P450 Cytochrome Enzyme for Andrographolide Synthesis and Its Application

Abstract

The present disclosure provides a P450 cytochrome enzyme for andrographolide synthesis and its application, belonging to the field of bioengineering. The present disclosure uses Saccharomyces cerevisiae CEN.PK2-1D as a host, and implements knockout of ROX1 and GAL80 genes on the genome, and integrative expression of GGPP synthase encoding gene and CPS diterpene synthase encoding gene at ROX1 site; and implements free expression of ApCPR and CYP71A8 and CYP71D10 both with truncated signal peptides, successfully constructing recombinant S. cerevisiae, and achieving de novo synthesis of 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid. Compared with the blank, a response value of a product peak reaches 1.9*106, and this strategy provides necessary reference for analyzing biosynthetic pathway of andrographolide and using metabolic engineering to synthesize andrographolide and related derivatives thereof.

Claims

1. A recombinant Saccharomyces cerevisiae, comprising knockout of ROX1 and GAL80 genes on the genome; integrative expression of a GGPP synthase encoding gene and CPS diterpene synthase encoding gene; and free expression of CYP71A8 encoding gene CYP71A8t with N-terminal truncated by 32 amino acids, CYP71A10 encoding gene CYP71D10t with N-terminal truncated by 28 amino acids, and CPR encoding gene ApCPR; wherein a nucleotide sequence of the CYP71A8 with N-terminal truncated by 32 amino acids is set forth in SEQ ID NO:3 and a nucleotide sequence of the CYP71D10 with N-terminal truncated by 28 amino acids being shown in SEQ ID NO:4; a nucleotide sequence of the ApCPR is set forth in SEQ ID NO:7; a nucleotide sequence of the GGPP synthase is set forth in SEQ ID NO:8; and a nucleotide sequence of the CPS diterpene synthase is set forth in SEQ ID NO:9.

2. The recombinant S. cerevisiae according to claim 1, wherein after the knockout of ROX1 site, the GGPP synthase encoding gene and the CPS diterpene synthase encoding gene are integrated at the ROX1 site.

3. The recombinant S. cerevisiae according to claim 1, wherein promoter P.sub.PGK1 is used for starting expression of the CPR encoding gene; promoter P.sub.TEF1 is used for starting expression of the CYP71A8t; and promoter P.sub.GAL7 is used for starting expression of the CYP71D10t.

4. The recombinant S. cerevisiae according to claim 1 3, wherein pY26 series vectors or pET series vectors are used as expression vectors.

5. A whole-cell catalyst, containing the recombinant S. cerevisiae according to claim 1.

6. A method for synthesizing 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid, using the recombinant S. cerevisiae according to claim 1 or the whole-cell catalyst comprising the recombinant S. cerevisiae as a fermentation strain for fermentation to produce 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid.

Description

BRIEF DESCRIPTION OF FIGURES

[0041] FIG. 1: Reaction diagram for catalytic synthesis of 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid by eukaryotic microorganisms.

[0042] FIG. 2: Vector map of pRS426-TEF1-Cas9-gRNA-URA3.

[0043] FIG. 3: Plasmid map of pET22b(+)-P.sub.T7-CYP71A8t and pET28a(+)-P.sub.T7-CYP71D10t.

[0044] FIG. 4: SDS-PAGE diagram of BL21 (DE3) expressing CYP71A8t and CYP71D10t; 1: pET22b empty vector; 2: pET22b-CYP71A8t; M: Marker; 3: pET28a empty vector; and 4: pET28a-CYP71D10t.

[0045] FIG. 5: Plasmid map of pY26-P.sub.TEF1-CYP71A8t-P.sub.GAL7-CYP71D10ts.

[0046] FIG. 6: LCMS-IT-TOF ion chromatogram of recombinant S. cerevisiae catalyzing ent-Copalol to synthesize 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid.

DETAILED DESCRIPTION

[0047] (I) Culture medium

[0048] LB medium: peptone 10 g/L, yeast powder 5 g/L, and sodium chloride 10 g/L. 20 g/L agar powder is added to prepare an LB solid culture medium.

