COCAINE ESTERASE MUTANT AND USE THEREOF
20240117329 ยท 2024-04-11
Inventors
- Xiabin CHEN (Hangzhou, CN)
- Jianzhuang YAO (Hangzhou, CN)
- Shurong HOU (Hangzhou, CN)
- Xingyu DENG (Hangzhou, CN)
- Yun ZHANG (Hangzhou, CN)
- Junsen TONG (Hangzhou, CN)
Cpc classification
International classification
Abstract
Disclosed are a cocaine esterase mutant and use thereof. The cocaine esterase mutant is obtained by mutating a wildtype cocaine esterase, an amino acid sequence of the wildtype cocaine esterase is shown as SEQ ID No.1, the cocaine esterase mutant is T172R/G173Q/L196C/I301C, or additionally added with V116K point mutation, or additionally added with A51 site mutation, and the A51 site mutation is L, Y, V, F or W. Catalytic efficiency of the cocaine esterase mutant screened on a cocaine toxic metabolite benzoylecgonine is greatly improved compared with that of a wildtype enzyme.
Claims
1. A cocaine esterase mutant obtained by mutating a wildtype cocaine esterase, wherein an amino acid sequence of the wildtype cocaine esterase is shown as SEQ ID No.1, and the cocaine esterase mutant is one of the following: (1) V116K, (2) T172R/G173Q/V116K, (3) T172R/G173Q/L196C/1301C/V116K, (4) T172R/G173Q/L196C/1301C/V116K/A51L, (5) T172R/G173Q/L196C/1301C/V116K/A51Y, (6) T172R/G173Q/L196C/1301C/V116K/A51V, (7) T172R/G173Q/L196C/1301C/V116K/A51F, and (8) T172R/G173Q/L196C/1301C/V116K/A51W.
2. The cocaine esterase mutant according to claim 1, wherein the cocaine esterase mutant is used for preparing a medicament for treating cocaine intoxication.
3. The cocaine esterase mutant according to claim 1, wherein the cocaine esterase mutant is used for preparing a hydrolytic agent for hydrolyzing benzoylecgonine into ecgonine and benzoic acid.
4. The cocaine esterase mutant according to claim 1, wherein the cocaine esterase mutant is used for treating cocaine or benzoylecgonine contamination in water or soil.
5. A gene encoding the cocaine esterase mutant according to claim 1.
6. The gene according to claim 5, wherein the gene is used for treating cocaine or benzoylecgonine contamination in water or soil.
7. An expression vector containing the gene according to claim 5.
8. A recombinant expression cell containing the expression vector according to claim 6.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0032]
[0033]
[0034]
DETAILED DESCRIPTION
[0035] The overall technical route of the present invention is shown in
Embodiment 1: Site-Directed Mutagenesis
[0036] CocE mutants were obtained by site-directed mutagenesis.
[0037] Firstly, cDNA (GenBank #AF173165.1, synthesized by Shanghai Generay Biotech) of wildtype CocE was constructed into an Escherichia coli expression vector pET-22b (+) (provided by Shanghai Generay Biotech, and a target gene containing C-terminal-6?His was inserted into NdeI and XhoI restriction site). Wildtype CocE plasmid was used as a template to design mutant primers, PCR products of the mutants were obtained through PCR (KOD One Mater Mix, Shanghai Toyobo) amplification. DNA templates in the products were removed through DpnI (Thermo Scientific, FD1703), and then transformed into competent cells (DH5a) to cyclize the PCR products. The transformed competent cell bacterial solution was coated on LB solid medium containing 100 ?g/ml ampicillin, and cultured at 37? C. for 15 hours. Monoclones were selected and the mutant plasmids were extracted by plasmid extraction kit. The mutant plasmids with correct sequence were confirmed by DNA sequencing. For those with multiple mutations, one mutation was followed by next round of mutation. Mutant primer design was shown in table 1.
