CARDIOVASCULAR IMPLANT BASED ON IN-SITU REGULATION OF IMMUNE RESPONSE AND METHOD FOR MAKING THE SAME

20230211046 · 2023-07-06

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided is a cardiovascular implant based on in-situ regulation of immune response and a method for making the same, belonging to the technical field of biomedicine. The cardiovascular implant includes a cardiovascular implant body and H4000-CD25/dcas9 sustained-release nanoparticles modified on the cardiovascular implant body; the H4000-CD25/dcas9 sustained-release nanoparticles include an H4000 plasmid nanocarrier (Engreen), an anti-CD25 antibody, and a dcas9 plasmid sequence; a method for preparing the cardiovascular implant includes: constructing a cardiovascular implant body, preparing an H4000-CD25 nanotransfection vector, preparing H4000-CD25/dcas9 sustained-release nanoparticles, and conjugating the H4000-CD25/dcas9 sustained-release nanoparticles on the cardiovascular implant body. The present disclosure aims to construct a cardiovascular implant modified with the H4000-CD25/dcas9 sustained-release nanoparticles, which may induce nerve fiber ingrowth into engineered blood vessels; with the regulation ability of Treg cells on immune response, antithrombotic function of the cardiovascular implant is improved and in-situ regeneration of the cardiovascular implant is promoted.

    Claims

    1. A cardiovascular implant based on in-situ regulation of immune response, comprising a cardiovascular implant body and H4000-CD25/dcas9 sustained-release nanoparticles modified on the cardiovascular implant body; wherein the H4000-CD25/dcas9 sustained-release nanoparticles comprise an H4000 plasmid nanocarrier (Engreen), an anti-CD25 antibody, and a dcas9 plasmid sequence; the H4000 plasmid nanocarrier and the anti-CD25 antibody are covalently linked, and the dcas9 plasmid sequence is used to enhance the expression of demethylase TET2.

    2. The cardiovascular implant based on in-situ regulation of immune response according to claim 1, wherein the dcas9 plasmid sequence is pZdonor_U6-sgRNA-EF1α-dSpCas9-NLS-VP64-2A-EGFP-2A-Puro.

    3. The cardiovascular implant based on in-situ regulation of immune response according to claim 1, wherein the cardiovascular implant is tubular, 1-4 mm in diameter, and 0.5-20 cm in length.

    4. A method for preparing the cardiovascular implant based on in-situ regulation of immune response according to claim 1, comprising the following steps: step 1, constructing a cardiovascular implant body; step 2, preparing an H4000-CD25 nanotransfection vector; step 3, preparing H4000-CD25/dcas9 sustained-release nanoparticles by the H4000-CD25 nanotransfection vector and a Crispr/dcas9 system plasmid; and step 4, conjugating the H4000-CD25/dcas9 sustained-release nanoparticles on the cardiovascular implant body: co-incubating the cardiovascular implant body with the H4000-CD25/dcas9 sustained-release nanoparticles and collagen to obtain the cardiovascular implant.

    5. The method according to claim 4, wherein a method for constructing the cardiovascular implant body in step 1 comprises: removing cells and then nucleic acids and fats from isolated blood vessels to obtain a blood vessel matrix material; and covering collagen on a surface of the blood vessel matrix material to obtain the cardiovascular implant body.

    6. The method according to claim 4, wherein the H4000-CD25/dcas9 sustained-release nanoparticles in step 3 are prepared by encapsulating the Crispr/dcas9 system plasmid on the H4000-CD25 nanotransfection vector, wherein the Crispr/dcas9 system plasmid is incubated with the H4000-CD25 nanotransfection vector at 0.4 μg of plasmid/μL of transfection vector.

    7. The method according to claim 4, wherein a method for conjugating the H4000-CD25/dcas9 sustained-release nanoparticles on the cardiovascular implant body in step 4 comprises: conducting a first incubation of the cardiovascular implant body with the H4000-CD25/dcas9 sustained-release nanoparticles for 10 min, and conducting a second incubation of the cardiovascular implant body with the collagen for 10 min; and repeating the first and second incubations twice to obtain a self-assembled cardiovascular implant modified with the H4000-CD25/dcas9 sustained-release nanoparticles.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0030] FIG. 1 is a schematic diagram that illustrates a sequence of Crispr/dcas9 system plasmid in Example 1 of the present disclosure;

    [0031] FIG. 2 is a schematic diagram that illustrates the spatial distribution of H4000-CD25 and the preparation process of an H4000-CD25/dcas9 transfection plasmid in Example 1 of the present disclosure;

    [0032] FIG. 3 illustrates hydrodynamic sizes of H4000 and H4000-CD25PE;

    [0033] FIG. 4 is a schematic diagram that illustrates the preparation and transplantation of an H4000-CD25/dcas9 vascular sustained-release system;

