CRISPR/CAS9-MEDIATED MEANS AND METHODS FOR CELL REPROGRAMMING
20240124891 ยท 2024-04-18
Inventors
- Wolfgang WURST (Muenchen, DE)
- Florian GIESERT (Muenchen, DE)
- Jessica GIEHRL-SCHWAB (Muenchen, DE)
- Benedict RAUSER (Muenchen, DE)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C07K2319/92
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2800/40
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N2840/445
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
C07K14/4705
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
Abstract
The present invention relates to CRISPR-mediated means and methods, e.g., for adjustably induction of multiple gene expression and subsequent cell reprogramming. Particularly, the CRISPR-mediated means and methods of the present invention relate to conversion of endogenous glial cells into GABAergic neurons representing an effective method for cell reprogramming.
Claims
1. A plurality of separate adeno-associated viruses (AAVs) comprising: (i) a first AAV comprising a first nucleic acid encoding a first portion of a Cas9 protein devoid of endonuclease activity; preferably said first nucleic acid further encoding a first split-intein polypeptide (e.g., an N-intein polypeptide), further preferably said first split-intein polypeptide having at least 80% sequence identity with the polypeptide having SEQ ID NO: 10 (N-Split-lntein) and having the intein activity (e.g., protein trans-splicing activity); most preferably said first portion of said Cas9 protein devoid of said endonuclease activity is devoid of an enzymatic activity having EC: 3.1.-further most preferably said first nucleic acid encoding the polypeptide having at least 80% sequence identity with the polypeptide having SEQ ID NO: 2 (N-dCas9-N-intein); optionally said first nucleic acid further encoding one or more guide RNAs (gRNAs) (e.g., said first nucleic acid is about 4.5 Kb in size); (ii) a second AAV comprising a second nucleic acid encoding a second portion of a Cas9 protein devoid of endonuclease activity; preferably said second nucleic acid further encoding a second split-intein polypeptide having complementarity to said first split-intein (e.g., a C-intein), further preferably said second split-intein polypeptide having at least 80% sequence identity with the polypeptide having SEQ ID NO: 12 (C-Split-lntein) and having the intein activity (e.g., protein trans-splicing activity); most preferably said second nucleic acid further encoding at least one polypeptide having a trans-activating activity (e.g., activating transcription) and/or one or more guide RNAs (gRNAs),; further most preferably said at least one polypeptide having trans-activating activity having at least 80% sequence identity with the polypeptide having SEQ ID NO: 20 (VP16); further most preferably said second portion of said Cas9 protein devoid of said endonuclease activity is devoid of an enzymatic activity having EC: 3.1.-.-.; further most preferably said second nucleic acid encoding the polypeptide having at least 80% sequence identity with the polypeptide having SEQ ID NO: 4 (C-dCas9-C-intein-VP64); (iii) a third AAV comprising a third nucleic acid encoding at least one polypeptide having a trans-activating activity (e.g., activating transcription) and capable of binding to and/or associating with an at least one guide RNA (gRNA) and/or said first and/or second portion of said Cas9 protein, wherein said third nucleic acid further encoding at least one guide RNA (gRNA) comprising at least one aptamer capable of binding at least one transcription co-activator protein (e.g., said co-activator protein comprising one or more of the following: (i) MS2 adaptor polypeptide having SEQ ID NO: 14; (ii) MS2-p65 polypeptide having SEQ ID NO: 16; and/or (iii) MS2-p65-HSF1 polypeptide having SEQ ID NO: 18), preferably said third nucleic acid encoding a synergistic activation mediator (SAM) complex and at least one guide RNA (gRNA) comprising at least one aptamer capable of binding at least one co-activator protein (e.g., said co-activator protein comprising one or more of the following: (i) MS2 adaptor polypeptide having SEQ ID NO: 14; (ii) MS2-p65 polypeptide having SEQ ID NO: 16; and/or (iii) MS2-p65-HSF1 polypeptide having SEQ ID NO: 18), most preferably comprising at least two aptamers, each capable of binding at least two co-activator proteins (e.g., said co-activator protein comprising one or more of the following: (i) MS2 adaptor polypeptide having SEQ ID NO: 14; (ii) MS2-p65 polypeptide having SEQ ID NO: 16; and/or (iii) MS2-p65-HSF1 polypeptide having SEQ ID NO: 18), (iv) optionally a fourth AAV comprising a fourth nucleic acid encoding a reporter polypeptide, preferably said reporter polypeptide is a fluorescent protein, further preferably said fluorescent protein is a green fluorescence protein; wherein said first portion of said Cas9 protein devoid of endonuclease activity and said second portion of said Cas9 protein devoid of endonuclease activity, when joined together, form a Cas9 protein devoid of endonuclease activity, preferably said formed Cas9 protein is capable of binding DNA.
2. The plurality of claim 1, wherein the first portion of the Cas9 protein is the N-terminal lobe of the Cas9 protein and the second portion of the Cas9 protein is the C-terminal lobe of the Cas9 protein.
3. The plurality of any one of the preceding claims, wherein: (i) the first portion of the Cas9 protein is the N-terminal lobe of the Cas9 protein up to amino acid 573 and the second portion of the Cas9 protein is the C-terminal lobe of the Cas9 protein beginning at amino acid 574; or (ii) the first portion of the Cas9 protein is the N-terminal lobe of the Cas9 protein up to amino acid 637 and the second portion of the Cas9 protein is the C-terminal lobe of the Cas9 protein beginning at amino acid 638.
4. The plurality of any one of the preceding claims, wherein the first nucleic acid encodes a first portion of the Cas9 protein having a first split-intein and wherein the second nucleic acid encodes a second portion of the Cas9 protein having a second split-intein complementary to the first split-intein, wherein the first portion of the Cas9 protein and the second portion of the Cas9 protein, when joined together, form the Cas9 protein (e.g., by intein-mediated protein trans-splicing).
5. The plurality of any one of the preceding claims, wherein the first nucleic acid encodes a first portion of the Cas9 protein having a Nostoc punctiforme (Npu) strain PCC73102 N-split-intein IntN and wherein the second nucleic acid encodes a second portion of the Cas9 protein having a Nostoc punctiforme (Npu) strain PCC73102 C-split-intein IntC, wherein the first portion of the Cas9 protein and the second portion of the Cas9 protein, when joined together, form the Cas9 protein.
6. The plurality of any one of the preceding claims, wherein the SAM complex comprises a MS2 coat protein (e.g., having SEQ ID NO: 14) fused to the p65 subunit of NF-kappaB (e.g., forming SEQ ID NO: 16) and the activation domain of human heat-shock factor 1 (HSF1) (e.g., forming SEQ ID NO: 18).
7. The plurality of any one of the preceding claims, wherein a second portion of a Cas9 protein devoid of endonuclease activity is fused to a transcription activation domain, preferably said transcription activation domain having at least 80% sequence identity with the polypeptide having SEQ ID NO: 20 (VP16).
8. The plurality of any one of the preceding claims, wherein the third nucleic acid further encodes a transcription activation domain.
9. The plurality of claim 7 or 8, wherein said transcription activation domain comprising at least one VP16 (SEQ ID NO: 20) domain, preferably comprising a quadruple VP16 (VP64) domain.
10. The plurality of any one of the preceding claims, wherein the Cas9 is a Type II CRISPR system Cas9.
11. A composition, kit, expression system or recombinant host cell (e.g., isolated) comprising the plurality of any one of the preceding claims, preferably said composition, kit, expression system or recombinant host cell is pharmaceutical and/or diagnostic composition, kit, expression system or recombinant host cell, further preferably said composition, kit, expression system or recombinant host cell further comprising a reporter, most preferably said reporter is a fluorescent protein, further most preferably said fluorescent protein is a green fluorescence protein.
12. The plurality, composition, kit, expression system or recombinant host cell of any one of the preceding claims for use as a medicament and/or in therapy.
13. A method for reprogramming and/or modifying a cell, said method comprising: a) providing: (i) a cell; and (ii) the plurality, composition, kit, expression system or recombinant host cell of any one of the preceding claims; b) applying and/or expressing (ii) to/in (i); preferably said cell is an astrocyte, further preferably said cell is reprogrammed into a neuron, most preferably said astrocyte is reprogrammed into a neuron.
14. The plurality, composition, kit, expression system or recombinant host cell of any one of the preceding claims, for use in one or more of the following methods: i) method of treatment, amelioration, prophylaxis and/or diagnostics of a neurodegenerative disease, cancer, cardiovascular disease, metabolic disease, monogenic disorder (e.g., single-gene associated disorder, e.g., Osteogenesis Imperfecta (OGI), Retinoblastoma (RB), Cystic Fibrosis, Thalassemia, Fragile X Syndrome (FXS), Hypophosphatemia, Hemophilia and Ichthyosis) and/or diabetes, preferably said neurodegenerative disease is selected from the group consisting of: Parkinson's disease, Parkinsonism, Parkinson-plus syndrome, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS) and Huntington's disease; ii) method for reprogramming and/or modifying a cell, preferably an astrocyte, further preferably into a neuron; iii) method for inducing and/or modifying expression of one or more genes of interest (e.g., endogenous, e.g., transcription factors, e.g., one or more of the following: Achaete-scute homolog 1 (Ascl1, e.g., UniProtKB-P50553 or Q02067), LIM homeobox transcription factor 1-alpha (Lmx1a, e.g., UniProtKB-Q8TE12 or Q9JKU8), Nurr1 (e.g., UniProtKB -P43354), preferably or alternatively Achaete-scute homolog 1 (Ascl1, e.g., UniProtKB-P50553 or Q02067), LIM homeobox transcription factor 1-alpha (Lmx1a, e.g., UniProtKB-Q8TE12 or Q9JKU8), Neurogenic differentiation factor 1 (Neurod1, e.g., UniProtKB-Q13562 or Q60867), miRNA218 (e.g., NR_029632, NR_029799.1); iv) method for cell-replacement and/or transplantation; v) method for somatic reprogramming of a cell; preferably an astrocyte, further preferably into a neuron; vi) method for genome and /or transcriptome modification, and/or gene therapy; vii) method of screening (e.g., guide RNAs) and/or monitoring gene expression; preferably said composition or kit further comprising a reporter, further preferably said reporter is a fluorescent protein, further preferably said fluorescent protein is a green fluorescence protein; viii) method for producing a neuron; viii) in a method according to any one of preceding claims; ix) said method is an in vitro, in vivo or ex vivo method; x) in any combination of (i)-(x).
15. Use of the plurality, composition, kit, expression system or recombinant host cell of any one of the preceding claims, for one or more of the following: i) for reprogramming and/or modifying a cell, preferably an astrocyte, further preferably into a neuron; ii) for inducing and/or modifying expression of one or more genes of interest (e.g., endogenous, e.g., transcription factors, e.g., one or more of the following: Achaete-scute homolog 1 (Ascl1, e.g., UniProtKB -P50553 or Q02067), LIM homeobox transcription factor 1-alpha (Lmx1a, e.g., UniProtKB-Q8TE12 or Q9JKU8), Nurr1 (e.g., UniProtKB -P43354), preferably or alternatively Achaete-scute homolog 1 (Ascl1, e.g., UniProtKB-P50553 or Q02067), LIM homeobox transcription factor 1-alpha (Lmx1a, e.g., UniProtKB-Q8TE12 or Q9JKU8), Neurogenic differentiation factor 1 (Neurod1, e.g., UniProtKB-Q13562 or Q60867), a ncRNA (non-coding RNA, e.g., miRNA), miRNA218 (e.g., N R_029632, N R_029799. 1); iii) for cell-replacement and/or transplantation; iv) for somatic reprogramming of a cell; preferably said cell is selected from the group consisting of: an astrocyte, cardiomyocyte, adipocyte, muscle cell, osteoclast, osteoblast, osteocytes, a blood cell (e.g., white blood cell), a skin cell, a stem cell, further preferably said astrocyte is reprogrammed into a neuron; v) for genome modification and/or gene therapy; vi) for producing a neuron; vii) as a medicament and/or in therapy; viii) for treatment, amelioration, prophylaxis and/or diagnostics of a degenerative disease (e.g., neurodegenerative disease), cancer, cardiovascular disease, metabolic disease, monogenic disorder (e.g., single-gene associated disorder, e.g., Osteogenesis Imperfecta (OGI), Retinoblastoma (RB), Cystic Fibrosis, Thalassemia, Fragile X Syndrome (FXS), Hypophosphatemia, Hemophilia and Ichthyosis) and/or diabetes, preferably said neurodegenerative disease is selected from the group consisting of: Parkinson's disease, Parkinsonism, Parkinson-plus syndrome, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS) and Huntington's disease; ix) in a method according to any one of preceding claims; x) for in vitro, in vivo or ex vivo use; xi) in any combination of (i)-(x).
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070] GFP.sup.+/NeuN.sup.+ neurons 5 wpi. Arrow heads indicating GFP.sup.+/NeuN.sup.+ cells. d, Quantification NeuN.sup.+/GFP.sup.+ cells. GFP 3.9?0.53%, ALNe-218 15.67?0.96% and ALN 14.77?3.09%. GFP vs. ALNe-218 P=0.0007, GFP vs. ALN P=0.001. Multiple comparison ANOVA F(2,6)=35-85. Scale bar indicates 50 ?m. Error bars represent mean ?SD. Tukey's multiple comparisons test * P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
DETAILED DESCRIPTION OF THE INVENTION
Definitions
[0082] As referred herein EC numbers (Enzyme Commission numbers) may be used to refer to enzymatic activity according to the Enzyme nomenclature database, Release of Feb. 26, 2020 (e.g., available at https://enzyme.expasy.org/). The EC number refers to Enzyme Nomenclature 1992 from NC-IUBMB, Academic Press, San Diego, Calif., including supplements 1-5 published in Eur. J. Biochem. 1994, 223, 1-5; Eur. J. Biochem. 1995, 232, 1-6; Eur. J. Biochem. 1996, 237, 1-5; Eur. J. Biochem. 1997, 250, 1-6; and Eur. J. Biochem. 1999, 264, 610-650; respectively.
