FLOW CELLS AND METHODS FOR MAKING THE SAME
20240123448 ยท 2024-04-18
Inventors
- Jeffrey S. Fisher (San Diego, CA, US)
- Anthony Flannery (San Diego, CA, US)
- Sahngki Hong (San Diego, CA, US)
- Brinda Kodira Cariappa (San Diego, CA, US)
- Lewis J. Kraft (San Diego, CA, US)
Cpc classification
B01L2200/0647
PERFORMING OPERATIONS; TRANSPORTING
B01L2200/12
PERFORMING OPERATIONS; TRANSPORTING
B01J19/0046
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502707
PERFORMING OPERATIONS; TRANSPORTING
B01J2219/00621
PERFORMING OPERATIONS; TRANSPORTING
B01J2219/00644
PERFORMING OPERATIONS; TRANSPORTING
B01J2219/00612
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502761
PERFORMING OPERATIONS; TRANSPORTING
International classification
Abstract
An example of a flow cell includes a substrate and a reaction area defined in or over the substrate. The reaction area includes two angularly offset and non-perpendicular surfaces relative to a planar surface of the substrate, a polymeric hydrogel positioned over at least a portion of each of the two angularly offset and non-perpendicular surfaces; a first primer set attached to the polymeric hydrogel that is positioned over the portion of a first of the two angularly offset and non-perpendicular surfaces; and a second primer set attached to the polymeric hydrogel that is positioned over the portion of a second of the two angularly offset and non-perpendicular surfaces, wherein the first and second primer sets are orthogonal.
Claims
1. A flow cell, comprising: a substrate; and a reaction area defined in or over the substrate, the reaction area including: two angularly offset and non-perpendicular surfaces relative to a planar surface of the substrate; a polymeric hydrogel positioned over at least a portion of each of the two angularly offset and non-perpendicular surfaces; a first primer set attached to the polymeric hydrogel that is positioned over the portion of a first of the two angularly offset and non-perpendicular surfaces; and a second primer set attached to the polymeric hydrogel that is positioned over the portion of a second of the two angularly offset and non-perpendicular surfaces, wherein the first and second primer sets are orthogonal.
2. The flow cell as defined in claim 1, wherein: the reaction area is defined in the substrate; and the two angularly offset and non-perpendicular surfaces protrude outward relative to the planar surface of the substrate.
3. The flow cell as defined in claim 1, wherein: the reaction area is defined in the substrate; and the two angularly offset and non-perpendicular surfaces protrude inward relative to the planar surface of the substrate.
4. The flow cell as defined in claim 1, wherein: the reaction area is defined in a layer over the substrate; the two angularly offset and non-perpendicular surfaces are part of a triangular prism defined in the layer; and the flow cell further comprises a post positioned on the substrate and supporting the triangular prism such that the triangular prism is a spaced distance from the planar surface.
5. The flow cell as defined in claim 4, further comprising an adhesive component between the first of the two angularly offset and non-perpendicular surfaces and the polymeric hydrogel applied thereon.
6. The flow cell as defined in claim 4, wherein: the planar surface of the substrate defines an interstitial region adjacent to the post; and the flow cell further comprises; a first reactive pad over the interstitial region at an area that underlies the first of the two angularly offset and non-perpendicular surfaces, the first reactive pad including the polymeric hydrogel and primers of the first primer set; and a second reactive pad over the interstitial region at an area that underlies the second of the two angularly offset and non-perpendicular surfaces, the second reactive pad including the polymeric hydrogel and primers of the second primer set.
7. The flow cell as defined in claim 1, further comprising: a plurality of additional reaction areas defined in or over the substrate; and interstitial regions of the planar surface separating the reaction area and each of the plurality of additional reaction areas from each other.
8. The flow cell as defined in claim 1, wherein: the first primer set includes an un-cleavable first primer and a cleavable second primer; and the second primer set includes a cleavable first primer and an un-cleavable second primer.
9. A method, comprising: defining a triangular prism in or over a substrate, the triangular prism including two angularly offset and non-perpendicular surfaces relative to a planar surface of the substrate; angle depositing a sacrificial layer over a first of the two angularly offset and non-perpendicular surfaces; depositing a first functionalized layer over the sacrificial layer and over a second of the two angularly offset and non-perpendicular surfaces; removing the sacrificial layer, thereby exposing the first of the two angularly offset and non-perpendicular surfaces; and selectively applying a second functionalized layer over the first of the two angularly offset and non-perpendicular surfaces.
10. The method as defined in claim 9, wherein defining the triangular prism in the substrate involves nanoimprint lithography or dry etching.
11. The method as defined in claim 10, wherein: the triangular prism is defined in the substrate such that the two angularly offset and non-perpendicular surfaces protrude outward relative to the planar surface of the substrate; prior to angle depositing the sacrificial layer, the method further comprises: applying a second sacrificial layer over the triangular prism and the planar surface of the substrate, wherein the second sacrificial layer has a different etch rate than the substrate; and etching the second sacrificial layer to expose the triangular prism without exposing the planar surface of the substrate; and after the second functionalized layer is selectively applied, the method further comprises removing the second sacrificial layer from the planar surface of the substrate.
12. The method as defined in claim 10, wherein: the triangular prism is defined in the substrate such that the two angularly offset and non-perpendicular surfaces extend inward relative to the planar surface of the substrate; and the method further comprises polishing the first functionalized layer and the second functionalized layer from the planar surface of the substrate.
13. The method as defined in claim 10, wherein: the triangular prism is defined in the substrate such that the two angularly offset and non-perpendicular surfaces extend inward relative to the planar surface of the substrate; after the first functionalized layer is deposited, the method further comprises: forming an insoluble photoresist over the first functionalized layer over the second of the two angularly offset and non-perpendicular surfaces; and removing the first functionalized layer and the sacrificial layer from over the first of the two angularly offset and non-perpendicular surfaces; the second functionalized layer is also applied over the insoluble photoresist; and after the second functionalized layer is applied, the method further comprises removing the insoluble photoresist.
14. The method as defined in claim 13, further comprising polishing the first functionalized layer and the second functionalized layer from the planar surface of the substrate.
15. The method as defined in claim 9, wherein defining the triangular prism in the substrate involves etching the substrate through a through-hole defined in a mask layer positioned over the substrate.
16. The method as defined in claim 15, wherein: the sacrificial layer is angle sputtered through the through-hole; and the mask layer is removed prior to the deposition of the first functionalized layer.
17. The method as defined in claim 16, further comprising polishing the first functionalized layer and the second functionalized layer from the planar surface of the substrate.
18. The method as defined in claim 9, wherein defining the triangular prism over the substrate involves nanoimprinting or dry etching the triangular prism in a first layer positioned over a second layer positioned over the substrate, wherein the first and second layers have different etch rates.
19. The method as defined in claim 18, further comprising isotropically etching the second layer to form a post that supports the triangular prism a spaced distance from the planar surface and to expose a portion of the planar surface adjacent to the post.
20. The method as defined in claim 19, wherein: the first functionalized layer is also deposited over the portion of the planar surface at a first area that underlies the second of the two angularly offset and non-perpendicular surface; and the second functionalized lay is also selectively applied over the portion of the planar surface at a second area that underlies the first of the two angularly offset and non-perpendicular surface.
21. A method, comprising: defining a triangular prism over a substrate, the triangular prism including two angularly offset and non-perpendicular surfaces relative to a planar surface of the substrate; introducing a precursor adhesive component over a first of the two angularly offset and non-perpendicular surfaces; depositing a first functionalized layer that selectively attaches to a second of the two angularly offset and non-perpendicular surfaces and not to the precursor adhesive component; activating the precursor adhesive component to form an adhesive component over the first of the two angularly offset and non-perpendicular surfaces; and depositing a second functionalized layer that selectively attaches to the adhesive component.
22. The method as defined in claim 21, wherein: defining the triangular prism over the substrate involves nanoimprinting or dry etching the triangular prism in a first layer positioned over a second layer positioned over the substrate, wherein the first and second layers have different etch rates; and the method further comprises isotropically etching the second layer to form a post that supports the triangular prism a spaced distance from the planar surface and to expose a portion of the planar surface adjacent to the post.
23. The method as defined in claim 21, wherein the precursor adhesive component is tantalum oxide and wherein activating the precursor adhesive component involves depositing a silane on the precursor adhesive component.
24. The method as defined in claim 22, wherein the first layer is a nanoimprint lithography resin that includes surface groups to attach the first functionalized layer.
25. A method, comprising etching a substrate through a through-hole defined in a mask layer positioned over the substrate to form a triangular prism defined in the substrate, the triangular prism including two angularly offset and non-perpendicular surfaces relative to a planar surface of the substrate; angle depositing a first functionalized layer through the through-hole and onto a first of the two angularly offset and non-perpendicular surfaces; angle depositing a second functionalized layer through the through-hole and onto a second of the two angularly offset and non-perpendicular surfaces; and removing the mask layer.
26.-38. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0006] Features of examples of the present disclosure will become apparent by reference to the following detailed description and drawings, in which like reference numerals correspond to similar, though perhaps not identical, components. For the sake of brevity, reference numerals or features having a previously described function may or may not be described in connection with other drawings in which they appear.
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
DETAILED DESCRIPTION
[0032] Examples of the flow cells disclosed herein may be used for sequencing, examples of which include sequential paired-end nucleic acid sequencing or simultaneous paired-end nucleic acid sequencing. In several of the examples disclosed herein, the flow cells include an array of triangular prisms that support the primer set(s).
[0033] For sequential paired-end sequencing, a single primer set is attached to a vertically oriented surface of a triangular prism, i.e., perpendicular with respect to a planar surface of the flow cell substrate. The vertically oriented surface, and thus the primers attached thereto, faces a reflective and slanted surface of an adjacent triangular prism that enhances the signals during sequential paired-end sequencing. For sequential paired-end sequencing, the primers in the primer set include orthogonal cleaving (linearization) chemistry that enables forward strands to be generated, sequenced, and then removed, and then enables reversed strands to be generated, sequenced, and then removed. In these examples, orthogonal cleaving chemistry may be realized through different cleavage sites that are attached to the different primers in the set.
[0034] For simultaneous paired-end sequencing, two primer sets are respectively attached to i) the slanted surfaces of a triangular prism, i.e., surfaces that are angularly offset and non-perpendicular with respect to a planar surface of the flow cell substrate or ii) the offset surfaces of a multi-level depression. In these examples, the positioning of the primer sets improves the signal integrity because the signals from one surface do not deleteriously affect the signals from another surface. For simultaneous paired-end sequencing, the primer sets are controlled so that the cleaving (linearization) chemistry is orthogonal at the different surface. In these examples, orthogonal cleaving chemistry may be realized through identical or different cleavage sites that are attached to different primers in the different sets. This enables a cluster of forward strands to be generated in one region and a cluster of reverse strands to be generated in another region. The slanted surfaces of the triangular prism and the offset surfaces of the multi-depth depression keep the forward and reverse strands spatially separate, which separates the fluorescence signals from both reads while allowing for simultaneous base calling of each read.