    [0034] FIG. 5 is a diagram that illustrates the maintenance effect of H4000-Cy3/dcas9 and in vivo fluorescence on detection of vascular sustained-release fluorescence in vitro and in vivo;

    [0035] FIG. 6 illustrates the size and surface morphology of a nanocomposite in Example 1 of the present disclosure (inside and outside of biological tissue, observed under scanning electron microscope);

    [0036] FIG. 7 shows flow cytometry scatter plots of the transfection efficiency of Treg cells by H4000-CD25/dcas9 system (including control group and positive results);

    [0037] FIG. 8 illustrates the effect of the expression of inflammatory factors in macrophages after transfection according to the present disclosure (observed under fluorescence microscope);

    [0038] FIG. 9 illustrates the effect of cardiovascular implant on secretion of Treg anti-inflammatory factors (detected by ELISA);

    [0039] FIG. 10 is a graph showing hematoxylin-eosin (HE) staining to detect vascular morphology and cell aggregation after vascular graft, and small animal computed tomography (CT) and ultrasonography to detect blood flow patency;

    [0040] FIG. 11 illustrates the observation of sustained release of a plasmid by plasmid PCR amplification;

    [0041] FIG. 12 illustrates the nerve ingrowth and the nerve 3D reconstruction of blood vessels.

    DETAILED DESCRIPTION OF THE EMBODIMENTS

    [0042] The present disclosure will be further described in detail below with reference to accompanying drawings and an example:

    [0043] Example: A method for preparing a cardiovascular implant based on in-situ regulation of immune response was provided, as shown in FIGS. 1, 2, and 3, including the following steps:

    [0044] (1) constructing a cardiovascular implant body:

    [0045] a) under sterile conditions, the common carotid artery was extracted from a SD rat weighing 250-300 g, the blood was washed away with normal saline; the outer connective tissue of the common carotid artery was separated and removed, and cut into small blood vessels with a length of 0.5-1 cm (generally, tissue engineered blood vessels with a length of 0.5-20 cm can meet the needs of clinical applications, such as vascular graft, and the transplantation recipients of the cardiovascular implant are rats, so a small blood vessel with a length of 0.5-1 cm is preferred).

    [0046] Trypsin was diluted with M199 medium to a concentration of 0.05%, the blood vessels were digested and treated at 37° C. for 30 min to remove cells, and nucleic acid and fat were removed with RNase, DNase, and lipase to obtain a blood vessel matrix material with only collagen and elastic fibers present. Herein, the blood vessel matrix material was 1-4 mm in diameter, so as to ensure the preparation of a small-diameter cardiovascular implant (TEBV) with a diameter that met the requirements.

    [0047] b) the blood vessel matrix material was incubated with a 4 mg/mL collagen solution for 24 h to obtain a cardiovascular implant body.

    [0048] (2) preparation of H4000-CD25 nanotransfection vector: Transfection reagent H4000 was conjugated with anti-CD25-PE antibody (12-0390-82, eBioscience) to form H4000-CD25 transfection nanoparticles. The specific steps were as follows:

    [0049] a) 20 μL of H4000 was diluted to 1 mL to measure the hydrodynamic size of H4000.

    [0050] b) 20 μL of H4000 was diluted to 1 mL to test the zeta potentials of H4000 at pH 7.4 and at pH 4.7, respectively; the results showed the zeta potential of H4000 was 3.5 mV both at pH 7.4 and pH 4.7, without obvious potential change.

    [0051] c) 40 μL (namely 8 μg) of 0.2 mg/mL CD25-PE was pipetted and 15 μL of 10×MES (4-morpholineethanesulfonic acid, pH 5.5) buffer was added.

    [0052] d) 100 μL of H4000 was pipetted, mixed well and incubated for 1 h on a shaker at 25° C. in the dark; 8 μL (namely 8 μg) of EDC (N1-((ethylimino)methylene)-N3,N3-dimethylpropane-1,3-diamine, 1 mg/mL, diluted with MES) was added, and incubated overnight on the shaker in the dark.

    [0053] e) a resulting mixture was ultrafiltered with pure water at 100 KDa three times, and the volume was made up to 100 μL.

    [0054] The hydrodynamics and zeta potential of the product were measured to determine the conjugation effect. The volume was 20 μL, and the hydrodynamic size of H4000 was increased from 193 nm to 306 nm, indicating that the conjugation was successful. The particle size of nanoparticles was observed under scanning electron microscope.

    [0055] (3) the Crispr/dcas9 system plasmid was encapsulated onto the H4000-CD25 nanotransfection vector to form H4000-CD25/dcas9 sustained-release nanoparticles. The specific steps were as follows:

    [0056] a) 0.8 μg of dcas9 plasmid was diluted with 25 μL of serum-free diluent and mixed well to prepare a dcas9 diluent.

    [0057] The serum-free diluent was recommended to be OPTI-MEM, serum-free DMEM or 1640.