[0083] The term EC: 3.1.-.-. as used herein can be interchangeably used with the term EC: 3.1.X.Y., wherein X is independently selected from 1 to 31 and Y is independently selected from 1 to 114. The term EC: 3.1.-.-. may refer to endonuclease activity of Cas9.
[0084] The term AAV may refer to Adeno-associated virus.
[0085] As used herein, the terms nucleic acids or nucleotide sequences may refer to DNA molecules (e.g. cDNA or genomic DNA), RNA (mRNA), combinations thereof or hybrid molecules comprised of DNA and RNA. The nucleic acids can be double- or single-stranded and may contain double- and single-stranded fragments at the same time. Most preferred are double stranded DNA molecules.
[0086] The term endonuclease activity may refer to enzymatic activity that cleave the phosphodiester bond within a polynucleotide chain.
[0087] The terms intein or intein activity may refer to polypeptides (e.g., co-called protein introns) capable of excising themselves out of a polypeptide sequence and joining the remaining flanking regions (e.g., exteins) with a peptide bond.
[0088] The term intein activity may refer to protein trans-splicing activity.
[0089] The term split-intein may refer to a sub-group of inteins that are present in two separate complementary entities and catalyze protein splicing in trans upon association of said two complementary entities.
[0090] The terms guide RNA or gRNA may refer to non-coding short RNA sequences which bind to the complementary target DNA sequences and confer target sequence specificity to the CRISPR-Cas9 system.
[0091] The term Cas9 may refer to CRISPR associated protein 9. Cas9 is a dual RNA-guided DNA endonuclease enzyme associated with the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR).
[0092] The term trans-activating activity may refer to transcription activation (e.g., increasing a rate of gene expression), e.g., in trans.
[0093] The term aptamer may refer to a short segment of DNA (e.g., oligonucleotide), RNA or peptide that binds to a specific molecular target (such as a protein).
[0094] The terms transcription co-activator or coactivator may refer a type of transcriptional co-regulator that binds to an activator (a transcription factor) to increase the rate of transcription of a gene or set of genes.
[0095] The terms synergistic activation mediator or SAM may refer to potent transcriptional activation protein complex.
[0096] The term polypeptide is equally used herein with the term protein. Proteins (including fragments thereof, preferably biologically active fragments, and peptides, usually having less than 30 amino acids) comprise one or more amino acids coupled to each other via a covalent peptide bond (resulting in a chain of amino acids). The term polypeptide(s) as used herein describes a group of molecules, which, for example, consist of more than 30 amino acids. Polypeptides may further form multimers such as dimers, trimers and higher oligomers, i.e. consisting of more than one polypeptide molecule. Polypeptide molecules forming such dimers, trimers etc. may be identical or non-identical. The corresponding higher order structures of such multimers are, consequently, termed homo- or heterodimers, homo-or hetero-trimers etc. An example for a hetero-multimer is an antibody molecule, which, in its naturally occurring form, consists of two identical light polypeptide chains and two identical heavy polypeptide chains. The terms polypeptide and protein also refer to naturally modified polypeptides/proteins wherein the modification is affected e.g. by post-translational modifications like glycosylation, acetylation, phosphorylation and the like. Such modifications are well known in the art.
[0097] Sequence identity: The relatedness between two amino acid sequences or between two nucleotide sequences is described by the parameter sequence identity. For purposes of the present invention, the sequence identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277), preferably version 5.0.0 or later. The parameters used may be gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labeled longest identity (obtained using the no-brief option) is used as the percent identity and is calculated as follows:
(Identical Residues?100)/(Length of Alignment?Total Number of Gaps in Alignment).
[0098] Alternatively, the parameters used may be gap open penalty of 10, gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of Needle labeled longest identity (obtained using the no-brief option) is used as the percent identity and is calculated as follows:
(Identical Deoxyribonucleotides?100)/(Length of Alignment?Total Number of Gaps in Alignment).
[0099] Expression: The term expression includes any step involved in the production of a variant (polypeptide) including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
[0100] Expression vector: The term expression vector may refer to a linear or circular DNA molecule that comprises a polynucleotide encoding a variant (polypeptide) and is operably linked to control sequences that provide for its expression, in particular for its transcription.
[0101] Fragment: The term fragment may refer to a polypeptide having one or more (e.g. several) amino acids absent from the amino and/or carboxyl terminus of a mature polypeptide; wherein the fragment has an activity as described elsewhere herein.
[0102] Host cell: The term host cell may refer to any cell type that is susceptible to transformation, transfection, transduction, or the like with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term host cell encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication, e.g., recombinant or transgenic host cell.
[0103] Nucleic acid construct: The term nucleic acid construct may refer to a nucleic acid molecule, either single- or double-stranded, which is isolated from a naturally occurring gene or is modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature or which is synthetic, which comprises one or more control sequences.
[0104] Operably linked: The term operably linked may refer to a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs expression of the coding sequence.
[0105] Control sequences: The term control sequences as used herein may refer to nucleic acid sequences necessary for expression of a polynucleotide encoding a variant (polynucleotide) of the present invention. Each control sequence may be native (i.e., from the same gene) or foreign (i.e., from a different gene) to the polynucleotide encoding the variant or native or foreign to each other. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, pro-peptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the polynucleotide of the present invention.
[0106] Parkinson's disease and the associated disturbance in movement coordination and behavior are provoked by the loss of dopaminergic neurons in the SNpc. To date, the prevailing paradigm of disease treatment is the symptomatic management by direct interference of the dopaminergic system to restore dopamine levels in the affected striata through drug treatment or transplantation of dopaminergic neurons. In the course of the present invention genetic tools to reprogram striatal astrocytes into mature neurons by the aCRISPR-mediated activation of multiple endogenous transcription factors, such as Ascl1, Lmx1a and Nr4a2 (ALN), or Ascl1, Lmx1a, NeuroD1 together with miRNA218 (ALNe-218) were developed. The conventional reprogramming approaches use the ectopic expression of the gene coding sequences (cDNA), making multiplexing of several genes difficult if not impossible, especially when large genes have to be expressed. In contrast, the aCRISPR platform allows multiplexed activation of many endogenous genes solely by introducing sgRNAs, with a fixed cargo size for each gene, such that the endogenous transcriptional machinery can be co-opted to execute complex genetic splicing patterns. Herein, it has been shown that two distinct approaches based on CRISPR-mediated gene activation are suitable to achieve successful treatment of a murine toxin-induced PD model. For the dCAM mouse line a Rosa26 knock-in strategy of a Cre- and Flpe-dependent dual activator system was followed, harbouring the VPR and SAM activator complexes where the defined integration and the optional two-fold mode of activation are the prominent features differentiating the transgenic line developed in the course of the present invention from the recently reported SPH transgenic mouse line. After confirming the technical and biological functionality of the dCAM approach, the toolbox was expanded by developing an AAV-based split-dCas9/SAM system, making it versatile and applicable across species with minimal modifications. Strikingly, with the split-dCas9 AAV-based system (AAV-dCAS) it was possible to recapitulate the results obtained with dCAM, confirming the functionality of the aCRISPR approach to reprogram in vivo striatal astrocytes into induced neurons. At 13 wpi the combination ALN was capable to generate functional neurons with mature electrophysiological properties, whereas cells reprogrammed by ALNe-218 exhibited characteristics reminiscent of astrocytes or immature neurons. Furthermore, only ALN induced neurons led to an improvement in voluntary motor behavior, and a balancing of the axial symmetry-. This behavioral rescue could be observed to a similar extent, both in dCAM as well as AAV-dCAS animals confirming the functionality of the aCRISPR-mediated activation approach. The de novo induced neurons were not immunoreactive for the dopaminergic marker TH. Nevertheless, independent of reprogramming, we observe TH+ neurons in the striatum, which may either emerge due to the 6-OHDA toxin treatment or represent naturally occurring TH+ interneurons within the striatum. Although this is contradictory the previously reported formation of dopaminergic neurons based on ALNe-218 overexpression mediated reprogramming, this discrepancy may be explained by the different reprogramming system used and presumably diverse reprogramming kinetics. Furthermore, the FLEx-GFP marker employed in this study, allows the definite identification of induced neurons and its demarcation from reprogramming independent TH+ neurons. Interestingly, scRNA-seq analysis, as well as immunological staining, revealed a GABAergic identity of the reprogrammed neurons. This is indicating that the regional identity of the targeted astrocytes is a predominant factor for the determination of the final neuronal subtype. The induced neurons were not positive for DARPP32, a marker for striatal medium spiny neurons representing the main neuronal class within the striatum, nor did they exhibit standard electrophysiological properties of this particular neuronal subtype. This indicates that the reprogrammed neurons presumably differentiate into a distinct GABAergic interneuron population, capable of modulating striatal circuits. Furthermore, these electrophysiological properties are distinct from PV+ interneurons, which have been shown by a recent publication to arise during ALN overexpression in NG2+ oligodendrocyte precursors, which may be explained by the different starter cell populations. The major originality of this study lies in the fact, that the aCRISPR induced ALN combination in the striatum, using either dCAM or AAV-dCAS, induces specific GABAergic neurons, capable of alleviating motor behaviour symptoms in a 6-OHDA model. This is surprising, since the research focus so far has been on the restoration of the dopaminergic drive to alleviate motor symptoms. However, it has been reported that dopamine depletion in 6-OHDA toxin treated PD rodent models has a strong effect on striatal circuits. Specifically, increased excitatory cholinergic and reduced inhibitory GABAergic signals have been observed. In addition, most of the basal striatal excitatory drive arising from cholinergic interneurons is balanced by a concomitant GABAergic inhibition; this signalling is impaired by dopamine deprivation38/Furthermore, integrity of the fast spiking striatal GABAergic interneurons has been shown to depend on dopaminergic input from SNpc39. Altogether, these reports as well as our own findings suggest, that the imbalance in striatal micro circuitryincluding impaired GABAergic signallingcontribute to the altered motor behaviour in parkinsonian state. Therefore, restoration or reinforcing of GABAergic inhibition in the striatum is attractive as a novel therapeutic concept for PD.
[0107] In summary, herein for the first time it was shown that a rescue of PD motor behaviour deficits can be achieved by the direct conversion of endogenous astrocytes into functional GABAergic neurons via an aCRISPR mediated induction of the reprogramming factors Ascl1, Lmx1a and Nr4a2.
Embodiments of the Invention
[0108] In some aspects/embodiments, the present invention relates to a plurality of separate adeno-associated viruses (AAVs) comprising: (i) a first AAV comprising a first nucleic acid encoding a first portion of a Cas9 protein devoid of endonuclease activity; (ii) a second AAV comprising a second nucleic acid encoding a second portion of a Cas9 protein devoid of endonuclease activity; (iii) a third AAV comprising a third nucleic acid encoding a synergistic activation mediator (SAM) complex and a single guide RNA (sgRNA) comprising at least two aptamers, each capable of binding two MS2 coactivator proteins, wherein the first portion of said Cas9 protein devoid of endonuclease activity and the second portion of said Cas9 protein devoid of endonuclease activity, when joined together, form a Cas9 protein devoid of endonuclease activity.
[0109] In some aspects/embodiments, the first portion of the Cas9 protein of the present invention is the N-terminal lobe of the Cas9 protein and the second portion of the Cas9 protein of the present invention is the C-terminal lobe of the Cas9 protein.
[0110] In some aspects/embodiments, the first portion of the Cas9 protein is the N-terminal lobe of the Cas9 protein up to amino acid 573 and the second portion of the Cas9 protein is the C-terminal lobe of the Cas9 protein beginning at amino acid 574.
[0111] In some aspects/embodiments, the first nucleic acid encodes a first portion of the Cas9 protein having a first split-intein and wherein the second nucleic acid encodes a second portion of the Cas9 protein having a second split-intein complementary to the first split-intein, wherein the first portion of the Cas9 protein and the second portion of the Cas9 protein, when joined together, form the Cas9 protein.
[0112] In some aspects/embodiments, the split-intein polypeptides of the present invention are selected from the group consisting of: Nostoc punctiforme (Npu) strain PCC73102 split-inteins, gp41-1 inteins, NrdJ-1 inteins, IMPDH-1 inteins, HwarPolA29,62 inteins.
[0113] In some aspects/embodiments, the the first nucleic acid encodes a first portion of the Cas9 protein having a Rhodothermus marinus N-split-intein Rma IntN and wherein the second nucleic acid encodes a second portion of the Cas9 protein having a Rhodothermus marinus C-split-intein Rma IntC, wherein the first portion of the Cas9 protein and the second portion of the Cas9 protein, when joined together, form the Cas9 protein.
[0114] In some aspects/embodiments, the SAM complex of the present invention comprises a MS2 coat protein fused to the p65 subunit of NF-kappaB and the activation domain of human heat-shock factor 1 (HSF1).
[0115] In some aspects/embodiments, the second portion of a Cas9 protein devoid of endonuclease activity is fused to a transcription activation domain.
[0116] In some aspects/embodiments, the third nucleic acid further encodes a transcription activation domain.
[0117] In some aspects/embodiments, the transcription activation domain is a quadruple VP16 (VP64) domain.
[0118] In some aspects/embodiments, the Cas9 is a Type II CRISPR system Cas9.