Definitions
[0035] It is to be understood that terms used herein will take on their ordinary meaning in the relevant art unless specified otherwise. Several terms used herein and their meanings are set forth below.
[0036] The singular forms a, an, and the include plural referents unless the context clearly dictates otherwise.
[0037] The terms comprising, including, containing and various forms of these terms are synonymous with each other and are meant to be equally broad.
[0038] The terms top, bottom, lower, upper, on, etc. are used herein to describe the flow cell and/or the various components of the flow cell. It is to be understood that these directional terms are not meant to imply a specific orientation, but are used to designate relative orientation between components. The use of directional terms should not be interpreted to limit the examples disclosed herein to any specific orientation(s).
[0039] The terms first, second, etc. also are not meant to imply a specific orientation or order, but rather are used to distinguish one component from another.
[0040] It is to be understood that the ranges provided herein include the stated range and any value or sub-range within the stated range, as if such values or sub-ranges were explicitly recited. For example, a range of about 400 nm to about 1 ?m (1000 nm), should be interpreted to include not only the explicitly recited limits of about 400 nm to about 1 ?m, but also to include individual values, such as about 708 nm, about 945.5 nm, etc., and sub-ranges, such as from about 425 nm to about 825 nm, from about 550 nm to about 940 nm, etc. Furthermore, when about and/or substantially are/is utilized to describe a value, they are meant to encompass minor variations (up to +/?10%) from the stated value.
[0041] An acrylamide monomer is a monomer with the structure
##STR00001##
or a monomer including an acrylamide group. Examples of the monomer including an acrylamide group include azido acetamido pentyl acrylamide:
##STR00002##
and N-isopropylacrylamide:
[0042] ##STR00003##
Other acrylamide monomers may be used.
[0043] The term activation, as used herein, refers to a process that generates reactive groups at the surface of a single layer substrate or an outermost layer of a multi-layered substrate. Activation may be accomplished using silanization or plasma ashing. While the figures do not depict a separate silanized layer or OH groups from plasma ashing, it is to be understood that activation generates a silanized layer or OH groups at the surface of the activated support or layer to covalently attach the functionalized layers to the underlying support or layer. Additionally, in any of the example methods, it is to be understood that if the substrate does not inherently include the reactive groups, e.g., to covalently attach the polymeric hydrogel/functionalized layer, a suitable activation process is performed prior to the deposition of any of the polymeric hydrogels/functionalized layers.
[0044] An active pair refers to a vertically oriented surface of one triangular prism that has a primer set attached thereto and that faces a reflective and angled surface of an adjacent triangular prism. The reflective surface may amplify the excitation light that is directed toward a cluster of amplicons attached to the primers of the primer set. The reflective surface may also or alternatively amplify the emission signal(s) emitted from the cluster of amplicons during sequencing.
[0045] An aldehyde, as used herein, is an organic compound containing a functional group with the structure CHO, which includes a carbonyl center (i.e., a carbon double-bonded to oxygen) with the carbon atom also bonded to hydrogen and an R group, such as an alkyl or other side chain. The general structure of an aldehyde is:
##STR00004##
[0046] As used herein, alkyl refers to a straight or branched hydrocarbon chain that is fully saturated (i.e., contains no double or triple bonds). The alkyl group may have 1 to 20 carbon atoms. Example alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tertiary butyl, pentyl, hexyl, and the like. As an example, the designation C1-4 alkyl indicates that there are one to four carbon atoms in the alkyl chain, i.e., the alkyl chain is selected from the group consisting of methyl, ethyl, propyl, iso-propyl, n-butyl, isobutyl, sec-butyl, and t-butyl.
[0047] As used herein, alkenyl refers to a straight or branched hydrocarbon chain containing one or more double bonds. The alkenyl group may have 2 to 20 carbon atoms. Example alkenyl groups include ethenyl, propenyl, butenyl, pentenyl, hexenyl, and the like.
[0048] As used herein, alkyne or alkynyl refers to a straight or branched hydrocarbon chain containing one or more triple bonds. The alkynyl group may have 2 to 20 carbon atoms.
[0049] As used herein, aryl refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent carbon atoms) containing only carbon in the ring backbone. When the aryl is a ring system, every ring in the system is aromatic. The aryl group may have 6 to 18 carbon atoms. Examples of aryl groups include phenyl, naphthyl, azulenyl, and anthracenyl.
[0050] An amine or amino functional group refers to an NR.sub.aR.sub.b group, where R.sub.a and R.sub.b are each independently selected from hydrogen (e.g.,
##STR00005##
C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocyclyl, as defined herein.
[0051] The phrase angularly offset and non-perpendicular surface refers to a surface of a protruding triangular prism that is slanted at an angle that is greater than 0? and less than 90? or greater than 90? and less than 180? relative to a planar surface of a substrate over which the protruding triangular prism is formed, or a surface of a depressed triangular prism that is slanted at an angle that is greater than 180? and less than 270? or greater than 270? and less than 360? relative to a planar surface of a substrate in which the depressed triangular prism is formed.
[0052] As used herein, the term attached refers to the state of two things being joined, fastened, adhered, connected or bound to each other, either directly or indirectly. For example, a nucleic acid can be attached to a functionalized polymer by a covalent or non-covalent bond. A covalent bond is characterized by the sharing of pairs of electrons between atoms. A non-covalent bond is a physical bond that does not involve the sharing of pairs of electrons and can include, for example, hydrogen bonds, ionic bonds, van der Waals forces, hydrophilic interactions and hydrophobic interactions.
[0053] An azide or azido functional group refers to N.sub.3.
[0054] As used herein, a bonding region refers to an area of a patterned structure that is to be bonded to another material, which may be, as examples, a spacer layer, a lid, another patterned structure, etc., or combinations thereof (e.g., a spacer layer and a lid, or a spacer layer and another patterned structure). The bond that is formed at the bonding region may be a chemical bond (as described above), or a mechanical bond (e.g., using a fastener, etc.).
[0055] As used herein, carbocycle means a non-aromatic cyclic ring or ring system containing only carbon atoms in the ring system backbone. When the carbocycle is a ring system, two or more rings may be joined together in a fused, bridged or spiro-connected fashion. Carbocycles may have any degree of saturation, provided that at least one ring in a ring system is not aromatic. Thus, carbocycles include cycloalkyls, cycloalkenyls, and cycloalkynyls. The carbocycle group may have 3 to 20 carbon atoms. Examples of carbocycle rings include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cyclohexenyl, 2,3-dihydro-indene, bicyclo[2.2.2]octanyl, adamantyl, and spiro[4.4]nonanyl.
[0056] As used herein, the term carboxylic acid or carboxyl as used herein refers to COOH.
[0057] As used herein, cycloalkylene means a fully saturated carbocycle ring or ring system that is attached to the rest of the molecule via two points of attachment.
[0058] As used herein, cycloalkenyl or cycloalkene means a carbocycle ring or ring system having at least one double bond, wherein no ring in the ring system is aromatic. Examples include cyclohexenyl or cyclohexene and norbornenyl or norbornene. Also as used herein, heterocycloalkenyl or heterocycloalkene means a carbocycle ring or ring system with at least one heteroatom in ring backbone, having at least one double bond, wherein no ring in the ring system is aromatic.
[0059] As used herein, cycloalkynyl or cycloalkyne means a carbocycle ring or ring system having at least one triple bond, wherein no ring in the ring system is aromatic. An example is cyclooctyne. Another example is bicyclononyne. Also as used herein, heterocycloalkynyl or heterocycloalkyne means a carbocycle ring or ring system with at least one heteroatom in ring backbone, having at least one triple bond, wherein no ring in the ring system is aromatic.
[0060] The term depositing, as used herein, refers to any suitable application technique, which may be manual or automated, and, in some instances, results in modification of the surface properties. Generally, depositing may be performed using vapor deposition techniques, coating techniques, grafting techniques, or the like. Some specific examples include chemical vapor deposition (CVD), spray coating (e.g., ultrasonic spray coating), spin coating, dunk or dip coating, doctor blade coating, puddle dispensing, flow through coating, aerosol printing, screen printing, microcontact printing, inkjet printing, or the like.
[0061] The term each, when used in reference to a collection of items, is intended to identify an individual item in the collection, but does not necessarily refer to every item in the collection. Exceptions can occur if explicit disclosure or context clearly dictates otherwise.
[0062] The term epoxy (also referred to as a glycidyl or oxirane group) as used herein refers to
##STR00006##
[0063] As used herein, the term flow cell is intended to mean a vessel having a flow channel where a reaction can be carried out. In some instances, the flow cell is an open wafer, and the flow channel is open to the external environment. In other instances, the flow cell is enclosed, and further includes an inlet for delivering reagent(s) to the flow channel, and an outlet for removing reagent(s) from the flow channel. In some examples, the flow cell accommodates the detection of the reaction that occurs in the flow cell. For example, the flow cell can include one or more transparent surfaces allowing for the optical detection of arrays, optically labeled molecules, or the like.
[0064] As used herein, a flow channel or channel may be an area defined in an open wafer or between two bonded components, which can selectively receive a liquid sample. In some examples, the flow channel may be defined between two patterned structures, and thus may be in fluid communication with surface chemistry of the patterned structures. In other examples, the flow channel may be defined between a patterned structure and a lid, and thus may be in fluid communication with surface chemistry of the patterned structures. In still other examples, the flow channel is defined in a substrate and is open to the external environment.
[0065] As used herein, the terms functionalized layer and functionalized layer pad and polymeric hydrogel refer to a gel material that is applied over at least a portion of a flow cell substrate. The gel material includes functional group(s) that can attach to primer(s). In some examples, the functionalized layer/polymeric hydrogel is positioned over all or a portion of the angularly offset and non-perpendicular surfaces of a triangular prism. In other examples, the functionalized layer/polymeric hydrogel is positioned on all or a portion of the bottom surfaces in the deep and shallow portions of a multi-depth depression. In still other examples, the functionalized layer pad sits on, and thus appears to protrude from, a substantially flat substrate surface. The terms functionalized layer and polymeric hydrogel also refer to the gel material that is applied over all or a portion of the substrate, and that is exposed to further processing to define the final layer or pad.
[0066] As used herein, heteroaryl refers to an aromatic ring or ring system (i.e., two or more fused rings that share two adjacent atoms) that contain(s) one or more heteroatoms, that is, an element other than carbon, including but not limited to, nitrogen, oxygen and sulfur, in the ring backbone. When the heteroaryl is a ring system, every ring in the system is aromatic. The heteroaryl group may have 5-18 ring members.
[0067] As used herein, heterocycle means a non-aromatic cyclic ring or ring system containing at least one heteroatom in the ring backbone. Heterocycles may be joined together in a fused, bridged or spiro-connected fashion. Heterocycles may have any degree of saturation provided that at least one ring in the ring system is not aromatic. In the ring system, the heteroatom(s) may be present in either a non-aromatic or aromatic ring. The heterocycle group may have 3 to 20 ring members (i.e., the number of atoms making up the ring backbone, including carbon atoms and heteroatoms). In some examples, the heteroatom(s) are O, N, or S.
