Herbicide-resistance gene and application thereof in plant breeding
11952582 ยท 2024-04-09
Assignee
Inventors
- Jiankang Zhu (Shanghai, CN)
- Vipasha VERMA (Shanghai, CN)
- Feng Li (Shanghai, CN)
- Meiling Zhang (Shanghai, CN)
- Ming Li (Shanghai, CN)
- Mei Chen (Shanghai, CN)
Cpc classification
C12Y113/11027
CHEMISTRY; METALLURGY
International classification
Abstract
Provided are a mutant HPPD polypeptide having high resistance to a herbicide and an encoding gene thereof, and an application thereof in an improved plant. The amino acid at position 282 of the mutant HPPD polypeptide is mutated from arginine to serine at a wild-type HPPD polypeptide. In addition, the mutant HPPD polypeptide further comprises an amino acid at position 349 that is mutated from glutamic acid to lysine, and/or an amino acid at position 156 that is mutated from alanine to valine. The mutated HPPD polypeptide can be used for cultivating plants having resistance to a herbicide having HPPD inhibition.
Claims
1. An isolated herbicide resistance polypeptide comprising the amino acid sequence as set forth in SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or SEQ ID NO: 10.
2. An isolated polynucleotide encoding the herbicide resistance polypeptide of claim 1.
3. A vector comprising the polynucleotide of claim 2.
4. A host cell comprising the vector of claim 3.
5. A method for producing an herbicide resistance polypeptide, comprising the steps of: (a) culturing the host cell of claim 4 under conditions suitable for the expression of the herbicide resistance polypeptide, thereby expressing the herbicide resistance polypeptide; and (b) isolating the herbicide resistance polypeptide from said cell.
6. A method for producing a transgenic plant, comprising the steps of: (a) introducing, into a plant cell, a polynucleotide encoding the herbicide resistance polypeptide of claim 1; and (b) regenerating said transgenic plant from said plant cell; wherein the transgenic plant is selected from the group consisting of Arabidopsis, soybean, and rice.
Description
DESCRIPTION OF DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application with color drawing(s) will be provided by the Office by request and payment of the necessary fee.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
MODES FOR CARRYING OUT THE PRESENT INVENTION
(29) After extensive and intensive research, the inventors unexpectedly discovered HPPD inhibitor resistance genes PaHPPD-M3, PaHPPD-DS18, PaHPPD-DS73 and PaHPPD-SDM derived from Pseudomonas aeruginosa with high resistance to HPPD inhibitor and applications thereof, for the first time. Specifically, the invention relates to nucleic acid sequences, mutation sites and amino acid sequences of HPPD mutants PaHPPD-M3, PaHPPD-DS18, PaHPPD-DS73 and PaHPPD-SDM, and stability resistance detection in microorganisms. Experiments show that plant Arabidopsis introduced with the mutant gene showed significant HPPD inhibitory herbicide-resistance. The mutant gene has a very broad application prospect in the field of breeding HPPD inhibitory herbicide-tolerant plants. The present invention has been completed on the basis of this.
(30) Specifically, the presence of tyrosine aminotransferase in E. coli DH5a can catalyze the production of p-hydroxyphenylpyruvate (4-HPP) from tyrosine, which is used as a substrate for HPPD to produce homogentisic acid (HGA). After further oxidation and polymerization, a brown substance is produced. The addition of HPPD inhibitors will inhibit this reaction, thereby reducing the production of pigment. Therefore, the gradation of pigment can be used as an inhibition index of HPPD activity. By optimizing some of the properties of the pigment and the optimal conditions for higher resolution pigments, the inventors established a high-throughput E. coli screening system of tembotrion herbicide-resistance genes based on 96-well plates. Through heterologous expression of HPPD mutant genes from different species in E. coli DH5?, the resistance characteristics of E. coli DH5?-mutated gene to triketone herbicides were analyzed by detecting the absorption value of pigment at 405 nm (
(31) Using the E. coli pigment screening system, the invention obtained four new mutant HPPD enzymes, all of which retain the activity of catalyzing the conversion of p-hydroxyphenylpyruvate (HPP) to homogentisic acid and have higher tolerance to HPPD inhibitors than that of the original unmutated HPPD. The first HPPD mutant is PaHPPD-M3, wherein the arginine at position 282 of PaHPPD of Pseudomonas aeruginosa is mutated to serine (R282S). Specifically, the nucleic acid sequence, mutation site (C844A) and amino acid sequence of HPPD mutant PaHPPD-M3 are involved.
