SPIKE-IN REFERENCE STANDARD FOR USE IN DETECTING SAMPLE TARGET FROM DNA OR RNA ORGANISM
20240117451 ยท 2024-04-11
Inventors
- Shuwei Yang (Rockville, MD)
- Liancheng HUANG (Guangzhou, Guangdong, CN)
- Feifei FENG (Guangzhou, Guangdong, CN)
- Longwen SU (Guangzhou, Guangdong, CN)
- Kun LIN (Guangzhou, Guangdong, CN)
- Can TANG (Guangzhou, Guangdong, CN)
- Chen LIANG (Guangzhou, Guangdong, CN)
- Yuanmei WANG (Guangzhou, Guangdong, CN)
- Yanqing CAI (Guangzhou, Guangdong, CN)
- Yilin PANG (Guangzhou, Guangdong, CN)
- Chuan SHEN (Guangzhou, Guangdong, CN)
- Zhixue YU (Guangzhou, Guangdong, CN)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2740/15052
CHEMISTRY; METALLURGY
C12N2740/15043
CHEMISTRY; METALLURGY
C12Q2600/166
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/86
CHEMISTRY; METALLURGY
C12N2740/15022
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
Abstract
Positive reference spiked in collected sample for use in qualitatively and quantitatively detecting viral RNA.
Claims
1. A mock virus vector, wherein a viral (lentiviral or adenoviral is preferable) backbone is used as the vector; the lentiviral backbone contains one or more quantitative detection nucleic acid fragments and the coding gene of a fluorescent protein for tracking, the quantitative detection nucleic acid fragments has the same length as the nucleic acid target sequence of a test sample, and has the same percentage of base composition as the nucleic acid target sequence of the test sample; wherein the 5 end sequence A and 3 end sequence B of the quantitative detection nucleic acid fragment are the same as or different from the corresponding 5 end sequence A and 3 end sequence B of the nucleic acid target sequence of the test sample; the sequence A consists of a 5 end primer sequence for amplifying the nucleic acid target sequence of the test sample and two bases of the nucleic acid target sequence of the test sample directly downstream of the 5 end primer sequence; and the sequence B consists of a 3 end primer sequence for amplifying the nucleic acid target sequence of the test sample and two bases of the nucleic acid target sequence of test sample directly upstream of the 3 end primer sequence; the base sequence between the 5 end sequence A and 3 end sequence B of the quantitative detection nucleic acid fragment and the base sequence between the 5 end sequence A and 3 end sequence B of the nucleic acid target sequence of test sample are completely different (preferably, there is no subsequences having more than 3 contiguous bases, for example, 4, 5, 6, or 7 contiguous bases, preferably, 8-30 contiguous bases between the two base sequences after their alignment, are identical); preferably, the one or more quantitative detection nucleic acid fragments and the fluorescent proteins are connected by means of linkers; more preferably, the length of the linkers is 6-800 bp, preferably, 20-800 bp or 6-200 bp, preferably, the linkers contain transcriptional control elements, including but not limited to a CMV (promoter), an IRES (ribosome binding site).
2. The mock virus vector of claim 1, wherein the nucleic acid target sequence of test sample is derived from an organism, and the organism is selected from a virus, a bacterium, a fungus, a plant, an animal (including a lower animal and a higher animal, preferably, the lower animal includes but not limited to nematodes and drosophila, and the higher animal including but not limited to a salmon, a zebra fish, and a mammal, and more preferably, the mammal includes but not limited to a human, a gorilla, a monkey, and a mouse).
3. The mock virus vector of claim 2, wherein the virus is selected from the group consisting of DNA viruses (such as herpes simplex virus, hepatitis A virus, hepatitis B virus, human papilloma virus (HPV), and adenovirus) or RNA viruses (such as hepatitis C virus, human immunodeficiency virus, coronavirus, influenza virus such as avian influenza virus or swine influenza virus); the bacterium includes but not limited to one from tuberculosis, gonorrhea, anthracnose, syphilis, plague, trachoma, etc., and the fungus is selected from but not limited to the group consisting of mould, yeast, truffles and other mushrooms well-known to humans; preferably, the coronavirus is selected from the group consisting of SARS virus, MERS virus, and SARS-CoV-2 virus.
4. The mock virus vector of claim 3, wherein the length of the quantitative detection nucleic acid fragment is 80 bp-60 kb, preferably, 80 bp-19.5 kb, 80 bp-17.5 kb, 80 bp-1.5 kb, 80 bp-1 kb, 80 bp-500 bp, more preferably, 80 bp-200 bp, and the total length of the linker sequence between the quantitative detection nucleic acid fragments is not more than 8.5 kb, 8 kb or 7 kb.
5. The mock virus vector of claim 1, wherein the lentiviral vector is a lentivirus vector (preferably, pEZ-Lv201) or an FIV virus vector.
6. The mock virus vector of claim 1, wherein the lentiviral vector includes but not limited to second-generation or third-generation lentiviral vectors.
7. The mock virus vector of claim 1, wherein, when the nucleic acid of test sample derives from SARS-COV-2, the nucleic acid target sequence of test sample is at least two coding genes selected from the following coding genes group consisting of: full length Orflab coding gene or fragment thereof, full length S protein coding gene or fragment thereof, full length E protein coding gene or fragment thereof, and full length N protein coding gene or fragment thereof.
8. The mock virus vector of claim 7, wherein the quantitative detection nucleic acid fragment is one or more selected from the group consisting of: a detection target sequence 1 (corresponding to the fragment of Orflab coding gene of test sample) comprises or at least consists of sequences selected from SEQ ID NO: 1 to SEQ ID NO: 2 or a combination thereof, a detection target sequence 2 (corresponding to the fragment of S protein coding gene of test sample) comprises or at least consists of SEQ ID NO: 3; a detection target sequence 3 (corresponding to the fragment of E protein coding gene of test sample) comprises or at least consists of SEQ ID NO: 4; a detection target sequence 4 (corresponding to the fragment of N protein coding gene of test sample) comprises or at least consists of sequences selected from SEQ ID NO: 5 to SEQ ID NO: 8 or any combination thereof.
9. The mock virus vector of claim 8, wherein the sequence of the mock virus is shown in SEQ ID NO: 9.
10. A mock virus particle prepared by the mock virus vector of claim 1, preferably, the mock virus particle is prepared by transfecting the mock virus vector into a human 293T cell line.
11. Use of the mock virus vector of claim 1 in the following: (1) qualitative and quantitative detection of nucleic acid targets in samples; for example, an application for being used as a reference standard (qualitative determination, such as positive and negative determinations) for the presence of a nucleic acid target in a test sample (for example, from a patient with COVID-19, a carrier of SARS-CoV-2, a patient suspected of having COVID-19, or SARS-CoV-2 in a sample), for example, an application for quality analysis and quality control during processes of sample collection, sample storage, and sample RNA extraction; or for example, an application for quantitative detection of SARS-CoV-2 in a sample; (2) an application for preparing reagents or kits in detecting the nucleic acid target in the sample; (3) an application for evaluating, for example, a therapeutic effect on a patient carrying the nucleic acid target; (4) an application for evaluating or screening a drug for the treatment of a disease caused by the organism (for example, a cell, a virus or fungus).
12. A qualitative and quantitative reference standard RNA prepared by extracting the mock virus particle of claim 10, wherein the organism is an RNA virus.
13. The qualitative and quantitative reference standard RNA of claim 12, which is used as a reference standard in the process of reverse transcription from RNA to cDNA involved in the detection of RNA viruses such as SARS-CoV-2, for example, being used for quality analysis and quality control in a reverse transcription reaction system using RNA as a sample.
14. A qualitative and quantitative reference standard DNA, wherein the quantitative reference standard DNA is prepared by extracting the DNA of the mock virus particle of claim 10, wherein the genetic material of the organism is DNA.
15. The qualitative and quantitative reference standard DNA of claim 14, which is used for quality analysis and quality control of amplification efficiency and fluorescence signal in an DNA amplification process involved in a process of detecting an RNA virus (such as SARS-CoV-2) or a process of detecting an organism of which the genetic material is DNA.
16-23. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
DETAILED DESCRIPTION OF THE INVENTION
[0145] Although the present invention has described the specific embodiments, certain modifications and equivalents will be apparent to those skilled in the art and are intended to be included within the scope of the present invention.
[0146] The present invention is illustrated by the following Examples, which would not limit the present invention in any way.
Example 1: Construction Method of Recombinant Plasmid
[0147] 1. Experimental Materials
[0148] Reagents: DNA Polymerase (Gencopoeia, C0103A); primer Oligo (Invitrogen); cloning vector pEZ-Lv201 (Genecopoeia); Fast-Fusion? Cloning Kit (Gencopoeia, FFPC-C020); gel recovery kit (Omega); 2T1 competent (Genecopoeia, U0104A); STBL3 competent (Genecopoeia, U0103A); Restriction enzymes (Fermentas); DNA Ladder (Genecopoeia); E.Z.N.A.? Gel Extraction Kit (OMEGA); UltraPF? DNA Polymerase Kit (Genecopoeia, C0103A); E.Z.N.A.? Plasmid Mini Kit I (OMEGA); Endotoxin-Free Plasmid Mini/Middle Kit (Omega).
[0149] 2. Experimental Steps
[0150] In this Example, a coronavirus nucleic acid detection target sequence and a fluorescent protein gene sequence are inserted into a lentivirus vector, and the specific steps are as follows:
[0151] A. Design of the Vector [0152] 1. The backbone of the vector is shown in
[0154] The SARS-CoV-2-specific target orf1ab sequence fragment was cloned into a lentivirus clone vector.