    [0058] b) 2 μL of Entranster™-H4000/H4000-CD25PE was diluted with 25 μL of serum-free diluent and mixed well to prepare an Entranster™-H4000/H4000-CD25PE diluent, which was let stand for 5 min at room temperature.

    [0059] c) the Entranster™-H4000 diluent was added separately to the dcas9 diluent, mixed well, and let stand for 15 min at room temperature (or shaken on a shaker or pipetted with a sampler more than 10 times), and the preparation of H4000-CD25/dcas9 sustained-release nanoparticles was completed. The incubation ratio of Crispr/dcas9 system plasmid to H4000-CD25 nanotransfection vector was 0.4 μg of plasmid/μL of transfection vector.

    [0060] (4) H4000-CD25/dcas9 sustained-release nanoparticles were conjugated onto the cardiovascular implant body, which was specifically as follows:

    [0061] a) H4000-CD25/dcas9 sustained-release nanoparticles were added to a culture vessel containing cells and complete medium, and mixed well gently.

    [0062] b) the cardiovascular implant body was soaked in the working solution containing H4000-CD25PE/dcas9 sustained-release nanoparticles for 10 min and then in phosphate-buffered saline (PBS) for 2 min; the cardiovascular implant body was soaked in soluble collagen PBS (1 g/L) for 10 min and then in PBS for 2 min, and the incubation and elution steps were repeated twice to obtain a self-assembled cardiovascular implant modified with H4000-CD25/dcas9 sustained-release nanoparticles.

    [0063] In the present disclosure, a series of tests for quality control and characterization was further carried out, and the results were as follows:

    [0064] (1) Observation of morphology and various indicators

    [0065] The cardiovascular implant was taken out, and the morphology and various indicators were observed, as shown in FIG. 6. A control group was set up in this experiment, which was the cardiovascular implant body.

    [0066] Measurement of nanoparticle size under scanning electron microscope: Five groups were subjected to scanning electron microscopy, including three blood vessel-free groups (H4000 group, H4000-CD25 group and H4000-CD25/dcas9 group) and two blood vessel incubation groups (pure acellular blood vessel group and H4000-CD25/dcas9 blood vessel incubation group). For the blood vessel-free groups, one droplet was dropped onto a mica sheet to dry. The blood vessel incubation groups needed to be incubated with glutaraldehyde overnight before scanning, and dehydrated with alcohol and tert-butanol gradiently. All groups were mounted on the mechanical stage for gold plating and photographing.

    [0067] (1) Detection of the sustained-release effect:

    [0068] a) Residue detection of cardiovascular implant nanoparticles is as shown in FIGS. 4 and 5.

    [0069] Preparation of H4000-Cy3 Nanoparticles:

    [0070] Step 1, reaction of H4000 with Cy3: 10 μL of activated Cy3 (5 mg/mL), 200 μL of H4000, and 200 μL of NaHCO.sub.3 (0.1 M, pH 7.8) were mixed well, and reacted overnight at 4° C. in the dark.

    [0071] Step 2, dialysis (the specification of the dialysis bag was 3500 Da): the dialysis bag was boiled with 50% ethanol for half an hour to activate, sealed with clips at both ends, put in a deionized water bath and stirred, with the water changed every 2 h, and dialyzed overnight after the last time of changing for collection.

    [0072] Step 3, the foregoing H4000-Cy3 cardiovascular implant was placed in 1.5% agarose gel in normal saline, photographs were taken at 1/3/7/15/30 days to compare the residual fluorescence of Cy3, respectively, and the residual DIR fluorescence in vivo was observed with an in vivo imaging system at 1/3/7/15/30 days after transplantation, respectively.

    [0073] b) Cardiovascular implant plasmid release assay: As shown in FIG. 11, the foregoing H4000-CD25PE/dcas9 engineered blood vessel was placed in a 1.5% agarose in normal saline. Plasmids were amplified by PCR at 1/3/7/15/30 days to observe the sustained release of the plasmids, respectively.

    [0074] (2) Detection of the transfection efficiency and the effect on the release of inflammatory cytokines: As shown in FIGS. 7 and 8, at 24-48 h after transfection of Treg cells in vitro, incubation with rabbit GFP (bs-0844r, Bioss) and mouse FOXP3 primary antibodies (ab22510, abcam), as well as rabbit 488 and mouse 568 secondary antibodies (Thermo Fisher), was carried out, and the transfection efficiency was detected by flow cytometry (C6, BD). The expression changes of IL10, TGF and IL35 were detected by an ELISA kit (X-Y Biotechnology Co., Ltd.). Supernatants were collected from Treg cells in the H4000-CD25PE and H4000-CD25 PE/dcas9 groups two days after transfection, and added to the above macrophage medium at a ratio of 1:1. The culture was continued for two days. The supernatants were incubated with mouse CD68 (TA318150, ORIGENE) and rabbit CCR2 (GB11326, Servicebio) primary antibodies and with mouse 488 and rabbit 568 secondary antibodies, and the fluorescence was photographed.