(32) The second HPPD mutant is PaHPPD-DS18, wherein the arginine at position 282 of PaHPPD of Pseudomonas aeruginosa is mutated to serine (R282S) and the glutamic acid at position 349 is mutated to lysine (E349K). Specifically, the nucleic acid sequence, mutation sites (C844A, G216A and G1045A) and amino acid sequence of HPPD mutant PaHPPD-DS18 are involved.
(33) The third HPPD mutant is PaHPPD-DS73, wherein the arginine at position 282 of PaHPPD of Pseudomonas aeruginosa is mutated to serine (R282S) and the alanine at position 156 is mutated to valine (A156V). Specifically, the nucleic acid sequence, mutation sites (C844A and C467T) and amino acid sequence of HPPD mutant PaHPPD-DS73 are involved.
(34) The fourth HPPD mutant is PaHPPD-SDM, wherein the arginine at position 282 of PaHPPD of Pseudomonas aeruginosa is mutated to serine (R282S), the glutamic acid at position 349 is mutated to lysine (E349K) and the alanine at position 156 is mutated to valine (A156V). Specifically, the nucleic acid sequence, mutation sites (G216A, C467T, C844A and G1045A) and amino acid sequence of HPPD mutant PaHPPD-SDM are involved. The nucleic acid sequences, mutation sites and amino acid sequences of the mutants PaHPPD-M3, PaHPPD-DS18, PaHPPD-DS73 and PaHPPD-SDM according to the present invention are provided. Further, the resistance of the mutant gene at the microbial level is provided, wherein the mutants PaHPPD-M3, PaHPPD-DS18 and PaHPPD-DS73 led to a tolerance of up to 100 ?M against three triketone herbicides (sulcotrione, mesotrione and tembotrion) in microorganism; and the mutant PaHPPD-SDM led to a tolerance of up to 60 ?M against three triketone herbicides (sulcotrione, mesotrione and tembotrion) in microorganism.
(35) At the same time, using the plant constitutive 35S promoter, the gene PaHPPD-M3 was over-expressed and transformed into Arabidopsis, and an Arabidopsis plant over-expressing PaHPPD-M3 that significantly resistant to HPPD inhibitors (triketone herbicides) was obtained. At the level of ?MS medium, the maximum tolerance concentration of HPPD inhibitor before the germination of T3 generation seeds of Arabidopsis overexpressing PaHPPD-M3 was 125 nM. Under conditions of herbicide-containing medium, the maximum tolerance concentration of HPPD inhibitor of T3 generation transgenic seedlings was 250 nM. Under potted conditions, HPPD inhibitor (mesotrione) was sprayed on fully expanded leaves of well-grown Arabidopsis, and the maximum tolerance concentration was 5 ?M.
(36) After being treated with 250 nM triketone herbicides for 6 h, the total chlorophyll and carotenoid contents of the leaves of Arabidopsis plants overexpressing PaHPPD-M3 were significantly higher than those of WT, OE At and OE Pa. Compared with the seedlings without herbicide treatment, the expression of HPPD, VTE1 and VET3 genes in PaHPPD-M3 overexpressing lines were significantly up-regulated, while the expression of HPPD, VTE1 and VET3 genes in WT, OE At and OE Pa lines were significantly down-regulated.
(37) The Arabidopsis plants overexpressing PaHPPD-M3 were cultured in ? MS medium containing 100 nM mesotrione for 72 h. Then the newly expanded leaves were stained with NBT and DAB respectively. The results indicated that the accumulation of superoxide and hydrogen peroxide in Arabidopsis plants overexpressing PaHPPD-M3 was significantly less than that in WT, OE At and OE Pa.
(38) At the same time, the gene PaHPPD-SDM was overexpressed and cloned into 35S-pCAMBIA1305-3FLAG vector, which was transferred into rice Nipponbare through rice transgene technology mediated by Agrobacterium to obtain the transgenic rice T0 generation strain. Transgenic rice in pots was sprayed with herbicide (200 ?M mesotrione) on well-grown seedlings. 21 days after the treatment, the leaves of wild-type rice were albino and the growth was inhibited until death, while OE PaHPPD-SDM rice grew well and the phenotype was similar to that of untreated OE PaHPPD-SDM. The chlorophyll content of OE PaHPPD-SDM leaves after treatment did not decrease significantly.