[0049] YPD medium: peptone 20 g/L, yeast powder 10 g/L, and glucose 20 g/L. 20 g/L agar powder is added to prepare a YPD solid medium.

[0050] TB medium: peptone 12 g/L, yeast powder 24 g/L, dipotassium hydrogen phosphate 12.54 g/L, potassium dihydrogen phosphate 2.31 g/L, and glycerol 5 g/L.

[0051] YNB medium: glucose 20 g/L, and 20 mL/LYNB medium (purchased from Sangon Biotech (Shanghai) Co., Ltd.). 20 g/L agar powder is added to prepare a YNB solid medium.

[0052] (II) Strains and plasmids

[0053] pY26-GDP-TEF, pET22b(+), pET28a(+) and pMD-19 vectors are all commercial plasmids, S. cerevisiae CEN.PK2-1D is a commercial yeast cell, and chassis cell C800 is a publicly available strain, recorded in Promoter-Library-Based Pathway Optimization for Efficient (2S)-Naringenin Production From p-Coumaric Acid in Saccharomyces cerevisiae, Song Gao, Hengrui zhou, Jingwen Zhou, Jian chen. J Agric Food Chem, 2020 Jun. 24.

[0054] A pRS426-TEF1-Cas9-gRNA-URA3 vector (SEQ ID NO:49) is synthesized by Jiangsu Genecefe Biotechnology Co., Ltd., and the vector map is shown in FIG. 2.

[0055] (III) 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid detection conditions

[0056] Measurement is performed using LCMS-IT-TOF. Conditions: Chromatographic column C18 (4.6 mm?250 mm, 5 ?m); mobile phase methanol (B)-water (A), gradient elution (0-24 min, 30-60% B; 24-40 min, 60% B; 40-46 min, 60%-30% B; 46-50 min, 30% B); column temperature 35? C.; flow rate 0.5 mL/min; and injection volume 5 ?L.

Example 1 Construction of Recombinant Plasmids pET22b(+)-CYP71A8t and pET28a(+)-CYP71D10t

[0057] Two original CYP450 enzymes CYP71A8 (a nucleotide sequence as shown in SEQ ID NO:1) and CYP71D10 (a nucleotide sequence as shown in SEQ ID NO:2) derived from Andrographis paniculata were used as templates respectively. PCR amplification was performed using primer pairs 71A8t-F/71A8t-R and 71D10t-F/71D10t-R to obtain target fragments CYP71A8t (a nucleotide sequence as shown in SEQ ID NO:3) and CYP71D10t (a nucleotide sequence as shown in SEQ ID NO:4) both with truncated signal peptides. The amplified CYP71A8t and CYP71D10t were verified by 1.5% agarose gel electrophoresis and then subjected to Gibson assembly with the pET22b(+) and pET28a(+) expression vectors respectively. The assembled plasmids were transferred into E. coli JM109 competent cells, spread on an LB solid medium containing corresponding antibiotics, and cultured at 37? C. overnight. Positive clones were selected and plasmids were extracted. After sequencing was correct, the plasmids were reserved for expression of recombinant E. coli BL21 (DE3) protein. The plasmids were named pET22b(+)-P.sub.T7-CYP71A8t and pET28a(+)-P.sub.T7-CYP71D10t respectively (plasmid map shown in FIG. 3).

TABLE-US-00001 TABLE1 PrimersusedforconstructingCYP71A8tandCYP71D10texpressionvectors Primer Sequence(5-3) 71A8t-F CTGCCCAGCCGGCGATGGCCACCAAGAACTTGCCCCCGT SEQIDNO:13 71A8t-R CAGTGGTGGTGGTGGTGGTGAACGAACACACCCTCAGTATA SEQIDNO:14 GAACTTTG 71D10t-F TAAGAAGGAGATATACCATGAAACGTCCCCGGAGTTCCG SEQIDNO:15 71D10t-R CAGTGGTGGTGGTGGTGGTGCTTTACAGGCAAAGGGTTTTT SEQIDNO:16 CAATTTGGG