[0155] The SARS-CoV-2-specific target orf1ab sequence was shown in SEQ ID NO: 1 [0156] 3. Construction steps
[0157] (1) Synthesis of SARS-CoV-2 Specific Target orf1ab Sequence Fragment
[0158] Primers for fragment synthesis in Table 1 were designed and synthesized according to the insert sequences
TABLE-US-00002 TABLE1 Primersforsynthesisofinsertionfragments PrimerID Sequences cCDC-orf1ab-PF1 CCCTCACTAAAGGGAGGAGAAGCATGTCGACGAATTCCTAATAC GACTCACTATAG(SEQIDNO:52) cCDC-orf1ab-PF2 GTGGCAACGGCAGTACAGACAACGATATCCTATAGTGAGTCGTA TTAGGAATTCG(SEQIDNO:53) cCDC-orf1ab-PF3 TGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTT TGTGACTTAAAAGGT(SEQIDNO:54) cCDC-orf1ab-PF4 CAAGTTGTAGGTATTTGTACATACTTACCTTTTAAGTCACAAAA TCCTTTAGGATTTG(SEQIDNO:55) cCDC-orf1ab-PF5 AGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTG TGGGTTTTACACTTA(SEQIDNO:56) cCDC-orf1ab-PF6 AATGACCCTGTGGGTTTTACACTTAAAATGCAGTTCCGAGCTCA CTCGACTCTCTGATC(SEQIDNO:57) cCDC-orf1ab-PF7 CCGAGCTCACTCGACTCTCTGATCAGACGATGGTTTTACTTATC ACCAAATCCGCGTAG(SEQIDNO:58) cCDC-orf1ab-PF8 ACGATTGTGCATCAGCTGACTACGATCTGCCTACGCGGATTTGG TGATAAGTAAAAC(SEQIDNO:59) cCDC-orf1ab-PF9 GTAGTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGT AAGTGCAGCCCGTCT(SEQIDNO:60) cCDC-orf1ab-PF10 CACATTCCACAGCTCGAGTGCCTGTGCCGCACGGTGTAAGACGG GCTGCACTTACACCG(SEQIDNO:61)
[0159] The primers in Table 1 were diluted to 50 pmol/?l, and then 1 ?l of each was taken and mixed evenly for later use;
[0160] PCR amplification of the insertion sequences: the insertion fragment M was amplified by using the primer mixture in Table 1 as a template, the cCDC-orf1ab-PF1+cCDC-orf1ab-PF10 as primers, and by using the reaction system in Table 2 and the reaction program in Table 3; electrophoresis detection results were shown in
[0161] Target sequence insertion fragment M of mock virus that can be spiked in for the detection of 2019-nCoV reference standards by such as NGS, RT-PCR methods were synthesized, the sequence of which was shown in SEQ ID NO: 46;
TABLE-US-00003 TABLE 2 PCR reaction system Reagent name 1 ? volume 5 ? UltraPF? Buffer 5 ?l dNTP (25 mM) 0.2 ?l Mg.sup.2+ (50 mM) 0.75 ?l UltraPF? DNA Polymerase (5 U/?l) 0.2 ?l Primer mix in Table 1 1 ?l Primer (5 pmol/L) 2 ?l ddH.sub.2O Added to 25 ?l
TABLE-US-00004 TABLE 3 PCR reaction procedure reaction temperature time Cycle numbers 98? C. 3 min 1 98? C. 20 sec 35 58? C. 30 sec 72? C. 1 min 72? C. 10 min 1
[0162] B. The Synthesized Insertion Fragment M was Cloned into a Vector of Interest
[0163] 1. Enzyme Cleavage of the Vector
[0164] The enzyme cleavage system was established according to Table 4. The cleavage product of the vector was recovered by E.Z.N.A.? Gel Extraction Kit from OMEGA.
TABLE-US-00005 TABLE 4 Enzyme cleavage system reagent Amount pEZ-Lv201 3 ?g 10 ? NEB buffer 4 ?l EcoRI (NEB) 0.4 ?l (10 ?/?l) XhoI (NEB) 0.4 ?l (10 ?/?l) ddH.sub.2O Added to 40 ?l
[0165] 2. Ligation of Synthesized Insertion Fragment M and Plasmid Vector
[0166] In-fusion reaction was performed with Fast-Fusion Cloning Kit. After the reaction, 5 ?l was taken to transform E. coli competent cells 2T1.
[0167] 3. Screening of Recombinant Gene Clones by PCR
[0168] Each PCR reaction system was added 16 ?l ddH2O and 1 ?l vector primers SEQ ID NO: 47 and SEQ ID NO: 48 (5 pmol/?l), and the PCR reaction procedure was shown in Table 5; the PCR products were detected by electrophoresis, and the detection results were shown in
TABLE-US-00006 TABLE 5 PCR Reaction Procedure reaction temperature time Cycle numbers 94? C. 3 min 94? C. 30 sec 25 Cycles 58? C. 30 sec 72? C. 2 min 72? C. 10 min
Example 2: Preparation of Lentivirus
[0169] After obtaining the recombinant lentivirus vector, recombinant lentiviral particles can be prepared.
[0171] 2. Experimental Steps
[0172] The preparation steps of lentivirus were as follows: [0173] 1. 293T (ATCC?CRL-3216?) cells were cultured in DMEM medium with 10% fetal bovine serum, under 5% CO.sub.2 at 37? C.; the recombinant plasmid prepared in Example 1 and a helper plasmid containing Gag-pol and Rev were co-transfected into cells according to the recommended procedure of Lenti-Pac? HIV lentivirus packaging kit; [0174] 2. After 12 h of transfection, the medium was replaced with fresh medium and cells were cultured for 24 h continuously; [0175] 3. Supernatant of cultured cells was collected, which contained lentivirus particles (named as LPP-WH-Fragment3-Lv201).
Example 3: Concentration of Lentivirus
[0176] 1. Experimental Materials
[0177] Reagents: Lentivirus Concentration Solution (6?) (GeneCopoeia, LT007), PBS (GeneCopoeia, PE002).
[0178] 2. Experimental Steps
[0179] 1). The supernatant containing lentivirus particles was collected from the tool cell culture plate or flask. The supernatant was centrifuged at 2000 g for 10 min at 4? C. to remove cell debris.
[0180] 2). The concentration reagent was purchased from GeneCopoeia (Lenti-Pac? Lentivirus Concentration Reagent, LT007). The lentivirus supernatant and concentration reagent were mixed at a ratio of lentivirus solution volume: concentration reagent volume=5:1 (directly adding the 6? stock solution of lentivirus concentration reagent), and then incubated at 0-4? C. for 2 h or more (or incubated overnight). During the stable storage period of lentivirus, appropriately prolonging the incubation period can improve the recovery rate of lentivirus. Note: the lentivirus can be stably stored for about 3 days at 0-4? C.
[0181] 3). After incubation, the mixture was centrifuged at 3500 g for 25 min at 4? C.
[0182] 4). After centrifugation, the supernatant was carefully aspirated and discarded, and the left pellet was lentivirus particles.
[0183] Note: the centrifuged pellet which is lentivirus particle should be avoided to be aspirated (in some cases, the pellet may not be visible).
[0184] 5). DMEM or PBS was taken in a volume of 1/10-1/100 the volume of the lentivirus supernatant collected in step 1 and used for concentration, and then the lentivirus pellet was resuspended by pipetting (for example, if the supernatant collected in step 1 was 10 mL, the amount of DMEM or PBS taken in this step was 0.1 mL-1 m).
[0185] NOTE: the pipetting should be performed gently when resuspending the lentivirus pellet.
[0186] 6). When the concentration operation of resuspended lentivirus solution was finished, it was stored at ?80? C. after aliquoting, and meanwhile a small amount of the concentrated lentivirus solution was taken to determine the titer.
Example 4: Quantification of Lentivirus
[0187] 1. Experimental Materials
[0188] Reagents: Medium (CORNING, 10-013-CV), Fetal Bovine Serum (Excell Bio, FSP500), PBS (GeneCopoeia, PE002), Trypsin (CORNING, 25-053-CI), Lenti-Pac? Lentivirus Titer Detection kit (GeneCopoeia, LT006), penicillin-streptomycin solution (HyClone), RNaseLock? RNase inhibitor.
[0189] 2. Experimental Steps
[0190] The lentivirus titer can be measured by four methods:
[0191] Method i: Detection of the physical titer of lentivirus by using a real-time fluorescence quantitative PCR instrument.
[0192] Method ii: Determination of the biological copy number (titer) of lentivirus by using a fluorescence microscopy cytometry.
[0193] Method iii: Determination of lentivirus biotiter by using flow cytofluorimetry.
[0194] Method iv: Detection of the copy number of lentivirus RNA by ddPCR method.
TABLE-US-00007 TABLE 6 Result comparison of the four methods: experimental method Method i Method ii Method iii Method iv final titer results of 1.96 ? 1.99 ? 6.35 ? 4.17 ? lentivirus (copies/ml) 10.sup.10 10.sup.10 10.sup.10 10.sup.10
[0195] Method i: Detection of the Physical Titer of Lentivirus by a Real-Time Fluorescence Quantitative PCR Instrument.
[0196] 1. RNA Extraction
[0197] RNA was extracted according to the molecular cloning experiment manual. Finally, 50 ?L of TE buffer was used to dissolve RNA precipitates (herein, the TE buffer was a 100 ?M TE buffer prepared from DEPC-treated water, which was used in the present invention to dissolve the RNA precipitate).
[0198] 2. Treatment with DNase I (Removal of Genome of a Free Cell and Plasmids)
[0199] DNase I reaction. The following reaction (total volume 25 ?L) was performed according to Table 7 by using a 1.5 mL tube:
TABLE-US-00008 TABLE 7 DNase I reaction system Reagent Amount DEPC treated water 1.5 ?L Lentiviral RNA 20.0 ?L DNase I buffer (10?) 2.5 ?L DNase I 1.0 ?L Total 25.0 ?L Incubation: 1) 37? C., 30-60 min; 2) 75? C., 10 min (to inactivate DNase I) Note: If the DNase I digestion step was omitted, a qPCR reaction using the unreverse-transcribed RNA sample as a template must be added as a control in the qPCR reaction step to determine the copy number of plasmid DNA carried in a sample (without subjected to DNase I digestion), wherein the copy number of RNA in the sample was obtained by subtracting the copy number of plasmid DNA determined by the control from the copy number determined by the qPCR reaction using the reverse transcribed product as a template.
[0200] 3. Reverse Transcription
[0201] RNA-Primer Mix was prepared according to Table 8, mixed evenly, incubated at 70? C. for 5 min, and then the centrifuge tube was placed on ice immediately to cool down.
TABLE-US-00009 TABLE 8 RNA and cDNA Synthesis Primer binding reaction system Reagent Amount RNA (digested by DNase I) 10.0 ?L cDNA Synthesis Primer (4.0 ?M) 5.0 ?L (final concentration 1.0 ?M) Note: The random primers in the kit (final concentration of 10 ?M in reverse transcription reaction solution) can be used in place of HIV cDNA Synthesis Primer. It was not necessary to use cDNA Synthesis Primers and random primers at the same time.
[0202] 1) The reverse transcription reaction system was prepared according to Table 9, and other components were added (total volume 20 ?L), and then incubated at 37? C. for 60 min.
TABLE-US-00010 TABLE 9 Reverse transcription reaction system Reagent Amount Reverse Transcription Buffer (10?) 2.0 ?L 25 mM dNTP 1.0 ?L RNaseLock? RNase inhibitor 1.0 ?L Reverse Transcription Enzyme 1.0 ?L Total 20.0 ?L
[0203] 2) 90? C., 10 minutes. The product can be directly used in qPCR detection experiments as a test sample, or stored at ?20? C.