(39) Under normal growth conditions (treated with 0.1% Tween-20 as control), the contents of superoxide, hydrogen peroxide (H.sub.2O.sub.2) and malondialdehyde (MDA) in leaves of WT and OE SDM rice lines were similar. 1 week after spraying with 200 ?M mesotrione (prepared with 0.1% Tween-20), the contents of superoxide, H.sub.2O.sub.2 and MDA in WT rice leaves were significantly higher than that in OE SDM rice leaves. It showed that the overexpression of PaHPPD-SDM in OE SDM rice prevented the accumulation of peroxide, H.sub.2O.sub.2 and MDA, and enhanced the resistance to triketone herbicides.
(40) Using the plant constitutive 35S promoter, the genes PaHPPD-Gm and PaHPPD-SDM were overexpressed and cloned into 35S-pCAMBIA1305-3FLAG vector, which were transferred into soybean William 82 through soybean transgenic technology mediated by Agrobacterium to obtain transgenic soybean T0 and T1 generation strains. The leaves were coated with different concentrations of mesotrione (0, 1, 5, 10 and 30 ?M, prepared with 0.1% Tween-20). 2 weeks later, the leaves of the OE PaHPPD-SDM soybean line did not show symptoms of bleaching or damage at a mesotrione concentration of 30 ?M, while WT showed bleaching symptoms at a mesotrione concentration of 5 ?M, and the bleaching symptoms became more severe as the concentration increased.
(41) 4 week-old seedlings of T1 generation soybean line of OE PaHPPD-SDM, T1 generation soybean of OE GmHPPD and WT were sprayed twice with 20 ?M mesotrione. 2 weeks after the treatment, it was found that the contents of chlorophyll a and chlorophyll b in the leaves and the plant height of OE GmHPPD and WT sprayed with mesotrione were significantly lower than that of the control treatment, and the performance of WT was more significant. At the same time, it was found that the contents of chlorophyll a and chlorophyll b in the leaves and the plant height of OE PaHPPD-SDM sprayed with mesotrione were reduced compared with the control, but the contents of chlorophyll a and chlorophyll b and the plant height were both significant higher than that of OE GmHPPD and WT treated with mesotrione. It was shown that OE PaHPPD-SDM soybean significantly improved its resistance to triketone herbicides.
(42) Therefore, the present invention relates to nucleic acid sequences encoding mutant PaHPPD-M1-7, PaHPPD-DS18, PaHPPD-DS73 and PaHPPD-SDM, mutation sites and amino acid sequences thereof, as well as PaHPPD-SDM rice lines and seeds and PaHPPD-SDM soybean strains and seeds. Further provided are methods for imparting herbicide-resistance or tolerance to plants, particularly resistance or tolerance to certain classes of HPPD inhibitory herbicides through PaHPPD-M3 and PaHPPD-SDM. The mutant gene will play an important role in the application of obtaining plants tolerant to HPPD inhibitory herbicides.
(43) Terms
(44) As used herein, the term HPPD refers to 4-Hydroxyphenylpyruvate Dioxygenase (HPPD, EC 1.13.11.27) existing in various organisms and it is a key enzyme that catalyzes the oxygenation of4-hydroxyphenylpyruvate (HPP, the degradation product of tyrosine) to produce homogentisate (HGA). Inhibition of HPPD will lead to uncoupling of photosynthesis in plant cells and lack of auxiliary light-harvesting pigments. At the same time, due to the lack of photoprotection normally provided by carotenoids, reactive oxygen intermediates and photooxidation cause chlorophyll destruction, resulting in albinism in the photosynthetic tissues of plants, and the growth is inhibited until death. HPPD inhibitory herbicides have proved to be very effective selective herbicides with spectral herbicidal activity, which can be used both before and after buds, with high activity, low residues, safety for mammals and environmental friendliness, etc.
(45) As used herein, the terms HPPD inhibitor, HPPD inhibitory herbicide, and HPPD inhibiting herbicide are used interchangeably, and refer to a preparation that inhibits plant growth or even causes plant death by inhibiting HPPD, preferably are triketone HPPD inhibitors, such as sulcotrione, mesotrione, and tembotrion.