[0068] The term hydrazine or hydrazinyl as used herein refers to a NHNH.sub.2 group.
[0069] As used herein, the term hydrazone or hydrazonyl as used herein refers to a
##STR00007##
group in which R.sub.a and R.sub.b are each independently selected from hydrogen, C1-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C3-7 carbocycle, C6-10 aryl, 5-10 membered heteroaryl, and 5-10 membered heterocyclyl, as defined herein.
[0070] As used herein, hydroxy or hydroxyl refers to an OH group.
[0071] As used herein, the term interstitial region refers to an area, e.g., of a substrate that separates features, e.g., protruding or depressing triangular prisms, multi-depressions (concave regions), or functionalized layer pads. For example, an interstitial region can separate one protruding triangular prism of an array from another protruding triangular prism of the array. The two features that are separated from each other are discrete, i.e., lacking physical contact with each other. In many examples, the interstitial region is continuous, except where the features are formed. Interstitial regions may have a surface material that differs from the surface material of the features. For example, a protruding triangular prism can have a functionalized layer and primer set(s) attached to its angularly offset and non-perpendicular surfaces, and the interstitial regions can be free of functionalized layer and primer set(s). In the examples disclosed herein, the planar surface of the substrate defines the interstitial regions.
[0072] As used herein, the term multi-depth depression refers to a discrete concave feature defined in a resin layer that includes a deep portion and a shallow portion that is adjacent to the deep portion. The multi-depth depression can have any of a variety of shapes at its opening including, as examples, round, elliptical, square, polygonal, star shaped (with any number of vertices), etc. The cross-section of a multi-depression taken orthogonally with the surface can be curved, square, polygonal, hyperbolic, conical, angular, etc.
[0073] As used herein, a negative photoresist refers to a light sensitive material in which a portion that is exposed to light of particular wavelength(s) becomes insoluble to a developer. In these examples, the insoluble negative photoresist has less than 5% solubility in the developer. With the negative photoresist, the light exposure changes the chemical structure so that the exposed portions of the material become less soluble (than non-exposed portions) in the developer. While not soluble in the developer, the insoluble negative photoresist may be at least 99% soluble in a remover that is different from the developer. The remover may be a solvent or solvent mixture used, e.g., in a lift-off process.
[0074] In contrast to the insoluble negative photoresist, any portion of the negative photoresist that is not exposed to light is at least 95% soluble in the developer. In some examples, the portion of the negative photoresist not exposed to light is at least 98%, e.g., 99%, 99.5%, 100%, soluble in the developer.
[0075] Nitrile oxide, as used herein, means a R.sub.aC?N.sup.+O.sup.? group in which R.sub.a is defined herein. Examples of preparing nitrile oxide include in situ generation from aldoximes by treatment with chloramide-T or through action of a base on imidoyl chlorides [RC(Cl)?NOH] or from the reaction between hydroxylamine and an aldehyde.
[0076] Nitrone, as used herein, means a
##STR00008##
group in which R.sup.1, R.sup.2, and R.sup.3 may be any of the R.sub.a and R.sub.b groups defined herein, except that R.sup.3 is not hydrogen (H).
[0077] As used herein, a nucleotide includes a nitrogen containing heterocyclic base, a sugar, and one or more phosphate groups. Nucleotides are monomeric units of a nucleic acid sequence. In RNA, the sugar is a ribose, and in DNA, the sugar is a deoxyribose, i.e., a sugar lacking a hydroxyl group that is present at the 2 position in ribose. The nitrogen containing heterocyclic base (i.e., nucleobase) can be a purine base or a pyrimidine base. Purine bases include adenine (A) and guanine (G), and modified derivatives or analogs thereof. Pyrimidine bases include cytosine (C), thymine (T), and uracil (U), and modified derivatives or analogs thereof. The C-1 atom of deoxyribose is bonded to N-1 of a pyrimidine or N-9 of a purine. A nucleic acid analog may have any of the phosphate backbone, the sugar, or the nucleobase altered. Examples of nucleic acid analogs include, for example, universal bases or phosphate-sugar backbone analogs, such as peptide nucleic acid (PNA).
[0078] The term orthogonal, as used herein in reference to cleaving chemistry or removal conditions, means that two components (e.g., primers, layers, etc.) are susceptible to different cleaving or removal agents, and thus one component is not affected by the cleaving agent or removal conditions of the other component, and vice versa. The term orthogonal, as used herein in reference to primer sets (e.g., those described in reference to
[0079] In some examples, the term over may mean that one component or material is positioned directly on another component or material. When one is directly on another, the two are in contact with each other.
[0080] In other examples, the term over may mean that one component or material is positioned indirectly on another component or material. By indirectly on, it is meant that a gap or an additional component or material may be positioned between the two components or materials.
[0081] A patterned structure refers to a single layer base support that includes, or a multi-layer stack with a layer that includes, surface chemistry in a pattern, e.g., in depressions or otherwise positioned on the support or layer surface. The surface chemistry may include a functionalized layer and primers (e.g., used for library template capture and amplification). In some examples, the single layer base support or the layer of the multi-layer stack has been exposed to patterning techniques (e.g., etching, lithography, etc.) in order to generate the pattern for the surface chemistry. However, the term patterned structure is not intended to imply that such patterning techniques have to be used to generate the pattern. For example, a base support may be a substantially flat surface having a pattern of the functionalized layers thereon. The patterned structure may be generated via any of the methods disclosed herein.
[0082] As used herein, the term polyhedral oligomeric silsesquioxane refers to a chemical composition that is a hybrid intermediate (e.g., RSiO.sub.1.5) between that of silica (SiO.sub.2) and silicone (R.sub.2SiO). An example of polyhedral oligomeric silsesquioxane may be that described in Kehagias et al., Microelectronic Engineering 86 (2009), pp. 776-778, which is incorporated by reference in its entirety. In an example, the composition is an organosilicon compound with the chemical formula [RSiO.sub.3/2].sub.n, where the R groups can be the same or different. Example R groups for POSS include epoxy, azide/azido, a thiol, a poly(ethylene glycol), a norbornene, a tetrazine, acrylates, and/or methacrylates, or further, for example, alkyl, aryl, alkoxy, and/or haloalkyl groups.
[0083] As used herein, a positive photoresist refers to a light sensitive material in which a portion that is exposed to light of particular wavelength(s) becomes soluble to a developer. In these examples, any portion of the positive photoresist exposed to light is at least 95% soluble in the developer. In some examples, the portion of the positive photoresist exposed to light is at least 98%, e.g., 99%, 99.5%, 100%, soluble in the developer. With the positive photoresist, the light exposure changes the chemical structure so that the exposed portions of the material become more soluble (than non-exposed portions) in the developer.
[0084] In contrast to the soluble positive photoresist, any portion of the positive photoresist not exposed to light is insoluble (less than 5% soluble) in the developer. While not soluble in the developer, the insoluble positive photoresist may be at least 99% soluble in a remover that is different from the developer. In some examples, insoluble positive photoresist is at least 98%, e.g., 99%, 99.5%, 100%, soluble in the remover. The remover may be a solvent or solvent mixture used in a lift-off process.
[0085] As used herein, the primer is defined as a single stranded nucleic acid sequence (e.g., single strand DNA). Some primers, referred to herein as amplification primers, serve as a starting point for template amplification and cluster generation. Other primers, referred to herein as sequencing primers, serve as a starting point for DNA synthesis. The 5 terminus of the primer may be modified to allow a coupling reaction with a functional group of a polymer. The primer length can be any number of bases long and can include a variety of non-natural nucleotides. In an example, the sequencing primer is a short strand, ranging from 10 to 60 bases, or from 20 to 40 bases.
[0086] A spacer layer, as used herein, refers to a material that bonds two components together. In some examples, the spacer layer can be a radiation absorbing material that aids in bonding, or can be put into contact with a radiation absorbing material that aids in bonding.
[0087] The term substrate refers to the single layer base support or a multi-layer structure upon which surface chemistry is introduced.
[0088] The term tantalum pentoxide refers to the inorganic compound with the formula Ta.sub.2O.sub.5. This compound is transparent, having a transmittance ranging from about 0.25 (25%) to 1 (100%), to wavelengths ranging from about 0.35 ?m (350 nm) to at least 1.8 ?m (1800 nm). A tantalum pentoxide base support or tantalum pentoxide layer may comprise, consist essentially of, or consist of Ta.sub.2O.sub.5. In examples where it is desirable for the tantalum pentoxide base support or the tantalum pentoxide layer to transmit electromagnetic energy having any of these wavelengths, the base support or layer may consist of Ta.sub.2O.sub.5 or may comprise or consist essentially of Ta.sub.2O.sub.5 and other components that will not interfere with the desired transmittance of the base support or layer.
[0089] A thiol functional group refers to SH.
[0090] As used herein, the terms tetrazine and tetrazinyl refer to six-membered heteroaryl group comprising four nitrogen atoms. Tetrazine can be optionally substituted.
[0091] Tetrazole, as used herein, refer to five-membered heterocyclic group including four nitrogen atoms. Tetrazole can be optionally substituted.
[0092] The term transparent refers to a material, e.g., in the form of a base support or layer, that is capable of transmitting a particular wavelength or range of wavelengths. For example, the material may be transparent to wavelength(s) that are used to chemically change a positive or negative photoresist. Transparency may be quantified using transmittance, i.e., the ratio of light energy falling on a body to that transmitted through the body. The transmittance of a transparent base support or a transparent layer will depend upon the thickness of the base support or layer, the wavelength of light, and the dosage of the light to which it is exposed. In the examples disclosed herein, the transmittance of the transparent base support or the transparent layer may range from 0.25 (25%) to 1 (100%). The material of the base support or layer may be a pure material, a material with some impurities, or a mixture of materials, as long as the resulting base support or layer is capable of the desired transmittance. Additionally, depending upon the transmittance of the base support or layer, the time for light exposure and/or the output power of the light source may be increased or decreased to deliver a suitable dose of light energy through the transparent base support and/or layer to achieve the desired effect (e.g., generating a soluble or insoluble photoresist).
[0093] A vertically oriented surface is the surface of a right triangular prism that is perpendicular to a planar surface of a substrate over which the right triangular prism is formed.
[0094] Flow Cells
[0095] A top view of the flow cell 10 is shown in
[0096] In some examples, the flow cell 10 is an open wafer flow cell that includes one patterned structure whose surface is open to the external environment. In these examples, a flow channel 12 and the surface chemistry of the flow cell 10 are open to the external environment and thus are open to receive fluids.
[0097] In other examples, the flow cell 10 is an enclosed flow cell that includes two patterned structures bonded together or one patterned structure bonded to a lid. Between the two patterned structures or the one patterned structure and the lid is a flow channel 12. The example shown in
[0098] Each flow channel 12 in an enclosed flow cell 10 is in fluid communication with an inlet and an outlet (not shown). The inlet and outlet of each flow channel 12 may be positioned at opposed ends of the flow cell 10. The inlets and outlets of the respective flow channels 12 may alternatively be positioned anywhere along the length and width of the flow channel 12 that enables desirable fluid flow.