Example 2 Heterologous Expression of CYP71A8t and CYP71D10t

[0058] After the plasmids pET22b(+)-P.sub.T7-CYP71A8t and pET28a(+)-P.sub.T7-CYP71D10t constructed in Example 1 were respectively transferred into E. coli BL21 competent cells, single clones were selected and inoculated into an LB medium containing 100 mg/L ampicillin and 50 mg/L kanamycin respectively, and cultured at 37? C. and 220 rpm for 16 h to serve as seed liquid. Then the seed liquid in a volume ratio of 1% inoculation amount was respectively transferred to a TB medium with ampicillin or kanamycin (50 mL medium in a 250 mL shaking flask, 50 g/L antibiotics, and 1/1000 volume ratio), and cultured at 37? C. and 220 rpm until OD.sub.600 of fermentation broth reached 0.6-0.8. A final concentration of 80 mg/L 5-aminolevulinic acid hydrochloride, 10 mg/L FeSO.sub.4 solution and 0.5 mM IPTG were added to induce expression of CYP71A8t and CYP71D10t proteins. After induction at 16? C. for 20 h, the cells were collected by centrifugation at 4? C. and 6000 rpm for 15 min.

[0059] After washing the collected cells twice with PBS buffer (pH=7.4), lysis buffer (500 mM potassium phosphate, pH 7.4, 250 mM NaCl, 0.25% sodium cholate, 10% glycerol, 10 mM imidazole, and 10 mM ?-mercaptoethanol) was added to resuspend the cells. The cells were sonicated on ice for 3 minutes, and cell lysate was centrifuged at 4? C. and 10000 rpm for 20 min to remove cell debris. Supernatant was collected and subjected to SDS-PAGE protein verification (results shown in FIG. 4).

Example 3 Expression Identification of Recombinant Plasmids pET22b(+)-CYP71A8t57 and pET28a(+)-CYP71D10t59

[0060] Using original sequences of CYP71A8 and CYP71D10 as templates and using primers (Table 2), 57 and 59 amino acids were truncated respectively, and named CYP71A8t57 (a nucleotide sequence as shown in SEQ ID NO:5) and CYP71D10t59 (a nucleotide sequence as shown in SEQ ID NO:6). A method for constructing recombinant plasmids was the same as in Example 1, and the corresponding plasmids were named pET22-CYP71A8t57 and pET28-CYP71D10t59. Induction and identification methods were the same as in Example 2. Supernatant of lysate was collected. SDS-PAGE protein electrophoresis results showed that the protein was not expressed.

TABLE-US-00002 TABLE2 PrimersusedforconstructingCYP71A8t57andCYP71D10t59expressionvectors Primer Sequence(5-3) 71A8t57-F CACCAGCTGAGCTCATTGCCTCACCACGACCTCCGGC SEQIDNO:17 71A8t57-R CAGTGGTGGTGGTGGTGGTGAACGAACACACCCTCAGTATAGAAC SEQIDNO:18 TTTG 71D10t59-F GTCAGCTCCCGACCACCGCATCATATTTTAGCCGACTTGGCGTC SEQIDNO:19 71D10t59-R CAGTGGTGGTGGTGGTGGTGCTTTACAGGCAAAGGGTTTTTCAAT SEQIDNO:20 TTGGG

Example 4 Construction of S. cerevisiae CW1006

[0061] Using S. cerevisiae CEN.PK2-1D genome as a template, primer pairs 2UProx1-F/2UProx1-R and 7DOWNrox1-F/7DOWNrox1-R were used to amplify and obtain upstream and downstream homology fragments of ROX1 respectively, primer 3GAL7-F/3GAL7-R was used to amplify and obtain a promoter P.sub.GAL7 fragment, and primer 5TEF1-F/5TEF1-R was used to amplify and obtain a promoter P.sub.TEF1 fragment. Using Andrographis paniculata genome as a template, primer 4 ApGGPPS-F/4 ApGGPPS-R was used to amplify and obtain an ApGGPPs fragment, and primer 6ApCPS-F/6ApCPS-R was used to amplify and obtain an ApCPS fragment. Using pMD-19 vector as a template, primer 1GJ-F/1GJ-R was used to amplify and obtain a linearized fragment of vector pMD-19. The above fragments were purified and subjected to Gibson assembly to obtain vector pMD19T-UProx1-P.sub.GAL7-ApGGPPs-P.sub.TEF1-ApCPS-DOWNrox1. The obtained vector was transformed into E. coli JM109 and sequenced for verification, and positive recombinant vector pMD19T-UProx1-P.sub.GAL7-ApGGPPs-P.sub.TEF1-ApCPS-DOWNrox1 was obtained. Using the above vector as a template, primer 2UProx1-F/7DOWNrox1-F was used to amplify and obtain a Donar-ROX1 fragment.