[0204] 4. qPCR Reaction
[0205] 1) Preparation of Standard Curve Samples
[0206] Positive reference standard (obtained from the Lenti-Pac? Lentivirus Titer Assay Kit (GeneCopoeia, LT006) with a copy number of 1?10.sup.9 copies/?L) was diluted.
[0207] A standard curve was generated (2 ?L of each subsequent dilution gradient was used as a template for qPCR reaction). [0208] (1) Initial copy number: 1?10.sup.8 copies/?L (operation method: 5 ?L qPCR standard (DNA)+45 ?L ddH.sub.2O) [0209] (2) Initial copy number: 1?10.sup.7 copies/?L (operation method: 5 ?L {circle around (1)}+45 ?L ddH.sub.2O) [0210] (3) Initial copy number: 1?10.sup.6 copies/?L (operation method: 5 ?L {circle around (2)}+45 ?L ddH.sub.2O) [0211] (4) Initial copy number: 1?10.sup.5 copies/?L (operation method: 5 ?L {circle around (3)}+45 ?L ddH.sub.2O) [0212] (5) Initial copy number: 1?10.sup.4 copies/?L (operation method: 5 ?L {circle around (4)}+45 ?L ddH.sub.2O) [0213] (6) Initial copy number: 1?10.sup.3 copies/?L (operation method: 5 ?L {circle around (5)}+45 ?L ddH.sub.2O)
[0214] 2) qPCR Reaction System was Prepared According to Table 10 (Total Volume of 20 ?L):
TABLE-US-00011 TABLE 10 qPCR reaction system Reagent Amount qPCR Standard or cDNA Sample or ddH.sub.2O 2.0 ?L 2 ? All-in-One? qPCR Mix 10.0 ?L qPCR Primer Mix (2.5 ?M) 2.0 ?L ddH.sub.2O 6.0 ?L Total 20 ?L Note: (1) The components in the reaction system (except for the positive reference standard and sample) were premixed before divided into tubes. (2) Non-template control (NTC) group in the qPCR reaction was set. (3) For reference samples, 2 ?L was taken from each dilution tube: 3) qPCR reaction procedure
[0215] The reaction procedure of Table 11 was suitable for the Bio-Rad iQ5 real time PCR detection system. The melting curve procedure was shown in Table 12. Those skilled in the art can make routine fine-tuning depending on the detection system used.
TABLE-US-00012 TABLE 11 qPCR reaction procedure Cycle numbers Steps Temperature Duration 1 denaturation 95? C. 10 min 40 denaturation 95? C. 10 sec Annealing 60? C. 20 sec Extension 72? C. 15 sec
TABLE-US-00013 TABLE 12 Melting curve procedure Temperature Temperature interval Duration 72-95? C. 0.5? C. 6 sec/each 30? C. 30 sec
[0216] 4) Data Analysis
[0217] (1) After the qPCR reaction, the Ct value (amplification threshold cycle number) of each reference was read, and a standard curve with log (initial copy number) as the abscissa and Ct value as the ordinate was drawn, as shown in
[0218] Remarks for
[0219] (2) The Ct value of test sample was read and introduced into the standard curve formula (y=?3.4363x+35.451) in {circle around (1)} (shown in
[0220] (3) Copy number (copies/ml) of original sample was obtained by multiplying the above initial copy number by the dilution factor (wherein, the dilution factor was calculated by the following formula).
[0221] Note: [0222] (A) RNA volume: 50 ?L (according to this experimental procedure) [0223] (B) Original sample volume: lentivirus particle solution volume for RNA extraction, 10 ?l [0224] (C) DNase reaction volume: 25 ?L (according to this experimental procedure) [0225] (D) RNA volume in DNase reaction: 20 ?L (according to this experimental procedure) [0226] (E) RT reaction volume: 20 ?L (according to this experimental procedure) [0227] (F) RNA volume in RT reaction: 10 ?L (according to this experimental procedure) [0228] (G) cDNA volume in PCR reaction: 2 ?L (according to this experimental procedure)
[0229] (4) Each lentivirus particle contains two single-stranded positive-stranded RNA genomes, therefore, the number of lentivirus particles obtained should be ? of the copy number. Therefore, the physical titer of lentivirus particle number (copies/ml) is obtained by dividing the original sample copy number by 2. Table 13 shows a data sheet of the calculation process of the physical titer of lentivirus particles.
TABLE-US-00014 TABLE 13 Data sheet of the calculation process of the physical titer of lentivirus particles Ct value (amplification threshold cycle Log (initial initial copy physical titer Sample number) copy number) number (SQ) (copies/ml) 1 13.13 6.49 6.21E+06 1.96E+10
[0230] Method ii: Determination of the Biological Copy Number (Titer) of Lentivirus by Using a Fluorescence Microscopy Cytometry
[0231] Day 1: Culture of H1299 Cells (ATCC?CRL-5803?)
[0232] 1. A 24-well culture plate was used; 5?10.sup.4 cells and 0.5 mL of DMEM complete medium (supplemented with 10% heat-inactivated fetal bovine serum, penicillin-streptomycin) were respectively added to each well, and incubated overnight (about 24 h) in 5% CO.sub.2, at 37? C.
[0233] Day 2: Infection of H1299 Cells
[0234] 2. After 24 hours of cell culture, the culture medium was removed; 250 ?l of DMEM medium (supplemented with 10% heat-inactivated fetal bovine serum, penicillin-streptomycin solution), and the diluted lentivirus as shown in step 3 were sequentially added. Each lentivirus was added to 3 wells of culture plate.
[0235] 3. The lentivirus was fluorescently labeled and the detection titer could be determined by fluorescence microscopy cytometry. The lentivirus was inoculated in gradient firstly, and 0.03 ?L, 0.3 ?L, and 0.3 ?L of lentivirus stock solution were added to each well (triplicate wells for each lentivirus). Appropriate DMEM medium (supplemented with 10% heat-inactivated fetal bovine serum, penicillin-streptomycin solution) was added to each well to a final volume of 0.5 mL per well. Blank control well was used as a reference.
[0236] Day 3: Replacement of Medium
[0237] 4. The original medium was removed and cells were incubated in fresh DMEM medium (supplemented with 5% heat-inactivated fetal bovine serum, penicillin-streptomycin solution) for 24 hours.
[0238] 5. Lentivirus titer was determined by cytometry with an Inverted Fluorescence Microscope.
[0239] The wells where the number of fluorescent cells could be counted under the microscope were selected; 5 fields of view were randomly selected and photographed, and the number of fluorescent cells in the well was calculated.
[0240] In a well added with 0.03 ?l of virus, the number of fluorescent cells was moderate and the number of cells could be calculated. The average number of fluorescent cells in 5 fields of view in the well was X, and the lentivirus titer was calculated according to the following formula:
Lentivirus titer (TU/mL)=X (average number of fluorescent cells)?63.3 (area of 24-well plate/area of microscope observation view field)/0.03 ?l (volume of lentivirus solution actually added).
[0241] The biological titer of Lentivirus determined by fluorescence microscopy cytometry in Table 14 was obtained.
TABLE-US-00015 TABLE 14 Biological titer of Lentivirus determined by fluorescence microscopy cytometry triplicate well 1 triplicate well 2 triplicate well 3 Number of Number of Number of fluorescent Mean fluorescent Mean fluorescent Mean Mean titer titer Lentiviral particles cells value cells value cells value value (TU/ml) (copies/ml) LPP-WH- purified 61 48 40 45 50 49 47 1.99 ? 10.sup.8 1.99 ? 10.sup.10 Fragment (0.03 ?l) 56 49 59 3-Lv201 36 44 37 45 41 42 40 51 59 Note: 1 TU/ml was approximately equal to 100 copies/ml
[0242] After infection of H1299 cells by the lentivirus, the fluorescence picture as shown in
[0243] Method iii: Determination of Lentivirus Biotiter by Flow Cytofluorimetry.
[0244] Steps 1-4 were the same as steps 1-4 in method ii.
[0245] Day 4: Determination of Lentivirus Titer by Flow Cytofluorimetry
[0246] 5. The lentivirus titer was determined by flow cytofluorimetry (Flow cytometer: BD FACSMelody)
[0247] Cells with eGFP fluorescence could be counted by FACS (flow cytometry). Fluorescence observation of eGFP could be performed using a fluorescence microscope. After observation of the fluorescence state, the cells were digested with trypsin, and the digestion was terminated with DMEM complete medium, and then the cells were centrifuged at 500 g for 10 min. The cells were resuspended in 1 ml of PBS, and the total number of cells in each well was determined with a hemocytometer. Cell were then analyzed by a flow cytometer to obtain the percentage of fluorescent cells, as shown in
Lentivirus titer (TU/mL)=percentage of fluorescent cells?total number of cells in well+volume of lentivirus solution actually added (mL). The lentivirus biotiter was shown in Table 15.
TABLE-US-00016 TABLE 15 Biotiter of lentivirus Fluores- number of cence Titer Titer lentiviral particles cells(cells) rate (%) (TU/ml) (copies/ml) LPP-WH- 0.03 ?l 8.54E+05 2.23 6.35E+08 6.35E+10 Fragment3- lentivirus Lv201 added Note: 1 TU/ml was approximately equal to 100 copies/ml
[0248] Remarks for
[0249] Method iv: Detection of the Copy Number of Lentivirus RNA by ddPCR Method
[0250] 1. Experimental Materials [0251] Reagent: Bio-Rad ddPCR? Supermix for Probes (No dUTP) [0252] Equipment: Bio-Rad QX200 droplet digital PCR System
[0253] 2. Experimental Steps
[0254] 1. The cDNA obtained by reverse transcription of lentivirus particle RNA was 10-fold gradient diluted with ddH2O (DNase free) to obtain 4 ddPCR samples to be tested;
[0255] 2. The ddPCR? Supermix for Probes (No dUTP) was thawed at room temperature, mixed well by turning upside down and centrifuged briefly;
[0256] 3. ddPCR Reaction Mix (FAM/HEX dual channel) was prepared according to Table 16.
TABLE-US-00017 TABLE 16 ddPCR reaction system Final Component Amount concentration 2 ? Supermix for Probes (No dUTP) 10 ?L 1? Primer Mix 1 (10 ?M) 1.8 ?L 0.9 ?M Taqman Probe 1 (5 ?M) 1 ?L 0.25 ?M Primer Mix 2 (10 ?M) 1.8 ?L 0.9 ?M Taqman Probe 2 (5 ?M) 1 ?L 0.25 ?M cDNA 1 ?L ddH.sub.2O to 20 ?L Total volume 20 ?L
[0257] 4. After the prepared system was mixed well by shaking and centrifuged, it was carefully transferred to sample wells in the middle row of the droplet generation card, and 70 ?L of droplet generation oil was added to the well in the lower row, and then droplets were generated in a droplet generator.