[0099] The inlet allows fluids to be introduced into the flow channel 12, and the outlet allows fluid to be extracted from the flow channel 12. Each of the inlets and outlets is fluidly connected to a fluidic control system (including, e.g., reservoirs, pumps, valves, waste containers, and the like) which controls fluid introduction and expulsion.
[0100] The flow channel 12 may have any desirable shape. In an example, the flow channel 12 has a substantially rectangular configuration with curved ends (as shown in
[0101] The height of the flow channel 12 can be as small as a monolayer thick when microcontact, aerosol, or inkjet printing is used to deposit a separate material (e.g., a spacer layer) that defines the side walls of the flow channel 12. For other examples, the height of the flow channel 12 can be about 1 ?m, about 10 ?m, about 50 ?m, about 100 ?m, or more. In an example, the height may range from about 10 ?m to about 100 ?m. In another example, the height may range from about 10 ?m to about 30 ?m. In still another example, the depth is about 5 ?m or less. It is to be understood that the height of the flow channel 12 may be greater than, less than or between the values specified above.
[0102] The spacer layer used to attach a patterned structure and a lid or two patterned structures may be any material that will seal portions of the patterned structures together or portions of the patterned structure and the lid. As examples, the spacer layer may be an adhesive, a radiation-absorbing material that aids in bonding, or the like. In some examples, the spacer layer is the radiation-absorbing material, e.g., KAPTON? black. The patterned structure or the patterned structure and the lid may be bonded using any suitable technique, such as laser bonding, diffusion bonding, anodic bonding, eutectic bonding, plasma activation bonding, glass frit bonding, or others methods known in the art.
[0103] As mentioned, the flow channel 12 is at least partially defined by a patterned structure. Different examples of the patterned structures that may define at least one surface of the flow cell 10 are shown in
[0104] Some examples of the flow cell 10 suitable for simultaneous paired-end sequencing are shown in
[0105] Another example of a flow cell 10 suitable for simultaneous paired-end sequencing is shown in
[0106] Still another example of the flow cell 10 for simultaneous paired-end sequencing is depicted in
[0107] An example of the flow cell 10 for sequential paired-end sequencing is shown in
[0108] Each example of the patterned structure includes a substrate 14 or 16. The substrate 14 is a single layer base support (as shown in
[0109] Examples of suitable single layer base supports (i.e., substrate 14) include epoxy siloxane, glass, modified or functionalized glass, polymers (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, polytetrafluoroethylene (such as TEFLON? from Chemours), cyclic olefins/cyclo-olefin polymers (COP) (such as ZEONOR? from Zeon), polyimides, nylon (polyamides), etc.) ceramics/ceramic oxides, silica (i.e., silicon dioxide (SiO.sub.2)), fused silica, or silica-based materials, aluminum silicate, silicon and modified silicon (e.g., boron doped p+ silicon), silicon nitride (Si.sub.3N.sub.4), tantalum pentoxide (Ta.sub.2O.sub.5) or other tantalum oxide(s) (TaO.sub.x), hafnium oxide (HfO.sub.2), carbon, metals, or the like. In some examples, the resins set forth herein may also be used as the single layer substrate 14. In the example shown in
[0110] Examples of the multi-layered structure (i.e., substrate 16) include a base support 18 and at least one other layer 20 thereon. Any example of the single layer base support 14 may be used as the base support 18. The other layer 20 may be any material that can be etched or imprinted to form the angularly offset and non-perpendicular surfaces 24A, 24B, the triangular prisms 44, or the multi-depth depressions 32. Examples of the layer 20 include inorganic oxides, such as tantalum oxide (e.g., Ta.sub.2O.sub.5), aluminum oxide (e.g., Al.sub.2O.sub.3), silicon oxide (e.g., SiO.sub.2), or hafnium oxide (e.g., HfO.sub.2), or polymeric resins, such as a polyhedral oligomeric silsesquioxane based resin (e.g., POSS? from Hybrid Plastics), a non-polyhedral oligomeric silsesquioxane epoxy resin, a poly(ethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP? from Bellex), and combinations thereof.
[0111] In some examples, the substrate 14 or 16 (including both 18 and 20) is capable of transmitting the light that is used to pattern a photoresist (e.g., ultraviolet light) and that is used in nucleic acid sequencing (e.g., ultraviolet light and visible light). In these particular examples, suitable materials include siloxanes, glass, modified or functionalized glass, polymers (including acrylics, polystyrene and copolymers of styrene and other materials, polyethylene terephthalate (PET), polycarbonate, cyclic olefin copolymer (COC), and some polyamides), silica or silicon oxide (e.g., SiO.sub.2), fused silica, silica-based materials, silicon nitride (Si.sub.3N.sub.4), resins, or the like. Examples of resins that can transmit UV light include inorganic oxides, such as tantalum pentoxide (e.g., Ta.sub.2O.sub.5) or other tantalum oxide(s) (TaO.sub.x), aluminum oxide (e.g., Al.sub.2O.sub.3), silicon oxide (e.g., SiO.sub.2), hafnium oxide (e.g., HfO.sub.2), indium tin oxide, titanium dioxide, etc., or polymeric resins, such as a polyhedral oligomeric silsesquioxane based resin (e.g., POSS? from Hybrid Plastics), a non-polyhedral oligomeric silsesquioxane epoxy resin, a poly(ethylene glycol) resin, a polyether resin (e.g., ring opened epoxies), an acrylic resin, an acrylate resin, a methacrylate resin, an amorphous fluoropolymer resin (e.g., CYTOP? from Bellex), and combinations thereof.
[0112] In any of the examples set forth herein, the substrate 14 or the base support 18 may be a circular sheet, a panel, a wafer, a die etc. having a diameter ranging from about 2 mm to about 300 mm, e.g., from about 200 mm to about 300 mm, or may be a rectangular sheet, panel, wafer, die etc. having its largest dimension up to about 10 feet (?3 meters). As one example, a die may have a width ranging from about 0.1 mm to about 10 mm. While example dimensions have been provided, it is to be understood that the substrate 14 or the base support 18 may have any suitable dimensions.
[0113] Each example of the patterned structure includes an array of features, such as the triangular prisms 44, the reactions areas 22, 22, 22, the functionalized layer pads 42A, 42B, or the multi-depth depressions 32. Many different layouts of these features may be envisaged, including regular, repeating, and non-regular patterns. The triangular prisms 44 are arranged in one or more rows such that, within each row, the perpendicular surface 46 of one triangular prism 44 faces the reflective surface 48 of another triangular prism 44. Multiple rows of the triangular prisms 44 may be formed across the substrate 14, 16. In an example, the reactions areas 22, 22, 22, the functionalized layer pads 42A, 42B, or the multi-depth depressions 32 are disposed in a hexagonal grid for close packing and improved density. Other layouts for the reactions areas 22, 22, 22, the functionalized layer pads 42A, 42B, or the multi-depth depressions 32 may include, for example, rectilinear (rectangular) layouts, triangular layouts, and so forth. In some examples, the layout can be an x-y format in rows and columns. In some other examples, the layout or pattern can be a repeating arrangement of the reactions areas 22, 22, 22, the functionalized layer pads 42A, 42B, or the multi-depth depressions 32.
[0114] The layout for any of the features may be characterized with respect to the density (number) of the triangular prisms 44, the reactions areas 22, 22, 22, the functionalized layer pads 42A, 42B, or the multi-depth depressions 32 in a defined area. For example, the triangular prisms 44, the reactions areas 22, 22, 22, the functionalized layer pads 42A, 42B, or the multi-depth depressions 32 may be present at a density of approximately 2 million per mm.sup.2. The density may be tuned to different densities including, for example, a density of about 100 per mm.sup.2, about 1,000 per mm.sup.2, about 0.1 million per mm.sup.2, about 1 million per mm.sup.2, about 2 million per mm.sup.2, about 5 million per mm.sup.2, about 10 million per mm.sup.2, about 50 million per mm.sup.2, or more, or less. It is to be further understood that the density can be between one of the lower values and one of the upper values selected from the ranges above, or that other densities (outside of the given ranges) may be used.
[0115] The layout of the triangular prisms 44, the reactions areas 22, 22, 22, the functionalized layer pads 42A, 42B, or the multi-depth depressions 32 may also or alternatively be characterized in terms of the average pitch, or the spacing from the center of one feature to the center of an adjacent feature (center-to-center spacing) or from the right edge of one feature to the left edge of an adjacent feature (edge-to-edge spacing). The pattern can be regular, such that the coefficient of variation around the average pitch is small, or the pattern can be non-regular in which case the coefficient of variation can be relatively large. In either case, the average pitch can be, for example, about 50 nm, about 0.15 ?m, about 0.5 ?m, about 1 ?m, about 5 ?m, about 10 ?m, or more or less. The average pitch for a particular pattern of can be between one of the lower values and one of the upper values selected from the ranges above.
[0116] Each of the triangular prisms 44 shown in
[0117] The size of each reaction area 22, 22, 22 may be characterized by the dimensions of the angularly offset and non-perpendicular surfaces 24A, 24B. These surfaces 24A, 24B are squares or rectangles, and thus can each be defined by their length and width. As examples, the length and the width of each angularly offset and non-perpendicular surface 24A, 24B can range from about 0.1 ?m to about 100 ?m, e.g., about 0.5 ?m, about 1 ?m, about 10 ?m, or more, or less.
[0118] When the reaction area 22 is part of a depressed triangular prism 44 that extends into the substrate 16 from the planar surface 26, as shown in
[0119] When the reaction area 22 is part of a triangular prism 44 that protrudes out from the planar surface 26, as shown in
[0120] The depth and width of each depressed triangular prism 44 or the height and base of each protruding triangular prism 44 or of each triangular prism 44 also contribute to the overall configuration of the reaction areas 22, 22, 22. The depth or height can range from about 0.1 ?m to about 100 ?m, e.g., about 0.5 ?m, about 1 ?m, about 10 ?m, or more, or less. The width or base can also range from about 0.1 ?m to about 100 ?m, e.g., about 0.5 ?m, about 1 ?m, about 10 ?m, or more, or less.
[0121] Referring specifically to the example shown in
[0122] The width of the post 54 is smaller than the base of the triangular prism 44, but is large enough to support the triangular prism 44. The width can be controlled by the etching process used to form the post 54. The length of the post 54 is the same length as the triangular prism 44.