    [0075] (3) In vivo regulation of inflammatory response by the system: As shown in FIG. 9, at 24-48 h after transfection of Treg cells in vitro, incubation with rabbit GFP (bs-0844r, Bioss) and mouse FOXP3 primary antibodies (ab22510, abcam), and then rabbit 488 and mouse 568 secondary antibodies (Thermo Fisher), was performed, and the transfection efficiency was detected by flow cytometry (C6, BD). The expression changes of IL10, TGF and IL35 were detected by an ELISA kit (X-Y Biotechnology Co., Ltd.). The steps were as follows.

    [0076] a) At 3/7/15/30 days, the foregoing transplanted acellular cardiovascular implant bodies and normal non-transplanted blood vessels were taken. After the clots of the blood vessels were rinsed with normal saline within 2 min, the blood vessels were transferred to 4% formalin for incubation for 3 h and then to 30% sucrose overnight; frozen sections were made and incubated with cd3 and foxp3 (abcam) primary antibodies, as well as cd68 and CCR2 (abcam) primary antibodies, respectively; incubation with mouse 488 and rabbit 568 secondary antibodies and DAPI was performed, and photographs were taken by confocal microscopy for in vivo detection of changes in immune cells of untransfected blood vessel grafts over time.

    [0077] b) At 3/7/15 days, the transplanted engineered blood vessels from the above three groups (H4000-CD25PE, H4000/dcas9, and H4000-CD25PE/dcas9) were taken. After the clots of the blood vessels were rinsed with normal saline within 2 min, the blood vessels were transferred to 4% formalin to incubate for 3 h and then to 30% sucrose overnight; frozen sections were made and incubated with GFP (Servicebio) and foxp3 (abcam) primary antibodies, as well as cd68 (ORIGENE) and CCR2 (abcam) primary antibodies, respectively; incubation with mouse 488 and rabbit 568 secondary antibodies as well as DAPI was performed, and photographs were taken by confocal microscopy for in vivo detection of changes in immune cells of transfected blood vessel grafts over time.

    [0078] (4) Observation of vascular patency: As shown in FIG. 10, the well-constructed functional molecule-modified TEBVs (cardiovascular implants) and the control group were transplanted into the allogeneic or xenogeneic common carotid artery through end-to-end anastomosis, which was performed with surgical sutures under the microscope, 10 cases in each group.

    [0079] One month after the operation, the blood flows of the TEBV-transplanted common carotid artery and the contralateral healthy common carotid artery were measured by Doppler flowmeter. MicroCT scanning was performed by intravenous injection of iohexol to determine differences in vascular morphology and connectivity. Biological blood vessel prostheses were transplanted into the rat carotid artery. After one month, the bioengineered blood vessel modified with H4000-CD25/dcas9 sustained-release nanoparticles prepared by the present disclosure remained unobstructed, with the average blood flow significantly higher than that of the control group; morphological photography and HE staining of frozen sections showed that no thrombosis and intimal hyperplasia was present in the blood vessels, and thrombosis was obvious in the control group.

    [0080] (5) Observation of three-dimensional reconstruction of blood vessels and nerves: As shown in FIG. 12, the transplanted H4000-CD25PE/dcas9-transfected engineered blood vessels were taken at 30/60/90 days, respectively. After the clots of the blood vessels were rinsed with normal saline within 2 min, the blood vessels were transferred to 4% formalin to incubate for 3 h and then to 30% sucrose for incubation overnight; adventitias were torn off for stretched preparation, and incubated with PGP9.5 (abcam) and TUBB3 (Bioss) primary antibodies to detect in vivo nerve growth; adventitias were incubated with mouse 488 and rabbit 568 secondary antibodies, and photographs were taken by confocal microscopy; three-dimensional reconstruction of blood vessels and nerves were conducted using 3Dmax software according to the model of blood vessels and nerves, and the in vivo nerve growth was detected and compared.

    [0081] In the foregoing example of the present disclosure, using the influence and effect of different severity of inflammation on the regeneration of the cardiovascular implant, we constructed a cardiovascular implant modified with H4000-CD25/dcas9 sustained-release nanoparticles, which may induce nerve fiber ingrowth into engineered blood vessels.

    [0082] The cardiovascular implant modified with H4000-CD25/dcas9 sustained-release nano-system is prepared in the present disclosure. When the cardiovascular implant prepared by the present solution is used for vascular graft, sustained-release nanoparticles may regulate the immune response in-situ, accelerate revascularization, effectively overcome the thrombosis, and promote long-term vascular patency.