TABLE-US-00001 TABLE1 Primersequencesusedforsite-directedmutagenesis Mutationsite Primer(5-3) T172R/G173Q Forwardprimer CTCTCATAGGTCGCCAGCTCATCACGTC Reverseprimer GACGTGATGAGCTGGCGACCTATGAGAG L196C Forwardprimer CTCGCAGCAATTTGCAATGACGTCG Reverseprimer CGACGTCATTGCAAATTGCTGCGAG I301C Forwardprimer GGAAGTTCGGCTGCGCCGCGACCTAC Reverseprimer GTAGGTCGCGGCGCAGCCGAACTTCC V116K Forwardprimer ATGTGGGCATGTTCGGCTTTTCGTACTTGGGT Reverseprimer ACCCAAGTACGAAAAGCCGAACATGCCCACAT A51L Forwardprimer GTGTTCTTGTGGTCGACGCAGT Reverseprimer ACTGCGTCGACCACAAGAACAC A51Y Forwardprimer TTCGACGTGTTCTACTGGTCGACGCAGTCG Reverseprimer CGACTGCGTCGACCAGTAGAACACGTCGAA A51V Forwardprimer GACGTGTTCGTTTGGTCGACGCA Reverseprimer TGCGTCGACCAAACGAACACGTC A51F Forwardprimer CCATACGACAAGTTCGACGTGTTCTTCTGGTC Reverseprimer GACCAGAAGAACACGTCGAACTTGTCGTATGG A51W Forwardprimer CCATACGACAAGTTCGACGTGTTCTGGTGGTC Reverseprimer GACCACCAGAACACGTCGAACTTGTCGTATGG
Embodiment 2: Protein Expression and Purification
[0038] The successfully constructed mutant plasmids were transformed into Escherichia coli BL21 competent cells to express proteins, the bacterial solution was inoculated into an LB liquid medium (containing 100 ?g/ml ampicillin), subjected to enlarge cultivation on a shaker at 37? C. and 250 rpm until OD.sub.600=0.6-0.8, and then the bacterial solution was cooled to 15? C. IPTG (Sigma, 367-93-1) was added until a final concentration was 1 mM, and then protein expression was induced at 15? C. and 180 rpm for 15 hours. The cells were collected and re-suspended in 50 mM Tris-HCl buffer (pH 7.4) containing 150 mM NaCl. Escherichia coli cells were disrupted with a precooled high-pressure cell disrupter (SCIENTZ JG-IA, Ningbo Scientz), centrifuged at 9,000 rpm for 45 minutes and then the supernatant was collected. The supernatant was mixed with a cobalt medium (Takara, TALON Metal Affinity Resin) by rotation at 4? C. for 2 hours to bind the protein containing 6?His to the medium. The binding solution was added into a gravity column, naturally flowing out under the action of gravity, and the target protein was purified by using a gradient elution method of imidazole with different concentrations. The eluted components were collected in a 30K (Millipore) ultrafiltration tube, and the buffer was replaced by centrifugal concentration. The protein was stored in solution S (50 mM HEPES, 20% D-sorbitol, 1 M glycine, pH 7.4). Protein concentration was determined by Bradford kit (Sangon Biotech, C503031-1000).
Embodiment 3: Enzyme Activity Analysis
[0039] Firstly, an experimental method for detecting a substrate BZE and a product benzoic acid BA by HPLC was established. Both BZE and BA had strong ultraviolet absorption at 230 nm. In HPLC analysis, acetonitrile and 0.1% formic acid were used as mobile phases to separate BZE and BA by C18 liquid chromatography column. The absorption of BZE and BA at wavelength 230 nm was detected by an ultraviolet detector, and linear standard curves of BZE and BA were obtained. The activity of BZE reaction catalyzed by CocE was determined, and the reaction temperature was 25? C., with three repetitions in each group. An enzymatic reaction was started by 50 ?L of substrate BZE solution with 50 ?L of enzyme solution (diluted with 0.1 M phosphate buffer (pH 7.4)). The specific reaction conditions were shown in Table 2.
TABLE-US-00002 TABLE 2 Conditions for in vitro catalytic reaction of high-activity mutant enzyme to substrate BZE BZE Reaction time Enzyme and concentration thereof concentration(?M) (min) Wildtype, 100, 250 4 T172R/G173Q, 500, 1,000, 2,500, 10 T172R/G173Q/L196C/I301C, (50 nM) 5,000, 7,500, 12,500 T172R/G173Q/L196C/I301C/V116K, 5, 10, 20, 50, 100, 200 2 T172R/G173Q/L196C/I301C/V116K/A51L, 500, 1,000 5 T172R/G173Q/L196C/I301C/V116K/A51Y, (4 nM) V116K, 5, 10, 20, 50, 100, 200 4 T172R/G173Q/V116K, 500, 1,000 10 T172R/G173Q/L196C/I301C/V116K/A51V, T172R/G173Q/L196C/I301C/V116K/A51F, T172R/G173Q/L196C/I301C/V116K/A51W, (4 nM)
[0040] 50 ?L of 10% perchloric acid was added to stop the reaction, and then, 50 ?L of acetonitrile was added, and the mixture was centrifuged at 12,000 rpm for 5 minutes. Then, the supernatant was diluted to an appropriate multiple and injected into 100 L. The peak time, peak areas and curves of BZE and BA were compared, and the residual BZE concentration and the BA concentration in the reaction sample were calculated. The k.sub.cat and K M of each mutant could be obtained by calculating the reaction rates of BA catalyzed by enzyme at different substrate concentrations, drawing a kinetic curve of the enzyme reaction with GraphPad Prism 8, and performing Michaelis-Menten kinetic analysis. The results were shown in Table 3.