(46) As used herein, the terms herbicide-resistance polypeptide, mutated HPPD polypeptide, mutated PaHPPD polypeptide, mutated HPPD protein, mutated HPPD enzyme, polypeptide of the invention are used interchangeably, and all refer to the polypeptide of the first aspect of the invention.
(47) In another preferred embodiment, the herbicide-resistance polypeptide is a protein or polypeptide having SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8 and/or SEQ ID NO: 10, or a derived polypeptide or active fragment thereof having the same herbicide tolerance.
(48) As used herein, the terms herbicide-resistance and herbicide tolerance are used interchangeably and refer to tolerance to herbicides, especially triketone HPPD inhibitors, such as sulcotrione, mesotrione, tembotrion. The herbicide-resistance polypeptides PaHPPD-M3, PaHPPD-DS18 and PaHPPD-DS73 of the present invention can tolerate herbicides with a concentration of at least 10 ?M, preferably 50 ?M, more preferably 100 ?M. The herbicide-resistance polypeptide PaHPPD-SDM of the present invention can tolerate herbicides with a concentration of at least 10 ?M, preferably 40 ?M, more preferably 60 ?M. In addition, the rice seedlings overexpressing the herbicide-resistance polypeptide PaHPPD-SDM of the present invention can tolerate herbicides with a concentration of at least 200 ?M, preferably 400 ?M, more preferably 600 ?M. At the same time, the soybean seedlings overexpressing the herbicide-resistance polypeptide PaHPPD-SDM of the present invention can tolerate herbicides with a concentration of at least 40 ?M, preferably 80 ?M, more preferably 120 ?M.
(49) As used herein, isolation refers to the material is isolated from its original environment (if it is a natural substance, the original environment is the natural environment). Such as, the polynucleotides and polypeptides in the native state of the living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated from other substances present in the natural state, then they are isolated and purified.
(50) As used herein, isolated herbicide-resistance polypeptide refers that the herbicide-resistance polypeptide is basically free of other proteins, lipids, carbohydrates or other substances that are naturally associated with it. The skilled in the art can purify herbicide-resistance polypeptide using standard protein purification techniques. Substantially pure polypeptides can produce a single primary band on non-reductive polyacrylamide gels.
(51) The Polypeptide(s) of the Present Invention
(52) The herbicide resistant polypeptide of the present invention has one or more characteristics selected from the group consisting of: (a) the polypeptide constitutes HPPD protease in the form of homotetramer in bacteria such as Pseudomonas; (b) the polypeptide forms HPPD protease in the form of homodimer in plants and mammals; (c) the primary structures of the polypeptides PaHPPD-M3, PaHPPD-DS18, PaHPPD-DS73 and PaHPPD-SDM can be divided into two structural regions, including the significantly different N-terminal region and the highly conserved C-terminal region; (d) the polypeptides PaHPPD-M3, PaHPPD-DS18, PaHPPD-DS73 and PaHPPD-SDM all have an ?/? folding structure, the core of which is composed of parallel and anti-parallel ? chains and surrounded by a helix, the structure contains a tubbiness domain. The iron binding site and the AA surrounding the active site are unchanged. The mutation site (R282S) is located on the ?-helix. One (A156V) of the three mutation sites is located on the connection between the ?-helix and ?. The other two are located on two adjacent ?-helices. One of the mutations on the position of the ?-helix (E349K) may affect the structure of this ?-helix, and the helix acts as an entrance for the substrate to enter the active center. The mutation of another mutation site (R282S) will greatly affect the opening and closing of the entrance for the substrate to enter the active center, resulting in a larger entrance.
(53) The amino acid sequence alignment results of PaHPPD derived from Pseudomonas aeruginosa and its mutants PaHPPD-M3, PaHPPD-DS18, PaHPPD-DS73 and PaHPPD-SDM with plant HPPDs are shown in
(54) The three-dimensional HPPD protein structure of P. aeruginosa, Arabidopsis and rice marked with mutation sites of PaHPPD-M3, PaHPPD-DS18, PaHPPD-DS73 and PaHPPD-SDM are shown in
(55) The nucleotide and amino acid information of the main species HPPD is shown in Table A below
(56) TABLE-US-00001 TABLE A Accession number of Species amino acid Gene ID/ Name derived sequence Gene symbol PaHPPD Pseudomonas NP_249556 882225 aeruginosa AtHPPD Arabidopsis 6532701544 AT1G06570.1 thaliana OsHPPD Rice XP_ Os02g0168100 015626163 or LOC4328425 GmHPPD Soybean NP_ LOC100101901 001235148 S1HPPD tomato XP_ LOC101245475 004243609
(57) The polypeptide(s) of the present invention may be recombinant polypeptide(s), natural polypeptide(s), synthetic polypeptide(s), and preferably recombinant polypeptide(s). The polypeptide(s) of the present invention may be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeasts, higher plants, insects and mammalian cells) using recombinant techniques. The polypeptide(s) of the present invention may be glycosylated or may be non-glycosylated according to the host used in the recombinant production protocol. The polypeptide(s) of the invention may also include or may not include the starting methionine residue.