[0258] 5. The generated droplet sample (40 ?L) was transferred from the upper row of the droplet generation card to a ddPCR-dedicated 96-well plate, the 96-well plate was sealed with a PX1 heat sealer after covered with aluminum film.
[0259] 6. After sealing the plate, the PCR reaction should be carried out within 30 minutes, or the PCR should be carried out within 4 hours stored in a 4? C. refrigerator. The PCR reaction should be carried out according to Table 17, and the rate of temperature increase or decrease should be 2? C./sec.
TABLE-US-00018 TABLE 17 PCR reactions step temperature duration number of cycles predenaturation 95? C. 10 min 1 denaturation 94? C. 10 s 40 annealing 60? C. 15 s extension 68? C. 20 s Enzyme 98? C. 4 min 1 inactivation maintain 4? C. ? temperature
[0260] 7. After PCR, the 96-well plate was taken out and the droplets on a droplet reader were read.
[0261] 8. After reading of the droplets, the data results were analyzed by a Bio-rad QuantaSoft software, and the copy number concentrations of ORF1ab and N genes in the mock virus cDNA were calculated according to
Example 5: RNA Extraction
[0262] 1. Experimental Materials [0263] Reagents: GeneCopoeia RNAzol? RT RNA Isolation Reagent, isopropanol, 75% ethanol, ddH.sub.2O (RNase and DNase free). [0264] Equipment: Vortex Shaker.
[0265] 2. Experimental Steps
[0266] 1. Sample Treatment
[0267] 400 ?l of virus suspension was taken and added to a 1.5-2 ml centrifuge tube containing 1 ml of RNAzol RT, and then mixed well by shaking, and left standing at room temperature for about 5 minutes;
[0268] 2. Phase Separation
[0269] Each 1 ml RNAzol RT was added with 400 ?l ddH.sub.2O (RNase and DNase free), or supplemented with ddH.sub.2O (RNase and DNase free) to 1.4 ml; the lid was closed, and then the solution was mixed well by shaking for about 15 sec, and left standing at room temperature for 5 to 15 min. Centrifuge was performed at 10,000 rpm for 15 min;
[0270] 3. Precipitation
[0271] The supernatant was transferred to a new 1.5-2 ml centrifuge tube, added with an equal volume of isopropanol, and left standing at room temperature for 10 min. Centrifuge was performed at 10,000 g for 10 min.
[0272] 4. Washing
[0273] The supernatant was discarded, the remained precipitate was added with 400 ?l of 75% ethanol, mixed well and centrifuged at 7500 g for 1-3 min. This washing step was repeated once.
[0274] 5. Dissolution
[0275] The supernatant was discarded; the precipitate was air dried, and added with 50 ?l TE (RNase and DNase free) for dissolving, thereby obtaining the total RNA.
Example 6: cDNA Preparation
[0276] 1. Experimental Materials [0277] Reagents: GeneCopoeia SureScript? First-Strand cDNA Synthesis Kit, Lentivirus RNA, DEPC treated water. [0278] Equipment: ordinary PCR machine.
[0279] 2. Experimental Steps
[0280] 1). Preparation of Reverse Transcription System
[0281] The reverse transcription system was prepared according to Table 18 of GeneCopoeia? SureScript? First-Strand cDNA Synthesis Kit Instruction:
TABLE-US-00019 TABLE 18 Reverse transcription system for cDNA preparation reagent amount 5 ? RT buffer 4 ?l 20 ? RTase Mix 1 ?l Lentiviral RNA (100 ng/?l) 5 ?l DEPC treated water To 20 ?l
[0282] 2). Reverse Transcription Reaction
[0283] The reverse transcription procedure was performed according to Table 19 on a ordinary PCR machine.
TABLE-US-00020 TABLE 19 Reverse transcription procedure for cDNA preparation Reaction temperature Duration 25? C. 5 min 50? C. 60 min 85? C. 5 min
[0284] The reverse transcribed cDNA was stored at ?20? C.
Example 7
[0285] RNA Preparation Method and Quality Control Analysis
[0286] 1. Experimental Materials
[0287] Reagents: RNAzol RNA Isolation reagent (GeneCopoeia), MgCl.sub.2.Math.6H.sub.2O (sigma), DEPC (MBCHEM), isopropanol (Guangzhou Chemical Reagent Factory), Trizma Base (Sigma), EDTA (Sigma), RNaseLock (GeneCopoeia), DNase I (NEB), 1-step Taqman qPCR Mix (GeneCopoeia), 2-step Taqman qPCR Mix (GeneCopoeia), BlazeTaq RTase Mix (GeneCopoeia), ddPCR Supermix for Probes (No dUTP) (Bio-rad), FAM-labeled probes (Invitrogen), pipette tips (Axygen), 50 ml centrifuge tubes (BIOFIL), 1.5 ml centrifuge tubes (Axygen).
[0288] 2. Experimental Steps [0289] 1) 80 ml of mock virus culture solution was prepared. After PEG concentration and precipitation, the virus was stored in PBS buffer with a volume of 10 ml and treated with Benzonase twice to remove the residual plasmid DNA; [0290] 2) Operation on ice: 300 ?l mock virus+1 ml RNAzol, mixed well, left standing for 5 min, then added with 100 ?l DEPC treated water to a volume of 1.4 ml; [0291] 3) After centrifugation at 10,000 rpm and 4? C. for 10 min, all the supernatants were collected into a 50 ml centrifuge tube, and added with an equal volume of isopropanol; [0292] 4) After mixing, the solution was dispensed into 1.4 ml/tube and left standing for 5 min at room temperature; [0293] 5) After centrifugation at 10,000 rpm, 4? C. for 15 min, the supernatant was discarded; 400 ?l of 75% ethanol (prepared with DEPC treated water) was added to the pellet, mixed well, centrifuged at 7,500 rpm for 2 min at 4? C.; the washing step was repeated again; [0294] 6) The supernatant was discarded; the precipitate was left at room temperature for about 5 minutes to be air dried, 50 ?l TE (containing RNaseLock: 0.02 U/?l) was added to dissolve the precipitate; all the RNA solutions were mixed well, aliquoted, and stored in a ?80? C. refrigerator; [0295] 7) Residual plasmid DNA in RNA was treated with DNase I, and the unit of DNase I activity was 7 U/1.5 ?g RNA. The amount of each component was: RNA 58 ?l, Dnase I 14 ?l, 10?Dnase I buffer 8 ?l, 37? C. for 15 min or 75? C. for 10 min; [0296] 8) DNA residues were detected by qPCR with primers as shown in Table 20. The amount of each component added was: 5?2-step Taqman mix 4 ?l, primers and Probe Mix (10 uM) 0.25 ?l, RNA 2 ?l, DEPC H.sub.2O to 20 ?l, and the reaction system was shown in Table 21.
TABLE-US-00021 TABLE20 Relevantprimersfordetectionof DNAresiduesbyqPCR No. primername Primersequence 1 cCDC-F1 CCCTGTGGGTTTTACACTTAA(SEQ IDNO:62) cCDC-R1 ACGATTGTGCATCAGCTGA(SEQID NO:63) cCDC-FAM-P1 5-FAM-CCGTCTGCGGTATGTGGAAA GGTTATGG-BHQ1-3(SEQID NO:64) 2 cCDC-F2 GGGGAACTTCTCCTGCTAGAAT(SEQ IDNO:65) cCDC-R2 CAGACATTTTGCTCTCAAGCTG(SEQ IDNO:66) cCDC-FAM-P2 5-FAM-TTGCTGCTGCTTGACAGATT- BHQ1-3(SEQIDNO:67) 3 Ro-E-F ACAGGTACGTTAATAGTTAATAGCGT (SEQIDNO:68) Ro-E-R ATATTGCAGCAGTACGCACACA(SEQ IDNO:69) E_Sarbeco_P1 5-FAM-ACACTAGCCATCCTTACTGCGC TTCG-BHQ1-3(SEQIDNO:70) 4 WH-F CCAGATCCATCAAAACCAAGC(SEQID NO:71) WH-R TGCACAAATGAGGTCTCTAGC(SEQID NO:72) WH-FAM-P 5-FAM-AGTGACACTTGCAGATGCTGGC T-BHQ1-3(SEQIDNO:73)
TABLE-US-00022 TABLE 21 Reaction procedure for detection of DNA residues by qPCR Steps Temperature Duration Cycle numbers predenaturation 95? C. 2 min 1 denaturation 95? C. 10 s 40 Annealing 60? C. 30 s [0297] 9) RNA copy number and DNA residues were detected by ddPCR, and the amount of each component added was 2?ddPCR Supermix 10 ?L, Primer mix 900 nM, Probe 250 nM, RNA 2 ?L, DEPC H.sub.2O to 20 ?l, and the reaction procedure was shown in Table 22.
TABLE-US-00023 TABLE 22 Reaction procedure for detecting RNA copy number and DNA residues by ddPCR Cycle Reaction Steps Temperature Duration numbers rate Predenaturation 95? C. 10 min 1 2? C./sec Denaturation 94? C. 30 s 40 Annealing/Extension 60? C. 1 min Heat inactivation 98? C. 10 min 1 holding 4? C. Infinite 1 [0298] 10) RNA amplification efficiency was detected by RT-qPCR, and the amount of each component was 5?1-step Tagman mix 4 ?l, primers and Probe Mix (10 ?M) 0.25 ?l, RNA 2 ?l, DEPC H.sub.2O to 20 ?l, and the reaction procedure was shown in Table 23.
TABLE-US-00024 TABLE 23 Reaction procedure for detection of RNA amplification efficiency by RT-qPCR Cycle Steps Temperature Duration numbers reverse transcription 50? C. 10 min 1 Predenaturation 95? C. 2 min 1 Denaturation 95? C. 10 s 40 Annealing/Extension 60? C. 30 s
[0299] 3. Experimental Results
[0300] 1) DNA Residues of RNA Standards were Detected According to Table 24
TABLE-US-00025 TABLE 24 Detection Results of DNA Residues for RNA Standards Detection gene ORF1ab-FAM S-FAM qPCR (Ct) 35.6 35.6 ddPCR(Copies) 0 8
[0301] Compared with RNA, the residual rate of plasmid after DNase I digestion was less than 1/10,000, which had no effect on the quantitative analysis of RNA reference standard.