[0119] In some aspects/embodiments, the invention relates to a plurality of separate adeno-associated viruses (AAVs, e.g., AAV2 and/or AAVS serotypes) comprising: (i) a first AAV (e.g., AAV2 or AAVS) comprising a first nucleic acid encoding a first portion of a Cas9 protein devoid of endonuclease activity; optionally, said first nucleic acid further encoding a first split-intein polypeptide (e.g., an N-intein polypeptide), preferably said first split-intein polypeptide having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity with the polypeptide having SEQ ID NO: 10 (N-Split-Intein) and having the intein activity (e.g., protein trans-splicing activity); optionally, said first nucleic acid further encoding one or more guide RNAs (gRNAs), preferably said first nucleic acid is up to about 4.5 Kb in size; further preferably said first portion of said Cas9 protein devoid of said endonuclease activity is devoid of an enzymatic activity having EC: 3.1.-.-.; most preferably said first nucleic acid encoding the polypeptide having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity with the polypeptide having SEQ ID NO: 2 (N-dCas9-N-intein); (ii) a second AAV (e.g., AAV2 or AAVS) comprising a second nucleic acid encoding a second portion of a Cas9 protein devoid of endonuclease activity; optionally, said second nucleic acid further encoding a second split-intein polypeptide having complementarity to said first split-intein (e.g., a C-intein), preferably said second split-intein polypeptide having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity with the polypeptide having SEQ ID NO: 12 (C-Split-lntein) and having the intein activity (e.g., protein trans-splicing activity); optionally, said second nucleic acid further encoding at least one polypeptide having a trans-activating activity (e.g., activating transcription) and/or one or more guide RNAs (gRNAs), preferably said second nucleic acid is up to about 4.5 Kb in size; further preferably said at least one polypeptide having said trans-activating activity having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity with the polypeptide having SEQ ID NO: 20 (VP16); further preferably said second portion of said Cas9 protein devoid of said endonuclease activity is devoid of an enzymatic activity having EC: 3.1.-.-.; most preferably said second nucleic acid encoding the polypeptide having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity with the polypeptide having SEQ ID NO: 4 (C-dCas9-C-intein-VP64); (iii) a third AAV comprising a third nucleic acid encoding at least one polypeptide having a trans-activating activity (e.g., activating transcription) and capable of binding to and/or associating with an at least one guide RNA (gRNA) and/or said first and/or second portion of said Cas9 protein, wherein said third nucleic acid further encoding at least one guide RNA (gRNA) comprising at least one aptamer capable of binding at least one transcription co-activator protein (e.g., said co-activator protein comprising one or more of the following: (i) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to the MS2 adaptor polypeptide having SEQ ID NO: 14; (ii) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to MS2-p65 polypeptide having SEQ ID NO: 16; and/or (iii) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to MS2-p65-HSF1 polypeptide having SEQ ID NO: 18; (iv) a fusion of a suitable adaptor polypeptide (e.g., least 80% sequence identity to SEQ ID NO: 14) with a suitable activator polypeptide, e.g., p65 and/or HSF1), preferably said third nucleic acid encoding a synergistic activation mediator (SAM) complex and at least one guide RNA (gRNA) comprising at least one aptamer capable of binding at least one co-activator protein (e.g., said co-activator protein comprising one or more of the following: (i) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to the MS2 adaptor polypeptide having SEQ ID NO: 14; (ii) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to MS2-p65 polypeptide having SEQ ID NO: 16; and/or (iii) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to MS2-p65-HSF1 polypeptide having SEQ ID NO: 18; (iv) a fusion of a suitable adaptor polypeptide (e.g., least 80% sequence identity to SEQ ID NO: 14) with a suitable activator polypeptide, e.g., p65 and/or HSF1), most preferably comprising at least two aptamers, each capable of binding at least two co-activator proteins (e.g., said co-activator protein comprising one or more of the following: (i) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to the MS2 adaptor polypeptide having SEQ ID NO: 14; (ii) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to MS2-p65 polypeptide having SEQ ID NO: 16; and/or (iii) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to MS2-p65-HSF1 polypeptide having SEQ ID NO: 18; (iv) a fusion of a suitable adaptor polypeptide (e.g., least 80% sequence identity to SEQ ID NO: 14) with a suitable activator polypeptide, e.g., p65 and/or HSF1), (iv) optionally, a fourth AAV comprising a fourth nucleic acid encoding a reporter polypeptide, preferably said reporter polypeptide is a fluorescent protein, further preferably said fluorescent protein is a green fluorescence protein; wherein said first portion of said Cas9 protein devoid of endonuclease activity and said second portion of said Cas9 protein devoid of endonuclease activity, when joined together, form a Cas9 protein devoid of endonuclease activity, preferably said formed Cas9 protein is capable of binding DNA, further preferably said formed Cas9 protein having at least 80% identity to SEQ ID NO: 27 (e.g., Cas9 having UniProtKB Accession Number Q99ZW2).
[0120] In some aspects/embodiments, the first portion of the Cas9 protein is the N-terminal lobe of the Cas9 protein up to amino acid 573 and the second portion of the Cas9 protein is the C-terminal lobe of the Cas9 protein beginning at amino acid 574; or the first portion of the Cas9 protein is the N-terminal lobe of the Cas9 protein up to amino acid 637 and the second portion of the Cas9 protein is the C-terminal lobe of the Cas9 protein beginning at amino acid 638.
[0121] In some aspects/embodiments, the first nucleic acid encodes a first portion of the Cas9 protein having a first split-intein and wherein the second nucleic acid encodes a second portion of the Cas9 protein having a second split-intein complementary to the first split-intein, wherein the first portion of the Cas9 protein and the second portion of the Cas9 protein, when joined together, form the Cas9 protein (e.g., by intein-mediated trans-splicing).
[0122] In some aspects/embodiments, the first nucleic acid encodes a first portion of the Cas9 protein having a Nostoc punctiforme (Npu) strain PCC73102 N-split-intein IntN and wherein the second nucleic acid encodes a second portion of the Cas9 protein having a Nostoc punctiforme (Npu) strain PCC73102 C-split-intein IntC, wherein the first portion of the Cas9 protein and the second portion of the Cas9 protein, when joined together, form the Cas9 protein.
[0123] In some aspects/embodiments, wherein the SAM complex comprises a MS2 coat protein (e.g., having SEQ ID NO: 14) fused to the p65 subunit of NF-kappaB (e.g., forming SEQ ID NO: 16) and the activation domain of human heat-shock factor 1 (HSF1) (e.g., forming SEQ ID NO: 18).
[0124] In some aspects/embodiments, second portion of a Cas9 protein devoid of endonuclease activity is fused to a transcription activation domain, preferably said transcription activation domain having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity with the polypeptide having SEQ ID NO: 20 (VP16).
[0125] In some aspects/embodiments, the present invention relates to composition, kit, expression system or recombinant host cell (e.g., isolated recombinant host cell) comprising the plurality of AAV of the present invention, preferably said composition, kit, expression system or recombinant host cell is pharmaceutical and/or diagnostic composition, kit, expression system or recombinant host cell, further preferably said composition, kit, expression system or recombinant host cell further comprising a reporter, further preferably said reporter is a fluorescent protein, further preferably said fluorescent protein is a green fluorescence protein.
[0126] In some aspects/embodiments, the plurality of AAVs, composition, kit, expression system or recombinant host cell of the present invention for use as a medicament (e.g., in vivo) and/or in therapy (e.g., in vivo).
[0127] In some aspects/embodiments, the present invention relates to a method for reprogramming and/or modifying a cell, said method comprising: (a) providing: (i) a cell; and (ii) the plurality of AAVs, composition, kit, expression system or recombinant host cell of the present invention; (b) applying and/or expressing (ii) to/in (i); preferably said cell is an astrocyte, further preferably said cell is reprogrammed into a neuron, most preferably said astrocyte is reprogrammed into a neuron.
[0128] In some aspects/embodiments, the plurality of AAVs of the present invention, composition, kit, expression system and/or recombinant host cell of the present invention is, for use in one or more of the following methods: (i) method of treatment, amelioration, prophylaxis and/or diagnostics of a neurodegenerative disease, cancer, cardiovascular disease, metabolic disease, monogenic disorder (e.g., single-gene associated disorder, e.g., Osteogenesis Imperfecta (OGI), Retinoblastoma (RB), Cystic Fibrosis, Thalassemia, Fragile X Syndrome (FXS), Hypophosphatemia, Hemophilia and Ichthyosis) and/or diabetes, preferably said neurodegenerative disease is selected from the group consisting of: Parkinson's disease, Parkinsonism, Parkinson-plus syndrome, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS) and Huntington's disease; (ii) method for re-programming and/or modifying a cell, preferably an astrocyte, further preferably into a neuron; (iii) method for inducing and/or modifying expression of one or more genes of interest (e.g., endogenous, e.g., transcription factors, e.g., one or more of the following: Achaete-scute homolog 1 (Ascl1, e.g., UniProtKB-P50553 or Q02067), LIM homeobox transcription factor 1-alpha (Lmx1a, e.g., UniProtKB-Q8TE12 or Q9JKU8), Nurr1 (e.g., UniProtKB-P43354), preferably or alternatively Achaete-scute homolog 1 (Ascl1, e.g., UniProtKB-P50553 or Q02067), LIM homeobox transcription factor 1-alpha (Lmx1a, e.g., UniProtKB-Q8TE12 or Q9JKU8), Neurogenic differentiation factor 1 (Neurod1, e.g., UniProtKB-Q13562 or Q60867), miRNA218 (e.g., NR_029632, NR_029799.1); (iv) method for cell-replacement and/or transplantation; (v) method for somatic reprogramming of a cell; preferably an astrocyte, further preferably into a neuron; (vi) method for genome and /or transcriptome modification, and/or gene therapy; (vii) method of screening (e.g., guide RNAs) and/or monitoring gene expression; preferably said composition or kit further comprising a reporter, further preferably said reporter is a fluorescent protein, further preferably said fluorescent protein is a green fluorescence protein; (viii) method for producing a neuron; (viii) in a method according to any one of preceding items; (ix) said method is an in vitro, in vivo or ex vivo method; (x) in any combination of (i)-(x).
[0129] In some aspects/embodiments, the present invention relates to use of the plurality, composition, kit, expression system or recombinant host cell of the present invention, for one or more of the following: (i) for reprogramming and/or modifying a cell, preferably an astrocyte, further preferably into a neuron; (ii) for inducing and/or modifying expression of one or more genes of interest (e.g., endogenous, e.g., transcription factors, e.g., one or more of the following: Achaete-scute homolog 1 (Ascl1 , e.g., UniProtKB-P50553 or Q02067), LIM homeobox transcription factor 1-alpha (Lmx1a, e.g., UniProtKB-Q8TE12 or Q9JKU8), Nurr1 (e.g., UniProtKB-P43354), preferably or alternatively Achaete-scute homolog 1 (Ascl1 , e.g., UniProtKB-P50553 or Q02067), LIM homeobox transcription factor 1-alpha (Lmx1a, e.g., UniProtKB-Q8TE12 or Q9JKU8), Neurogenic differentiation factor 1 (Neurod1, e.g., UniProtKB-Q13562 or Q60867), a ncRNA (non-coding RNA, e.g., miRNA), miRNA218 (e.g., NR 029632, NR_029799.1); (iii) for cell-replacement and/or transplantation; (iv) for somatic reprogramming of a cell; preferably said cell is selected from the group consisting of: an astrocyte, cardiomyocyte, adipocyte, muscle cell, osteoclast, osteoblast, osteocytes, a blood cell (e.g., white blood cell), a skin cell, a stem cell, further preferably said astrocyte is reprogrammed into a neuron; (v) for genome modification and/or gene therapy; (vi) for producing a neuron; (vii) as a medicament and/or in therapy; (viii) for treatment and amelioration, prophylaxis and/or diagnostics of a degenerative disease (e.g., neurodegenerative disease), cancer, cardiovascular disease, metabolic disease, monogenic disorder (e.g., single-gene associated disorder, e.g., Osteogenesis Imperfecta (OGI), Retinoblastoma (RB), Cystic Fibrosis, Thalassemia, Fragile X Syndrome (FXS), Hypophosphatemia, Hemophilia and Ichthyosis) and/or diabetes, preferably said neurodegenerative disease is selected from the group consisting of: Parkinson's disease, Parkinsonism, Parkinson-plus syndrome, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS) and Huntington's disease; (ix) in a method of the present invention; (x) for in vitro, in vivo or ex vivo use; (xi) in any combination of (i)-(x).
[0130] In some aspects/embodiments, the present invention relates to Split-dCas9 and SAM packaged in a plurality of AAV viruses that can be used, for reprogramming cells and/or for in vivo-cell therapy.
[0131] In some aspects/embodiments, the nucleic acids of the present invention (e.g., first, second, third and/or fourth) are operably linked to a control sequence, preferably operably linked to any suitable promoter (e.g., CBh-chicken ?-actin hybrid promoter or human glial fibrillary acidic protein (GFAP) promoter).
[0132] In some aspects/embodiments, the plurality, composition, kit, expression system or recombinant host cell of the present invention are particularly suitable for use as an in vivo medicament and/or in vivo therapy.
[0133] In some aspects/embodiments, the AAVs of the present invention are selected from the group consisting of: AAV1, AAV2, AAV4, AAV5, AAV7, AAV8, AAV9, preferably AAV2 and AAV5.
[0134] In some aspects/embodiments, the invention relates to SEQ ID NOs: 1-27 which are embodiments of the present invention.