[0123] In
[0124] In some examples of the architecture of
[0125] The size of each functionalized layer pad 42A, 42B shown in
[0126] The size of each multi-depth depression 32 shown in
[0127] Each of the architectures also includes the polymeric hydrogel/functionalized layer(s) 28 or 28A, 28B or the functionalized layer pads 42A, 42B. In each example, the polymeric hydrogel/functionalized layer(s) 28 or 28A, 28B or the functionalized layer pads 42A, 42B represent areas that have a primer set attached thereto. In the example shown in
[0128] The polymeric hydrogel/functionalized layer(s) 28 or 28A, 28B or the functionalized layer pads 42A, 42B may be any gel material that can swell when liquid is taken up and that can contract when liquid is removed, e.g., by drying. In an example, the gel material is an acrylamide copolymer. Some examples of the acrylamide copolymer are represented by the following structure (I):
##STR00009##
wherein: [0129] R.sup.A is selected from the group consisting of azido, optionally substituted amino, optionally substituted alkenyl, optionally substituted alkyne, halogen, optionally substituted hydrazone, optionally substituted hydrazine, carboxyl, hydroxy, optionally substituted tetrazole, optionally substituted tetrazine, nitrile oxide, nitrone, sulfate, and thiol; [0130] R.sup.B is H or optionally substituted alkyl; [0131] R.sup.C, R.sup.D, and R.sup.E are each independently selected from the group consisting of H and optionally substituted alkyl; [0132] each of the (CH.sub.2).sub.p can be optionally substituted; [0133] p is an integer in the range of 1 to 50; [0134] n is an integer in the range of 1 to 50,000; and [0135] m is an integer in the range of 1 to 100,000.
[0136] One specific example of the acrylamide copolymer represented by structure (I) is poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide, PAZAM.
[0137] One of ordinary skill in the art will recognize that the arrangement of the recurring n and m features in structure (I) are representative, and the monomeric subunits may be present in any order in the polymer structure (e.g., random, block, patterned, or a combination thereof). The molecular weight of the acrylamide copolymer may range from about 5 kDa to about 1500 kDa or from about 10 kDa to about 1000 kDa, or may be, in a specific example, about 312 kDa.
[0138] In some examples, the acrylamide copolymer is a linear polymer. In some other examples, the acrylamide copolymer is a lightly cross-linked polymer.
[0139] In other examples, the gel material may be a variation of structure (I). In one example, the acrylamide unit may be replaced with N,N-dimethylacrylamide
##STR00010##
In this example, the acrylamide unit in structure (I) may be replaced with
##STR00011##
where R.sup.D, R.sup.E, and R.sup.F are each H or a C1-C6 alkyl, and R.sup.G and R.sup.H are each a C1-C6 alkyl (instead of H as is the case with the acrylamide). In this example, q may be an integer in the range of 1 to 100,000. In another example, the N,N-dimethylacrylamide may be used in addition to the acrylamide unit. In this example, structure (I) may include
##STR00012##
in addition to the recurring n and m features, where R.sup.D, R.sup.E, and R.sup.F are each H or a C1-C6 alkyl, and R.sup.G and R.sup.H are each a C1-C6 alkyl. In this example, q may be an integer in the range of 1 to 100,000.
[0140] As another example of the gel material, the recurring n feature in structure (I) may be replaced with a monomer including a heterocyclic azido group having structure (II):
##STR00013##
wherein R.sup.1 is H or a C1-C6 alkyl; R.sub.2 is H or a C1-C6 alkyl; L is a linker including a linear chain with 2 to 20 atoms selected from the group consisting of carbon, oxygen, and nitrogen and 10 optional substituents on the carbon and any nitrogen atoms in the chain; E is a linear chain including 1 to 4 atoms selected from the group consisting of carbon, oxygen and nitrogen, and optional substituents on the carbon and any nitrogen atoms in the chain; A is an N substituted amide with an H or a C1-C4 alkyl attached to the N; and Z is a nitrogen containing heterocycle. Examples of Z include 5 to 10 carbon-containing ring members present as a single cyclic structure or a fused structure. Some specific examples of Z include pyrrolidinyl, pyridinyl, or pyrimidinyl.
[0141] As still another example, the gel material may include a recurring unit of each of structure (III) and (IV):
##STR00014##
wherein each of R.sup.1a, R.sup.2a, R.sup.1b and R.sup.2b is independently selected from hydrogen, an optionally substituted alkyl or optionally substituted phenyl; each of R.sup.3a and R.sup.3b is independently selected from hydrogen, an optionally substituted alkyl, an optionally substituted phenyl, or an optionally substituted C7-C14 aralkyl; and each L.sup.1 and L.sup.2 is independently selected from an optionally substituted alkylene linker or an optionally substituted heteroalkylene linker.
[0142] In still another example, the acrylamide copolymer is formed using nitroxide mediated polymerization, and thus at least some of the copolymer chains have an alkoxyamine end group. In the copolymer chain, the term alkoxyamine end group refers to the dormant species ONR.sub.1R.sub.2, where each of R.sub.1 and R.sub.2 may be the same or different, and may independently be a linear or branched alkyl, or a ring structure, and where the oxygen atom is attached to the rest of the copolymer chain. In some examples, the alkoxyamine may also be introduced into some of the recurring acrylamide monomers, e.g., at position R.sup.A in structure (I). As such, in one example, structure (I) includes an alkoxyamine end group; and in another example, structure (I) includes an alkoxyamine end group and alkoxyamine groups in at least some of the side chains.
[0143] It is to be understood that other molecules may be used to form the polymeric hydrogel/functionalized layer(s) 28 or 28A, 28B or the functionalized layer pads 42A, 42B, as long as they are capable of being functionalized with the desired chemistry, e.g., primer set(s) 50, or 30, 31. Some examples of suitable materials for the polymeric hydrogel/functionalized layer(s) 28 or 28A, 28B or the functionalized layer pads 42A, 42B include functionalized silanes, such as norbornene silane, azido silane, alkyne functionalized silane, amine functionalized silane, maleimide silane, or any other silane having functional groups that can respectively attach the desired chemistry. Still other examples of suitable materials for the polymeric hydrogel/functionalized layer(s) 28 or 28A, 28B or the functionalized layer pads 42A, 42B include those having a colloidal structure, such as agarose; or a polymer mesh structure, such as gelatin; or a cross-linked polymer structure, such as polyacrylamide polymers and copolymers, silane free acrylamide (SFA), or an azidolyzed version of SFA. Examples of suitable polyacrylamide polymers may be synthesized from acrylamide and an acrylic acid or an acrylic acid containing a vinyl group, or from monomers that form [2+2] photo-cycloaddition reactions. Still other examples of suitable materials for the polymeric hydrogel/functionalized layer(s) 28 or 28A, 28B or the functionalized layer pads 42A, 42B include mixed copolymers of acrylamides and acrylates. A variety of polymer architectures containing acrylic monomers (e.g., acrylamides, acrylates etc.) may be utilized in the examples disclosed herein, such as branched polymers, including dendrimers (e.g., multi-arm or star polymers), star-shaped or star-block polymers, and the like. For example, the monomers (e.g., acrylamide, acrylamide containing the catalyst, etc.) may be incorporated, either randomly or in block, into the branches (arms) of a dendrimer.
[0144] The gel material for the polymeric hydrogel/functionalized layer(s) 28 or 28A, 28B or the functionalized layer pads 42A, 42B may be formed using any suitable copolymerization process, such as nitroxide mediated polymerization (NMP), reversible addition-fragmentation chain-transfer (RAFT) polymerization, etc.
[0145] The attachment of the polymeric hydrogel/functionalized layer(s) 28 or 28A, 28B or the functionalized layer pads 42A, 42B to the underlying component (e.g., substrate 14, layer 20, or triangular prism 44) may be through covalent bonding. In some instances, the underlying base support 14 or layer 20 may first be activated, e.g., through silanization or plasma ashing. Covalent linking is helpful for maintaining the primer set(s) 50 or 30, 31 in the desired regions throughout the lifetime of the flow cell 10 during a variety of uses.
[0146] In some of the examples disclosed herein, the polymeric hydrogel/functionalized layer(s) 28A, 28B or the functionalized layer pads 42A, 42B are chemically the same, and some of the techniques disclosed herein may be used to immobilize the primer sets 30, 31 to the desired layer 28A or 28B, and/or pad 42A or 42B. In other examples disclosed herein, the polymeric hydrogel/functionalized layer(s) 28A, 28B or the functionalized layer pads 42A, 42B are chemically different (e.g., include different functional groups for respective primer set 30, 3B attachment), and some of the techniques disclosed herein may be used to immobilize the primer sets 30, 31 to the desired layer 28A or 28B, and/or pad 42A or 42B. In other examples disclosed herein, the materials applied to form the polymeric hydrogel/functionalized layer(s) 28A, 28B or the functionalized layer pads 42A, 42B may have the respective primer sets 30, 31 pre-grafted thereto, and thus the immobilization chemistries of the layers 28A, 28B or of the pads 42A, 42B may be the same or different.
[0147] Each of the architectures also includes the primer set(s) 50 or 30, 31 attached to the polymeric hydrogel/functionalized layer(s) 28 or 28A, 28B or pads 42A, 42B.
[0148] The primer set 50 includes two different primers that are used in sequential paired end sequencing. As examples, the primer set 50 may include P5 and P7 primers, P15 and P7 primers, or any combination of the PA primers, the PB primers, the PC primers, and the PD primers set forth herein. As examples, the primer set 50 may include any two PA, PB, PC, and PD primers, or any combination of one PA primer and one PB, PC, or PD primer, or any combination of one PB primer and one PC or PD primer, or any combination of one PC primer and one PD primer.
[0149] Examples of P5 and P7 primers are used on the surface of commercial flow cells sold by Illumina Inc. for sequencing, for example, on HISEQ?, HISEQX?, MISEQ?, MISEQDX?, MINISEQ?, NEXTSEQ?, NEXTSEQDX?, NOVASEQ?, ISEQ?, GENOME ANALYZER?, and other instrument platforms. The P5 primer (shown as a cleavable primer due to the cleavable nucleobase uracil) is:
TABLE-US-00001 P5:5.fwdarw.3 (SEQ.ID.NO.1) AATGATACGGCGACCACCGAGAUCTACAC
The P7 primer (shown as cleavable primers) may be any of the following:
TABLE-US-00002 P7#1:5.fwdarw.3 (SEQ.ID.NO.2) CAAGCAGAAGACGGCATACGAnAT
where n is 8-oxoguanine;
TABLE-US-00003 P7#2:5.fwdarw.3 (SEQ.ID.NO.3) CAAGCAGAAGACGGCATACnAGAT
where n is 8-oxoguanine;
TABLE-US-00004 P7#3:5.fwdarw.3 (SEQ.ID.NO.4) CAAGCAGAAGACGGCATACGAUAT; or P7#4:5.fwdarw.3 (SEQ.ID.NO.5) CAAGCAGAAGACGGCATACUAGAT.
The P15 primer (shown as a cleavable primer) is:
TABLE-US-00005 P15:5.fwdarw.3 (SEQ.ID.NO.6) AATGATACGGCGACCACCGAGAnCTACAC
where n is allyl-T (a thymine nucleotide analog having an allyl functionality).
The other primers (PA-PD, shown as non-cleavable primers) mentioned above include:
TABLE-US-00006 PA5.fwdarw.3 (SEQ.ID.NO.7) GCTGGCACGTCCGAACGCTTCGTTAATCCGTTGAG PB5.fwdarw.3 (SEQ.ID.NO.8) CGTCGTCTGCCATGGCGCTTCGGTGGATATGAACT PC5.fwdarw.3 (SEQ.ID.NO.9) ACGGCCGCTAATATCAACGCGTCGAATCCGCAACT PD5.fwdarw.3 (SEQ.ID.NO.10) GCCGCGTTACGTTAGCCGGACTATTCGATGCAGC
While not shown in the example sequences for PA-PD, it is to be understood that any of these primers may include a cleavage site, such as uracil, 8-oxoguanine, allyl-T, etc. at any point in the strand. Moreover, the P5, P7, and P15 primers may be made un-cleavable by eliminating the cleavage site (e.g., uracil, 8-oxoguanine, allyl-T, etc.) from the strand.