[0062] Using pRS426-TEF1-Cas9-gRNA-URA3 vector as a template, primer Cas9-F/Cas9-R was used to amplify and obtain linearized vector pRS426-TEF1-Cas9-gRNA-URA3. The obtained vector was transformed into E. coli JM109 and sequenced for verification. Recombinant vector pRS426-20nt with a correct sequence was obtained.

[0063] The above Donar-ROX1 fragment and pRS426-20nt were transformed into chassis cell C800, spread on YNB solid plates (containing 50 mg/L Leu, His and Trp), and cultured at 30? C. for 2-3 days. Positive clone strains were selected and passaged multiple times, then pRS426 plasmid was lost (cells can grow on YPD solid plates, but cannot grow on the YNB solid plates containing 50 mg/L Leu, His and Trp), and the CW1006 strain was successfully constructed.

TABLE-US-00003 TABLE3 PrimersusedforconstructingCW1006strain Primer Sequence(5-3) 1GJ-F gaatttgacaatgttaagctttgttaaacagcttggcgtaatcatggtcatag SEQIDNO:21 ctgtt 1GJ-R ggtagttccacgcggccgatccgagttctaattcactggccg SEQIDNO:22 2UProx1-F ggccagtgaattagaactcggatcggccgcgtggaactac SEQIDNO:23 2UProx1-R aaggatagtaagctggcaaatgttgattgtctaactgcgttcttttgt SEQIDNO:24 3GAL7-F aagaacgcagttagacaatcaacatttgccagcttactatccttcttgaaaat SEQIDNO:25 atg 3GAL7-R AATTTTGGAGAAACGTCGGttttgagggaatattcaactgttttttttt SEQIDNO:26 atcatgttga 4ApGGPPS-F agttgaatattccctcaaaaCCGACGTTTCTCCAAAATTCATTTCA SEQIDNO:27 ATTTTTTC 4ApGGPPS-R tagaaacattttgaagctatTCAATTCTGCCTCCGACCAATGTAC SEQIDNO:28 5TEF1-F ATTGGTCGGAGGCAGAATTGAatagcttcaaaatgtttctactcctt SEQIDNO:29 ttttactcttc 5TEF1-R AGGAGGGAAAACAAAGGCATcttagattagattgctatgctttcttt SEQIDNO:30 ctaatgagc 6ApCPS-F gcatagcaatctaatctaagATGCCTTTGTTTTCCCTCCTCG SEQIDNO:31 6ApCPS-R gcataaatttttagttaaagggTCAGAAGTAACGGCGGGTATGGT SEQIDNO:32 C 7DOWNrox1-F CATACCCGCCGTTACTTCTGAccctttaactaaaaatttatgcatttg SEQIDNO:33 gctcc 7DOWNrox1-R tatgaccatgattacgccaagctgtttaacaaagcttaacattgtcaaattctt SEQIDNO:34 cagg Cas9-F TGTTAATACTTCTAACTATAgttttagagctagaaatagcaagttaaa SEQIDNO:35 ataaggctag Cas9-R TATAGTTAGAAGTATTAACAgatcatttatctttcactgcggagaagtt SEQIDNO:36 tc

Example 5 Construction of Eukaryotic Microorganism Expression System for CYP71A8t and CYP71D10t

