PCR Clean-Up System (Promega). Purified DNA was sequenced using BigDye? Terminator v3.1 Cycle Sequencing System (Applied Biosystems) according to the manufacturer's instructions.
(131) Sequencing files for acetohydroxyacid synthase obtained with each amplicon were assembled using CAP3 Sequence Assembly Program (http://pbil.univ-lyon1.fr/cap3.php). The resulting DNA sequences of the acetohydroxyacid synthase gene were aligned using the Clustal W version 2.1 program (http://www.clustal.org).
Example 4
(132) Inheritance of Imazethapyr Resistance in a Segregating F2 Sorghum Population Generated by Crossing an Imazethapyr-Susceptible Line With the Resistant ADV-IMI-R Mutant
(133) A targeted crossing was carried out between sorghum line 90523 (Advanta proprietary elite line, susceptible to imidazolinones) and the imidazolinone-resistant ADV-IMI-R mutant (VT09-9754-48-6-BK selection). The resulting F1 plants were auto-pollinated and F2 seeds were harvested. The F2 seeds were planted in the field in Venado Tuerto, in October 2010. The F2 plants (177 plants) were sprayed with imazethapyr (Pivot?, BASF) at a rate of 3? (where 1? is the rate recommended by the manufacturer for commercial use which is equivalent to 100 ml a.i./ha). Before spraying, leaf tissue from each of the 177 F2 plants from both ADV-IMI-R mutant (VT09-9754-48-6-BK selection) and wild-type line 90523 were collected to isolate genomic DNA, which was resuspended in water at a final concentration of 100 ng/?l for use in genotypic analysis.
(134) Herbicide was sprayed 20 days after emergence (stage V6). The plants were assessed ten days after spraying, and the herbicidal effect was classified into three categories by visually assessed symptoms according to the following phenotypic scoring: 1=no damage 2=chlorotic 3=death
Example 5
(135) Development of DNA Markers Specific for SNP-SbAHAS
(136) A single point mutation in the AHAS gene replacing nucleotides G by A at nucleotide position +277 (codon 93) distinguishes the original endogamic sorghum line 80237 (herbicide-susceptible) from the induced ADV-IMI-R mutant. A molecular marker (designated herein as SNP-SbAHAS) was designed using the following group of dual labeled primers and probes:
(137) TABLE-US-00008 Primer/Probe Sequence Modification Forwardprimer CCGCGACGTCTTCGC (SEQIDNo.17) Reverseprimer TGCCTGGTGGATCTCCAT (SEQIDNo.18) Probe1 TACCCCGGCGGCACG 5'FAM-3'BHQ (SEQIDNo.19) Probe2 TACCCCGGCGGCGCG 5'VIC-3'BHQ (SEQIDNo.20)
(138) Genotyping was performed by a real time PCR allelic discrimination assay using an AB 7500 thermocycler (Applied Biosystems, Foster City, Calif., US). A PCR reaction mix was prepared in a final volume of 25 ?l comprising: 12.5 ?l 2? Perfecta? qPCR Supermix (Quanta Biosciences, Gaithersburg, Md., US), 0.08 ?M primers (forward and reverse), 0.4 ?M probes (1 and 2), 10 ?l genomic DNA and DNase-free water to make up the final volume. Amplification conditions: one initial denaturation cycle at 95? C. for 10 min, followed by 50 denaturation cycles at 92? C. for 15 seconds and hybridization/extension at 60? C. for 1 min. The results of the allelic discrimination assay were analyzed after amplification using the AB Sequence Detection System (SDS) 7500 1.4 software program (Applied Biosystems, Foster City, Calif., US).
Example 6
(139) Correlating Herbicide Resistance with AHAS Mutation in ADV-IMI-R Mutants
(140) Individual F2 progeny plants obtained by a ADV-IMI-R?90523 crossing were phenotypically classified (no damage, chlorosis and death) after spraying with imazethapyr (using the method of Example 4) and then genotypically classified using the molecular marker SNP-SbAHAS which is specific of the induced mutation in AHAS (using the method described in Example 5).
Example 7
(141) Genetic Mapping of Herbicide-Resistance and the Specific SNP-SbAHAS Marker
(142) Herbicide-resistance and the specific SNP-SbAHAS marker were genetically mapped. Based on the sorghum AHAS sequence disclosed in GenBank (Access No. GM663363.1, a BLAST analysis was carried out matching it with Sorghum bicolor genomic DNA sequences deposited in the Phytozome database (http://www.phytozome.net/search.php).
(143) Genotyping (fingerprinting) of the mutated ADV-IMI-R line and the endogamic line 90253 was carried out using a group of SSR-type molecular markers. Seven polymorphic SSRs located in chromosome 4 of Sorghum bicolor genome were selected for genotyping (Mace, E S et al., A consensus genetic map of sorghum that integrates multiple component maps and high-throughput Diversity Array Technology (DArT) markers, BMC Plant Biology, 2009, 9: 13; Srinivas, G et al., Exploration and mapping of microsatellite markers from subtracted drought stress ESTs in Sorghum bicolor (L.), Moench. Theor. Appl. Genet. 2009, 118: 703-717; Ramu, P et al., In silico mapping of important genes and markers available in the public domain for efficient sorghum breeding, Mol Breeding 2010, 26: 409-418; http://www.lbk.ars.usda.gov/psgd/sorghum/2009SorghumSEAMs_LB KARS.xls)
(144) The 7 selected polymorphic SSRs were:
(145) TABLE-US-00009 SSRin chromosome4 Forwardprimer Reverseprimer Xtxp12 AGATCTGGCGGCAACG(SEQIDNo.21) AGTCACCCATCGATCATC(SEQIDNo.22) Xtxp177 GCCGGTTGTGACTTG(SEQIDNo.22) TTAAAGCGATGGGTGTAG(SEQIDNo.24) Xtxp343 CGATTGGACATAAGTGTTC(SEQIDNo.25) TATAAACATCAGCAGAGGTG(SEQIDNo.26) Dsenhsbm39 TCAGTGATACAGCCGTCCAG(SEQIDNo.27) ATGCATAAACCACGGCTGTC(SEQIDNo.28) Xgap010 GTGCCGCTTTGCTCGCA(SEQIDNo.29) TGCTATGTTGTTTGCTTCTCCCTTCTC(SEQIDNo.30) Xsbarslbk4.50 GTGAAGCATCCCAACCCTTA(SEQIDNo.31) GCCTTTTTCCGTCTTCGAG(SEQIDNo.32) Xsgarslbk4.13 TCGGGTATTAGCCCTTTGTG(SEQIDNo.33) ACACCTCCTCTTGGTGGATG(SEQIDNo.34)
(146) The resulting PCR fragments from each of the tested SSRs were resolved by capillary electrophoresis using an automated sequencer ABI3130?1 (Applied Biosystems). Genotyping of these 7 SSRs was carried out in 177 individuals of the F2 progeny resulting from the ADV-IMI-R?90523 crossing. In addition, these same 177 F2 progeny plants were analyzed as to the presence of the SNP-SbAHAS marker specific for the induced mutation in the AHAS gene. The results were classified according to phenotypic rating upon application of imazethapyr on F2 progeny plants and analyzed using the computer program JoinMap (Van Ooijen, J W and Voorips, R E, JoinMap 3.0 Software for the calculation of genetic linkage maps, Plant Research International, 2001, Wageningen, The Netherlands).