[0302] 2) RNA Copy Number Quantification
[0303] ORF1ab-FAM was selected for RNA copy number quantification, as shown in
[0304]
[0305] 3) RNA Amplification Efficiency was Shown in Table 25 and
TABLE-US-00026 TABLE 25 RNA amplification efficiency RNA Copies Log.sub.10Copies ORF1ab-FAM S-FAM E-FAM N-FAM 200000 5.30 16.05 15.80 15.19 15.41 100000 5.00 16.94 16.73 15.77 16.25 10000 4.00 20.19 19.61 18.93 19.24 1000 3.00 23.08 22.66 21.85 22.45 100 2.00 27.03 26.59 25.89 26.06 E 1.02 1.05 1.04 1.05
[0306]
Example 8
[0307] cDNA Preparation and Quality Analysis
[0308] 1. Experimental Materials
[0309] Reagents: DNase I (NEB 2 U/?l), 5?BlazeTaq? Probe qPCR Master Mix (with ROX) (Genecopoeia, Cat. QP036), 5?FL SureScript? RT buffer (Genecopoeia), 10?RTase Mix (S+M)) (Genecopoeia), ddPCR? Supermix for Probes (No dUTP) (Bio-rad), DEPC treated water, PD-10 Desalting Columns (GE Healthcare Life Sciences), FAM-labeled probes (Invitrogen), pipette tips (Axygen), 50 ml centrifuge tube (BIOFIL), 1.5 ml centrifuge tube (AXYGEY), 200 ?l PCR tube (SARSTEDT), MicroAmp Optical 96-Well Reaction Plate (ABI).
[0310] 2. Experimental Steps
[0311] (1) The mock virus RNA (100 ng/?l, 50 ?l/tube) stored at ?80? C. was melted on ice, mixed by vortexing, and centrifuged briefly for the DNA in Dnase I-digested RNA; the digestion system was prepared according to Table 26 in a fume hood, and the prepared system was centrifuged briefly and then digested in a water bath. The DNase I digestion procedure was shown in Table 27. The digested system was mixed by vortexing, and centrifuged briefly for use.
TABLE-US-00027 TABLE 26 DNA Digestion System Components 1 ? Volume 10 ? Dnase I buffer 8 ?l DNase I(2 U/?l) 14 ?l Mock virus RNA(100 ng/?l) 50 ?l DEPC treated water 8 ?l
TABLE-US-00028 TABLE 27 DNA Digestion Procedure Reaction temperature Duration 37? C. 15 min 75? C. 15 min
[0312] (2) the reverse transcription system was prepared in 38 200 ?l PCR tubes (RNase and DNase-free), according to Table 28 in a fume hood; the prepared system was centrifuged and then subjected to normal PCR machine, and reverse transcription according to the procedure in Table 29. The system after reverse transcription was mixed by vortexing, and centrifuged briefly for use.
TABLE-US-00029 TABLE 28 RNA reverse transcription system Components 1 ? Volume 5 ? FL SureScript? RT buffer 4 ?l 10 ? RTase Mix(S + M) 2 ?l DNase I digested RNA 2 ?l DEPC treated water 12 ?l Total volume 20 ?l
TABLE-US-00030 TABLE 29 RNA reverse transcription procedure Reaction temperature Duration 25? C. 5 min 45? C. 60 min 85? C. 5 min
[0313] (3) All reverse transcription products in 38 tubes were collected in a 1.5 ml centrifuge tube (RNase and DNase-free) in a fume hood, mixed by vortexing, and centrifuged briefly.
[0314] (4) 500 ?l of reverse transcribed cDNA samples were taken and purified by P10 column gel filtration chromatography in a fume hood. The specific purification steps were as follows: [0315] 1) The P10 column was fixed on a test tube rack, and the bottom of the column was cut with alcohol-sterilized scissors; [0316] 2) 1 mL of 1?TE Buffer was added to the center of column to balance the column, and the effluent was discarded in a waste tank (repeated for 5 times); [0317] 3) 1 mL of 1?Dilution Buffer was added to the center of column, and the effluent was discarded in a waste tank; [0318] 4) 1 mL of 1?TE Buffer was added to the center of column, and the effluent was discarded in a waste tank (repeated for 6 times); [0319] 5) After there were no effluent from the column, 500 ?l cDNA sample was added to the center of column; [0320] 6) 500 ?l 1?TE Buffer was slowly added around the column, and the eluate was collected with a 1.5 mL centrifuge tube at the same time, which was marked as Tube No. 1; [0321] 7) 500 ?l 1?TE Buffer was slowly added around the column, and the eluate was collected with a 1.5 mL centrifuge tube at the same time, which was marked as Tube No. 2; [0322] 8) The above step of collecting the eluate was repeated until Tube No. 20, and the eluates were marked as Tube No. 1, 2, 3, . . . , 18, 19, 20, respectively; [0323] 9) Tubes No. 5, 6 and 7 were mixed into one tube (marked as cDNA Mix), mixed well by vortexing, and centrifuged briefly.
[0324] (5) 50 ?l of cDNA Mix was subjected to ddPCR to detect the copy number, wherein the specific steps of ddPCR were as follows:
[0325] 1) cDNA Mix was diluted by 100-fold: 20 ?l cDNA Mix+180 ?l 1?TE buffer, mixed well by vortexing, and centrifuged briefly.
[0326] 2) The ddPCR? Supermix for Probes (No dUTP) was thawed at room temperature, mixed well by turning upside down and centrifuged briefly;
[0327] 3) ddPCR Reaction Mix (FAM/HEX dual channel) was prepared according to Table 30.
TABLE-US-00031 TABLE 30 ddPCR reaction system Final Components 1 ? Volume concentration 2 ? Supermix for Probes (No dUTP) 10 ?L 1? ORF1ab Primer Mix (10 ?M) 1.8 ?L 0.9 ?M ORF1ab Taqman Probe (5 ?M) 1 ?L 0.25 ?M Diluted cDNA 2 ?L ddH.sub.2O Added to 20 ?L Total volume 20 ?L
[0328] 4) After the prepared system was mixed well by shaking and centrifuged, it was carefully transferred to sample wells in the middle row of the droplet generation card, and 70 ?L of droplet generator oil was added to the well in the lower row, and then droplets were generated in a droplet generator.
[0329] 5. The generated droplet sample (40 ?L) was transferred from the upper row of the droplet generation card to a ddPCR-dedicated 96-well plate, and then the 96-well plate was sealed with a PX1 heat sealer after covered with aluminum film.
[0330] 6) After sealing the plate, the PCR reaction should be carried out within 30 minutes, or the PCR should be carried out within 4 hours in a 4? C. refrigerator. The PCR procedure was shown in Table 31, wherein the rate of increase or decrease of the temperature was 2? C./s.
TABLE-US-00032 TABLE 31 PCR Reaction Procedure Steps Temperature Duration Cycle numbers Predenaturation 95? C. 10 min 1 Denaturation 94? C. 10 s 40 Annealing 60? C. 20 s Extension 72? C. 15 s Enzyme 98? C. 4 min 1 inactivation maintain 4? C. ? temperature
[0331] 7) After PCR, the 96-well plate was taken out and the droplets on a droplet reader were read.
[0332] 8) After reading of the droplets, the data were analyzed by a Bio-rad QuantaSoft software.
[0333] 9) Based on the ddPCR results, the cDNA Mix (1.18?10.sup.5 copies/?l) was thawed on ice, mixed well and centrifuged, and was diluted to cDNA Standard #1 (wherein cDNA concentration was 1?10.sup.5 copies/?l) by using 1?TE buffer: 1000 ?l cDNA Mix+180 ?l 1?TE buffer, mixed well by turning upside down and centrifuged briefly. Then cDNA Standard #1 was serially diluted by 1?TE buffer.
[0334] The specific steps of dilution were as follows: [0335] 1) cDNA Standard #2-1 (5?10.sup.4 copies/?l): 50 ?l cDNA Standard #1+50 ?l 1?TE buffer; [0336] 2) cDNA Standard #2-2 (5?10.sup.3 copies/?l): 20 ?l cDNA Standard #2-1+180 ?l 1?TE buffer; [0337] 3) cDNA Standard #2-3 (5?10.sup.2 copies/?l): 20 ?l cDNA Standard #2-2+180 ?l 1?TE buffer; [0338] 4) cDNA Standard #2-4 (5?10 copies/?l): 20 ?l cDNA Standard #2-3+180 ?l 1?TE buffer; [0339] 5) The sample of cDNA Standard #2 was subjected to qPCR to detect the amplification efficiency according to the system and procedure as shown in Table 32 and Table 33.
TABLE-US-00033 TABLE 32 qPCR reaction system Components 1 ? Volume 5 ? BlazeTaq? Probe qPCR Master Mix 4 ?l ORF1ab/N/S/E primers and Probe (10 ?M) 0.25 ?l cDNA sample diluted in gradient 2 ?l ROX (30 ?M) 0.1 ?l DEPC treated water 12 ?l
TABLE-US-00034 TABLE 33 qPCR reaction procedure Reaction temperature Duration Cycle numbers 95? C. 2 min 1 95? C. 10 s 40 60? C. 30 s
[0340] 3. Experimental Results
[0341] (1) ddPCR Results of cDNA Mix
[0342] 1) ddPCR original droplet data were shown in
[0343]
[0344] 2) Calculation Result:
TABLE-US-00035 TABLE 34 Calculation of cDNA Mix concentration based on ddPCR data Calculation process and final Samples concentration cDNA Mix concentration after 2360 ? 2 = 1180 copies/?l dilution by 100-fold cDNA Mix stock solution 1180 ? 100 = 1.18 ? 10.sup.5 copies/?l concentration Note: cDNA Mix was a mixture of cDNA in Tubes No. 5, 6 and 7.