[0135] In some aspects/embodiments, the nucleic acid of the invention (e.g., first, second, third and/or fourth comprises, consists of or encodes: one or more of the sequences having SEQ ID NO: 1-27.
[0136] In some aspects/embodiments, the invention relates to
[0137] In some aspects/embodiments, the nucleic acids of the present invention (e.g., first, second, third and/or fourth) encode one or more gRNAs.
[0138] In some aspects/embodiments, first nucleic acid further encoding a first split-intein polypeptide (e.g., an N-intein polypeptide), preferably said first split-intein polypeptide having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity with the polypeptide having SEQ ID NO: 10 (N-Split-Intein) and having the intein activity (e.g., protein trans-splicing activity).
[0139] In some aspects/embodiments, the first nucleic acid further encoding one or more guide RNAs (gRNAs), preferably said first nucleic acid is up to about 4.5 Kb in size.
[0140] In some aspects/embodiments, the first portion of said Cas9 protein devoid of said endonuclease activity is devoid of an enzymatic activity having EC: 3.1.-.-..
[0141] In some aspects/embodiments, the first nucleic acid encoding the polypeptide having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity with the polypeptide having SEQ ID NO: 2 (N-dCas9-N-intein).
[0142] In some aspects/embodiments, the second nucleic acid further encoding a second split-intein polypeptide having complementarity to said first split-intein (e.g., a C-intein), preferably said second split-intein polypeptide having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity with the polypeptide having SEQ ID NO: 12 (C-Split-Intein) and having the intein activity (e.g., protein trans-splicing activity).
[0143] In some aspects/embodiments, the second nucleic acid further encoding at least one polypeptide having a trans-activating activity (e.g., activating transcription) and/or one or more guide RNAs (gRNAs), preferably said second nucleic acid is up to about 4.5 Kb in size; further preferably said at least one polypeptide having said trans-activating activity having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity with the polypeptide having SEQ ID NO: 20 (VP16);
[0144] In some aspects/embodiments, the second portion of said Cas9 protein devoid of said endonuclease activity is devoid of an enzymatic activity having EC: 3.1.-.-..
[0145] In some aspects/embodiments, the second nucleic acid encoding the polypeptide having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity with the polypeptide having SEQ ID NO: 4 (C-dCas9-C-intein-VP64).
[0146] It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.
[0147] All publications and patents cited throughout the text of this specification (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material.
[0148] The invention is also characterized by the following items:
1. A plurality of separate adeno-associated viruses (AAVs, e.g., AAV2 and/or AAVS serotypes) comprising: [0149] (i) a first AAV (e.g., AAV2 or AAVS) comprising a first nucleic acid encoding a first portion of a Cas9 protein devoid of endonuclease activity; [0150] optionally, said first nucleic acid further encoding a first split-intein polypeptide (e.g., an N-intein polypeptide), preferably said first split-intein polypeptide having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) sequence identity with the polypeptide having SEQ ID NO: 10 (N-Split-lntein) and having the intein activity (e.g., protein trans-splicing activity); [0151] optionally, said first nucleic acid further encoding one or more guide RNAs (gRNAs), preferably said first nucleic acid is up to about 4.5 Kb in size; [0152] further preferably said first portion of said Cas9 protein devoid of said endonuclease activity is devoid of an enzymatic activity having EC: 3.1.-.-.; [0153] most preferably said first nucleic acid encoding the polypeptide having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) sequence identity with the polypeptide having SEQ ID NO: 2 (N-dCas9-N-intein); [0154] (ii) a second AAV (e.g., AAV2 or AAVS) comprising a second nucleic acid encoding a second portion of a Cas9 protein devoid of endonuclease activity; [0155] optionally, said second nucleic acid further encoding a second split-intein polypeptide having complementarity to said first split-intein (e.g., a C-intein), preferably said second split-intein polypeptide having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) sequence identity with the polypeptide having SEQ ID NO: 12 (C-Split-lntein) and having the intein activity (e.g., protein trans-splicing activity); [0156] optionally, said second nucleic acid further encoding at least one polypeptide having a trans-activating activity (e.g., activating transcription) and/or one or more guide RNAs (gRNAs), preferably said second nucleic acid is up to about 4.5 Kb in size; further preferably said at least one polypeptide having said trans-activating activity having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) sequence identity with the polypeptide having SEQ ID NO: 20 (VP16); [0157] further preferably said second portion of said Cas9 protein devoid of said endonuclease activity is devoid of an enzymatic activity having EC: 3.1.-.-.; [0158] most preferably said second nucleic acid encoding the polypeptide having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) sequence identity with the polypeptide having SEQ ID NO: 4 (C-dCas9-C-intein-VP64); [0159] (iii) a third AAV comprising a third nucleic acid encoding at least one polypeptide having a trans-activating activity (e.g., activating transcription) and capable of binding to and/or associating with an at least one guide RNA (gRNA) and/or said first and/or second portion of said Cas9 protein, wherein said third nucleic acid further encoding at least one guide RNA (gRNA) comprising at least one aptamer capable of binding at least one transcription co-activator protein (e.g., said co-activator protein comprising one or more of the following: (i) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to the MS2 adaptor polypeptide having SEQ ID NO: 14; (ii) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to MS2-p65 polypeptide having SEQ ID NO: 16; and/or (iii) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to MS2-p65-HSF1 polypeptide having SEQ ID NO: 18; (iv) a fusion of a suitable adaptor polypeptide (e.g., least 80% sequence identity to SEQ ID NO: 14) with a suitable activator polypeptide, e.g., p65 and/or HSF1), preferably said third nucleic acid encoding a synergistic activation mediator (SAM) complex and at least one guide RNA (gRNA) comprising at least one aptamer capable of binding at least one co-activator protein (e.g., said co-activator protein comprising one or more of the following: (i) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to the MS2 adaptor polypeptide having SEQ ID NO: 14; (ii) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to MS2-p65 polypeptide having SEQ ID NO: 16; and/or (iii) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to MS2-p65-HSF1 polypeptide having SEQ ID NO: 18; (iv) a fusion of a suitable adaptor polypeptide (e.g., least 80% sequence identity to SEQ ID NO: 14) with a suitable activator polypeptide, e.g., p65 and/or HSF1, most preferably comprising at least two aptamers, each capable of binding at least two co-activator proteins (e.g., said co-activator protein comprising one or more of the following: (i) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to the MS2 adaptor polypeptide having SEQ ID NO: 14; (ii) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to MS2-p65 polypeptide having SEQ ID NO: 16; and/or (iii) a polypeptide having at least 80% (e.g., at least 85%, 90%, 95% or 100%) sequence identity to MS2-p65-HSF1 polypeptide having SEQ ID NO: 18; (iv) a fusion of a suitable adaptor polypeptide (e.g., least 80% sequence identity to SEQ ID NO: 14) with a suitable activator polypeptide, e.g., p65 and/or HSF1, [0160] (iv) optionally, a fourth AAV comprising a fourth nucleic acid encoding a reporter polypeptide, preferably said reporter polypeptide is a fluorescent protein, further preferably said fluorescent protein is a green fluorescence protein; [0161] wherein said first portion of said Cas9 protein devoid of endonuclease activity and said second portion of said Cas9 protein devoid of endonuclease activity, when joined together, form a Cas9 protein devoid of endonuclease activity, preferably said formed Cas9 protein is capable of binding DNA, further preferably said formed Cas9 protein having at least 80% sequence identity to SEQ ID NO: 27 (e.g., Cas9 having UniProtKB Accession Number Q99ZW2). [0162] 2. The plurality of item 1, wherein the first portion of the Cas9 protein is the N-terminal lobe of the Cas9 protein and the second portion of the Cas9 protein is the C-terminal lobe of the Cas9 protein. [0163] 3. The plurality of any one of the preceding items, wherein: [0164] (i) the first portion of the Cas9 protein is the N-terminal lobe of the Cas9 protein up to amino acid 573 and the second portion of the Cas9 protein is the C-terminal lobe of the Cas9 protein beginning at amino acid 574; or [0165] (ii) the first portion of the Cas9 protein is the N-terminal lobe of the Cas9 protein up to amino acid 637 and the second portion of the Cas9 protein is the C-terminal lobe of the Cas9 protein beginning at amino acid 638. [0166] 4. The plurality of any one of the preceding items, wherein the first nucleic acid encodes a first portion of the Cas9 protein having a first split-intein and wherein the second nucleic acid encodes a second portion of the Cas9 protein having a second split-intein complementary to the first split-intein, wherein the first portion of the Cas9 protein and the second portion of the Cas9 protein, when joined together, form the Cas9 protein (e.g., by intein-mediated trans-splicing). [0167] 5. The plurality of any one of the preceding items, wherein the first nucleic acid encodes a first portion of the Cas9 protein having a Nostoc punctiforme (Npu) strain PCC73102 N-split-intein IntN and wherein the second nucleic acid encodes a second portion of the Cas9 protein having a Nostoc punctiforme (Npu) strain PCC73102 C-split-intein IntC, wherein the first portion of the Cas9 protein and the second portion of the Cas9 protein, when joined together, form the Cas9 protein. [0168] 6. The plurality of any one of the preceding items, wherein the SAM complex comprises a MS2 coat protein (e.g., having SEQ ID NO: 14) fused to the p65 subunit of NF-kappaB (e.g., forming SEQ ID NO: 16) and the activation domain of human heat-shock factor 1 (HSF1) (e.g., forming SEQ ID NO: 18). [0169] 7. The plurality of any one of the preceding items, wherein a second portion of a Cas9 protein devoid of endonuclease activity is fused to a transcription activation domain, preferably said transcription activation domain having at least 80% (e.g., at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) sequence identity with the polypeptide having SEQ ID NO: 20 (VP16). [0170] 8. The plurality of any one of the preceding items, wherein the third nucleic acid further encodes a transcription activation domain. [0171] 9. The plurality of item 7 or 8, wherein said transcription activation domain comprising at least one VP16 (SEQ ID NO: 20) domain, preferably comprising a quadruple VP16 (VP64) domain. [0172] 10. The plurality of any one of the preceding items, wherein the Cas9 is a Type II CRISPR system Cas9. [0173] 11. The plurality of any one of the preceding items, wherein the nucleic acid (e.g., first, second, third and/or fourth) is operably linked to a control sequence, preferably operably linked to a suitable promoter (e.g., CbH or GAFP promoter). [0174] 12. A composition, kit, expression system or recombinant host cell (e.g., isolated recombinant host cell) comprising the plurality of any one of the preceding items, preferably said composition, kit, expression system or recombinant host cell is pharmaceutical and/or diagnostic composition, kit, expression system or recombinant host cell, further preferably said composition, kit, expression system or recombinant host cell further comprising a reporter, further preferably said reporter is a fluorescent protein, further preferably said fluorescent protein is a green fluorescence protein. [0175] 13. The plurality, composition, kit, expression system or recombinant host cell of any one of the preceding items for use as a medicament and/or in therapy. [0176] 14. A method for reprogramming and/or modifying a cell, said method comprising: [0177] a) providing: (i) a cell; and (ii) the plurality, composition, kit, expression system or recombinant host cell of any one of the preceding items; [0178] b) applying and/or expressing (ii) to/in (i); [0179] preferably said cell is an astrocyte, further preferably said cell is reprogrammed into a neuron, most preferably said astrocyte is reprogrammed into a neuron. [0180] 15. The plurality, composition, kit, expression system or recombinant host cell of any one of the preceding items, for use in one or more of the following methods: [0181] i) method of treatment, amelioration, prophylaxis and/or diagnostics of a neurodegenerative disease, cancer, cardiovascular disease, metabolic disease, monogenic disorder (e.g., single-gene associated disorder, e.g., Osteogenesis Imperfecta (OGI), Retinoblastoma (RB), Cystic Fibrosis, Thalassemia, Fragile X Syndrome (FXS), Hypophosphatemia, Hemophilia and Ichthyosis) and/or diabetes, preferably said neurodegenerative disease is selected from the group consisting of: Parkinson's disease, Parkinsonism, Parkinson-plus syndrome, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS) and Huntington's disease; [0182] ii) method for reprogramming and/or modifying a cell, preferably an astrocyte, further preferably into a neuron; [0183] iii) method for inducing and/or modifying expression of one or more genes of interest (e.g., endogenous, e.g., transcription factors, e.g., one or more of the following: Achaete-scute homolog 1 (Ascl1, e.g., UniProtKB-P50553 or Q02067), LIM homeobox transcription factor 1-alpha (Lmx1a, e.g., UniProtKB-Q8TE12 or Q9JKU8), Nurr1 (e.g., UniProtKB-P43354), preferably or alternatively Achaete-scute homolog 1 (Ascl1, e.g., UniProtKB-P50553 or Q02067), LIM homeobox transcription factor 1-alpha (Lmx1a, e.g., UniProtKB-Q8TE12 or Q9JKU8), Neurogenic differentiation factor 1 (Neurod1, e.g., UniProtKB-Q13562 or Q60867), miRNA218 (e.g., NR_029632, NR 029799.1); [0184] iv) method for cell-replacement and/or transplantation; [0185] v) method for somatic reprogramming of a cell; preferably an astrocyte, further preferably into a neuron; [0186] vi) method for genome and /or transcriptome modification, and/or gene therapy; [0187] vii) method of screening (e.g., guide RNAs) and/or monitoring gene expression; preferably said composition or kit further comprising a reporter, further preferably said reporter is a fluorescent protein, further preferably said fluorescent protein is a green fluorescence protein; [0188] viii) method for producing a neuron; [0189] viii) in a method according to any one of preceding items; [0190] ix) said method is an in vitro, in vivo or ex vivo method; [0191] x) in any combination of (i)-(x). [0192] 16. Use of the plurality, composition, kit, expression system or recombinant host cell of any one of the preceding items, for one or more of the following: [0193] i) for reprogramming and/or modifying a cell, preferably an astrocyte, further preferably into a neuron; [0194] ii) for inducing and/or modifying expression of one or more genes of interest (e.g., endogenous, e.g., transcription factors, e.g., one or more of the following: Achaete-scute homolog 1 (Ascl1 , e.g., UniProtKB-P50553 or Q02067), LIM homeobox transcription factor 1-alpha (Lmx1a, e.g., UniProtKB-Q8TE12 or Q9JKU8), Nurr1 (e.g., UniProtKB-P43354), preferably or alternatively Achaete-scute homolog 1 (Ascl1 , e.g., UniProtKB-P50553 or Q02067), LIM homeobox transcription factor 1-alpha (Lmx1a, e.g., UniProtKB-Q8TE12 or Q9JKU8), Neurogenic differentiation factor 1 (Neurod1, e.g., UniProtKB-Q13562 or Q60867), a ncRNA (non-coding RNA, e.g., miRNA), miRNA218 (e.g., NR_029632, NR_029799.1); [0195] iii) for cell-replacement and/or transplantation; [0196] iv) for somatic reprogramming of a cell; preferably said cell is selected from the group consisting of: an astrocyte, cardiomyocyte, adipocyte, muscle cell, osteoclast, osteoblast, osteocytes, a blood cell (e.g., white blood cell), a skin cell, a stem cell, further preferably said astrocyte is reprogrammed into a neuron; [0197] v) for genome modification and/or gene therapy; [0198] vi) for producing a neuron; [0199] vii) as a medicament and/or in therapy; [0200] viii) for treatment, amelioration, prophylaxis and/or diagnostics of a degenerative disease (e.g., neurodegenerative disease), cancer, cardiovascular disease, metabolic disease, monogenic disorder (e.g., single-gene associated disorder, e.g., Osteogenesis Imperfecta (OGI), Retinoblastoma (RB), Cystic Fibrosis, Thalassemia, Fragile X Syndrome (FXS), Hypophosphatemia, Hemophilia and Ichthyosis) and/or diabetes, preferably said neurodegenerative disease is selected from the group consisting of: Parkinson's disease, Parkinsonism, Parkinson-plus syndrome, Alzheimer's disease, Amyotrophic lateral sclerosis (ALS) and Huntington's disease; [0201] ix) in a method according to any one of preceding items; [0202] x) for in vitro, in vivo or ex vivo use; [0203] xi) in any combination of (i)-(x).
