Method for measuring mutation rate
11959131 ยท 2024-04-16
Assignee
Inventors
Cpc classification
G16B25/00
PHYSICS
G06F17/18
PHYSICS
G16B20/20
PHYSICS
C12Q1/6806
CHEMISTRY; METALLURGY
G16B25/20
PHYSICS
C12Q1/6806
CHEMISTRY; METALLURGY
International classification
C12Q1/6806
CHEMISTRY; METALLURGY
G06F17/18
PHYSICS
G16B20/00
PHYSICS
G16B20/20
PHYSICS
G16B25/00
PHYSICS
Abstract
The present invention relates to a method for measuring a mutation rate, comprising preparing a library for next generation sequencing (NGS). Accordingly, the present invention can measure the effect of drugs, radiation, gene composition, aging, and various stresses experienced by an individual, etc. on the occurrence of mutations in a subject sample, and thus can be used for testing, diagnosis, management and evaluation related to toxicity tests, medical tests, maintenance and management of health, etc.
Claims
1. A method of identifying mutation, the method comprising the following steps (1) to (6): (1) preparing a library of genome fragments for next generation sequencing (NGS), comprising the following steps (a) to (c): (a) preparing DNA-adaptor ligates for a plurality of genomic DNA by: (i) cleaving each genomic DNA with a restriction enzyme; and (ii) joining adaptors to both ends of each cleaved genomic DNA, each adaptor comprising at least a random sequence that distinguishes each adaptor molecule from another by genomic DNA origin, wherein each end of a cleavage site of the genomic DNA is joined by at least one adaptor; (b) obtaining amplification products by using the DNA-adaptor ligates prepared in step (a) as templates and performing a polymerase chain reaction (PCR) using a primer that binds to the 3 end of a nucleotide sequence of interest at a specific region of genomic DNA and a primer that binds to the 5 end of the adaptors; (b-2) using the amplification products of step (b) as a template and performing nested PCR using: (i) a forward primer that binds to all or part of a nucleotide sequence of the specific region of genomic DNA; and (ii) a reverse primer that binds to all or part of the adaptor except for the random sequences, to produce nested amplification products, and (c) performing a second PCR by using the nested amplification products prepared in step (b-2) as templates and a primer pair which binds to both ends of the templates to form genome fragments; (2) determining the sequence of each genome fragment included in the library through NGS; (3) grouping the amplification products into a number of n by aligning the amplification products prepared in step (c) based on n number of landmarks on a reference genome sequence; (4) selecting m.sub.i number of genome fragments for each group, wherein m.sub.i is the number of genome fragments selected in the ith landmark, by sub-grouping the amplification products constituting the group according to the random sequences, then selecting one genome fragment for each m.sub.i number of sub-groups; (5) determining one representative nucleotide sequence without mutations for each group by comparing the nucleotide sequences of m.sub.i number of genome fragments; and (6) determining a mutation when there is a nucleotide sequence different from the representative nucleotide sequence of each group among the m.sub.i genomic fragments of n groups.
2. The method of claim 1, wherein, in step (c), the primer pair consists of a first primer and a second primer, in which the second primer comprises a different molecular index for each template.
3. The method of claim 1, further comprising verifying an accumulated mutation rate (AMR) using the following Equation 1:
4. The method of claim 1, wherein, in step (6), if there is one genome fragment having a different nucleotide at the same position when m.sub.i is 10 or more, the nucleotide is regarded as a mutation.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
BEST MODE
(9) In order to achieve the object above, one aspect of the present invention provides a method for measuring a mutation rate of a genome, comprising the following steps (1) to (7): (1) preparing a library for next-generation sequencing (NGS), comprising the following steps (a) to (c): (a) preparing a DNA-adapter ligates by cleaving each genomic DNA having landmark sequences extracted from an individual with a restriction enzyme and joining the adapter comprising a part of random sequences that distinguishes one adaptor molecule from another to both ends of each cleaved genomic DNA; (b) obtaining an amplification product by using the DNA-adapter ligates prepared in step (a) as a template and performing PCR using a first primer, which binds to the 3 end of the landmark sequences, and a second primer, which binds to the 5 end of the adapter; and (c) performing PCR by using the amplification product prepared in step (b) as a template and a primer pair which binds to both ends of the template; (2) determining the sequence of each genome fragment included in the library through NGS; (3) grouping the amplification products into a number of n by aligning the amplification products prepared in step (c) based on n number of landmarks on a reference genome sequence; (4) selecting m.sub.i number of genome fragments for each group (wherein m.sub.i is the number of genome fragments selected in the i.sup.th landmark) by sub-grouping the amplification products constituting the group according to the random sequences, then selecting one genome fragment for each m.sub.i number of sub-groups: (5) determining one representative nucleotide sequence without mutations for each group by comparing the nucleotide sequences of m.sub.i number of genome fragments; (6) determining a total number (M) of mutations by judging a case where a genome fragment having a nucleotide sequence different from the representative nucleotide sequence of each group among the m.sub.i number of genome fragments of n number of groups as a mutation; and (7) calculating an accumulated mutation rate (AMR) using the following Calculation Equation 1.