[0345] (2) Amplification Efficiency Results of qPCR for Each Gradient of cDNA Standard #2:
[0346] 1) Ct Value, wherein the calculation process was shown in table 10
TABLE-US-00036 TABLE 35 Ct Values of cDNA Standard #2 Gradient qPCR Copies Log.sub.10 (Copies ) ORF1ab-FAM S-FAM E-FAM N-FAM 2 ? 10.sup.5 5.30 19.7 19.5 17.9 19.5 1 ? 10.sup.5 5.00 20.8 20.1 18.8 20.4 1 ? 10.sup.4 4.00 24.0 23.5 22.2 23.6 1 ? 10.sup.3 3.00 27.6 27.2 25.9 27.0 1 ? 10.sup.2 2.00 31.2 30.7 29.2 30.5 R.sup.2 0.9995 0.9983 0.9993 0.9995 E 94.2% 94.8% 94.5% 99.5% Note: E = 10.sup.[(?1/slope)?1]
[0347] The standard curve of cDNA Standard #2 gradient qPCR was shown in
[0348]
[0349]
[0350]
[0351]
[0352] 2) The amplification curve of each gene was shown in
[0353]
Example 9: Amplification Efficiency of Spike-in Standards
[0354] 1. Experimental Materials [0355] Reagent: GeneCopoeia BlazeTaq SYBR Green qPCR mix [0356] Equipment: ABI ViiA 7 qPCR instrument
[0357] 2. Experimental Steps [0358] 1) According to the pre-experimental results of mock virus cDNA and spike-in mock virus cDNA and referring to the quantitation data of ddPCR, the two cDNAs were diluted by 10-fold gradient in a biological safety cabinet to obtain test samples of 10.sup.5 copies/uL to 10.sup.2 copies/uL [0359] 2) The system for dye-based qPCR reaction was prepared in a biological safety cabinet, and the targets to be tested were ORF1ab, S, E, and N; the system was shown in Table 36
TABLE-US-00037 TABLE 36 qPCR reaction system Components Volume 5 ? BlazeTaq SYBR Green qPCR mix 4 ?L Primer Mix 2 ?M) 2 ?L cDNA (10.sup.5~10.sup.2 copies/?L) 5 ?L ddH.sub.2O 9 ?L Total 20 ?L [0360] 3) After the system was completely prepared, qPCR quantitative detection and melting curve analysis were performed on a qPCR instrument (ABI ViiA7). The qPCR reaction procedure and melting curve procedure were shown in Table 37 and Table 38 respectively:
TABLE-US-00038 TABLE 37 qPCR reaction procedure Temperature Duration Cycle numbers 95? C. 30 s 1 95? C. 10 s 40 58? C. 10 s 68? C. 20 s
TABLE-US-00039 TABLE 38 Melting curve procedure Temperature temperature Interval Duration 95? C..fwdarw.60? C. 1.6? C. 1 sec/each [0361] 4) The amplification efficiencies of different targets of various cDNAs were calculated according to the Ct value of serially diluted samples. The results were shown in Table 39.
TABLE-US-00040 TABLE 39 Calculation of amplification efficiencies of four SARS-Cov-2 targets in mock virus cDNA and spike-in mock virus cDNA CDNA mock virus cDNA spike-in mock virus cDNA Target ORF1ab S E N ORF1ab S E N 500,000 21.8 22.50 21.1 21.0 21.43 22.83 21.28 20.77 50,000 25.8 26.01 25.3 23.9 25.77 26.00 25.05 23.88 5,000 28.8 31.00 28.6 27.0 28.56 30.43 28.67 27.41 500 32.6 34.50 32.5 30.5 32.91 34.75 32.78 30.89 NTC NA NA NA NA NA NA NA NA Amplification 91.6% 75.3% 84.7% 107% 85.7% 77.8% 83.0% 97.6% efficiency R.sup.2 0.997 0.995 0.998 0.998 0.998 0.994 0.999 0.999 specificity high low high high high low high high
[0362]
[0363] Remarks for
Example 10: Effect of the Amount of Added Spike-In Mock Virus cDNA on the Quantitative Results of SARS-CoV-2 Target in the Mock Virus cDNA
[0364] 1. Experimental Materials [0365] Reagent: GeneCopoeia BlazeTaq qPCR mix for Probes
[0366] 2. Experimental Steps
[0367] 1) The copy number concentrations of the two targets, ORF1ab and S, were estimated according to target quantification results of spike-in mock virus cDNA by dye-based qPCR.
[0368] 2) In a biological safety cabinet, spike-in mock virus cDNAs having various concentration gradients (5?10.sup.5 copies to 50 copies) were added to the mock virus cDNA used as detection kit raw materials and quality control.
[0369] 3) the system of probe-based qPCR reaction was prepared in a biological safety cabinet, and the targets were ORF1ab and S; the qPCR system was the same as that in the probe-based qPCR kit instruction.
[0370] 3. The Experimental Results were Shown in
[0371]
Example 11: Specific Method v for Lentivirus Quantification: The Copy Number Concentration of N and S Genes in the RNA of Mock Virus Spike-In Standard was Detected by One-Step RT-ddPCR Method
[0372] 1. Experimental Materials [0373] Reagent: BIO-Rad One-STEP RT-ddPCR Advanced Kit for Probes [0374] Equipment: Bio-Rad QX200 droplet digital PCR System
[0375] 2. Experimental Steps
[0376] 1. The mock virus spike-in standard RNA was diluted with ddH.sub.2O (DNase-free) by 100-fold, and then diluted by 10-fold to obtain two gradients, thereby obtaining 3 test samples for RT-ddPCR;
[0377] 2. All components of BIO-Rad One-STEP RT-ddPCR Advanced Kit for Probes were dissolved at room temperature, mixed well by turning upside down and centrifuged briefly;
[0378] 3. RT-ddPCR Reaction Mix was prepared according to Table 40
TABLE-US-00041 TABLE 40 RT-ddPCR reaction system component amount/?L Final concentration Supermix 5 1? Reverse Transcriptase 2 20 U/?L 300 mM DTT 1 15 mM Primer Mix (10 ?M) 1.8 0.9 ?M Taqman Probe (5 ?M) 1 0.25 ?M RNA 1 ddH.sub.2O Added to 20 Total volume 21
[0379] 4. After the prepared system was mixed well by shaking and centrifuged, it was carefully transferred to the sample wells in the middle row of the droplet generation card, and 70 ?L of droplet generation oil was added to the well in the lower row, and then droplets were generated in a droplet generator.
[0380] 5. The generated droplet sample (40 ?L) was transferred from the upper row of the droplet generation card to a ddPCR-dedicated 96-well plate, the 96-well plate was sealed with a PX1 heat sealer after covered with an aluminum film.
[0381] 6. After sealing the plate, the PCR reaction was performed within 30 minutes, or within 4 hours in a 4? C. refrigerator. The PCR reaction should be carried out according to Table 17, and the rate of temperature increase or decrease was set to be 2? C./sec.
TABLE-US-00042 TABLE 41 PCR reaction Steps Temperature Duration Cycle numbers reverse transcription 42? C. 60 min 1 Enzyme activation 95? C. 10 min 1 denaturation 95? C. 30 s 40 Annealing/Extension 60? C. 1 min Enzyme inactivation 98? C. 10 min 1 maintain temperature 4? C. ?
[0382] 7. After PCR was finished, the 96-well plate was taken out and the droplets reading was carried out by the droplet reader.
[0383] 8. After reading of the droplets, the data results were analyzed by a Bio-rad QuantaSoft software, and the copy number concentrations of N and S genes in the RNA of mock virus spike-in standard were calculated, as shown in
Example 12: SARS-Cov-2 2019-nCOV Nucleic Acid Qualitative and Quantitative Detection Kit (Fluorescent PCR Method) and Model Detection of Spike-In Positive Standard and Quality Control RNA
[0384] Based on one-step RT-PCR technology (RNA reversal transcription reaction and polymerase chain reaction (PCR) in combination with TAQMAN technology), 2019-nCOV N gene and S gene-specific conservative sequences were selected as amplification target area; specific primers and fluorescent probes (HEX markers for N gene probes, FAM markers for S gene probes) were designed for the detection of 2019-nCOV RNA in a sample; at the same time, endogenous internal control detection system (CY5 marker for internal control gene H probe, and AP593 marker for unique positive standard S gene and the N gene probe), that is, 3 pairs of primers and 4 probes, were included for qualitative and quantitative analysis of the target gene.
[0385] Standard: having the same nucleic acid sequence length, base percentage, Tm value and primers as the quality control (or targets to be tested), but having different arrangement of sequence fragments.
[0386] 1. Experimental Materials
[0387] 1.1. Instrument [0388] PCR Instrument: ABI viia7 [0389] Centrifuge: labnet, C1301 [0390] Biological Safety Cabinet: Suzhou Jinghua Company
[0391] 1.2. Consumptions [0392] 96-well plate: ABI, N8010560
[0393] 1.3. Reagent [0394] RNAzol? RT RNA Isolation Reagent: Guangzhou iGene Biotechnology Co., Ltd, QP020 [0395] Dnase I: NEB, M0303L [0396] Primers: see Table 42 [0397] TAQMAN probe: see Table 43
TABLE-US-00043 TABLE42 Primersequencesandrelatedinformation Target Primer gene name Sequence quality N cCDC-N-PF2 GGGGAACTTCTCCTG control (matchwith CTAGAAT cCDC) (SEQIDNO:74) CCDC-N-PR2 CAGACATTTTGCTCT CAAGCTG (SEQIDNO:75) quality S FL-S-F CCAGATCCATCAAAA control (matchwith CCAAGC FL) (SEQIDNO:76) FL-S-R TGCACAAATGAGGTC TCTAGC (SEQIDNO:77) Internal House- GAPDH2-PF CCTGCCACACTCAGT reference Keeping CCCC GAPDH (SEQIDNO:78) GAPDH2-PR GACAAGGTGCGGCTC CCTA (SEQIDNO:79)
TABLE-US-00044 TABLE43 Probesequenceandfluorescentlabelinformation Primer fluorescent Targetgene name Sequence label quality N(matchwith cCDC-N- TTGCTGCTGCTTGACAGATT HEX control cCDC) Probe1 (SEQIDNO:80) quality S(matchwith FL-S- AGTGACACTTGCAGATGCT FAM control FL) Probe1 GGCT(SEQIDNO:81) Internal HouseKeeping GAPDH- CACACTGAATCTCCCCTCCT Cy5 reference GAPDH Probe2 CACAGTTGC(SEQIDNO:82) Spikein N(matchwith cCDC-N- CACCGAGGATGCACAGCTC AP593 cCDC) Probe2 GCTCTA(SEQIDNO:83) Note: FL: Guangzhou Fulen Gene Co., Ltd., cCDC: Chinese Center for Disease Control and Prevention
[0398] 2. Experimental Steps
[0399] 2.1. RNA Extraction
[0400] The standard RNA and quality control RNA were extracted according to the instructions of RNAzol? RT RNA Isolation Reagent kit, and finally the RNA precipitate was dissolved by 50 ?L of TE buffer (herein, the TE buffer is 100 ?m TE buffer prepared by DEPC-treated water, and all the RNA precipitates in the present invention were dissolved by said TE buffer).
[0401] 2.2. Digestion of RNA by DNase I
[0402] The two RNAs were treated with DNase I after extraction to remove genome DNA and plasmid DNA residues in the RNA. RNA was treated with DNase I according to the reaction system in Table 44. The reaction system was centrifuged briefly after the sample was added, and then heated at 37? C. for 10 minutes, and 72? C. for 10 minutes to inactivate the DNase I, and stored at ?80? C. for later use.