[0204] The invention is further illustrated by the following examples (e.g., as illustrated in
Examples of the invention
Methods
Generation of the Split-dCas9
[0205] The nuclease inactivating point mutations D10A and N863A were introduced into the plasmids pAAV_crTLR#1_Nv1 and pAAV_crTLR#1_Cv1 from Truong et al. using QuikChange II Site Directed Mutagenesis Kit (Agilent Technologies, 200523, USA) (Truong et al., 2015). miRNA218 cloning was performed according to Rivetti di Val Cervo et al (Rivetti di Val Cervo et al., 2017).
Animals and Surgery
[0206] For the analysis the B6.Cg-Tg(Gfap-cre)77.6Mvs/2J (Gfap-Cre) was purchased from Jackson Laboratories (#024098). The Rosa26-dCas-activator mouse line was generated using CRISPR/Cas9-based gene editing by microinjection into one cell embryos. Adult mice (3-4 month) received a unilateral injection of 6-hydroxydopamine-HCl (6-0HDA-HCl) (Sigma-Aldrich, H4381, USA) into the left medial forebrain bundle (AP ?1.2, ML +1, DV ?4.9). Two weeks after toxin injection, high titer recombinant adeno-associated virus was applied into the ipsilateral striatum (AP +1, ML +2.1, DV ?3.5). Stereotaxic coordinates (millimeters) are relative to bregma.
Behaviour Analysis
[0207] To assess voluntary movement mice were tested on an automated, video-based gait analysis system, the CatWalk XT (Noldus, Wageningen, The Netherlands). For the vertical pole test the mice were placed facing upwards onto a wooden, rough-surfaced pole and tested for the time they needed to turn downwards. For the drug-induced circling behavior mice received an intraperitoneal injection of 5 mg/kg amphetamine before being placed into a transparent cylinder (diameter 12.5 cm, ehight 30 cm). After 15 min of habituation, they were monitored for 45 min and automated 90? body rotation counts were counted using Ethovision software (Ethovision XT 14, Noldus, Wageningen, The Netherlands).
Molecular Cloning
Polymerase Chain Reaction
[0208] PCRs are performed using the Q5 High-Fidelity 2? Master Mix (NEB, M0492S, USA). For the amplification of GC-rich regions the KAPA HiFi HotStart PCR Kit (Kapa Biosystems, KK2501, Swiss) was used. For colony PCR and genotyping reactions VWR Red Taq DNA Polymerase Master Mix (VWR, 733-2131, USA) was deployed. For STAgR cloning the Phusion High-Fidelity DNA Polymerase (Thermo Fisher, F530S, USA) was applied. Site-directed mutagenesis was performed using QuikChange II Site Directed Mutagenesis Kit (Agilent Technologies, 200523, USA). All reactions were performed according to manufacturer's instructions.
[0209] If the PCR product was further employed in cloning steps it was either PCR purified using QlAquick PCR purification kit (Quiagen, 28104, Netherlands), or gel purified followed by a gel purification step using QlAquick gel extraction kit (Quiagen, 28115, Netherlands), both reactions were performed according to manufacturer's instructions.
Enzymatic Digest
[0210] Restriction enzymes from New England Biolabs were used according to manufacturer's instructions. For plasmid digest 500 ng to 1 ?g of DNA was digested and subsequently gel purified using QlAquick gel extraction kit (Quiagen, 28115, Netherlands). For the digest of PCR products 500 ng of DNA was used followed by a PCR purification using QlAquick PCR purification kit (Quiagen, 28104, Netherlands), both reactions were performed according to manufacturer's instructions.
DNA Ligation
[0211] DNA fragments were ligated using T4 DNA Ligase (NEB, M0202S, USA) using 20 ng of vector DNA and a molar ratio of vector/insert of 1/3, reaction was performed for 20 minutes at room temperature. For the ligation of multiple PCR fragments Gibson assembly was performed using NEBuilder0 HiFi DNA Assembly Master Mix (NEB, E2621S, USA), fragments were used in an equimolar ratio and reaction was performed for 1 h at 50? C.
sgRNA Design and Cloning
[0212] All sgRNAs were designed using the online tool benchling.com. sgRNAs were targeted to the region -250 bp to the transcriptional start site of the target gene. Two sgRNAs were used per gene (see corresponding DNA binding sites below). Multiplexed sgRNA cloning was performed using the string assembly sgRNA cloning strategy (STAgR) (Breunig et al., 2018).
TABLE-US-00001 SEQ Name Gene Sequence5-3 IDNOS: Ascl1-1 Ascl1 GGGAGCCGCTCGCTGCAGCAGCG 28 Ascl1-2 Ascl1 GGGGCTGAATGGAGAGTTTGCA 29 Lmx1a-1 Lmx1a GGGAGCAAAGGAGTCGCCTTG 30 Lmx1a-2 Lmx1a GAATGCATCCAAGAGTGAACC 31 Nr4a2-1 Nr4a2 GGCGGTGGGTCATTGTTTCCG 32 Nr4a2-2 Nr4a2 GTGCCAGTGACGCCGGCCTGG 33 NeuroD1-1 NeuroD1 GGTTCTGGGAGGGGTGAATGA 34 NeuroD1-2 NeuroD1 GGCCATATGGCGCATGCCGGGG 35 Neurog2-1 Neurog2 ATAAGCTGGGGAGGGAGAGC 36 Neurog2-2 Neurog2 AAACAATCAGATCTGCCCCG 37 PITX3-1 PITX3 ATTCACHTATGGCAACCCA 38 PITX3-2 PITX3 GCTAGCCTGGGAGAGCCCAG 39 FoxA2-I FoxA2 GAAAGTAACCTTGAAACACCG 40 FoxA2-2 FoxA2 GGGTAGCCAGAAAGAGGACTG 41 MyoD1-1 MyoD1 CCAATAGGAGTGTAGTAGGG 42 MyoD1-2 MyoD1 GAGAGACTGGCAGCCATACG 43 Pou5f1-1 Pou5f1 ATCTGCCTGTGTCTTCCAGA 44 Pou5f1-2 Pou5f1 TGTCCGGTGACCCAAGGCAG 45
Transformation and Plasmid Purification
[0213] Chemically competent DH5a or NEB stable (plasmids for AAV production) bacteria were used for transformation. After a heat-shock was performed bacteria were spread on agar plates containing the suitable selection marker. Plates were incubated over night at 37? C. and single colonies were picked for further analysis.
[0214] For plasmid purification Plasmid Mini Kit (Qiagen, 12123, Netherlands) or EndoFree Plasmid Maxi Kit (Qiagen, 12163, Netherlands) was used according to manufacturer's instructions.
Cell Culture
[0215] All cells are incubated at 37? C. with 7.5% CO2. Neuro2A cell line was purchased from ATCC (ATCC, CCL-131, USA). Cells are cultures in DMEM/F12 GlutaMAXTM-I medium with 10% FCS.
Isolation of Primary Cortical Astrocytes
[0216] Primary cortical astrocytes were obtained from postnatal (P5-P6) mice following a protocol adapted from Heinrich et al.(Heinrich et al., 2011). After tissue dissection, the cortices were dissociated and purified using the Adult Brain Dissociation Kit from Miltenyi (Miltenyi, 130107677, Germany). Instead of using the gentleMACS Octo Dissociator the tissue was kept in the enzyme mixture for 30 minutes, every 10 minutes the mixture was pipetted up and down (5 times) using a 10 mL serological pipette for tissue dissociation. Subsequently the protocol was performed according to manufacturer's instructions without conducting the red blood cell removal. For the purification of astrocytes the cortical cell mixture was separated using the Anti-ACSA-2 MicroMead Kit (Miltenyi, 130097678, Germany). As soon as the cells reach a confluency of ?80% (day 7-10), 300.000 cells were seeded per 6 well.
Lipofection
[0217] Astrocytes were transfected using Lipofectamine 2000 (Invitrogen, 11668, USA) according to manufacturer's instructions. 30 minutes prior to the lipofection cells are equilibrated in 1.5 ml OptiMEM with 10% glutamine. 3.6 ?g of DNA is transfected per 6 well using a DNA/lipofectamine ratio of 1/3. 4 h later the transfection media is removed and exchanged by conditioned astrocyte media. 48 hours after the transfection the RNA is isolated, respectively cells are fixed using 4% paraformaldehyde for immunocytochemistry.
FACS Sorting
[0218] Astrocytes were trypsinated for 5 minutes using 0.05% trypsin-EDTA (Thermo Fisher, 25300054, USA), reaction was stopped with PBS pH 7.4 with 5% fetal bovine serum (Thermo Fisher, A2153, USA). After centrifugation cells were resuspended in PBS pH 7.4 with 0.5% fetal bovine serum and kept on ice until further processing. The green fluorescent protein was co-transfected in order to enrich cells that were successfully transfected. Green cells were enriched with the BD FACSaria II controlled with the BD FACSDiva Software Version 6.1.3 (BD Biosciences, USA), cells were collected and further processed for RNA isolation.
RNA Isolation, cDNA Preparation
[0219] Given the low transfection efficiency, cells are sorted using the FACSARIA III (Biosciences) with a 100 ?m nozzle according to GFP signal, expressed from a co-transfected plasmid. RNA is isolated using PicoPure RNA Isolation Kit (Invitrogen, KIT0204, USA). cDNA is produced using SuperScript VILO cDNA Synthesis Kit (Thermo Fisher, 11754050, USA).
Real Time qPCR qPCR is performed using TaqMan Universal Master Mix (Thermo Fisher, 4304437, USA) and TaqMan probes, all probes are listed herein. Reaction was performed according to manufacturer's instructions. RT-qPCR was carried out using an ABI Prism 7900 HT Real-Time PCR System and SDS 2.4.1 software.
TABLE-US-00002 Gene TaqMan probe (Assay ID) Ascl1/Mash1 Mm03058063_m1 Lmx1a Mm00473947_m1 Nr4a2/NR4A2 Mm00443060_m1 NeuroD1 Mm01280117_m1 Ngn2 Mm00437603_g1 PITX3 Mm01194166_g1 FoxA2 Mm00839704_mH MyoD1 Mm00440387_m1 Pou5fl Mm00658129_gH B-Actin Mm00607939_s1
Immunocytochemistry
[0220] Cells were fixed using 4% paraformaldehyde. Primary and secondary antibodies were diluted in PBS containing 1% bovine serum albumin and 0.5% Triton X-100. Primary antibody was incubated overnight at 4? C., secondary antibody was for one hour at room temperature. Primary antibodies: mouse-anti-ASCL1 1:1000 (BD Bioscience, 556604, USA), rabbit-anti-LMX1A 1:2000 (Merck-Millipore, ab10533, Germany), mouse-anti-Nr4a2 1:2000 (Santa Cruz, se-376984, USA), rabbit-anti-Flagtag 1:1000 (Sigma, F1804, USA), rabbit-anti-MAP2 1:1000 (Merck-Millipore, AB5622, Germany). Secondary antibodies: Donkey anti-mouse IgG Alexa Fluor 594 1:500 (Thermo Fisher Scientific, A-21203, Germany), donkey anti-rabbit IgG Alexa Fluor 594 1:500 (Thermo Fisher Scientific, A-21207, Germany). Coverslips were mounted onto glass slides using Aqua-Poly/Mount.