(58) The present invention further includes the fragments, derivatives and analogs of the herbicide-resistance polypeptide. As used herein, the terms fragments, derivatives and analogs refer to the polypeptides basically maintaining the same biological function or activity of the natural herbicide-resistance polypeptide of the present invention. The polypeptide fragments, derivatives or analogs of the present invention may be (i) a polypeptide with one or more conservative or non-conservative amino acid residues (preferably the conservative amino acid residues) being substituted, while such substituted amino acid residues may or may not be encoded by genetic code, or (ii) a polypeptide having substituted group(s) in one or more amino acid residues, or (iii) a polypeptide formed by fusion of the matured polypeptide with another compound (such as the compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iv) a polypeptide formed with additional amino acid sequence fused to said polypeptide sequence (such as, leader sequence, secretion sequence, or a sequence or a protein sequence used to purify the polypeptide, or a fusion protein). According to the subject application, these fragments, derivatives and analogs are within the scope commonly known by the skilled person.
(59) In the present invention, the term herbicide-resistance polypeptide refers to a polypeptide having the sequence of SEQ ID NO: 4 and the tolerance of herbicides. The term also includes a variant form of SEQ ID NO: 4 having the same function as the herbicide-resistance polypeptide. These variant forms include, but are not limited to, deletions of one or more amino acids (typically 1-50, preferably 1-30, more preferably 1-20, most preferably 1-10) , insert ions and/or substitutions, and the addition of one or several amino acids (typically at most 20, preferably at most 10, more preferably at most 5) at the C-terminus and/or N-terminus. For example, in the art, the protein's functions are usually unchanged when an amino acids is substituted by a similar or analogous one. Also, for example, the addition of one or several amino acids at the C-terminus and/or the N-terminus will not normally alter the function of the protein. The term also includes active fragments and active derivatives of the herbicide-resistance polypeptide.
(60) The variant forms of the polypeptide include homologous sequences, conserved variants, allelic variants, natural mutants, induced mutants, protein encoded by a DNA capable of hybridizing to the DNA of herbicide-resistance polypeptide under high or low stringency conditions, and a polypeptide or protein obtained using an antiserum against the herbicide-resistance polypeptide. The present invention further provides other polypeptides, such as fusion proteins comprising the herbicide-resistance polypeptide or fragments thereof. In addition to the almost full length of the polypeptide, the present invention also includes a soluble fragment of the herbicide-resistance polypeptide. Typically, the fragment has at least about 10 contiguous amino acids of the herbicide-resistance polypeptide, typically at least about 30 contiguous amino acids, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, most preferably at least about 100 contiguous amino acids.
(61) The invention also provides the analogues of the herbicide-resistance polypeptide or the polypeptide. These analogues can differ from the herbicide-resistance polypeptide by amino acid sequence differences or by modifications that do not affect the sequence, or by both. These polypeptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to a mutagenic agent, but also by site-directed mutagenesis or other known molecular biology techniques. Also included are analogues which include residues other than those naturally occurring L-amino acids (e.g., D-amino acids) or non-naturally occurring or synthetic amino acids (e.g., ? or ?-amino acids). It is to be understood that, the polypeptides of the present invention is not limited to the representative polypeptides listed hereinabove.
(62) Modification (usually do not change the primary structure) includes in vivo or in vitro chemical derivation of polypeptides, e.g., acelylation, or carboxylation. Also included is modification of glycosylation. Also included are sequences that have phosphorylated amino acid residues, e.g., phosphotyrosine, phosphoserine, phosphothronine, as well as sequences that have been modified to improve their resistance to proteolytic degradation or to optimize solubility properties.