TABLE-US-00045 TABLE 44 DNase I reaction system Reagent amount/?L DEPC treated water 10 RNA 30 DNase I buffer (10?) 5 DNase I 5 Total amount 50
[0403] Genome DNA and plasmid DNA residues were detected by qPCR and RT-PCR, and RNA could be used for subsequent experiments until no genes of interest was detected by qPCR which indicated that the residues were digested completely. Taking N gene target as an example, the qPCR reaction system was shown in Table 45, the RT-PCR reaction system 1 was shown in Table 46, and the running procedure was shown in Table 47.
TABLE-US-00046 TABLE 45 qPCR reaction system Components volume/?L (5?) two step qPCR Mix 4 10 ?M cCDC-N primer 0.25 10 ?M FL-N-AP593 0.25 ROX 0.1 DEPC treated water 10.4 RNA 5
TABLE-US-00047 TABLE 46 RT-PCR reaction system 1 Components volume/?L 5?)Probe One Step RT-qPCR Mix 4 10 ? RTase Mix 2 10 ?M cCDC-N primer 0.25 10 ?M FL-N-AP593 0.25 ROX 0.1 DEPC treated water 8.4 RNA 5
TABLE-US-00048 TABLE 47 QPCR and RT-PCR running procedure Number Detection of cycles step Temperature Time or not 1 reverse 50? C. 10 min no transcription 1 Pre- 95? C. 2 min no denaturation 40 denaturation 95? C. 15 sec no extension 60? C. 30 sec yes
[0404] 2.3. Sample Dilution and Standard Curve Preparation
[0405] The clean RNA was quantified by Biorad ddPCR, and then standard curve was prepared by diluting the RNA in gradient 10 with a dilution solution (TE buffer+0.25 U/?L RNase Inhibitor+1 pg/?L ttRNA). In addition, two low-concentration copy numbers of the standard RNA were obtained by dilution and used for subsequent experiments, wherein the low concentration copy numbers were 100 Copies/?L and 12.5 Copies/?L. The specific steps of RNA dilution were shown in Table 48.
TABLE-US-00049 TABLE 48 RNA dilution steps No. Concentration copies/?L concentration dilution step (1) 1.0 ? 10.sup.5 With a concentration of 1.0 ? 10.sup.5 copies/?L (2) 1.0 ? 10.sup.4 10 ?L(1) added with 90 ?L diluent (3) 1.0 ? 10.sup.3 10 ?L(2) added with 90 ?L diluent (4) 100 10 ?L(3) added with 90 ?L diluent (5) 50 50 ?L(4) added with 50 ?L diluent (6) 25 50 ?L(5) added with 50 ?L diluent (7) 12.5 50 ?L(6) added with 50 ?L diluent
[0406] 2.4. RT-PCR Detection Reaction
[0407] The diluted standard RNA was used for the drawing of standard curve; at the same time, the copy number of standard was fixed to detect the gradient of quality control. For details of the RT-PCR reaction system, please refer to Table 49. The samples were added after PCR reaction MIX (other components except for the quality control) was prepared, wherein each reaction well was added with 15 ?L prepared MIX firstly, and then 5 ?L quality control or test sample were added.
TABLE-US-00050 TABLE 49 RT-PCR reaction system 2 Components volume/?L 5?)Probe One Step RT-qPCR Mix 4 10 ? BlazeTaq? One Step RTase Mix 2 10 ?M cCDC-N primer 0.25 10 ?M cCDC N HEX 0.25 10 ?M FL-N-AP593 0.25 10 ?M FL S Primer 0.25 10 ?M FL S FAM 0.25 10 ?M GAPDH2 primer 0.25 10 ?M GAPDH2 CY5B 0.25 Human 293T RNA 1 Standard RNA-N 1 DEPC treated water 5.25 quality control RNA 5
[0408] 2.5. Instrument Detection
[0409] After the samples were added, the sample signal was detected on the ABIIVVA7 with the same running procedure of Table 47, wherein quality controls or clinical sample S gene were detected in FAM channel; quality controls or clinical sample N gene were detected in VIC (HEX) channel; endogenic human GAPDH gene was detected in CY5 channel, and S gene or N gene in the standard were detected in ROX (AP593) channel.
[0410] 3. Experimental Results
[0411] 3.1 Drawing of Standard Curve of Standard N Gene Concentration Gradient.
[0412] The standard N gene with a concentration of 2.4?10.sup.6 in the stock solution was diluted by 6 gradients of 10-fold according to Table 48, and then subjected to a single-channel signal detection. The ROX channel was selected to detect the signal intensity of the standard N gene. The concentration gradient standard curve of the standard N gene was calculated by using the logarithm of copy number as an abscissa and the Ct value as an ordinate. The result was shown in
[0413] 3.2. Parameter Model Determination of Positive Standard and Quality Control that can be Spiked into the Test Sample
[0414] The copy number of the standard N gene was kept unchanged, and the quality control RNA was detected in gradient by 3 primer pairs and 4 probes. 4-color channels were selected to determine the parameter model of positive standard and quality control that could be spiked in the test sample. The quantification accuracy of the quality control and standard was compared and the sensitivity of quality control was detected. The gradient detection of quality control was performed by selecting the copy number of standard N gene as 100 copies/rxn and 12.5 copies/rxn. The results were shown in Table 50 and Table 51.
TABLE-US-00051 TABLE 50 qPCR results 1 of parameter model of positive standard and quality control that can be spiked into the test sample Quality Control Concentration copies/rxn Detection target Ct value 1000 500 300 200 100 50 0 FL-S-FAM Quality Control RNA 24.11 25.18 26.1 27.46 27.6 28.62 NA cCDC-N HEX 25.8 26.6 26.9 29.3 28.67 30.03 NA GAPDH2-CY5 Human 293T RNA 23.91 23.86 24.1 24.86 24.14 23.96 23.84 N-AP593 Standard N gene - 29.05 28.62 28.3 28.87 28.59 28.59 28.46 100 copies/rxn Note: The detection concentration of the standard N gene was kept as 100copies/rxn; NA indicated that the Ct value was not detected.
TABLE-US-00052 TABLE 51 qPCR results 2 of parameter model of positive standard and quality control that can be spiked into the test sample Quality Control Concentration copies/rxn Detection target Ct value 100 50 25 12.5 2.5 0 FL-S FAM Quality Control RNA 27.59 28.92 29.66 30.67 32.88 NA cCDC-N HEX 27.78 30.24 31.59 30.26 34.04 NA GAPDH-CY5 293T-RNA 30.17 30.55 30.55 30.36 30.96 29.26 FL-N AP593 Standard N gene- 32.67 33.83 33.78 33.25 32.75 33.54 12.5 copies/rxn Note: The detection concentration of the standard N gene was kept as 12.5copies/rxn; NA indicated that the Ct value was not detected.
[0415] It was found that the average Ct value was 28.62 when the copy number of the standard N gene was 100 copies/rxn, which was close to the Ct value 28.67 of cCDCN-HEX group when the copy number of quality control RNA was 100 copies, indicating that the quantification was accurate. The average Ct value was 33.3 when the copy number of the standard N gene was 12.5 copies/rxn, which was 2 Ct different from the Ct value of cCDCN-HEX group when the copy number of quality control RNA was 100 copies. The above results show that the parameter model established in this method is accurate and can be used for the following applications: screening of SARS-cov-2 carrier; being an important basis for diagnosis of COVID-19 for individuals with elevated body temperature in hospital; screening of COVID-19 drugs, determination of treatment plans, and evaluation of efficacy; analysis of dynamic distribution of new coronavirus RNA load (2019-nCoV, Sars-cov-2 RNA Load) by using said model; as a reference for the guidance of drug use in late stage of COVID-19, and being one of the important indicators to identify whether patients with COVID-19 under treatment can be discharged from the hospital and enter a normal living community.
[0416] 3.3. Experimental Data of SARS-Cov-2 Positive Samples:
[0417] The same reaction system as that in 3.2 was used, except that the quality control RNA was replaced with clinical samples for detection. The test results were shown in Table 52. The clinical samples were 5 positive and 5 negative samples tested with a kit approved by China. Among them, samples 1-5 were positive clinical samples, samples 6-10 were negative clinical samples, and sample 11 was a negative control. The results were shown in Table 52, wherein MixC #1 was a 50-molecule positive standard; MixC #3 was a 200-molecule positive standard. When selecting four-color channels to detect clinical samples, no signal was detected for the S target in all samples, that is, No Ct (N was equivalent to No Ct); CY5 and ROX could be detected in all samples, that is, human RNA and spiked-in standard RNA could be detected, indicating that the whole reaction was normal and the result was credible. The results obtained by the product of the present invention were positive for samples 1/2/3/4/5 and negative for samples 6/7/8/9/10, which were different from the results of approved kit, that is, the positive sample No. 2 was identified as a negative sample by the product of the present invention. Therefore, the product of the present invention can be used for detection in combination with products of other companies for comprehensive analysis to prevent virus carriers from entering the society
TABLE-US-00053 TABLE 52 Detection results of clinical samples VIC CY5 RPOX sample N target GAPDH target RNA-S target Reference number MixC#1 MixC#3 MixC#1 MixC#3 MixC#1 MixC#3 Ct 1 (positive) 32.39 32.35 31.15 30.64 22.62 20.71 29.9 2 (positive) 3 (positive) 30.79 31.32 28.44 28.37 22.55 20.73 29 4 (positive) 33.58 34.7 30.59 30.07 22.84 20.92 32 5 (positive) 33.77 35.73 31.92 31.24 22.81 20.82 32 6 (negative) NoCt NoCt 27.95 28.05 24.95 23.15 N 7 (negative) NoCt NoCt 30.52 30 22.85 20.89 N 8 (negative) NoCt NoCt 29.83 29.5 22.79 20.81 N 9 (negative) NoCt NoCt 28.54 28.16 22.8 20.71 N 10 (negative) NoCt NoCt 29.25 28.54 22.77 20.77 N 11 (Negative NoCt NoCt 34.82 32.62 22.71 20.77 N Control) Note: N target refers to the target to be detected as N; GAPDH target refers to an internal control; RNA-S target refers to a spike-in internal control.
Example 13: Determination of the Number of mRNA Molecules of SARS-Cov-2 Receptor ACE2 in Human 239 Cells
[0418] 1. Experimental Steps
[0419] DNA residues were detected by qPCR & RT-PCR, and RNA copy number concentration was detected by One-Step RT-ddPCR. The primers and probes related to plasmid construction and qPCR detection were shown in Table 53.
[0420] The preparation of mock virus with spike-in internal control (Example 2), RNA extraction (specific method i in Example 4) and ddPCR quantification method (method iv in Example 4) have been described in the above sections.