    [0083] The cardiovascular implant constructed by this method can efficiently recognize the aggregated Treg cells, activate and enhance inflammatory inhibition thereof, and realize in-situ regulation of attached macrophages, thereby promoting inflammatory outcome and creating an excellent local microenvironment to accelerate vascular and nerve regeneration; the antithrombotic function of the cardiovascular implant is improved and in-situ regeneration of the cardiovascular implant is accelerated by means of the regulation ability of Treg cells to immune response.

    [0084] Collagen is a substance commonly used in the field of biomedicine, with high safety and biocompatibility. Given the characteristics of high mechanical strength, strong pressure bearing ability and excellent biocompatibility of collagen nanoparticles, the transfected nanoparticles are encapsulated in the collagen and cross-linked on the surface of the cardiovascular implant body by layer-by-layer self-assembly, achieving sustained release of H4000-CD25/dcas9 nanoparticles and prolonging the expiration date of patency of the cardiovascular implant.

    [0085] The dcas9 plasmid sequence is shown in SEQ ID NO: 1:

    TABLE-US-00001 ATGGACAAGAAGTACTCCATTGGCCTCGCCATCGGAACAAATAGCGTGGGCT GGGCTGTCATCACAGATGAGTACAAGGTGCCTAGCAAGAAATTTAAGGTGCTGGGA AATACAGACAGACATAGCATCAAGAAGAACCTCATTGGCGCTCTCCTGTTTGACTCC GGCGAAACAGCCGAAGCTACCAGACTCAAGAGAACCGCTAGGAGAAGGTACACCA GAAGGAAAAACAGGATTTGCTACCTGCAGGAAATTTTTTCCAACGAGATGGCCAAG GTGGACGATTCCTTCTTCCATAGGCTGGAAGAGAGCTTCCTCGTGGAGGAAGACAA GAAACACGAGAGGCATCCTATTTTTGGCAATATTGTGGATGAGGTCGCCTACCATGA GAAGTATCCCACAATCTATCATCTGAGAAAAAAACTGGTGGATAGCACCGACAAGG CCGATCTCAGGCTCATTTATCTCGCTCTGGCTCACATGATCAAGTTTAGGGGCCACTT CCTGATCGAAGGCGACCTGAATCCCGACAACTCCGACGTGGACAAACTGTTCATCC AGCTCGTCCAGACCTACAATCAACTCTTCGAGGAGAACCCCATCAATGCTTCCGGCG TGGATGCCAAGGCCATCCTGAGCGCTAGGCTCTCCAAGTCCAGGAGGCTGGAAAAT CTGATCGCCCAACTCCCTGGAGAGAAGAAGAACGGCCTGTTTGGCAATCTGATTGCC CTGAGCCTCGGACTCACCCCCAACTTCAAGAGCAACTTCGATCTCGCCGAAGACGCC AAACTCCAACTGAGCAAGGATACCTACGACGACGATCTCGATAATCTCCTCGCCCA GATCGGCGATCAATATGCCGACCTCTTTCTGGCCGCCAAAAACCTGAGCGACGCTAT TCTGCTCAGCGACATTCTCAGGGTGAATACAGAAATCACAA AAGCCCCCCTGTCCGCCAGCATGATCAAAAGGTACGATGAACACCATCAGGACCTC ACCCTGCTGAAGGCTCTGGTCAGGCAGCAACTCCCCGAAAAGTACAAGGAGATTTT CTTTGATCAGTCCAAGAATGGATATGCTGGCTATATTGATGGAGGCGCCTCCCAGGA GGAATTTTATAAATTCATCAAGCCCATTCTCGAAAAGATGGACGGAACCGAAGAGC TGCTGGTCAAACTCAATAGGGAGGATCTGCTGAGGAAGCAAAGGACCTTCGACAAT GGCAGCATCCCCCACCAGATCCACCTCGGCGAACTCCACGCTATCCTCAGGAGGCA GGAAGACTTCTACCCTTTCCTGAAGGATAACAGGGAGAAAATCGAGAAAATCCTGA CCTTCAGAATCCCCTACTACGTCGGACCTCTCGCCAGGGGCAATTCCAGATTCGCCT GGATGACAAGGAAGAGCGAGGAAACAATCACACCATGGAACTTCGAAGAAGTGGT CGATAAGGGCGCCAGCGCCCAGAGCTTCATTGAAAGGATGACCAACTTTGATAAGA ACCTGCCCAATGAGAAGGTGCTGCCTAAGCACTCCCTGCTGTATGAGTATTTCACCG TGTATAATGAGCTGACCAAGGTCAAGTACGTCACCGAGGGAATGAGAAAGCCTGCT TTTCTCTCCGGCGAGCAGAAAAAAGCCATCGTGGACCTGCTGTTCAAGACCAACAG