[0150] Each of the primers disclosed herein may also include a polyT sequence at the 5 end of the primer sequence. In some examples, the polyT region includes from 2 T bases to 20 T bases. As specific examples, the polyT region may include 3, 4, 5, 6, 7, or 10 T bases.
[0151] The 5 end of each primer may also include a linker (e.g., 68, 68 described in reference to
[0152] The primers sets 30, 31 used in simultaneously paired-end sequencing are related in that one set 30 includes an un-cleavable first primer and a cleavable second primer, and the other set includes a cleavable first primer and an un-cleavable second primer. These primer sets 30, 31 allow a single template strand to be amplified and clustered across both primer sets 30, 31, and also enable the generation of forward and reverse strands on adjacent functionalized layers 28A, 28B or pads 42A, 42B due to the cleavage groups being present on the opposite primers of the sets 30, 31. Examples of these primer sets 30, 31 will be discussed in reference to
[0153]
[0154] Each of the first primer sets 30A, 30B, 30C, and 30D includes an un-cleavable first primer 56 or 56 and a cleavable second primer 58 or 58; and each of the second primer sets 31A, 31B, 31C, and 31D includes a cleavable first primer 60 or 60 and an un-cleavable second primer 62 or 62.
[0155] The un-cleavable first primer 56 or 56 and the cleavable second primer 58 or 58 are oligonucleotide pairs, e.g., where the un-cleavable first primer 56 or 56 is a forward amplification primer and the cleavable second primer 58 or 58 is a reverse amplification primer or where the cleavable second primer 58 or 58 is the forward amplification primer and the un-cleavable first primer 56 or 56 is the reverse amplification primer. In each example of the first primer set 30A, 30B, 30C, and 30D, the cleavable second primer 58 or 58 includes a cleavage site 64, while the un-cleavable first primer 56 or 56 does not include a cleavage site 64.
[0156] The cleavable first primer 60 or 60 and the un-cleavable second primer 62 or 62 are also oligonucleotide pairs, e.g., where the cleavable first primer 60 or 60 is a forward amplification primer and the un-cleavable second primer 62 or 62 is a reverse amplification primer or where the un-cleavable second primer 62 or 62 is the forward amplification primer and the cleavable first primer 60 or 60 is the reverse amplification primer. In each example of the second primer set 31A, 31B, 31C, and 31D, the cleavable first primer 60 or 60 includes a cleavage site 64 or 66, while the un-cleavable second primer 62 or 62 does not include a cleavage site 64 or 66.
[0157] It is to be understood that the un-cleavable first primer 56 or 56 of the first primer set 30A, 30B, 30C, and 30D and the cleavable first primer 60 or 60 of the second primer set 31A, 31B, 31C, and 31D have the same nucleotide sequence (e.g., both are forward amplification primers), except that the cleavable first primer 60 or 60 includes the cleavage site 64 or 66 integrated into the nucleotide sequence or into a linker 68 attached to the nucleotide sequence. Similarly, the cleavable second primer 58 or 58 of the first primer set 30A, 30B, 30C, and 30D and the un-cleavable second primer 62 or 62 of the second primer set 31A, 31B, 31C, and 31D have the same nucleotide sequence (e.g., both are reverse amplification primers), except that the cleavable second primer 58 or 58 includes the cleavage site 64 integrated into the nucleotide sequence or into a linker 68 attached to the nucleotide sequence.
[0158] It is to be understood that when the first primers 56 and 60 or 56 and 60 are forward amplification primers, the second primers 58 and 63 or 58 and 62 are reverse primers, and vice versa.
[0159] The un-cleavable primers 56, 62 or 56, 62 may be any primers with a universal sequence for capture and/or amplification purposes, such as the P5 and P7 primers (without the respective cleavage sites) or any combination of the PA, PD, PC, PD primers (e.g., PA and PB or PA and PD, etc.). In some examples, the P5 and P7 primers are un-cleavable primers 56, 62 or 56, 62 because they do not include a cleavage site 64, 64, 66 (i.e., SEQ. ID. NOs. 1-5 without the uracil or 8-oxoguanine). It is to be understood that any suitable universal sequence can be used as the un-cleavable primers 56, 62 or 56, 62.
[0160] Examples of cleavable primers 58, 60 or 58, 60 include the P5 and P7 primers or other universal sequence primers (e.g., the PA, PB, PC, PD primers with cleavage sites) with the respective cleavage sites 64, 64, 66 incorporated into the respective nucleic acid sequences (e.g.,
[0161] Each primer set 30A and 31A or 30B and 31B or 30C and 31C or 30D and 31D is attached to a respective functionalized layer 28A, 28B or functionalized layer pad 42A, 42B. As described herein, the functionalized layers 28A, 28B or functionalized layer pads 42A, 42B may include different functional groups that can selectively react with the respective primers 56, 58 or 56, 58 or 60, 62 or 60, 62, or may include the same functional groups and the respective primers 56, 58 or 56, 58 or 60, 62 or 60, 62 may be sequentially attached as described in some of the methods.
[0162] While not shown in
[0163] The PX capture primers may be:
TABLE-US-00007 PX5.fwdarw.3 (SEQ.ID.NO.11) AGGAGGAGGAGGAGGAGGAGGAGG CPX (PX)5.fwdarw.3 (SEQ.ID.NO.12) CCTCCTCCTCCTCCTCCTCCTCCT
[0164]
[0165] In the example shown in
[0166] Also, in the example shown in
[0167] In the example shown in
[0168] Examples of suitable linkers 68, 68 may include nucleic acid linkers (e.g., 10 nucleotides or less) or non-nucleic acid linkers, such as a polyethylene glycol chain, an alkyl group or a carbon chain, an aliphatic linker with vicinal diols, a peptide linker, etc. An example of a nucleic acid linker is a polyT spacer, although other nucleotides can also be used. In one example, the spacer is a 6T to 10T spacer. The following are some examples of nucleotides including non-nucleic acid linkers with terminal alkyne groups (where B is the nucleobase and oligo is the primer):
##STR00015## ##STR00016## ##STR00017##
[0169] In the example shown in
[0170] The example shown in
[0171] The example shown in
[0172] In any of the examples using the primer set 50 or the primer sets 30, 31, the attachment of the primers to the layer 18, layers 28A, 28B, or the pads 42A, 42B leaves a template-specific portion of the primers free to anneal to its cognate template and the 3 hydroxyl group free for primer extension.
[0173] Different methods may be used to generate the flow cell architectures disclosed herein. The various methods will now be described.
[0174] Methods
[0175] Each of the examples methods disclosed herein utilizes angled deposition to directionally deposit one or more layers (e.g., sacrificial layer, polymeric hydrogel/functionalized layer 28A, 28B). Using angled deposition, the material is deposited to the desired surface with high precision and accuracy. As such, clean up techniques, such as polishing, do not have to be used for the specific material.
[0176] Methods for Forming the Architecture of
[0177] The example methods shown in the series of figures from
[0178] The methods shown in
[0179] In the example shown in
[0180] In one example, nanoimprint lithography is used to define the triangular prism 44. In this example, a working stamp is pressed into the single resin layer 20 while the material is soft, which creates an imprint of the working stamp features in the resin layer 20. In this example, each working stamp feature is a negative replica of the depressed triangular prism 44. The resin layer 20 may then be cured with the working stamp in place.
[0181] Curing may be accomplished by exposure to actinic radiation, such as visible light radiation or ultraviolet (UV) radiation, when a radiation-curable resin material is used; or by exposure to heat when a thermal-curable resin material is used. Curing may promote polymerization and/or cross-linking. As an example, curing may include multiple stages, including a softbake (e.g., to drive off any liquid carrier that may be used to deposit the resin) and a hardbake. The softbake may take place at a lower temperature, ranging from about 50? C. to about 150? C. The duration of the hardbake may last from about 5 seconds to about 10 minutes at a temperature ranging from about 100? C. to about 300? C. Examples of devices that can be used for softbaking and/or hardbaking include a hot plate, oven, etc.
[0182] After curing, the working stamp is released. This creates topographic features (e.g., the depressed triangular prism 44) in the resin layer 20.
[0183] Dry etching, a combination of gray scale lithography and dry etching, or silicon wet etching may be used to define the triangular prism 44. With gray scale lithography and dry etching, a photoresist and gray scale photo mask may be used to define the pattern of the triangular prism.
[0184] As depicted in
[0185] The material used to form the sacrificial layer 70 may be titanium, chromium, aluminum, gold, copper, or silicon nitride. In some examples, the material may be at least substantially pure (<99% pure). In other examples, molecules or compounds of the listed elements may be used. For example, oxides of any of the listed metals (e.g., aluminum oxide, zinc oxide, titanium dioxide, etc.) may be used, alone or in combination with the listed metal.
[0186] The first functionalized layer 28A is then applied over the sacrificial layer 70 and over the exposed surfaces of the resin layer 20. As depicted in
[0187] Referring specifically to
[0188] The second functionalized layer 28B is then selectively applied over the first of the two angularly offset and non-perpendicular surfaces 24B, as shown in
[0189] When the deposition of the second functionalized layer 28B is performed under high ionic strength, the second functionalized layer 28B does not deposit on or adhere to the first functionalized layer 28A. As such, the second functionalized layer 28B does not contaminate the first functionalized layer 28A.
[0190] The second functionalized layer 28B does attach to the exposed surfaces of the resin layer 20, e.g., the first angularly offset and non-perpendicular surface 24B and the portion of the planar surface 26 adjacent to the surface 24B, which has surface groups capable of attaching to the second functionalized layer 28B.
[0191] In the example shown in
[0192] The polishing process may be performed with a chemical slurry (including, e.g., an abrasive, a buffer, a chelating agent, a surfactant, and/or a dispersant). Alternatively, polishing may be performed with a solution that does not include the abrasive particles.
[0193] The chemical slurry may be used in a chemical mechanical polishing system to polish the planar surface 26. The polishing head(s)/pad(s) or other polishing tool(s) is/are capable of polishing the functionalized layers 28A, 28B that are present over the planar surface 26 while leaving the functionalized layers 28A, 28B in the depressed triangular prism 44 at least substantially intact. As an example, the polishing head may be a Strasbaugh ViPRR II polishing head. The polishing process can remove the functionalized layers 28A, 28B from the planar surface 26 without deleteriously affecting the underlying resin layer 20.
[0194] Cleaning and drying processes may be performed after polishing. The cleaning process may utilize a water bath and sonication. The water bath may be maintained at a relatively low temperature ranging from about 22? C. to about 30? C. The drying process may involve spin drying, or drying via another suitable technique.