TABLE-US-00003 TABLE 3 Catalytic kinetic parameters of high-activity mutant enzyme to substrate BZE K.sub.M k.sub.cat K.sub.eff Mutation site (?M) (min.sup.?1) (M.sup.?1min.sup.?1) RCE Wildtype WT 5,153 301.2 5.85 ? 10.sup.4 1.0 V116K 89.57 320.4 3.58 ? 10.sup.6 61.2 T172R/G173Q 4,355 418.7 9.61 ? 10.sup.4 1.6 T172R/G173Q/V116K 65.63 425.2 6.48 ? 10.sup.6 110.8 T172R/G173Q/L196C/I301C 3,709 556.7 1.50 ? 10.sup.5 2.6 T172R/G173Q/L196C/I301C/V116K 46.26 568.6 1.23 ? 10.sup.7 210.3 T172R/G173Q/L196C/I301C/V116K/A51L 27.84 873 3.14 ? 10.sup.7 536.5 T172R/G173Q/L196C/I301C/V116K/A51Y 43.59 910.6 2.09 ? 10.sup.7 357.4 T172R/G173Q/L196C/I301C/V116K/A51V 86.16 693.2 8.05 ? 10.sup.6 137.6 T172R/G173Q/L196C/I301C/V116K/A51F 59.29 733.9 1.24 ? 10.sup.7 211.8 T172R/G173Q/L196C/I301C/V116K/A51W 95.64 740.7 7.74 ? 10.sup.6 132.5 Note: K.sub.eff refers to the catalytic efficiency (k.sub.cat/K.sub.M) of the corresponding enzyme to the substrate BZE. RCE refers to a ratio of the catalytic efficiency of the mutant enzyme to BZE and that of the wildtype enzyme to BZE.
Embodiment 4: In Vivo Experiments in Animals
[0041] Experimental male SD rats (200 g/rat) purchased from Laboratory Animal Center of Zhejiang Academy of Medical Sciences were raised in a constant-temperature and constant-humidity environment. The feeding and experimental application was carried out by following Guide for the Care and Use of Laboratory Animals.
[0042] (1) Standard Curves for BA and BZE Blood Samples
[0043] Blood was collected from the femoral vein of rats using a blood collection needle and a heparin-treated capillary. Firstly, eight tubes of blood from the same rat, 75 ?L in each tube, were added to 100 ?L of 250 ?M paraxon to inhibit the effect of endogenous metabolizing enzymes on BZE, and frozen at ?80? C. After thawing, 19.7 ?L of mixed solution containing 0, 4, 10, 20, 40, 60, 100 and 200 ?M BA and BE standards, then subjected to vortex for 20 seconds, and then added with 150 ?L of acetonitrile and subjected to vortex for 1 minutes, then added with 50 ?L of 10% HClO.sub.4 and subjected to vortex for 1 minutes, centrifuged at 17,000 rcf for 15 minutes, and then centrifuged again after the supernatant was transferred. 250 ?L of supernatant were taken out for HPLC analysis. The sample volume was 100 ?L, and the HPLC experimental conditions were the same as those in Embodiment 3. The concentrations of BZE and BA in the final standard samples were 0, 0.2, 0.5, 1, 2, 3, 5 and 10 ?M respectively.
[0044] (2) High-Activity CocE Mutant Accelerated BZE Metabolism In Vivo
[0045] There were 5 rats in each group. Firstly, 0.2 or 1 mg/kg of high-active CocE mutant or normal saline was injected into the tail vein of rats, and 2 mg/kg BZE was injected into the tail vein within 1 minute. After BZE injection, 75 ?L of blood samples were taken at the 0.sup.th, 2.sup.nd, 5.sup.th, 10.sup.th, 30.sup.th, 60.sup.th, 90.sup.th and120.sup.th minutes respectively, and 100 ?L of 250 ?M paraxon were added in each sample, and then frozen at ?80? C. After thawing, the samples were subjected to vortex for 20 seconds, then added with 150 ?L of acetonitrile and subjected to vortex for 1 minute, then added with 50 ?L of 10% HClO.sub.4 and subjected to vortex for 1 minute, centrifuged at 17,000 g for 15 minutes, and then centrifuged again after the supernatant was transferred. 250 ?L of supernatant were taken out for HPLC analysis. The sample volume was 100 ?L. The BA and BZE concentrations in the blood of rats in each group at different time points were calculated according to the blood sample standard curve of the standards, so as to obtain the metabolism of BZE with or without the high-activity CocE mutant.
[0046] The results were shown in