(10)
(11) Step 1 provides a step of preparing a library for next-generation sequencing, comprising steps (a) to (c).
(12) As used herein, the term next-generation sequencing (NGS) is a high-speed analysis method for the nucleotide sequences of a genome, and can be used interchangeably with high-throughput sequencing, massive parallel sequencing, or second-generation sequencing.
(13) As used herein, the term library refers to a set of fragments of a gene obtained by cleavage with restriction enzymes, etc., and may be, but is not limited to, a set of fragments of a gene introduced into a vector. Specifically, in the present invention, the library may be prepared through the following steps (a) to (c), and the library may be used to measure the mutation rate.
(14) Step (a) provides a step of preparing a DNA-adapter ligates by cleaving each genomic DNA having landmarks extracted from an individual with a restriction enzyme and joining the adapter comprising a part of random sequences that distinguishes one adaptor molecule from another to both ends of each cleaved genomic DNA.
(15) As used herein, the term individual may refer to any animal, including humans, that requires the measurement of a mutation rate.
(16) Any method used in the art may be used as the method for extracting the genomic DNA from an individual without limitation.
(17) The term landmark refers to a specific nucleotide sequence to be distinguished from other nucleotide sequences in the genomic DNA. In one example, it may be a specific nucleotide sequence repeated in the genomic DNA. Specifically, it may be a LINE (long interspersed nuclear element)- or SINE (short interspersed nuclear element)-based repeating nucleotide sequence, or a nucleotide sequence repeated within the genome such as a specific restriction enzyme recognition site, but is not limited thereto. In addition, any nucleotide sequence capable of measuring a mutation rate of a specific region by being distinguished from other nucleotide sequences can be used without limitation.
(18) In one embodiment of the present invention, L1HS nucleotide sequence, which is a LINE-based repeating sequence, was used as a landmark for measuring the mutation rate.
(19) As used herein, the term adapter refers to a nucleotide sequence of a partial double-stranded structure used to obtain an amplification product containing all or part of a landmark and a nucleotide sequence of a restriction enzyme cleavage site, and it can bind to both ends of genomic DNA cleaved by a restriction enzyme. Specifically, the adapter may include a random sequence.
(20) One end of the adapter may include a sequence which complementarily binds to a genomic DNA region cleaved by a restriction enzyme.
(21) In addition, the adapter may include a nucleotide sequence capable of attaching a primer at the time of performing PCR in the step of preparing an amplification product for measuring the mutation rate.
(22) In one embodiment of the present invention, the genomic DNA of human white blood cells was cleaved with a DpnII restriction enzyme, and a DpnII adapter including a random sequence capable of binding to the cleavage site of the restriction enzyme was attached to the cleaved genomic DNA.
(23) Meanwhile, the adapter of the present invention may be one in which a phosphate group is bound at the 5 region to capture all of the complementary strands of the landmark DNA. In addition, in order to distinguish the complementary DNA strand, it may include one or more mismatch nucleotides in the double-stranded region of the adapter.
(24) That is, when only one strand of the landmark DNA is captured, it may be difficult to distinguish false positives caused by a chemical mutation occurring in a reaction, such as the library construction step, etc., and such a chemical mutation cannot occur at the same position of the complementary strands of DNA at the same time. Thus, by using the adapter capable of capturing both strands of the landmark DNA, it is possible to remove the noise caused by the chemical mutation and to measure the mutation rate more accurately.
(25) In addition, a restriction enzyme that produces non-palindrome overhangs can be used to prevent binding between the adapters. The restriction enzyme may be, but is not limited to, BstNI or AvaII restriction enzyme.