GAAGGTGACCGTCAAGCAACTCAAGGAGGACTACTTTAAGAAGATTGAGTGCTTTG ATAGCGTGGAAATTAGCGGAGTCGAGGACAGGTTCAATGCCTCCCTCGGAACATAT CACGACCTGCTGAAAATCATCAAAGACAAAGATTTTCTGGATAACGAGGAGAATGA AGACATTCTGGAGGACATTGTCCTCACCCTGACCCTGTTTGAGGACAGAGAGATGAT TGAAGAGAGGCTGAAAACCTATGCCCACCTGTTCGACGACAAGGTGATGAAGCAGC TCAAAAGAAGGAGATATACCGGCTGGGGCAGACTGTCCAGGAAGCTGATCAACGGC ATTAGGGACAAGCAGAGCGGCAAGACCATTCTCGACTTTCTCAAGTCCGACGGATT CGCCAACAGAAACTTTATGCAACTGATCCACGATGACAGCCTCACCTTTAAGGAAG ATATTCAGAAGGCTCAGGTCAGCGGCCAAGGCGATTCCCTCCATGAGCACATCGCT AATCTGGCTGGCTCCCCTGCTATCAAAAAGGGCATCCTCCAGACAGTCAAAGTCGTC GATGAG CTGGTCAAGGTGATGGGCAGGCATAAACCCGAGAACATTGTGATTGAGATGGCTAG GGAGAACCAGACCACCCAGAAAGGCCAGAAAAACAGCAGAGAAAGAATGAAGAG GATCGAGGAGGGCATCAAAGAACTGGGCAGCCAAATCCTCAAGGAGCACCCCGTCG AAAATACACAACTCCAGAACGAAAAACTCTACCTCTACTATCTGCAGAACGGCAGA GACATGTACGTGGACCAGGAACTGGACATCAACAGGCTCTCCGATTACGATGTGGA CGCCATCGTCCCTCAGTCCTTTCTGAAAGATGATAGCATCGACAACAAGGTGCTGAC CAGGTCCGACAAGAATAGGGGCAAGAGCGATAATGTGCCCTCCGAGGAGGTCGTCA AAAAAATGAAAAACTACTGGAGACAACTCCTCAACGCTAAGCTCATCACCCAAAGA AAGTTCGACAATCTGACCAAAGCCGAGAGGGGCGGCCTCTCCGAACTGGACAAGGC CGGCTTCATCAAAAGGCAATTGGTGGAAACCAGGCAGATTACAAAGCATGTCGCTC AAATTCTCGATAGCAGGATGAATACCAAATATGACGAGAACGACAAGCTGATCAGA GAGGTCAAGGTCATCACACTCAAGTCCAAGCTCGTGAGCGACTTCAGAAAAGATTT CCAATTTTATAAAGTCAGGGAGATCAACAATTACCACCACGCTCACGACGCTTATCT CAACGCTGTCGTGGGAACCGCCCTGATCAAAAAATACCCCAAGCTGGAAAGCGAGT TCGTGTATGGCGATTATAAAGTGTACGACGTGAGGAAGATGATCGCTAAAAGCGAG CAGGAAATCGGCAAGGCTACAGCCAAGTACTTTTTCTACTCCAACATTATGAACTTC TTCAAGACCGAGATTACCCTCGCCAACGGCGAAATTAGGAAGAGGCCCCTGATTGA AACAAATGGAGAAACAGGCGAAATCGTCTGGGACAAGGGCAGGGACTTCGCCACA GTCAGAAAAGTGCTGTCCATGCCTCAAGTCAACATCGTCAAAAAGACCGAGGTGCA GACCGGCGGCTTTAGCAAAGAAAGCATCCTGCCCAAGAGAAACTCCGACAAGCTCA TCGCTAGGAAGAAGGACTGGGACCCTAAGAAATACGGAGGATTTGACTCCCCTACC GTCGCCTATTCCGTCCTCGTCGTCGCTAAGGTGGAGAAGGGCAAGAGCAAGAAGCT CAAGAGCGTCAAGGAGCTGCTGGGAATCACCATCATGGAGAGGAGCTCCTTCGAAA AAAACCCTAT TGATTTCCTGGAGGCCAAGGGCTACAAGGAGGTCAAGAAGGACCTCATCATCAAGC TGCCCAAATACAGCCTCTTCGAACTGGAAAATGGCAGGAAGAGAATGCTCGCTAGC GCCGGCGAGCTCCAGAAAGGAAATGAGCTGGCTCTGCCCAGCAAGTACGTCAACTT CCTCTATCTCGCCAGCCACTATGAAAAGCTCAAGGGCAGCCCCGAAGACAATGAGC AGAAGCAGCTCTTCGTCGAGCAGCACAAGCACTACCTCGATGAAATCATCGAGCAA ATCAGCGAGTTTTCCAAAAGGGTGATTCTCGCCGACGCTAACCTCGATAAGGTCCTC TCCGCTTACAACAAGCATAGAGACAAGCCCATCAGAGAACAGGCCGAGAACATCAT CCACCTGTTTACACTCACAAACCTCGGAGCCCCTGCCGCTTTTAAATACTTCGATAC AACCATTGATAGGAAGAGGTACACCTCCACCAAGGAGGTGCTGGATGCTACCCTGA TTCATCAATCCATCACAGGACTCTACGAAACAAGGATTGACCTGTCCCAACTGGGAG GCGAC

    [0086] This specific example is only an explanation of the present disclosure, but it does not limit the present disclosure. Those skilled in the art can make modifications without creative contribution to the present example as needed after reading this specification, but these modifications are protected by the patent law as long as they fall within the scope of the present disclosure.