TABLE-US-00054 TABLE53 Relevantprimersandprobesforplasmid constructionandqPCRdetection SEQID PrimerName PrimerSequence 1 ACE2-F1 CAAGCTCTTCCTGGCTCCTTC (SEQIDNO:84) 2 ACE2-R1 GGTCTTCGGCTTCGTGGTTA (SEQIDNO:85) 3 ACE2-HEX-P1 5-HEX-AGCCTTGTTGCTGT AACTGCTGCTCAG-BHQ1-3 (SEQIDNO:86) 4 ACE2-F2 CAAGCTCGTCCTCTCCTCGTT (SEQIDNO:87) 5 ACE2-R2 GGTCTTCGGTCTGGTTTGAC (SEQIDNO:88) 6 ACE2-ROX-P2 5-ROX-AATCTGTATGCTGA TGGTCGCTCTGCC-BHQ2-3 (SEQIDNO:89)
[0421] The full-length sequence of quality control was shown in SEQ ID NO:50.
[0422] The sequence of standard (spike-in internal control) was shown in SEQ ID NO: 51.
[0423] 2. Experimental Results
[0424] 1) Spike-In Internal Control
[0425] RT-ddPCR quantification of RNA copy number concentration was performed according to SARS-cov-2 experimental method. The results showed that the copy number concentration of each aliquot of quality control RNA (detection probe ACE2-HEX) after mixing was about 2?10.sup.9 Copies/?l, and the copy number concentration of the spike-in internal control RNA (detection probe ACE2-ROX) was about 1?10.sup.9 Copies/?l.
[0426] According to obtained information, there is still no good method to measure the number of mRNA molecules of the gene to be detected in human cells. In the ORF stably transfected cell line of SARS-cov-2 receptor ACE2, the spike-in internal control we designed was used to determine the number of receptor ACE2 mRNA molecules.
[0427] 2) Detection of Primer Amplification Efficiency for Standards and Quality Controls
[0428] The concentration of quality control RNA and standard RNA prepared by in vitro transcription was diluted to 10000/1000/100/10/0 copies/rxn, and the amplification efficiencies of primers was tested to confirm that the amplification efficiency of standard primers and quality control primers were consistent. The results were shown in Table 54 and
TABLE-US-00055 TABLE 54 Primer amplification efficiency RNA Copies Log.sub.10Copies ACE2-HEX ACE2-ROX 10000 4 23.64 24.37 1000 3 27.11 27.20 100 2 29.69 30.11 10 1 32.50 33.20 NTC 0 UTD UTD R2 0.9928 0.9996 E 1.14 1.19
[0429] 4) SL 221-293T RNA and 293T RNA Quality Detection
[0430] The primers and probes in Table 53 were used to detect the quality of the extracted two types of cellular RNAs, and the results were shown in Table 55 and Table 56; with reference to the detection results of NanoDrop ND-1000 micro-ultraviolet spectrophotometer, the extracted RNA was of good quality and can be used for follow-up detection.
TABLE-US-00056 TABLE 55 SL 221-293T RNA quality detection SL221 RNA-pg/rxn 5000.00 1666.67 ACE2-HEX 22.66 22.48 23.93 24.18 GAPDH-CY5 26.20 26.19 27.60 27.90
TABLE-US-00057 TABLE 56 293T RNA quality detection 293T RNA-pg/rxn 25.00 12.5 GAPDH-CY5 29.64 30.96 31.2 31.77
Example 14 Effect of Spike-in Standards on Quantification Results of Intracellular Target ACE2 mRNA
[0431] 1. Experimental Materials
[0432] Reagents: [0433] 5?Probes One-Step RT-qPCR Mix (GeneCopoeia) [0434] 10?BlazeTaq? RTase Mix (GeneCopoeia) [0435] Primer (ACE2-1, ACE2-2, GAPDH) (Golden Wisdom) [0436] Probe (ACE2-HEX, ACE2-ROX, GAPDH-CY5) (Shanghai Bailiger) [0437] SL 221-293T RNA/293T RNA (GeneCopoeia) [0438] Equipment: ABI ViiA 7 qPCR instrument
[0439] 2. Experimental Steps
[0440] 1) According to the pre-experimental results of the quality control RNA, spike-in standard RNA and SL 221-293T RNA, and referring to the quantitation data of ddPCR, the quality control RNA, standard RNA and 293T RNA were subjected to a gradient dilution in a biological safety cabinet to obtain 2000/200/20/2 copies/?l of control RNA, 1000/100/50 copies/?l of standard RNA and 1000/333/111/37/12/4/1/0 pg/?l of SL 221-293T RNA/293T RNA.
[0441] 2) The RT-qPCR reaction system was prepared in a biological safety cabinet. The targets to be detected were ACE2-HEX and ACE2-ROX; the system was shown in Table 57. In the detection of quality control RNA and standard RNA, 293T RNA should be added to simulate cell detection; in the detection of intracellular ACE2 expression, 293T RNA was not added.
TABLE-US-00058 TABLE 57 Triple RT-qPCR reaction system components volume 5 ? One-Step RT-qPCR Mix for Probes 5 ?l 10 ? BlazeTaq RTase Mix 2.5 ?l ACE2-Primer1 0.25 ?l ACE2-Primer2 0.25 ?l GAPDH-Primer 0.25 ?l ACE2-HEX-Primer1 0.25 ?l ACE2-ROX 0.25 ?l GAPDH-CY5 0.25 ?l 293T RNA 1 ?l Standard RNA (1000/100/50 copies/?l) 1 ?l Quality Control RNA/SL 293T RNA 5 ?l ddH2O 10 ?l Total 25 ?l
[0442] 3) After the system was completely prepared, RT-PCR quantitative detection was performed on a qPCR instrument (ABI ViiA7).
[0443] 3. Experimental Results
[0444] 1) Preparation of Standard Curve of Standards and Quality Controls
[0445] The standard curves of the standard and quality control were shown in
[0446] The detection results were shown in Table 58 when the copy number of the standard spike-in internal control RNA was kept unchanged and the concentration of the quality control RNA was serially diluted. The detection results were shown in Table 59 when the copy number of the quality control RNA was kept unchanged and the concentration of the standard spike-in internal control RNA was serially diluted.
TABLE-US-00059 TABLE 58 Detection of quality control RNA with gradient concentration when the copy number of standard RNA being kept unchanged Quality Control Standard RNA-100 copies/rxn RNA-copies/rxn ACE2-HEX ACE2-ROX GAPDH-CY5 10000 23.73 30.54 28.88 23.55 30.89 28.44 1000 27.25 30.11 29.38 26.97 30.00 29.35 100 29.62 29.86 27.82 29.76 29.73 27.91 10 32.19 29.90 28.18 32.54 29.75 28.20 0 UTD 29.95 28.01 UTD 29.96 28.00 NTC UTD UTD UTD UTD UTD UTD
TABLE-US-00060 TABLE 59 Detection of standard RNA with gradient concentration when the copy number of quality control RNA being kept unchanged Standard RNA- Quality Control RNA-100 copies/rxn copies/rxn ACE2-ROX ACE2-HEX GAPDH-CY5 1000 28.16 30.51 30.70 27.86 30.16 30.30 100 31.25 31.54 30.99 31.66 31.55 30.10 10 35.01 32.29 30.62 34.67 32.11 30.50 0 UTD 29.49 30.68 UTD 29.80 30.70 NTC UTD UTD UTD UTD UTD UTD
[0447] Analysis of the results: When the concentration of the quality control RNA was 10 copies/rxn, the Ct value of ACE2-HEX was not significantly different from that of ACE2-ROX when the concentration of the standard RNA was 50 copies/rxn, with a ?Ct value being 0.1, indicating that the quantification was accurate and the reaction system was good.
[0448] 2) Detection of Intracellular ACE2 Expression
[0449] The expression of ACE2 was detected when the copy number of standard RNA was kept unchanged and the SL 221-293T RNA was diluted in gradient. The results were shown in Table 60.
TABLE-US-00061 TABLE 60 Detection of SL 221-293T RNA with gradient concentration when the copy number of the standard spike-in internal control RNA being kept unchanged Standard RNA-ACE2- Standard RNA-ACE2- Standard RNA-ACE2- SL 221 1000 copies/rxn 100 copies/rxn 50 copies/rxn RNA- ACE2- ACE2- GAPDH- ACE2- ACE2- GAPDH- ACE2- ACE2- GAPDH- pg/rxn HEX ROX CY5 HEX ROX CY5 HEX ROX CY5 5000 22.08 27.72 23.65 22.60 30.54 24.48 22.19 34.30 24.42 22.30 27.89 23.87 22.72 30.89 24.61 22.41 33.99 24.77 1666.67 23.89 27.72 23.48 24.40 30.11 27.58 23.58 32.14 24.66 24.15 28.16 25.67 24.32 30.00 26.14 23.68 32.53 25.81 555.56 25.71 27.89 26.71 25.81 29.86 27.06 25.33 31.23 27.29 25.60 27.97 26.47 25.75 29.73 26.21 25.21 31.35 27.02 185.19 27.95 28.34 28.04 27.49 29.90 29.08 27.59 31.27 30.93 27.37 28.17 28.76 27.36 29.75 28.85 27.02 31.42 28.92 61.73 28.96 28.08 29.85 28.99 29.93 29.65 28.71 31.17 30.20 28.76 27.95 31.10 28.61 29.58 31.39 28.57 31.13 30.64 20.58 30.88 28.11 33.09 30.69 30.10 32.50 30.21 31.42 32.81 30.81 28.14 31.93 31.05 29.95 34.17 30.41 31.43 32.67 6.86 32.44 28.08 34.25 32.48 29.96 33.83 32.45 31.57 34.46 32.28 28.37 33.59 31.56 29.76 34.23 31.89 31.56 34.16 0.00 UTD 28.05 UTD UTD 30.12 UTD UTD 31.36 UTD UTD 28.23 UTD UTD 30.21 UTD UTD 31.59 UTD
[0450] Analysis of results: Referring to the detection result of the quality control RNA, the number of transcribed mRNA molecules of ACE2 in cells was 50 copies/10 pg RNA. The total RNA extracted from one cell was about 10 pg, that is, 10 pg/cell. Therefore, the expression of ACE2 in SL 221-293T cells was approximately 50?5 copies/cell.
[0451] The results showed that the spike-in internal control of the present invention could be used to accurately determine the copy number of organisms such as RNA virus (2019-nCoV) and the copy number of viral RNA molecules. It can also be widely used to evaluate the transcription levels and the number of related mRNA molecules for endogenous genes in biological cells, or exogenous genes integrated into genome by gene editing methods during physiological changes and changes in different regulatory factors, thus having extensive application value.