[0195] While not shown, the method shown in
[0196] In other examples, the primers 56, 58 or 56, 58 are not pre-grafted to the functionalized layer 28A. In these examples, the primers 56, 58 or 56, 58 may be grafted after the functionalized layer 28A is applied (e.g., at
[0197] When grafting is performed during the method, grafting may be accomplished using any suitable grafting technique. As examples, grafting may be accomplished by flow through deposition (e.g., using a temporarily bound lid), dunk coating, spray coating, puddle dispensing, or by another suitable method. Each of these example techniques may utilize a primer solution or mixture, which may include the primer set 30 or 31, water, a buffer, and a catalyst. With any of the grafting methods, the primer sets 30 or 31 attach to the reactive groups of the functionalized layer 28A, 28B, and have no affinity for the planar surface 26. As such, the planar surface 26 that surrounds each of the depressed triangular prisms 44 defines the interstitial regions of the patterned structure.
[0198] While a single set of the functionalized layers 28A, 28B is shown in
[0199] In the example shown in
[0200] As depicted in
[0201] The first functionalized layer 28A is then applied over the sacrificial layer 70 and over the exposed surfaces of the resin layer 20. As depicted in
[0202] In this example method, the triangular prism 44 is defined in the substrate 16 such that the two angularly offset and non-perpendicular surfaces 24A, 24B extend inward relative to the planar surface 26 of the substrate 16; and i) after the first functionalized layer 28A is deposited, the method further comprises forming an insoluble photoresist 72 over the first functionalized layer 28A over the second of the two angularly offset and non-perpendicular surfaces 24A (
[0203] The formation of the insoluble photoresist 72 is depicted in
[0204] The development of the negative photoresist 72 is also schematically depicted in
[0205]
[0206] In this example method, the first functionalized layer 28A and the sacrificial layer 70 are then removed from over the first of the two angularly offset and non-perpendicular surfaces 24B, as shown in
[0207] As shown in
[0208] After the second functionalized layer 28 is applied, the method further comprises removing the insoluble photoresist 72. Insoluble photoresist 72 removal is depicted in
[0209] The method shown in
[0210] While not shown, the method shown in
[0211] In other examples, the primers 56, 58 or 56, 58 are not pre-grafted to the functionalized layer 28A. In these examples, the primers 56, 58 or 56, 58 may be grafted after the functionalized layer 28A is applied (e.g., at
[0212] When grafting is performed during the method, grafting may be accomplished using of the grafting techniques disclosed herein.
[0213] While a single set of the functionalized layers 28A, 28B is shown in
[0214] The method shown in
[0215] In
[0216] The through-hole 76 is defined in an area of the mask layer 74 that overlies a portion of the substrate 14 where it is desirable to form the depressed triangular prism 44. An example shape for the through-hole 76 is circular.
[0217] In this example method, the triangular prism 44 is then defined by etching the substrate 14 through the through-hole 76 defined in the mask layer 74 positioned over the substrate 14. In this example, a wet etching process or an anisotropic etching process may be used. The substrate 14, an example of which is silicon, may then be wet etched (e.g., using KOH or another suitable etchant) or dry etched (e.g., chemical etch with XeF.sub.2 gas) through the through-hole 76. This etching process forms the depressed triangular prism 44, as shown in
[0218] In this example method, as shown in
[0219] As depicted in
[0220] As depicted in
[0221] The first functionalized layer 28A is then applied over the sacrificial layer 70 and over the exposed surfaces of the single layer substrate 14. As depicted in
[0222] Referring specifically to
[0223] The second functionalized layer 28B is then selectively applied over the portion 78 of the first of the two angularly offset and non-perpendicular surfaces 24A. The second functionalized layer 28B may be any of the gel materials described herein and may be applied using any suitable deposition technique under high ionic strength conditions (e.g., in the presence of 10?PBS, NaCl, KCl, etc.). A curing process, as described herein, may be performed after deposition. Because the deposition of the second functionalized layer 28B is performed under high ionic strength in this example, the second functionalized layer 28B does not deposit on or adhere to the first functionalized layer 28A. As such, the second functionalized layer 28B does not contaminate the first functionalized layer 28A. The second functionalized layer 28B does attach to the exposed portion 78 of the first angularly offset and non-perpendicular surface 24A, which has surface groups capable of attaching to the second functionalized layer 28B.
[0224] This example method further comprises polishing the first functionalized layer 28A and the second functionalized layer 28B from the planar surface 26 of the substrate 14. Polishing may be performed as described in reference to
[0225] While not shown, the method shown in
[0226] In other examples, the primers 56, 58 or 56, 58 are not pre-grafted to the functionalized layer 28A. In these examples, the primers 56, 58 or 56, 58 may be grafted after the functionalized layer 28A is applied (e.g., at
[0227] When grafting is performed during the method, grafting may be accomplished using any suitable grafting technique.
[0228] While a single set of the functionalized layers 28A, 28B is shown in
[0229] The example method shown in
[0230] As depicted in
[0231] The mask layer 74 may be applied and patterned to form the through-hole 76 as described in reference to
[0232] The single layer substrate 14 may be etched through the through-hole 76 as described in reference to
[0233] In this example, the first functionalized layer 28A is then angle deposited through the through-hole 76 and onto the first of the two angularly offset and non-perpendicular surfaces 24A. In this example, the angle deposition involves inkjet printing or microcontact printing the gel material (of the first functionalized layer 28A) through the through-hole 76. The gel material may be formulated with a viscosity that is suitable for the particular printing technique. The applied gel material may be cured to form the first functionalized layer 28A. The resulting structure is shown in
[0234] As depicted in
[0235] As depicted in
[0236] While not shown, the method shown in
[0237] In other examples, the primers 56, 58 or 56, 58 are not pre-grafted to the functionalized layer 28A. In these examples, the primers 56, 58 or 56, 58 may be grafted after the functionalized layer 28A is applied (e.g., at
[0238] When grafting is performed during the method, grafting may be accomplished using any suitable grafting technique.
[0239] While a single set of the functionalized layers 28A, 28B is shown in
[0240] Methods for Forming the Architecture of
[0241] The example method shown in the series of figures from
[0242] The method shown in
[0243] In the example shown in
[0244] In one example, nanoimprint lithography is used to define the triangular prism 44. In this example, a working stamp is pressed into the single resin layer 20 while the material is soft, which creates an imprint of the working stamp features in the resin layer 20. In this example, each working stamp feature is a negative replica of the protruding triangular prism 44. The resin layer 20 may then be cured with the working stamp in place as described in reference to
[0245] In another example, dry etching is used to define the triangular prism 44. Suitable dry etching conditions include a CF.sub.4 and O.sub.2 reactive ion etch or SF.sub.6 and O.sub.2 reactive ion etch.
[0246] After the protruding triangular prism 44 is formed, the sacrificial layer 80 is applied over the substrate 16 (e.g., over the resin layer 20). The sacrificial layer 80 may be any material that is susceptible to plasma etching conditions (to which the resin layer 20 is not susceptible) and that is soluble in an organic solvent. As examples, the sacrificial material 80 is a negative photoresist, a positive photoresist, poly(methyl methacrylate), or the like. Any examples of the negative photoresist set forth herein may be used for the sacrificial layer 80. Examples of suitable positive photoresists include the MICROPOSIT? S1800 series or the AZ? 1500 series, both of which are available from Kayaku Advanced Materials, Inc., or SPR?-220 (from DuPont). When a photoresist is used, it is exposed to desired conditions (e.g., UV exposure, no UV exposure) for developing the photoresist and rendering it insoluble in a developer.
[0247] The sacrificial material 80 may be applied using any suitable deposition technique disclosed herein (e.g., spin coating, etc.) and may be cured (e.g., using heating).
[0248] Referring now to
[0249] As shown in
[0250] The first functionalized layer 28A is then applied over the sacrificial layers 70, 80, and over the exposed surface of the resin layer 20, as depicted in
[0251] Referring specifically to
[0252] The second functionalized layer 28B is then selectively applied over the first of the two angularly offset and non-perpendicular surfaces 24A and over the sacrificial layer 80 that is adjacent to the angularly offset and non-perpendicular surfaces 24A. This is shown in
[0253] Referring specifically to
[0254] While not shown, the method shown in
[0255] In other examples, the primers 56, 58 or 56, 58 are not pre-grafted to the functionalized layer 28A. In these examples, the primers 56, 58 or 56, 58 may be grafted after the functionalized layer 28A is applied (e.g., at
[0256] When grafting is performed during the method, grafting may be accomplished using any suitable grafting technique.
[0257] While a single set of the functionalized layers 28A, 28B is shown in
[0258] Methods for Forming the Architecture of
[0259]
[0260] The method shown in
[0261] The method shown in
[0262] As shown in
[0263] Some example material combinations for the substrate 14/second layer 84/first layer 82 include silicon/silicon dioxide/silicon, nanoimprint lithography resin/nanoimprint lithography resist/nanoimprint lithography resin, or nanoimprint lithography resin/photoresist or poly(methyl methacrylate)/nanoimprint lithography resin.
[0264] In this example, defining the triangular prism 44 over the substrate 14 involves nanoimprinting or dry etching the triangular prism 44 in the first layer 82 positioned over the second layer 84 positioned over the substrate 14. In this example, nanoimprinting may be performed as described in reference to
[0265] The method then includes isotropically etching the second layer 84 to form a post 54 that supports the triangular prism 44 a spaced distance d from the planar surface 26 (of the substrate 14) and to expose a portion of the planar surface 26 adjacent to the post 54. This is shown in
[0266] Because the triangular prism 44 is not susceptible to this isotropic etching process, etching of the layer 84 initiates at the exposed surfaces 87, and because neither the triangular prism 44 nor the substrate 14 is susceptible to this isotropic etching process, etching of the layer 84 continues partially under the triangular prism 44. This undercuts the triangular prism 44 to form the post 54. As described herein in reference to
[0267] The method described in
[0268] The first functionalized layer 28A is then applied. The first functionalized layer 28A may be any of the gel materials described herein and may be applied and cured as described herein in reference to
[0269] In the example shown in
[0270] Referring now to
[0271] The second functionalized layer 28B is then selectively applied over the first of the two angularly offset and non-perpendicular surfaces 24A. This is depicted in
[0272] The second functionalized layer 28B attaches to the first angularly offset and non-perpendicular surface 24A and a portion of the planar surface 26 adjacent to the surface 24A, which has surface groups capable of attaching to the second functionalized layer 28B. The second functionalized layer 28B applied to the portion of the planar surface 26 adjacent to the surface 24A defines another functionalized layer pad 42B.
[0273] The method described in
[0274] In this example method, the triangular prism 44 is activated after the precursor adhesive component 86 is applied. The activation process should be selected so that it does not also activate the precursor adhesive component 86. In one example, the precursor adhesive component 86 is applied, and then the entire structure is exposed to plasma ashing. In this example, plasma ashing introduces OH groups on the second of the two angularly offset and non-perpendicular surfaces 24B and to a portion of the planar surface 26 that is adjacent to the second of the two angularly offset and non-perpendicular surfaces 24B, but does not affect the precursor adhesive component 86. In this particular example, the precursor adhesive component 86 is Ta.sub.2O.sub.5 and both the triangular prism 44 and the substrate 14 are a polyhedral oligomeric silsesquioxane based resin.