    Sequence Listing Information:

    [0087] DTD Version: V1_3

    [0088] File Name: GWP20221000218_sequence listing.xml

    [0089] Software Name: WIPO Sequence

    [0090] Software Version: 2.2.0

    [0091] Production Date: 2022 Nov. 9

    General Information:

    [0092] Current application/Applicant file reference: GWP20221000218

    [0093] Earliest priority application/IP Office: CN

    [0094] Earliest priority application/Application number: 202111646804.5

    [0095] Earliest priority application/Filing date: 2021 Dec. 29

    [0096] Applicant name: Army Medical University

    [0097] Applicant name/Language: en

    [0098] Invention title: CARDIOVASCULAR IMPLANT BASED ON IN-SITU REGULATION OF IMMUNE RESPONSE AND METHOD FOR MAKING THE SAME (en)

    [0099] Sequence Total Quantity: 1

    Sequences:

    [0100] Sequence Number (ID): 1

    [0101] Length: 4104

    [0102] Molecule Type: DNA

    [0103] Features Location/Qualifiers: [0104] source, 1 . . . 4104 [0105] mol_type, other DNA [0106] note, DNA sequence of the dcas9 plasmid [0107] organism, synthetic construct

    [0108] Residues:

    TABLE-US-00002 atggacaaga agtactccat tggcctcgcc atcggaacaa atagcgtggg ctgggctgtc 60 atcacagatg agtacaaggt gcctagcaag aaatttaagg tgctgggaaa tacagacaga 120 catagcatca agaagaacct cattggcgct ctcctgtttg actccggcga aacagccgaa 180 gctaccagac tcaagagaac cgctaggaga aggtacacca gaaggaaaaa caggatttgc 240 tacctgcagg aaattttttc caacgagatg gccaaggtgg acgattcctt cttccatagg 300 ctggaagaga gcttcctcgt ggaggaagac aagaaacacg agaggcatcc tatttttggc 360 aatattgtgg atgaggtcgc ctaccatgag aagtatccca caatctatca tctgagaaaa 420 aaactggtgg atagcaccga caaggccgat ctcaggctca tttatctcgc tctggctcac 480 atgatcaagt ttaggggcca cttcctgatc gaaggcgacc tgaatcccga caactccgac 540 gtggacaaac tgttcatcca gctcgtccag acctacaatc aactcttcga ggagaacccc 600 atcaatgctt ccggcgtgga tgccaaggcc atcctgagcg ctaggctctc caagtccagg 660 aggctggaaa atctgatcgc ccaactccct ggagagaaga agaacggcct gtttggcaat 720 ctgattgccc tgagcctcgg actcaccccc aacttcaaga gcaacttcga tctcgccgaa 780 gacgccaaac tccaactgag caaggatacc tacgacgacg atctcgataa tctcctcgcc 840 cagatcggcg atcaatatgc cgacctcttt ctggccgcca aaaacctgag cgacgctatt 900 ctgctcagcg acattctcag ggtgaataca gaaatcacaa aagcccccct gtccgccagc 960 atgatcaaaa ggtacgatga acaccatcag gacctcaccc tgctgaaggc tctggtcagg 1020 cagcaactcc ccgaaaagta caaggagatt ttctttgatc agtccaagaa tggatatgct 1080 ggctatattg atggaggcgc ctcccaggag gaattttata aattcatcaa gcccattctc 1140 gaaaagatgg acggaaccga agagctgctg gtcaaactca atagggagga tctgctgagg 1200 aagcaaagga ccttcgacaa tggcagcatc ccccaccaga tccacctcgg cgaactccac 1260 gctatcctca ggaggcagga agacttctac cctttcctga aggataacag ggagaaaatc 1320 gagaaaatcc tgaccttcag aatcccctac tacgtcggac ctctcgccag gggcaattcc 1380 agattcgcct ggatgacaag gaagagcgag gaaacaatca caccatggaa cttcgaagaa 1440 gtggtcgata agggcgccag cgcccagagc ttcattgaaa ggatgaccaa ctttgataag 1500 aacctgccca atgagaaggt gctgcctaag cactccctgc tgtatgagta tttcaccgtg 1560 tataatgagc tgaccaaggt caagtacgtc