(26) As used herein, the term random sequence refers to any 5 to 11 nucleotides used to distinguish the origin of genomic DNA extracted from an individual, and may include a specific nucleotide sequence. The random sequence may bind to both ends of the genomic DNA cleaved by a restriction enzyme. Further, it shows a different nucleotide sequence for each genomic DNA origin, and thus, the mutation rate according to the respective origin of the genomic DNA may be easily measured when measuring the mutation rate from an amplification product. The random sequence may be located in a single strand part of the partial double-stranded structure of the adapter, but is not limited thereto.
(27) In one embodiment of the present invention, any seven nucleotides were used as a random sequence.
(28) As used herein, the term DNA-adapter ligates refers to a construct in which the genomic DNA cleaved by the restriction enzyme and the adapter are ligated, and is used as a template for amplification in order to measure the mutation rate. Specifically, the ligates may include a random sequence, for example the random sequence may be located between the genomic DNA and the adapter.
(29) Step (b) provides a step (b-1) of obtaining an amplification product by using the DNA-adapter ligates prepared in step (a) as a template and performing PCR using a first primer, which binds to the 3 end of the landmark, and a second primer, which binds to the 5 end of the adapter.
(30) The first primer is a primer that binds to the 3 end of the landmark, and the second primer is a primer that binds to the 5 end of the adapter. When performing PCR using the primers, the primers serve to capture the nucleotide sequence downstream to the 3 region of the landmark.
(31) As used herein, the term amplification product refers to a product of PCR performed using a first primer and a second primer, and may include a landmark, a random sequence, a genome fragment, and an adapter. Specifically, the amplification product may include all or part of the sequence of the landmark, and may include all or part of the sequence of the adapter, but is not limited thereto.
(32) As used herein, the term genome fragment is a sequences including the genomic DNA as a target for the measurement of the mutation rate, and can bind to a landmark and a random sequence to be distinguished from other genomic DNAs. Specifically, the genome fragment may include at least one nucleotide, and may include all or part of the genomic DNA cleavage site by the restriction enzyme in step (a).
(33) In one embodiment, amplification products were obtained by using the DNA-adapter ligates including the genomic DNA cleaved by the restriction enzyme, the random sequence and the adapter, and performing PCR using a first primer, which binds to the 3 end of the L1HS landmark, and a second primer, which binds to the 5 end of the adapter.
(34) Step (b) may further include a step (b-2) of performing nested PCR by using the amplification product prepared above as a template and using a forward primer, which binds to all or part of the nucleotide sequence of the landmark, and a reverse primer, which binds to all or part of the adapter except for the random sequence.
(35) As used herein, the term nested PCR refers to PCR for removing undesired amplification products using a first PCR amplification product as a template and specifically selecting only desired amplification products. Since the nested PCR can remove undesired amplification products, it can exhibit an effect of improving accuracy at the time of measuring the mutation rate in the present invention.
(36) In order to perform the nested PCR for removing undesired amplification products, the primers which bind to each of the landmark and the adapter for capturing a genome fragment can be used. Specifically, one of the primers may bind to all or part of the nucleotide sequence of the landmark, and the other primer may bind to all or part of the nucleotide sequence of the adapter.
(37) Further, the primers may be primers having additional nucleotide sequences suitable for next-generation sequencing, but are not limited thereto.
(38) Step (c) provides a step of performing PCR by using the amplification product prepared in step (b) as a template and a primer pair which binds to both ends of the template.
(39) The primer pair of step (c) may bind to both ends of the amplification product prepared in step (b). The primer pair may consist of a first primer, and a second primer including a different index for each template, and thus can be used to distinguish the library of the amplification products. Specifically, the different index for each template may be a conventional index that is generally used in next-generation sequencing. In addition, the primer pair may be a primer pair having additional nucleotide sequences suitable for next-generation sequencing.
(40) In one embodiment of the present invention, a library for NGS was prepared by using the primer pair including nucleotide sequences suitable for next-generation sequencing (
(41) Step 2 provides a step of determining the sequence of each genome fragment constituting the library through NGS.
(42) The terms genome fragment and NGS are the same as described above.
(43) The sequences of the genome fragments can be analyzed using a sequencer used for next-generation sequencing, and any sequencer can be used without limitation as long as it is a device commonly used in next-generation sequencing.
(44) The library may have additional nucleotide sequences suitable for next-generation sequencing added through step (c), and thus can be easily used in next-generation sequencing.
(45) Step 3 provides a step of grouping the amplification products into a number of n by aligning the amplification products prepared in step (c) based on n number of landmarks on a standard genome sequence.