[0275] As illustrated in
[0276] This example method then includes activating the precursor adhesive component 86 to form an adhesive component 86 over the first of the two angularly offset and non-perpendicular surfaces 24A. In an example, the Ta.sub.2O.sub.5 precursor adhesive component 86 can be silanized to generate surface groups to react with the functionalized layer 28B. Silanization may be performed with norbornene silane, azido silane, alkyne functionalized silane, amine functionalized silane, maleimide silane, or any other silane having functional groups that can attach the functionalized layer 28B. The adhesive component 86 (i.e., the activated precursor) is shown in
[0277] Also shown in
[0278] Referring again to
[0279] While not shown, the methods described in reference to
[0280] In other examples, the primers 56, 58 or 56, 58 are not pre-grafted to the functionalized layer 28A or the functionalized layer pad 42A. In these examples, the primers 56, 58 or 56, 58 may be grafted after the functionalized layer 28A is applied (e.g., at
[0281] When grafting is performed during the method, grafting may be accomplished using any suitable grafting technique.
[0282] While a single set of the functionalized layers 28A, 28B and pads 42A, 42B are shown in
[0283]
[0284] In the examples shown in
[0285] Methods for Forming the Architecture of
[0286] The example method shown in the series of figures from
[0287] The method shown in
[0288] As shown in
[0289] Defining the triangular prisms 44A, 44B in the substrate 14 may involves nanoimprint lithography or dry etching, as described in reference to
[0290] As depicted in
[0291] The functionalized layer 28 is then applied over the sacrificial layer 70 and over the exposed surfaces of the substrate 14, including the surfaces 46 and the planar surface 26. This is depicted in
[0292] Referring specifically to
[0293] The previous description of the method of
[0294] While not shown, the method shown in
[0295] In other examples, the primers of the single primer set 50 are not pre-grafted to the functionalized layers 28. In these examples, the may be grafted after the functionalized layer 28 is applied (e.g., at
[0296] The surface 46, 48 of adjacent triangular prisms 44A, 44B form an active pair 52. More specifically, the surface 48 and the surface chemistry on the surface 46 (including the primer set 50 attached to the polymeric hydrogel/functionalized layer 28) forms an active pair 52. The reflective surface 48 of the active pair 52 can i) redirect and amplify excitation light E.sub.x introduced during sequencing, and ii) redirect and amplify emission signals E.sub.m generated from amplicons attached at the surface 46 during sequencing, as shown in
[0297] While a single active pair 52 is shown in
[0298] Methods for Forming the Architecture of
[0299] The example methods shown in
[0300] The methods shown in
[0301] In the example shown in
[0302] The depression 90 may have any desirable geometry, such as a cylinder, cube, rectangular prism, or the like. The dimensions of the depression 90 may be similar to the dimensions set forth herein for the multi-depth depression 32, except that the depression 90 has a single depth.
[0303] When the layer 92 is a photoresist, the depression 90 may be defined in the layer 92 by developing the photoresist so that removal of the soluble portion creates the depression 90. Alternatively, the depression 90 can be formed using nanoimprint lithography or dry etching. The substrate 14 may have a different etch rate than the layer 92, and thus may function as an etch stop when dry etching is used.
[0304] As depicted in
[0305] It is to be understood that any of the materials for the sacrificial layer 70 may be used, as long as the removal conditions of the sacrificial layer 70 and the layer 92 are orthogonal (i.e., the layer 92 is unaffected by the conditions used to remove the sacrificial layer 70). As examples, the layer 92 may be a negative photoresist that can be lifted off in a remover such as dimethylsulfoxide (DMSO) with sonication, an acetone wash, or an NMP (N-methyl-2-pyrrolidone) based stripper wash, and the sacrificial layer 70 may be aluminum that can be removed in acidic or basic conditions or copper that can be removed using FeCl.sub.3.
[0306] The functionalized layer 28A is then applied, as shown in
[0307] Referring specifically to
[0308] The second functionalized layer 28B is then applied. The second functionalized layer 28B may be any of the gel materials described herein. In the example shown in
[0309] The layer 92 may then be removed. The structure may be exposed to a remover that will dissolve or otherwise lift off the layer 92 without removing the functionalized layers 28A, 28B that are attached to the substrate 14. Example negative photoresist, positive photoresist, or nanoimprint lithography resist removers include acetone, DMSO, or NMP (or any of the other examples set forth herein). When the functionalized layer 28B is applied over the layer 92, these portions of the functionalized layer 28B will be removed along with the layer 92. In this example, the functionalized layers 28A, 28B are in the form of functionalized layer pads 42A, 42B positioned on the planar surface 26 of the substrate 14, as shown in
[0310] While not shown, the method shown in
[0311] In other examples, the primers 56, 58 or 56, 58 are not pre-grafted to the functionalized layer 28A. In these examples, the primers 56, 58 or 56, 58 may be grafted after the functionalized layer 28A is applied (e.g., at
[0312] When grafting is performed during the method, grafting may be accomplished using any suitable grafting technique.
[0313] While a single set of functionalized layers 28A, 28B/pads 42A, 42B is shown in
[0314] The method illustrated in
[0315] In this example, defining the depression 90 over the substrate 14 begins with nanoimprinting or dry etching the depression 90 in the first layer 92 positioned over the second layer 94 positioned over the substrate 14. In this example, nanoimprinting may be performed as described herein. Alternatively, the depression 90 may be dry etched in the first layer 92. As examples, etching of the first layer 92 may involve an anisotropic oxygen plasma, a CF.sub.4 plasma, or a mixture of 90% CF.sub.4 and 10% O.sub.2 plasma. When the first layer 92 is silicon dioxide, it may be dry etched using a CHF.sub.3 and O.sub.2 and Ar reactive ion etch. The formation of the depression 90 exposes a surface 100 of the underlying second layer 94, as shown in
[0316] Defining the depression 90 continues with isotropically etching the second layer 94 to extend the depression down to the planar surface 26 of the substrate 14. This is shown in
[0317] As depicted in
[0318] It is to be understood that any of the materials for the sacrificial layer 70 may be used, as long as the removal conditions of the sacrificial layer 70 and the layer 94 are orthogonal (i.e., the layer 94 is unaffected by the conditions used to remove the sacrificial layer 70). As examples, the layer 94 may be a cured negative photoresist, a cured positive photoresist, or cured poly(methyl methacrylate), each of which can be lifted off in a remover such as dimethylsulfoxide (DMSO) with sonication, an acetone wash, or an NMP (N-methyl-2-pyrrolidone) based stripper wash; and the sacrificial layer 70 may be aluminum that can be removed in acidic or basic conditions or copper that can be removed using FeCl.sub.3.
[0319] The functionalized layer 28A is then applied, as shown in
[0320] Referring specifically to
[0321] The second functionalized layer 28B is then applied. The second functionalized layer 28B may be any of the gel materials described herein. In the example shown in
[0322] The layer 94 may then be removed. The structure may be exposed to a remover that will dissolve or otherwise lift off the layer 94 without removing the functionalized layers 28A, 28B that are attached to the substrate 14. The removal of the layer 94 will also remove the layer(s) positioned thereon, such as layer 92 and, in some instances, layer 28B. The removal of layer 94 leaves the functionalized layers 28A, 28B in the form of functionalized layer pads 42A, 42B positioned on the planar surface 26 of the substrate 14, as shown in
[0323] While not shown, the method shown in
[0324] In other examples, the primers 56, 58 or 56, 58 are not pre-grafted to the functionalized layer 28A. In these examples, the primers 56, 58 or 56, 58 may be grafted after the functionalized layer 28A is applied (e.g., at
[0325] When grafting is performed during the method, grafting may be accomplished using any suitable grafting technique.
[0326] While a single set of functionalized layers 28A, 28B/pads 42A, 42B is shown in
[0327] Methods for Forming the Architecture of
[0328] The example method shown in
[0329] The method shown in
[0330]
[0331] While one multi-depth depression 32 is shown in
[0332] The method then includes angle depositing the metal film 102 on at least a portion of a sidewall 104 of the multi-depth depression 32 that is adjacent to the deep portion 34. Examples of suitable materials for the metal film 102 include semi-metals, such as silicon, or metals, such as aluminum, copper, titanium, gold, silver, etc. In some examples, the semi-metal or metal may be at least substantially pure (<99% pure). In other examples, molecules or compounds of the listed elements may be used. For example, oxides of any of the listed semi-metals (e.g., silicon dioxide) or metals (e.g., aluminum oxide) may be used, alone or in combination with the listed semi-metal or metal.
[0333] The metal film 102 is angle deposited as described in reference to
[0334]
[0335] The first functionalized layer 28A is then patterned. In an example, patterning the first functionalized layer 28A involves: forming the insoluble photoresist 72 over the first functionalized layer 28A; and timed dry etching the insoluble photoresist 72 and the first functionalized layer 28A until the portion 108 of the first functionalized layer 28A in the deep portion 34 is covered by the region 110 of the insoluble photoresist 72, and portions of the first functionalized layer 28A in the shallow portion 36, over some of the metal film 102, and over the interstitial region 106 are removed.
[0336]
[0337] Referring now to
[0338] This dry etching process is performed for a measured amount of time to expose the desired film/surface/region. In one example, the timed dry etch may involve a reactive ion etch (e.g., with 10% CF.sub.4 and 90% O.sub.2) where the insoluble photoresist 72 and functionalized layer 28A are etched at a rate of about 17 nm/min. In another example, the timed dry etch may involve a 100% O.sub.2 plasma etch where the insoluble photoresist 72 and functionalized layer 28A are etched at a rate of about 98 nm/min. As shown in
[0339]
[0340] The region 110 of the insoluble photoresist 72 is then removed.
[0341]
[0342] In
[0343] While not shown, the method shown in
[0344] In other examples, the primers 56, 58 or 56, 58 are not pre-grafted to the functionalized layer 28A. In these examples, the primers 56, 58 or 56, 58 may be grafted after the functionalized layer 28A is applied (e.g., at
[0345] When grafting is performed during the method, grafting may be accomplished using any suitable grafting technique.
[0346] While a single multi-depth depression 32 is shown in
[0347] In any of the example methods used to generate the architectures of
[0348] Additional Notes
[0349] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail below (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appearing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein. It should also be appreciated that terminology explicitly employed herein that also may appear in any disclosure incorporated by reference should be accorded a meaning most consistent with the particular concepts disclosed herein.
[0350] Reference throughout the specification to one example, another example, an example, and so forth, means that a particular element (e.g., feature, structure, and/or characteristic) described in connection with the example is included in at least one example described herein, and may or may not be present in other examples. In addition, it is to be understood that the described elements for any example may be combined in any suitable manner in the various examples unless the context clearly dictates otherwise.
[0351] While several examples have been described in detail, it is to be understood that the disclosed examples may be modified. Therefore, the foregoing description is to be considered non-limiting.