accgagggaa tgagaaagcc tgcttttctc 1620 tccggcgagc agaaaaaagc catcgtggac ctgctgttca agaccaacag gaaggtgacc 1680 gtcaagcaac tcaaggagga ctactttaag aagattgagt gctttgatag cgtggaaatt 1740 agcggagtcg aggacaggtt caatgcctcc ctcggaacat atcacgacct gctgaaaatc 1800 atcaaagaca aagattttct ggataacgag gagaatgaag acattctgga ggacattgtc 1860 ctcaccctga ccctgtttga ggacagagag atgattgaag agaggctgaa aacctatgcc 1920 cacctgttcg acgacaaggt gatgaagcag ctcaaaagaa ggagatatac cggctggggc 1980 agactgtcca ggaagctgat caacggcatt agggacaagc agagcggcaa gaccattctc 2040 gactttctca agtccgacgg attcgccaac agaaacttta tgcaactgat ccacgatgac 2100 agcctcacct ttaaggaaga tattcagaag gctcaggtca gcggccaagg cgattccctc 2160 catgagcaca tcgctaatct ggctggctcc cctgctatca aaaagggcat cctccagaca 2220 gtcaaagtcg tcgatgagct ggtcaaggtg atgggcaggc ataaacccga gaacattgtg 2280 attgagatgg ctagggagaa ccagaccacc cagaaaggcc agaaaaacag cagagaaaga 2340 atgaagagga tcgaggaggg catcaaagaa ctgggcagcc aaatcctcaa ggagcacccc 2400 gtcgaaaata cacaactcca gaacgaaaaa ctctacctct actatctgca gaacggcaga 2460 gacatgtacg tggaccagga actggacatc aacaggctct ccgattacga tgtggacgcc 2520 atcgtccctc agtcctttct gaaagatgat agcatcgaca acaaggtgct gaccaggtcc 2580 gacaagaata ggggcaagag cgataatgtg ccctccgagg aggtcgtcaa aaaaatgaaa 2640 aactactgga gacaactcct caacgctaag ctcatcaccc aaagaaagtt cgacaatctg 2700 accaaagccg agaggggcgg cctctccgaa ctggacaagg ccggcttcat caaaaggcaa 2760 ttggtggaaa ccaggcagat tacaaagcat gtcgctcaaa ttctcgatag caggatgaat 2820 accaaatatg acgagaacga caagctgatc agagaggtca aggtcatcac actcaagtcc 2880 aagctcgtga gcgacttcag aaaagatttc caattttata aagtcaggga gatcaacaat 2940 taccaccacg ctcacgacgc ttatctcaac gctgtcgtgg gaaccgccct gatcaaaaaa 3000 taccccaagc tggaaagcga gttcgtgtat ggcgattata aagtgtacga cgtgaggaag 3060 atgatcgcta aaagcgagca ggaaatcggc aaggctacag ccaagtactt tttctactcc 3120 aacattatga acttcttcaa gaccgagatt accctcgcca acggcgaaat taggaagagg 3180 cccctgattg aaacaaatgg agaaacaggc gaaatcgtct gggacaaggg cagggacttc 3240 gccacagtca gaaaagtgct gtccatgcct caagtcaaca tcgtcaaaaa gaccgaggtg 3300 cagaccggcg gctttagcaa agaaagcatc ctgcccaaga gaaactccga caagctcatc 3360 gctaggaaga aggactggga ccctaagaaa tacggaggat ttgactcccc taccgtcgcc 3420 tattccgtcc tcgtcgtcgc taaggtggag aagggcaaga gcaagaagct caagagcgtc 3480 aaggagctgc tgggaatcac catcatggag aggagctcct tcgaaaaaaa ccctattgat 3540 ttcctggagg ccaagggcta caaggaggtc aagaaggacc tcatcatcaa gctgcccaaa 3600 tacagcctct tcgaactgga aaatggcagg aagagaatgc tcgctagcgc cggcgagctc 3660 cagaaaggaa atgagctggc tctgcccagc aagtacgtca acttcctcta tctcgccagc 3720 cactatgaaa agctcaaggg cagccccgaa gacaatgagc agaagcagct cttcgtcgag 3780 cagcacaagc actacctcga tgaaatcatc gagcaaatca gcgagttttc caaaagggtg 3840 attctcgccg acgctaacct cgataaggtc ctctccgctt acaacaagca tagagacaag 3900 cccatcagag aacaggccga gaacatcatc cacctgttta cactcacaaa cctcggagcc 3960 cctgccgctt ttaaatactt cgatacaacc attgatagga agaggtacac ctccaccaag 4020 gaggtgctgg atgctaccct gattcatcaa tccatcacag gactctacga aacaaggatt 4080 gacctgtccc aactgggagg cgac 4104

    END

    [0109]