(46) Specifically, step 3 is a step of aligning the amplification products prepared in step (c) including the genomic DNA isolated from an individual on the reference genome sequence, wherein the alignment of the amplification products is carried out by aligning the products based on one or more landmarks and grouping into the number of landmarks.
(47) As used herein, the term reference genomic sequence refers to a general or average genomic sequence of a specific individual, and refers to a nucleotide sequence of a genome to be used as a reference when comparing various types of genetic factors, etc. of individual genomic sequences. In the present invention, the reference genomic sequence employs the same nucleotide sequence of an individual as that of the genome fragment, which is a target for the measurement of the mutation rate, and thus can be easily used in the measurement of the mutation rate for each landmark, as the landmarks between the reference genomic sequence and the genome fragment are identical.
(48) Step 4 provides a step of selecting m.sub.i number of genome fragments for each group by sub-grouping the amplification products constituting the group according to the random sequences, then selecting one genome fragment for each m.sub.i number of sub-groups, wherein m.sub.i is the number of genome fragments selected in the i.sup.th landmark.
(49) Specifically, in step 4, the m.sub.i number of genome fragments may be selected for each group by sub-grouping the amplification products according to the random sequences in each group, which is grouped in step 3, followed by selecting one genome fragment for each sub-group.
(50) When one genome fragment is selected for each sub-group, it is possible to select genome fragments having the same sequences as the matching nucleotide sequences of the sub-grouped amplification products according to each random sequence, and when one genome fragment in the same random sequence is supported by 5 or more of the amplification products, the selected genome fragments may be considered valid.
(51) Step 5 provides a step of determining one representative nucleotide sequence without mutations for each group by comparing the nucleotide sequences between the m.sub.i number of genome fragments, and step 6 provides a step of determining a total number (M) of mutations by judging a case where a genome fragment having a nucleotide sequence different from the representative nucleotide sequence of each group among the m.sub.i number of genome fragments of n number of groups as a mutation.
(52) Specifically, a representative nucleotide sequence without mutations can be determined by aligning the nucleotide sequences of the m.sub.i number of genomic fragments, which are distinguished by different random sequences, while belonging to the same landmark, and the representative nucleotide sequence and the sequences of the genome fragments can be compared. In a case where there are 10 or more genome fragments having different random sequences arranged in the same landmark, when there is one genome fragment having a different nucleotide, it is classified as a mutation, and when there are two or more genome fragments, it is classified as a polymorphism, and accordingly, the total number of mutations can be determined.
(53) Step 7 provides a step of calculating an accumulated mutation rate (AMR) using the following Calculation Equation 1.
(54)
In the Calculation Equation 1, AMR represents accumulated mutation rate, M represents the total number of mutations; m.sub.i represents the number of genome fragments selected in the i.sup.th landmark; and l.sub.i represents the number of nucleotides whose sequences are determined and analyzed among the genome fragments of the i.sup.th landmark.
(55) In one embodiment of the present invention, the total number of mutations was determined from 28 samples of human white blood cells through steps (1) to (6), and the mutation rate was calculated using Calculation Equation 1 above. As a result, it was confirmed that in the 28 samples, 0.2 to 2.1 mutations were found in every 10,000 nucleotides, and an average of 0.9 mutations occurred therein (
MODE FOR INVENTION
(56) Hereinafter, the action and effect of the present invention will be described by way of Examples. However, these Examples are provided for illustrative purposes only, and the scope of the invention is not intended to be limited by these Examples.
Example 1: Construction of DNA Sequence Library of Genome Fragments
(57) 28 samples of genomic DNA of human w % bite blood cells deposited under KDC (Korean medicine Data Centre) were obtained from the Korea Institute of Oriental Medicine, and a DNA sequence library of the genome fragments was constructed in the same manner as in
(58) Specifically, 200 ng of genomic DNA for each sample was cleaved by DpnII restriction enzyme at 37? C. for 2 hours and then purified with a PCR purification kit and dissolved in 30 ?L of elution buffer, 50 ng of each cleaved genomic DNA and 16 pmol of an adapter, which is a hybridized partially double-stranded DNA of SEQ ID NO: (5-3: GAGCAGGTGACTCTGGCTTCCTACACGACGCTCTTCCGATCTNNNNNNNCACCCACA CTTGACC) including a random sequence and SEQ ID NO: 2 (5-3: AATTGGTCAAGTGTGGGTG), which forms an overhang capable of binding to the DpnII cleavage site by complementary binding to the 3 end of SEQ ID NO: 1, were mixed in an aqueous solution containing 400 U of DNA ligase (Solgent) and 1? buffer, and reacted at room temperature for 1 hour. The adapter was attached to the cleavage site obtained by the restriction enzyme through the above reaction, purified with a PCR purification kit, and dissolved in 30 ?L of elution buffer. 1 ?L, 2 ?L, and 4 ?L of each DNA to which the adapter was attached was taken to be used as a template for PCR reaction, and PCR was carried out using an L1_C primer of SEQ ID NO: 3, which binds to the 3 region of L1HS, and an A_C primer of SEQ ID NO: 4, which binds to the 5 region based on the adapter, under the conditions shown in Table 1 below. At this time, the extension reaction of the 3 region performed at 68? C. for 10 minutes is a step for filling the single strand region of the adapter so that both strands can be used as a template for the amplification reaction in the subsequent PCR reaction, and it may be carried out as an independent reaction by using another DNA polymerase.