Lentivirus Production
[0221] Production and titer determination of replication incompetent, self-inactivating lentiviruses was performed as described before (Theodorou et al., 2015).
Western Blot
[0222] Primary antibodies were diluted in TBS-T containing 0.5% milk powder and incubated over night at 4? C. Primary antibodies: rabbit-anti-HA tag (C29F4) 1:500 (Cell Signaling, 3724, USA), mouse-anti-?-Actin 1:10000 (GeneTex, GTX26276, USA), anti-mouse-N-Cas9 1:500 (Epigentek, A-9000, USA), anti-mouse-C-Cas9 1:1000 (Novus biologicals, NBP2-52398SS, USA), anti-rabbit-P2A 1:1000 (Sigma-Aldrich, ABS31, USA). Secondary antibodies were diluted in TBS-T containing 5% milk powder and incubated for 1 hour at room temperature. Secondary antibodies: Goat anti-rabbit IgG HRPO 1:5000 (Dianova, 111-035-003, USA), goat anti-mouse IgG HRPO 1:5000 (Dianova, 115-035-003, USA).
Animals
[0223] For the analysis the B6.Cg-Tg(Gfap-cre)77.6Mvs/2J (GFAP-Cre) was purchased from Jackson Laboratories (024098), the line was further bred on a B6N background. The Rosa26-dCas-activator mouse line (dCAM) was produced on a B6N background. For the analysis littermates of the B6.Cg-Tg(Gfap-cre)77.6Mvs/2J x dCAM/N line was used. When crossing the B6.Cg-Tg(Gfap-cre)77.6Mvs/2J line with transgenic animal carrying LoxP cassettes, it was payed attention to only breed female Cre mice, as it is known for this line to have Cre expression in the male germline.
Generation of CRISPR-Activator Mouse Line via Microinjection of One-Cell Embryo
[0224] The Rosa26-dCas-activator mouse line was generated using CRISPR/Cas9-based gene editing by microinjection into one cell embryos. For this, a gene specific guide RNA (Rosa26_gRNA 5-ACTCCAGTCTTTCTAGAAGA-3) was used as in vitro transcribed single gRNA (EnGen? sgRNA Synthesis Kit, NEB, E3322, USA). Prior to pronuclear injection, gRNA (25 ng/?l) and targeting vector (50 ng/?l) were diluted in microinjection buffer (10 mM Tris, 0.1 mM EDTA, pH 7.2) together with recombinant Cas9 protein (50ng/?l, IDT, Coralville, USA) and incubated for 10 min at room temperature and 10 minutes at 37? C. to form the active ribonucleoprotein (RNP) complex. One-cell embryos were obtained by mating of C57BL/6N males (obtained from Charles River, Sulzbach, Germany) with C57BL/6N females superovulated with 5 units PMSG (Pregnant Mare's Serum Gonadotropin) and 5 units HCG (Human Chorionic Gonadotropin). For microinjections, one-cell embryos were injected into the larger pronucleus. Following injection, zygotes were transferred into pseudo-pregnant CD1 female mice to obtain live pups. All mice showed normal development and appeared healthy. Handling of the animals was performed in accordance to institutional guidelines and approved by the animal welfare committee of the government of upper Bavaria. The mice were housed in standard cages in a specific pathogen-free facility on a 12 h light/dark cycle with ad libitum access to food and water. Analysis of gene editing events was performed on genomic DNA isolated from ear biopsies of founder mice and F1 progeny, using the Wizard Genomic DNA Purification Kit (Promega, A1120, Germany) following the manufacturer's instructions.
Animal Housing
[0225] Animal housing and handling protocols were approved by the committee for the Care and Use of Laboratory animals of the Government of Upper Bavaria (Germany) and were carried out in accordance with the European Communities' Council Directive 2010/63/EU. During the work, all efforts were made to minimize animal suffering. All mouse lines were kept in a controlled pathogen free (SPF) hygiene standard environment on a 12 h light/dark cycle. The mice had access to ad libitum standard feed and water always. All tests were approved for the ethical treatment of animals by the Government of Upper Bavaria.
6-OHDA Lesion
[0226] Adult (3-4 months) mice were chosen for dopamine depletion of the left striatum, mice received a unilateral injection of 6-hydroxydopamine-HCl (6-OHDA-HCl) (Sigma-Aldrich, H4381, USA) into the left medial forebrain bundle (MFB). All animals receive intraperitoneal injection of Medetomidin (0.5 mg/kg), Midazolam (5mg/kg), Fentanyl (0.05 mg/kg) (MMF) as anesthesia. The mouse received pre-emptive Metamizol (200 mg/kg s.c.) and a local subcutaneous injection of 2% Lidocain. The animal was positioned into the stereotactic frame containing an integrated warming base (Stoelting, 51730D, USA) to maintain normothermia. 6-OHDA-HCl was dissolved in 0.2% ascorbic acid (Sigma-Aldrich, A4403, USA) in saline at a concentration of 2 ?g/pl of free-base 6-0HDA-HCl. Each mouse was injected 1.5 ?l (0.2 ?l/min) of solution into the left MFB according to the following coordinates: anteroposterior (AP) -1.2, mediolateral (ML) +1, dorsoventral (DV) -4.9 (all millimeters relative to bregma) with flat skull position. The needle was left in place for 3 minutes after the injection to allow the toxin to diffuse before slow withdrawal of the capillary. Mice were woken up from anesthesia by the subcutaneous injection of Atipamezol (2.5 mg/kg) and Flumazenil (0.5 mg/kg). Mice were left for recovery for 2 weeks before experimentation.
Stereotactic Injection
[0227] The dopamine depleted animals were injected into the ipsilateral striatum with high titer recombinant adeno-associated virus (AAV). Mice were anesthetized with MMF and received pre-emptive pain treatment as for the 6-OHDA-HCl injection, subsequently they were positioned into the stereotactic frame with flat skull position. Each mouse received 1 ?l rAAV2/5 (0.2 ?l/min) into the left dorsal striatum according to the following coordinates: AP +1, ML +2.1, DV ?3.5 (all millimeters relative to bregma). The needle was left in place for 3 minutes after the injection to allow the virus to diffuse before slow withdrawal of the capillary. Mice were woken up from anesthesia by the subcutaneous injection of Atipamezol (2.5 mg/kg) and Flumazenil (0.5 mg/kg).
rAAV Production
[0228] High-titer preparations of rAAV2/5 were produced based on the protocol of Zolotukhin and colleagues (Zolotukhin et al., 1999) with minor modifications. In brief, HEK 293T cells were transfected with the CaPO4 precipitation method, the plasmids pRC5, Ad helper and pAAV were applied in an equimolar ratio. After 72 h, cell pellet was harvested with AAV release solution, 50 U/ml benzonase was added, then solution was incubated for 2 h at 37? C. Cells were frozen and thawed in liquid nitrogen to allow rAAV release. Purification of rAAV vector was done with iodixanol densities gradient (consisting of 15, 25, 40 and 56% iodixanol), followed by gradient spinning at 50.000 rpm for 2 h 17 min at 22? C. in a Ti70 rotor (Beckman, Fullerton, CA, USA). rAAV was collected at 40% iodixanol with a 5 ml syringe. Virus was dialyzed (Slide-A-Lyzer 10.000 MWCO 5m1) in buffer A overnight to remove iodixanol. Anion exchange chromatography column HiTrap Q FF sepharose column and Superloop were connected with the AKTAprime plus chromatography system to collect the eluted fraction. To measure rAAV concentration, the eluted fraction was spun and washed once in PBS-MK Pluronic-F68 buffer with a Millipore 30K MWCO 6 ml filter unit. rAAVs were stored in a glass vial tube at 4? C. rAAVs were titered by SYBR Green qPCR with GFP or SV40 primer (DCosta et al., 2016). Usual titer was 3 x 1014 to 5 x 1015 GC/ml.
Immunohistochemistry
[0229] For histological analysis the mice were asphyxiated with CO2 and perfused transcardially with 4% ice-cold paraformaldehyde (PFA) (Sigma-Aldrich, P6148, USA) in 0.1 M PBS with pH 7.4. After dissection the brain was post-fixed in PFA overnight at 4? C. followed by storage in 30% sucrose for minimum 24 hours at 4? C. Brains were cut coronal into 40 ?m thick serial sections on a cryostat (Thermo Fisher Scientific, HM 560 Kryostat, Microm, Germany). Free floating sections were stored at 4? C. in cyro protection solution (50% PBS pH 7.4, 25% ethylene glycol (Carl Roth, 2441, Germany), 25% glycerol (Sigma-Aldrich, G9012, USA)) until further processing.
[0230] In general sections were blocked in PBS pH 7.4 with 2% fetal bovine serum (Thermo Fisher, A2153, USA) and 0.1% Triton X-100 (Sigma-Aldrich, T9284, USA) for 2 hours. Subsequently, brain slices were incubated over night at 4? C. in primary antibody diluted in blocking solution. Sections were three times washed for 15 minutes with PBS pH 7.4 before incubated with secondary antibody diluted in PBS pH 7.4 containing 0.1% Triton X-100 (Sigma-Aldrich, T9284, USA) for one hour at room temperature. Slices were washed with 100 ng/mL DAPI-PBS solution pH 7.4 (Sigma-Aldrich, D8417, USA) for 5 minutes, followed by three 15 minutes washes with PBS pH 7.4. Slices were mounted on coverslips using Aqua-Poly/Mount (Polysciences, 18606, USA). For the NeuN staining the sections were undertaken an antigen retrieval protocol. In short, the sections were incubated in 0.01 M Na-citrate buffer pH 6 at 80? C. for 45 minutes and allowed to cool down to room temperature per se. Subsequently, brain slices were blocked in 3% milk solution containing 0.3% Triton X-100 for 2 hours. Sections are incubated overnight at 4? C. in primary antibody diluted in blocking solution. Sections are washed three times for 1 hour in PBS pH 7.4 containing 0.3% Triton X-100 and incubated overnight at 4? C. in secondary antibody diluted in blocking solution. Slices were washed with 100 ng/mL DAPI-PBS solution pH 7.4 (Sigma-Aldrich, D8417, USA) for 5 minutes, followed by three 15 minutes washes with PBS pH 7.4. Slices were mounted on coverslips using Aqua-Poly/Mount (Polysciences, 18606, USA). Primary antibodies: rabbit-anti-tyrosine hydroxylase 1:500 (Pel-Freeze, P40101, USA), mouse-anti-NeuN 1:1000 (Abcam, ab104224, USA), anti-chicken-GFP 1:1000 (Abcam, ab13970, USA), anti-rabbit-GFAP 1:1000 (Abcam,ab7260, USA), anti-mouse-Parvalbumin 1:1000 (Sigma-Aldrich, P3088, USA), anti-rabbit-calretinin 1:1000 (Swant, CR7697, Switzerland), anti-goat-CHAT 1:100 (Merck-Millipore, AB144P, Germany), anti-rabbit-Gad65/67 1:500 (Abcam, ab49832, USA), anti-mouse-vGLUT1 1:1000 (Atlas, AMAb91041, USA), anti-rabbit-DARPP32 1:500 (Abcam, ab40801, USA), anti-rabbit-MAP2 1:500 (Merck-Millipore, ab5622, Germany), anti-rabbit-TUJ1 1:500 (Abcam, ab18207, USA). Secondary antibodies: Donkey anti-mouse IgG Alexa Fluor 594 1:500 (Thermo Fisher Scientific, A-21203, Germany), donkey anti-rabbit IgG Alexa Fluor 594 1:500 (Thermo Fisher Scientific, A-21207, Germany), donkey anti-chicken IgY Alexa Fluor 488 1:250 (Dianova, 703-546-155, Germany).
Image Acquisition
[0231] All images were acquired on a confocal laser scanning (Zeiss LSM880) microscope, if not differently indicated.
Cell Counting
[0232] All stereological quantifications were performed using the Stereoinvestigator Zeiss Imager M2 with the software version 2019.1.3. The dorsal striatum of at least three animals was analyzed for quantification. Regions close to the subventricular zone were excluded form counting.
Behaviour Analysis
[0233] Thirteen weeks after rAAV intracerebral injection mice underwent gait analysis.
Catwalk
[0234] Mice were tested on an automated, video-based gait analysis system, the CatWalk XT (Noldus, Wageningen, The Netherlands). The animals walk over an elevated glass walkway (width 8 cm, length 100 cm) enclosed by plexiglas walls (height 14 cm) in a dark room. A camera (Pulnix Camera RM-765) situated below the middle of the walkway tracked the illuminated footprints, which were later analyzed with the CatWalk software Version 7.1. The software automatically calculates a wide number of parameters in several categories which describe gait in spatial and temporal aspects. For a more detailed description see HOlter et al. and Zimprich et al.(1-161ter and Glasl, 2012; Zimprich et al., 2018).
[0235] Drug-induced Rotation Analyses
[0236] The mice were placed individually in plexiglas cylinders (diameter 12.5 cm, height 30 cm). Experiments were recorded from a ventral plane view, videos were analyzed with the automated 90? body rotation counts using Ethovision software (Ethovision XT 14, Netherlands). Mice were allowed to habituate for 15 min before monitoring for 45 min. Amphetamine was dissolved in saline at a concentration of 0.5 mg/mL, each mouse received an intraperitoneal injection of 5 mg/kg before being placed into the cylinder.