[0064] Using Andrographis paniculata genome as a template, primer CPR-F/CPR-R was used to amplify ApCPR gene. Using S. cerevisiae genome as a template, primer P.sub.GAL7-F/P.sub.GAL7-R was used to amplify promoter P.sub.GAL7, and primer PTEF1-F/PTEF1-R was used to amplify promoter P.sub.TEF1. Using a nucleotide sequence of CYP71A8 as a template, primer CYP71A8t-F/CYP71A8t-R was used to amplify CYP71A8t. Using a nucleotide sequence of CYP71D10 as a template, primer CYP71D10t-F/CYP71D10t-R was used to amplify CYP71D10t. Using expression vector pY26-GDP-TEF as a template, primer pY26-F/pY26-R was used to amplify a linearized vector. The amplified products were recovered by ethanol precipitation. The promoter P.sub.GAL7, promoter P.sub.TEF1, CYP71A8t, CYP71D10t and linearized vector were subjected to Gibson assembly to obtain a recombinant vector. The recombinant vector was transferred into E. coli JM109 competent cells, spread on an LB solid medium containing 100 mg/L ampicillin, and cultured at 37? C. overnight. Positive clones were selected and plasmids were extracted. Correctly sequenced plasmids were transferred into the S. cerevisiae CW1006 constructed in Example 4, spread on YNB solid plates (containing 50 mg/L Leu, His and Trp), and cultured at 30? C. for 2-3 days. Positive clones were selected, and recombinant S. cerevisiae CW1006/pY26-P TEF1-CYP71A8t-P.sub.GAL7-CYP71D10t was constructed (plasmid map shown in FIG. 5).

TABLE-US-00004 TABLE4 PrimersusedforconstructingpY26-PTEF1-CYP71A8t-PGAL7-CYP71D10texpressionvector Primer Sequence(5-3) CPR-F GTAAAGGGGGSGGGGSGGGGSATGGATTCGCGGCTGGAG SEQIDNO:37 CPR-R gaatgtaagcgtgacataacTCACCAAACATCCCTCAGGTATCG SEQIDNO:38 PGAL7-F accaaacctctggcgaagaatttgccagcttactatccttcttgaaa SEQIDNO:39 PGAL7-R GGGGGCAAGTTCTTGGTCATttttgagggaatattcaactgtttttttttat SEQIDNO:40 catgttg CYP71A8t-F agttgaatattccctcaaaaATGACCAAGAACTTGCCCCC SEQIDNO:41 CYP71A8t-R cattttgaagctatgagctcAACGAACACACCCTCAGTATAGAACTTT SEQIDNO:42 G PTEF1-F CAAAGTTCTATACTGAGGGTGTGTTCGTTgagctcatagcttcaaaat SEQIDNO:43 gtttctactcctt PTEF1-R GAACTCCGGGGACGTTTCATactagttctagaaaacttagattagattgc SEQIDNO:44 tatgctttc CYP71D10t-F ctaagttttctagaactagtATGAAACGTCCCCGGAGTTCC SEQIDNO:45 CYP71D10t-R ATCCATSCCCCSCCCCSCCCCCTTTACAGGCAAAGGGTTTTTCA SEQIDNO:46 ATTTGG pY26-F ACCTGAGGGATGTTTGGTGAgttatgtcacgcttacattcacgcc SEQIDNO:47 pY26-R aaggatagtaagctggcaaattcttcgccagaggtttggtc SEQIDNO:48

Example 6 Synthesis of 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic Acid by Recombinant S. cerevisiae

[0065] The recombinant S. cerevisiae CW1006/pY26-P.sub.TEF1-CYP71A8t-P.sub.GAL7-CYP71D10t constructed in Example 5 was streaked and inoculated into an LB medium containing 50 mg/L ampicillin, and cultured at 37? C. overnight. Single colonies were selected and transferred into an YNB medium (containing 50 mg/L Leu, His and Trp), and cultured at 30? C. and 220 rpm for 16-18 h. The culture was transferred to a fresh 25 mL YPD medium at a 1% (v/v) inoculation amount, and cultured at 30? C. and 220 rpm. After fermentation for 120 h, fermentation broth was collected, and a response value of 3,15,19-Trihydroxy-8(17),13-ent-labdadiene-16-oic acid was measured by LCMS-IT-TOF. The results were shown in FIG. 6. A response value of a product peak reached 1.9*106.

[0066] Although the present disclosure has been disclosed in exemplary embodiments above, it is not intended to limit the scope of the present disclosure. Those skilled in the art can make various changes and modifications within the spirit and scope of the present disclosure, and therefore the scope of protection of the present disclosure should be defined by the claims.