(59) Meanwhile, the primers are as shown in Table 2.
(60) TABLE-US-00001 TABLE 1 Temperature (? C.) Time Note 68 10 min 3 extension reaction 95 (denaturation) 20 sec Repeated for 20 cycles 58 (annealing) 20 sec 68 (extension) 2 min 68 8 min
(61) TABLE-US-00002 TABLE2 Typesof primers Nucleotidesequence(5-3) L1_Cprimer GGGAGATATACCTAATGCTAGATGACAC(SEQID NO:3) A_CPrimer GAGCAGGTGACTCTGGCTT(SEQIDNO:4)
(62) 1 ?L of the amplification product of the genome fragment obtained as a result of the PCR was taken to be used as a template for the subsequent nested PCR, and the nested PCR was carried out using an L1_N primer of SEQ ID NO: 5, which binds to the 5 end of the amplification product, and an A_N primer of SEQ ID NO: 6, which binds to the 3 end, under the same conditions as shown in Table 1. A sequence library for NGS was constructed using an NGS_F primer of SEQ ID NO: 7 and an NGS_R primer of SEQ ID NO. 8 under the same conditions as shown in Table 1 by taking 0.1 ?L of the amplification product obtained as a result of the nested PCR and attaching nucleotide sequences necessary for NGS (next-generation sequencing) to both ends of the amplification product (
(63) The amplification product and the constructed library were subjected to electrophoresis on 2% agarose gel. As a result, it was confirmed that they showed similar patterns, thereby confirming that it was possible to construct the library for properly measuring the mutation rate through the above method (
(64) TABLE-US-00003 TABLE3 Typesof primers Nucleotidesequence(5-3) L1_Nprimer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGC ACATGTACCCTAAAACTTAG(SEQIDNO:5) A_Nprimer CTACACGACGCTCTTCCGAT(SEQIDNO:6) NGS_Fprimer CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTG GAGTTCAGACGTGTG(SEQIDNO:7) NGS_Rprimer AATGATACGGCGACCACCGAGATCTACACTCTTTCCC TACACGACGCTCTTCCGATCT(SEQIDNO:8)
Example 2: NGS Measurement of Mutation Rate Through Data Analysis
(65) The nucleotide sequence of the amplification products of the library constructed in Example 1 was determined using a sequencer (HiSeq2000, Illumina). Among the sequences of amplification products, those contained no ambiguous nucleotide sequences and carry the nucleotide sequence necessary for NGS were selected, and then they were aligned to the reference genome sequence, independently arranged in the L1HS landmark, and grouped.
(66) The random sequences, which were used as a molecular index of the amplified products arranged in each landmark, were extracted and sub-grouped according to each template from which they were derived. Subsequently, the originated matching nucleotide sequences of the sub-grouped genome fragments were determined, and the genome fragments having the nucleotide sequences were selected. At this time, the matching nucleotide sequences were considered valid w % ben there were five or more amplification products in one random sequence.