Vertical Pole Test
[0237] Mice were placed facing upwards onto a wooden, rough-surfaced pole (length 50 cm, diameter 1 cm) with a square base plate. Mice were tested for the time they need to turn downwards (latency time) and the total time they need to reach the base of the pole (total time). Right before the test trials, the mice were trained in small groups with less than ten animals. Each mouse was coached three to five times before moving on to the next one. Then three test trials were performed with each mouse in the same sequential order, so that the time interval between training and testing was the same for each individual.
Electrophysiology
Preparation of Brain Slices
[0238] Acute 220 ?m thick brain coronal slices containing the dorsal striatum were cut on a vibratome (Leica VT1200, Germany) in a bubbled (95% O2/5% CO2) standard ice-cold artificial cerebrospinal fluid (ACSF) containing (in mM): 126 NaCl, 2.5 KCl, 1.2 MgCl2, 2.4 CaCl2, 1.2 NaH2PO4, 21.4 NaHCO3, 11.1 glucose, complemented from slicing only with (in mM): 3 kynurenic acid, 26.2 NaHCO3, 225 sucrose, 1.25 glucose and 4.9 MgCl2. Slices were then transferred to a chamber containing standard ACSF oxygenated with 95% O2/5% CO2 at 35? C. for 15 min and subsequently maintained at room temperature for at least another 15 min prior to use.
Whole-Cell Recordings
[0239] Dorsal striatal reprogrammed cells (either neurons or glia) were visualized with a 20x/1.0NA WI objective, 4x post-magnification, under video microscope (Olympus BX51WI, Germany) coupled with infrared gradient contrast and epifluorescence. Whole-cell patch-clamp recordings in current clamp mode were acquired from the somata of fluorescent cells with a Multiclamp 700B amplifier (Molecular Devices, Foster City, CA), digitized at 10 kHz and Bessel filtered at 4kHz. Pipettes (4-6 m0) were filled with an intracellular solution containing (in mM): 100 K-gluconate, 20 KCl, 4 Mg-ATP, 0.3 Na-GTP, 10 Na2-Phosphocreatine, 10 Hepes, (pH 7.3, 290 mOsm). All recordings were carried out at 35? C. and slices continually superfused with oxygenated (95% 02/5% CO2) ACSF. Passive membrane properties were assessed by injecting 500 ms depolarizing current steps. Putative spontaneous postsynaptic potential were recorded with the same internal solution in voltage clamp mode while the cell being held at -70 mV. Data were analyzed with custom-written routines in IgorPro.
Single Cell Analysis
Tissue Dissociation
[0240] Cells were dissected from mouse striatum (n=2) and dissociated into single cell suspension using the papain kit (Worthington) according to manufacturer's instructions. Incubation with dissociating enzyme was performed for 90 min.
Library Preparation and Sequencing
[0241] Single cell suspensions were loaded onto 10? Genomics Single Cell 3Chips together with the reverse transcription mastermix according to manufacturer's instructions for the Chromium Single Cell 3library & Gel Bead Kit v2 (PN-120237, 10? Genomics) to generate single cell gel beads in emulsion (GEMs). cDNA synthesis was done according to 10?Genomics guidelines. Libraries were pooled and sequenced on a NovaSeq6000 (Illumina) according to the Chromium Single Cell v.2 specifications and with an average read depth of 50,000 aligned reads per cell. Sequencing was performed in the genome analysis center of the Helmholtz Center Munich.
Alignment and Data Analysis
[0242] Transcriptome alignment of single cell data was done using Cell Ranger 3.1.0 against a modified version of the mouse transcriptome GrCm38 (Ensembl Release 99) that included both GFP and Cre sequences. Quality Control (QC) of mapped cells was done using recommendations by Luecken et al.(Luecken and Theis, 2019), selecting 3,899 cells with at least 800 reads and 250 detected genes. Normalization and log transformation was performed using the counts per million (CPM) strategy with a target count depth of 10,000 using SCANPY's (Wolf et al., 2018) normalize_total and log1p functions. Highly variable gene selection was performed via the function highly_variable_genes using the Seurat49 flavour with default parametrization, obtaining 4,274 HVGs in at least one experimental group. Following cell count normalization experimental groups were integrated with Scanorama (Hie et al., 2019). Unsupervised clustering of cells was done using the Leiden algorithm (Traag et al., 2019b) as implemented in SCANPY and with resolution parameter of 0.05. This allowed classification and counting of nine main cell types based on marker genes selected using t-test between the normalized counts of each marker gene in a cell type against all others (function rank_genes_groups in SCANPY). 1,110 cells assigned to astrocytic and neuronal cell types were subclustered into four groups using Leiden with a resolution of 0.30. Marker genes in these four groups were detected using t-test between each group against the other three. Detection of cells positive for GFP, Cre and other marker genes was done using as criteria any cell with normalized counts greater than zero. Visualization of cell groups is done using Uniform Manifold Approximation and Projection (UMAP) (Melville et al., 2018), as implemented in SCANPY.
Statistics
[0243] Statistical analysis was performed using Graphpad Prism 7 software. If not differently indicated, at least three biological replicates were analyzed. The normality of the distribution of data points was verified using Shapiro-Wilk test. Data was analyzed using either an unpaired t-test or a multiple comparison ANOVA, followed by a posthoc Tukey's multiple comparisons test. When normality tests did not indicate normal distribution, non-parametric Kruskall-Wallis test was performed. Asterisks are assigned as followed * p<0.5, ** p<0.01, *** p<0.001, **** p<0.0001.
Example 1: Results: Generation of the Conditional Rosa26 knock-in dCas9 Activator Mouse (dCAM)
[0244] To facilitate the comprehensive and efficient application of CRISPR/Cas9 activation (CRISPRa) in vivo, we generated a dCas9-activator knock-in mouse line in the safe harbor locus Gt(ROSA)26Sor, combining two previously described activation systems dCas9-VPR and SAM (synergistic activation mediator) (Chavez et al., 2015; Konermann et al., 2015) (
Example 2: Results: dCAM Based Reprogramming of Astrocytes into Induced Neurons in vivo
[0245] To model advanced stages of PD in mice, we utilized the well-established 6-hydroxydopamine (6-OHDA) toxin model. dCAM x Gfap-Cre double transgenic mice, expressing CRISPRa specifically in astrocytes, were subjected to a unilateral injection of the neurotoxin into the medium forebrain bundle (MFB) at the age of 12-16 weeks, resulting in an efficient and reproducible lesion of the dopaminergic neurons, primarily in the ipsilateral SNpc and their projections into the striatum (Gregorian et al., 2009). This injury promotes reactive gliosis in the striatum, indicated by the upregulation of Gfap (
Example 3: Results: AAV Based Split-dCas9-Activator System (AAV-dCAS) for Endogenous Gene Activation
[0246] The efficient and thorough reprogramming via CRISPRa gene activation observed in our dCAM line encouraged us to generate a universal tool, independent of transgenic recipients, by delivering the complete CRISPRa system via AAVs. It is important to render these reprogramming approaches versatile for a broad range of applications, such as usage in other model organisms like non-human primates, and ultimately, for cell reprogramming therapies in patients. Gold standard for the delivery of the sgRNAs are AAVs, as they exhibit low immunogenicity and ensure high and sustained expression (Grieger and Samulski, 2005; Mattugini et al., 2019; Zaiss and Muruve, 2005). To circumvent the low packaging capacity of AAVs, we applied a split-intein approach to the dCas9-SAM system suitable for AAV (AAV-dCAS) integration. As our in vitro studies have shown that the SAM activator system alone is sufficient to provide robust gene induction (
Example 4: Results: AAV-dCAS Based Reprogramming of Astrocytes into Induced Neurons in vivo
[0247] Similar to the dCAM-based reprogramming experiment, we employed the transgenic Gfap-Cre mouse line to ensure astrocyte-specific expression of the reprogramming tools. Experimental setup and timeframe were identical to the dCAM setting; to deliver split-dCas9, a FLEx-N-dCas9 and a C-dCas9-VP64 AAV were used, inducing expression of N-dCas9 in astrocytes (Gregorian et al., 2009; Torper et al., 2015); identical sgRNAs and the FLEx-GFP reporter were delivered by additional AAVs. At 5 wpi, the proportion of different infected cell types was comparable to the results in the dCAM system (
Example 5: Results: Characterization of Cell Identity of Induced Neurons
[0248] To define the subtype of the induced neurons, immunohistochemical (IHC) analysis on striatal sections of mice 13 wpi was performed. Data is shown for the AAV-dCAS system, and the analysis of dCAM revealed similar results (data not shown). Cells were positive for Gad65/67 a marker for GABAergic neurons (
Example 6: Results: Single cell RNA-seq Analysis Reveals the GABAergic Fate of Induced Neurons in dCAM Model
[0249] To further characterize the induced neurons scRNA-seq experiments were performed using striatal tissue 13 wpi from GFP control, as well as ALN reprogrammed animals (n=2). The dCAM system was used, as low number of AAVs ensures high consistency within the data. Batch integration of single cell data using Scanorama (Hie et al., 2019) and unsupervised clustering and marker gene annotation of all 3,899 QC-controlled cells (
Example 7: Results: Electrophysiological Properties of AAV-dCAS Induced Neurons
[0250] We additionally investigated the electrophysiological properties of neurons reprogrammed with ALN combination 13 weeks after initiating of the reprogramming process and found that induced neurons exhibited mature electrophysiological properties characterized by depolarization-induced action potentials (APs) (
Example 8: Results: ALN-based Reprogramming Rescues Toxin-Induced Motor Phenotype
[0251] The phenotypical rescue of toxin-induced phenotypes represents the definite proof for the functionality and integration of the induced neurons. We examined the motor behavior in the unilateral 6-OHDA PD model to determine the therapeutic impact of in vivo direct neuronal reprogramming of the dCAM and AAV-dCAS models. Motor behavior was assessed during voluntary movement using the automated CatWalk XT system (Brooks and Dunnett, 2009; Dunnett and Torres, 2012; Glajch et al., 2012; Vandeputte et al., 2010). At 5 wpi we did not observe appreciable differences in spontaneous motor behavior between lesioned animals injected with the activating sgRNA combinations compared to GFP control virus (
[0252] Discussion
[0253] Parkinson's disease and the associated disturbance in movement coordination and behavior are provoked mainly by the loss of dopaminergic neurons in the SNpc. To date, the prevailing paradigm of disease treatment is the symptomatic management by direct interference of the dopaminergic system. Dopamine levels are restored by drug treatment or through transplantation of dopaminergic neurons (Stoker et al., 2017). As an alternative method, we have developed genetic tools to reprogram striatal astrocytes into mature neurons by the CRISPRa-mediated activation of multiple endogenous transcription factors, such as Ascl1, Lmx1a and Nr4a2 (ALN), or Ascl1, Lmx1a, NeuroD1 together with miRNA218 (ALNe-218) (Caiazzo et al., 2011; Pereira et al., 2017; Rivetti di Val Cervo et al., 2017; Torper et al., 2015). The conventional reprogramming approaches use the ectopic expression of the gene coding sequences (cDNA), making multiplexing of several genes difficult if not impossible, especially when large genes have to be expressed. In contrast, the CRISPRa platform allows multiplexed activation of many endogenous genes solely by introducing specific sgRNAs, with a fixed cargo size for each gene, such that the endogenous transcriptional machinery can be co-opted to execute complex genetic splicing patterns (Pang et al., 2011; Torper et al., 2015; Vierbuchen et al., 2010). Here, we describe two distinct approaches based on CRISPR-mediated gene activation to achieve successful treatment of a murine toxin-induced PD model. For the dCAM mouse line we followed a Rosa26 knock-in strategy of a Cre- and Flpe-dependent dual activator system, harboring the VPR and SAM activator complexes where the defined integration and the optional twofold mode of activation are the prominent features differentiating our line from the recently reported SPH transgenic mouse line (Zhou et al., 2018). After confirming the technical and biological functionality of the dCAM approach, we expanded the toolbox by developing an AAV-based split-dCas9/SAM system, making it versatile and applicable across species with minimal modifications (Truong et al., 2015). Strikingly, with the split-dCas9 AAV-based system (AAV-dCAS) we could recapitulate the results obtained with dCAM, confirming the functionality and robustness of the CRISPRa approach to reprogram striatal astrocytes into induced neurons by multiple gene activation in vivo.