(67) As a result of the sub-grouping, as an example, there were a total of 43,559 amplification products having the DNA of the F28 sample as an example, and they had 6,122 random sequences. In addition, the amplification products grouped in the 27.sup.th landmark of the L1HS among the amplification products were arranged on a positive strand having a size of 535 bp, ranging from 14584433 to 14584967 on the 1.sup.st chromosome, and was found to be ?17 bp away from L1HS having a size of 2,222 bp. Meanwhile, among random sequences as represented with numbers from 0 to 20, the first random sequence represented by 0 consisted of the sequence CAAAAAG, and there were 20 sequence reads (Read_0 to Read_19) sub-grouped according to the random sequence. Further, the second random sequence represented by 1 consisted of the sequence TGAGAAT, and it was confirmed that there were 19 sequence reads (Read_0 to Read 18) sub-grouped according to the random sequences (
(68) Meanwhile, the nucleotide sequences of the genome fragments defined by different random sequences while belonging to the same landmark were aligned with each other to determine a representative nucleotide sequence without mutations, and then this was compared with the nucleotide sequences of the genome fragments selected above. Specifically, in a case where there were 10 or more genome fragments having different random sequences arranged in the same landmark, when there was one genome fragment having a different nucleotide sequence, it was classified as a mutation, and when two or more genome fragments were present, this was classified as a polymorphism. As a result, as one example, the amplification products (CL_1484) grouped in the 1.484.sup.th landmark of the L1HS were arranged in a negative strand having a size of 115 bp, ranging from 49814618 to 49814732 on the 11.sup.th chromosome. The mutations occurred in a specific genome fragment among the sub-grouped genome fragments of the amplification products, and specifically, it was confirmed that the position of the specific nucleotide in which the mutations occurred could be found. Furthermore, it was confirmed that mutations occurred in 6 nucleotides among 558,026 nucleotides in a total of 8,905 amplification products (
(69) Meanwhile, as a result of the detailed analysis of the amplification products grouped in the 1,484.sup.th landmark of L1HS, it was confirmed that 15 nucleotide sequences among the nucleotide sequences of the genome fragments distinguished by 24 random sequences coincided with the representative nucleotide sequence (Con_15/24). In addition, it was confirmed that the mutation occurred in the 8.sup.th random sequence consisting of 6 amplification products, and the remaining nucleotide sequences were excluded from the analysis because either the number of amplification products did not reach 5, or some of the amplification products were inconsistent with the representative nucleotide sequence (
(70) The mutation rate was calculated using the following Calculation Equation 1 by calculating the number of genome fragments having different random sequences according to the analyzed landmarks, the total number of nucleotides included in the nucleotide sequences, and the total number of mutation events.
(71)
(72) As a result, it was confirmed that in the 28 samples, the mutation rate showed a distribution of 0.2 to 2.1 mutations in every 10,000 nucleotides and had an average of 0.9 mutations (
Example 3: Confirmation of Improvement of Accuracy on Measurement of Mutation Rate Using Modified Adapter
(73) The genomic DNA used in Example 1 was cleaved by AvaII restriction enzyme at 37? C. for 2 hours, and then purified in the same manner as in Example 1 and dissolved in the elution buffer. The cleaved genomic DNA was attached to the complementary binding site of the adapter through the same conditions and procedures as in Example 1, using the adapter in which the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 9 (5-3: GTCGGTCAAGTGTGGGTG) were complementarily bound such that the adapter could be attached to captured DNA by a ligation reaction since it includes one mismatched base pair and a phosphate bound to the 5 end, and that the AvaII restriction enzyme cleavage site was formed, and the resultant was purified and dissolved in the elution buffer (
(74) Using the same conditions and procedures as in Example 1, the DNA to which the adapter was attached was subjected to PCR amplification, and the library for NGS was constructed. As for the prepared library, the nucleotide sequences were determined and analyzed through the same process and procedure as in Example 2. The nucleotide sequences having the same random sequences were enumerated according to each landmark so as to identify the mismatched regions on nucleotide sequences 1 and 2 of the adapter, thereby confirming the complementary relationship of the double helix.
(75) Therefore, it was confirmed that by using the adapter modified as described above, only those mutations whose nucleotide sequences of the captured DNA having a mutually complementary relationship matched were selected as effective mutations, and thus, various mutations occurring in only one strand of the double helix could be distinguished during experimentation. As a result, it is confirmed that distortions caused by various types of noise generated during the experimentation were eliminated, thereby providing more accurate measurement values.
(76) While the present disclosure has been described with reference to the particular illustrative embodiments, it will be understood by those skilled in the art to which the present disclosure pertains that the present disclosure may be embodied in other specific forms without departing from the technical spirit or essential characteristics of the present disclosure. Therefore, the embodiments described above are considered to be illustrative in all respects and not restrictive. Furthermore, the scope of the present disclosure is defined by the appended claims rather than the detailed description, and it should be understood that all modifications or variations derived from the meanings and scope of the present disclosure and equivalents thereof are included in the scope of the appended claims.