[0254] Thirteen weeks after injection, the combination ALN was capable to generate functional neurons with mature electrophysiological properties, whereas cells reprogrammed by ALNe-218 exhibited characteristics reminiscent of astrocytes or immature neurons. Furthermore, only ALN induced neurons led to an improvement in voluntary motor behavior, and a balancing of the axial symmetry. This behavioral rescue could be observed to a similar extent, both in dCAM as well as AAV-dCAS animals, confirming the biological functionality of the CRISPRa-mediated gene activation approach. The de novo induced neurons were not immunoreactive for the dopaminergic marker TH. Nevertheless, independent of reprogramming, we observe TH+ neurons in the striatum, which may either emerge due to the 6-OHDA toxin treatment or represent naturally occurring TH+ interneurons within the striatum (Mao et al., 2019; Pereira et al., 2017; Tepper and Koos, 2016). In this regard, the FLEx-GFP marker employed in this study, proved to be beneficial for the definite identification of induced neurons and its demarcation from reprogramming independent TH+neurons. Interestingly, scRNA-seq analysis of reprogrammed neurons in vivo, as well as immunological staining, revealed a GABAergic identity of the reprogrammed neurons. This is indicating that the regional identity of the targeted astrocytes in combination with the reprogramming factors are predominant for the determination of the final neuronal subtypes, which is supported in part by recent publications of Qian et al. and Zhou et al., 2020 utilizing the knockdown of the RNA-binding protein PTB (Qian et al., 2020; Zhou et al., 2020). The induced neurons were neither positive for DARPP32, a marker for striatal medium spiny neurons representing the main neuronal class within the striatum, nor did they exhibit standard electrophysiological properties of this particular neuronal subtype. This indicates that the reprogrammed neurons presumably differentiate into a distinct GABAergic interneuron population, capable of modulating striatal motor circuits (Cepeda et al., 2008; Gertler et al., 2008; Grande et al., 2013; Planert et al., 2013). Furthermore, these electrophysiological properties are distinct from PV+ interneurons, which have been shown by a recent publication to arise during ALN overexpression in NG2+ oligodendrocyte precursors, which may be explained by the different starter cell populations (Masserdotti et al., 2016; Pereira et al., 2017). The major originality of this study lies in the fact, that the CRISPRa induced ALN combination in the striatum, using either dCAM or AAV-dCAS, induces specific GABAergic neurons, capable of alleviating motor behavior symptoms in a 6-OHDA model. This is surprising, since the research focus so far has been on the restoration of the dopaminergic drive to alleviate motor symptoms. However, it has been reported that dopamine depletion in 6-OHDA toxin treated PD rodent models has a strong effect on striatal circuits. Specifically, increased excitatory cholinergic and reduced inhibitory GABAergic signals have been observed (Salin et al., 2009). In addition, most of the basal striatal excitatory drive arising from cholinergic interneurons is balanced by a concomitant GABAergic inhibition; this signaling is impaired by dopamine deprivation (Lozovaya et al., 2018). Furthermore, integrity of the fast spiking striatal GABAergic interneurons has been shown to depend on dopaminergic input from SNpc39. Altogether, these reports as well as our own findings suggest, that the imbalance in striatal microcircuitry-including impaired GABAergic signaling-contribute to the altered motor behavior in parkinsonian state. These observations are supported by Martinez-Cerdeno et al. transplanting GABAergic neuron precursors into the striatum of parkinsonian state rats (Martinez-Cerdeno et al., 2010) and also rescuing in part motor behavior. Therefore, restoration or reinforcing of GABAergic inhibition in the striatum is an attractive alternative therapeutic concept for PD beyond the dopamine replacement strategies. Future experiments will show which strategy will reveal the best therapeutic effects.
[0255] In summary, here we show, that the transgene dCAM and the universal applicable AAV-dCAS system can rescue PD motor behavior deficits by the direct conversion of endogenous astrocytes into functional GABAergic neurons via a CRISPRa mediated induction of the reprogramming factors Ascl1, Lmx1a and Nr4a2. These novel tools can be employed to any reprogramming approaches in any organ, tissue and cell-type in vivo.
REFERENCES
[0256] Berninger, B., et al., 2007. Functional properties of neurons derived from in vitro reprogrammed postnatal astroglia. J Neurosci. 27, 8654-64. [0257] Breunig, C. T., et al., 2018. One step generation of customizable gRNA vectors for multiplex CRISPR approaches through string assembly gRNA cloning (STAgR). PLoS One. 13, e0196015. [0258] Brooks, S. P., Dunnett, S. B., 2009. Tests to assess motor phenotype in mice: a user's guide. Nat Rev Neurosci. 10, 519-29. [0259] Caiazzo, M., et al., 2011. Direct generation of functional dopaminergic neurons from mouse and human fibroblasts. Nature. 476, 224-7. [0260] Cepeda, C., et al., 2008. Differential electrophysiological properties of dopamine D1 and D2 receptor-containing striatal medium-sized spiny neurons. Eur J Neurosci. 27, 671-82. [0261] Chavez, A., et al., 2015. Highly efficient Cas9-mediated transcriptional programming. Nat Methods. 12, 326-8. [0262] Colasante, G., et al., 2020. In vivo CRISPRa decreases seizures and rescues cognitive deficits in a rodent model of epilepsy. Brain. 143, 891-905. [0263] DCosta, S., et al., 2016. Practical utilization of recombinant AAV vector reference standards: focus on vector genomes titration by free ITR qPCR. Mol Ther Methods Clin Dev. 5, 16019. [0264] Dunnett, S. B., Torres, E.M., 2012. Rotation in the 6-OHDA-Lesioned Rat. In: Animal Models of Movement Disorders: Volume I. Vol., E. L. Lane, S. B. Dunnett, ed.Aeds. Humana Press, Totowa, NJ, pp. 299-315. [0265] Foglieni, C., et al., 2017. Split GFP technologies to structurally characterize and quantify functional biomolecular interactions of FTD-related proteins. Sci Rep. 7, 14013. [0266] Gertler, T. S., Chan, C. S., Surmeier, D. J., 2008. Dichotomous anatomical properties of adult striatal medium spiny neurons. J Neurosci. 28, 10814-24. [0267] Glajch, K. E., et al., 2012. Sensorimotor assessment of the unilateral 6-hydroxydopamine mouse model of Parkinson's disease. Behav Brain Res. 230, 309-16. [0268] Grande, A., et al., 2013. Environmental impact on direct neuronal reprogramming in vivo in the adult brain. Nature communications. 4, 1-12. [0269] Grealish, S., et al., 2010. Characterisation of behavioural and neurodegenerative changes induced by intranigral 6-hydroxydopamine lesions in a mouse model of Parkinson's disease. Eur J Neurosci. 31, 2266-78. [0270] Gregorian, C., et al., 2009. Pten deletion in adult neural stem/progenitor cells enhances constitutive neurogenesis. J Neurosci. 29, 1874-86. [0271] Grieger, J. C., Samulski, R.J., 2005. Packaging capacity of adeno-associated virus serotypes: impact of larger genomes on infectivity and postentry steps. J Virol. 79, 9933-44. [0272] Guo, Z., et al., 2014. In vivo direct reprogramming of reactive glial cells into functional neurons after brain injury and in an Alzheimer's disease model. Cell Stem Cell. 14, 188-202. [0273] Heinrich, C., et al., 2010. Directing astroglia from the cerebral cortex into subtype specific functional neurons. PLoS Biol. 8, e1000373. [0274] Heinrich, C., et al., 2011. Generation of subtype-specific neurons from postnatal astroglia of the mouse cerebral cortex. Nat Protoc. 6, 214-28. [0275] Heins, N., et al., 2002. Glial cells generate neurons: the role of the transcription factor Pax6. Nat Neurosci. 5, 308-15. [0276] Hie, B., Bryson, B., Berger, B., 2019. Efficient integration of heterogeneous single-cell transcriptomes using Scanorama. Nat Biotechnol. 37, 685-691. [0277] H?lter, S. M., Glasl, L., 2012. High-Throughput Mouse Phenotyping. In: Animal Models of Movement Disorders: Volume I. Vol., E. L. Lane, S. B. Dunnett, ed.Aeds. Humana Press, Totowa, NJ, pp. 109-133. [0278] Jamebozorgi, K., et al., 2019. Cellular and molecular aspects of Parkinson treatment: future therapeutic perspectives. Molecular neurobiology. 56, 4799-4811. [0279] Konermann, S., et al., 2015. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 517, 583-8. [0280] Lozovaya, N., et al., 2018. GABAergic inhibition in dual-transmission cholinergic and GABAergic striatal interneurons is abolished in Parkinson disease. Nat Commun. 9, 1422. [0281] Luecken, M. D., Theis, F. J., 2019. Current best practices in single-cell RNA-seq analysis: a tutorial. Mol Syst Biol. 15, e8746. [0282] Mao, M., Nair, A., Augustine, G. J., 2019. A Novel Type of Neuron Within the Dorsal Striatum. Front Neural Circuits. 13, 32. [0283] Martinez-Cerdeno, V., et al., 2010. Embryonic MGE precursor cells grafted into adult rat striatum integrate and ameliorate motor symptoms in 6-OHDA-lesioned rats. Cell Stem Cell. 6, 238-50. [0284] Masserdotti, G., Gasc6n, S., G?tz, M., 2016. Direct neuronal reprogramming: learning from and for development. Development. 143, 2494-2510. [0285] Mattugini, N., et al., 2019. Inducing Different Neuronal Subtypes from Astrocytes in the Injured Mouse Cerebral Cortex. Neuron. 103, 1086-1095 e5. [0286] McGregor, M. M., Nelson, A. B., 2019. Circuit Mechanisms of Parkinson's Disease. Neuron. 101, 1042-1056. [0287] Melville, J., McInnes, L., Healy, J., 2018. UMAP: uniform manifold approximation and projection for dimension reduction. Preprint at arXiv https://arxiv. org/abs/1802.03426. [0288] Mirelman, A., et al., 2016. Arm swing as a potential new prodromal marker of Parkinson's disease. Mov Disord. 31, 1527-1534. [0289] Pang, Z. P., et al., 2011. Induction of human neuronal cells by defined transcription factors. Nature. 476, 220-3. [0290] Parmar, M., Grealish, S., Henchcliffe, C., 2020. The future of stem cell therapies for Parkinson disease. Nat Rev Neurosci. 21, 103-115. [0291] Pereira, M., et al., 2017. Direct Reprogramming of Resident NG2 Glia into Neurons with Properties of Fast-Spiking Parvalbumin-Containing Interneurons. Stem Cell Reports. 9, 742-751. [0292] Planert, H., Berger, T. K., Silberberg, G., 2013. Membrane properties of striatal direct and indirect pathway neurons in mouse and rat slices and their modulation by dopamine. PLoS One. 8, e57054. [0293] Qian, H., et al., 2020. Reversing a model of Parkinson's disease with in situ converted nigral neurons. Nature. 582, 550-556. [0294] Rivetti di Val Cervo, P., et al., 2017. Induction of functional dopamine neurons from human astrocytes in vitro and mouse astrocytes in a Parkinson's disease model. Nat Biotechnol. 35, 444-452. [0295] Salin, P., et al., 2009. Changes to interneuron-driven striatal microcircuits in a rat model of Parkinson's disease. Neurobiol Dis. 34, 545-52. [0296] Schlachetzki, J.C., et al., 2014. Increased tyrosine hydroxylase expression accompanied by glial changes within the non-lesioned hemisphere in the 6-hydroxydopamine model of Parkinson's disease. Restor Neurol Neurosci. 32, 447-62. [0297] Stoker, T. B., Blair, N. F., Barker, R. A., 2017. Neural grafting for Parkinson's disease: challenges and prospects. Neural Regen Res. 12, 389-392. [0298] Tepper, J., Koos, T., 2016. Gabaergic interneurons of the Striatum. In: Handbook of Behavioral Neuroscience. Vol. 24, ed.Aeds. Elsevier, pp. 157-178. [0299] Theodorou, M., et al., 2015. Limitations of In Vivo Reprogramming to Dopaminergic Neurons via a Tricistronic Strategy. Hum Gene Ther Methods. 26, 107-22. [0300] Torper, O., et al., 2015. In Vivo Reprogramming of Striatal NG2 Glia into Functional Neurons that Integrate into Local Host Circuitry. Cell Rep. 12, 474-81. [0301] Traag, V. A., Waltman, L., van Eck, N.J ., 2019a. From Louvain to Leiden: guaranteeing well-connected communities. Scientific Reports. 9, 5233. [0302] Traag, V. A., Waltman, L., van Eck, N. J., 2019b. From Louvain to Leiden: guaranteeing well-connected communities. Sci Rep. 9, 5233. [0303] Truong, D. J., et al., 2015. Development of an intein-mediated split-Cas9 system for gene therapy. Nucleic Acids Res. 43, 6450-8. [0304] Vandeputte, C., et al., 2010. Automated quantitative gait analysis in animal models of movement disorders. BMC Neuroscience. 11, 92. [0305] Vierbuchen, T., et al., 2010. Direct conversion of fibroblasts to functional neurons by defined factors. Nature. 463, 1035-41. [0306] Vignoles, R., et al., 2019. Direct Lineage Reprogramming for Brain Repair: Breakthroughs and Challenges. Trends Mol Med. 25, 897-914. [0307] Wolf, F. A., Angerer, P., Theis, F.J., 2018. SCANPY: large-scale single-cell gene expression data analysis. Genome Biol. 19, 15. [0308] Zaiss, A. K., Muruve, D.A., 2005. Immune responses to adeno-associated virus vectors. Curr Gene Ther. 5, 323-31. [0309] Zhou, H., et al., 2018. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice. Nat Neurosci. 21, 440-446. [0310] Zhou, H., et al., 2020. Glia-to-Neuron Conversion by CRISPR-CasRx Alleviates Symptoms of Neurological Disease in Mice. Cell. 181, 590-603 e16. [0311] Zimprich, A., et al., 2018. Analysis of locomotor behavior in the German Mouse Clinic. J Neurosci Methods. 300, 77-91. [0312] Zolotukhin, S., et al., 1999. Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield. Gene Ther. 6, 973-85.
[0313] One skilled in the art would readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. Further, it is readily apparent to one skilled in the art that varying substitutions and modifications may be made to the invention disclosed herein without departing from the scope and spirit of the invention. The compositions, methods, procedures, treatments, molecules and specific compounds described herein are presently representative of certain embodiments are exemplary and are not intended as limitations on the scope of the invention. Changes therein and other uses will occur to those skilled in the art which are encompassed within the spirit of the invention are defined by the scope of the claims. The listing or discussion of a previously published document in this specification should not necessarily be taken as an acknowledgement that the document is part of the state of the art or is common general knowledge.
[0314] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms comprising, including, containing, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by exemplary embodiments and optional features, modification and variation of the inventions embodied herein may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[0315] The invention has been described broadly and generically herein. Each of the narrower species and sub generic groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein. All documents, including patent applications and scientific publications, referred to herein are incorporated herein by reference for all purposes.
[0316] Other embodiments are within the following claims. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.