(63) In the present invention, conservative variant polypeptide of the herbicide-resistance polypeptide refers to a polypeptide formed by replacing at most 10, preferably at most 8, more preferably at most 5, most preferably 3 amino acids with the amino acid having similar or analogous property, compared with the amino acid sequence of SEQ ID NO: 4. These conservative variant polypeptides are preferably formed by carrying out the amino acid replacement according to Table B.
(64) Preferably, the polypeptide of the present invention (including a conservative variant polypeptide, or a derivative polypeptide) maintains the mutation from arginine (R) to serine (S) or threonine (T) at the amino acid of position 282 corresponding to SEQ ID NO: 2. More preferably, the polypeptide of the present invention maintains the mutation from arginine (R) to serine (S) at the amino acid of position 282 corresponding to SEQ ID NO: 2.
(65) TABLE-US-00002 TABLE B Initial Representative Preferred residue substitution substitution Ala (A) Val; Leu; Ile Val Arg (R) Lys; Gln; Asn Lys Asn (N) Gln; His; Lys; Arg Gln Asp (D) Glu Glu Cys (C) Ser Ser Gln (Q) Asn Asn Glu (E) Asp Asp Gly (G) Pro; Ala Ala His (H) Asn; Gln; Lys; Arg Arg Ile (I) Leu; Val; Met; Ala; Phe Leu Leu (L) Ile; Val; Met; Ala; Phe Ile Lys (K) Arg; Gln; Asn Arg Met (M) Leu; Phe; Ile Leu Phe (F) Leu; Val; Ile; Ala; Tyr Leu Pro (P) Ala Ala Ser (S) Thr Thr Thr (T) Ser Ser Trp (W) Tyr; Phe Tyr Tyr (Y) Trp; Phe; Thr; Ser Phe Val (V) Ile; Leu; Met; Phe; Ala Leu
(66) Polynucleotides
(67) The polynucleotides of the present invention can be in a form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. DNA can be the coding strand or the non-coding strand. The coding sequences encoding mature polypeptide can be identical to the coding sequences shown in SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and SEQ ID NO: 9 or can be degenerate variants thereof.
(68) As used herein, degenerate variants in the present invention refers to nucleic acid sequences encoding proteins having SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8 and SEQ ID NO: 10 but different from the coding sequences shown in SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7 and SEQ ID NO: 9.
(69) The polynucleotides encoding the mature polypeptides of SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8 and SEQ ID NO: 10 comprise coding sequences encoding only the mature polypeptide; coding sequences of the mature polypeptide and various additional coding sequences; coding sequences (and optionally additional coding sequences) of the mature polypeptide, and non-coding sequences.
(70) The term polynucleotide encoding a polypeptide may include a polynucleotide that encodes the polypeptide, or a polynucleotide that also includes additional coding and/or non-coding sequences.
(71) The present invention also relates to variants of the polynucleotides as described above, which encode fragments, analogs and derivatives of polypeptides or polypeptides having the same amino acid sequence as the present invention. Variants of such polynucleotides may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitutions of variants, deletions of variants, and insertions of variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but the function of the polypeptide encoded by the polynucleotide will not be substantially altered.
(72) The present invention also relates to polynucleotides that hybridize to the sequences as described above and having at least 50%, preferably at least 70%, more preferably at least 80% identical between the two sequences. In particular, the present invention relates to polynucleotides that can hybridize to the polynucleotides of the present invention under stringent conditions. In the present invention, stringent conditions mean: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2?SSC, 0.1% SDS, 60? C.; or (2) hybridization adding a denaturant, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42? C., or the like; or (3) hybridization only occurs when the identity between the two sequences is at least 90%, more preferably 95% or more. And the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide shown in SEQ ID NO: 4.
(73) The present invention also relates to a nucleic acid fragment that hybridizes to the above sequences. As used herein, a nucleic acid fragment is at least 15 nucleotides in length, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides. Nucleic acid fragments can be used for nucleic acid amplification techniques (such as PCR) to determine and/or isolate polynucleotides encoding the herbicide-resistance polypeptide.
(74) Recombinant Technology and Plant Improvement
(75) A polynucleotide full length sequence or fragment thereof encoding the herbicide-resistance polypeptide of the present invention can be obtained via PCR amplification, recombinant method or artificial synthesis. For a PCR amplification method, primers can be designed according to the relevant nucleotide sequences disclosed in the present invention, particularly the open reading frame sequences, and the commercially available cDNA libraries or cDNA libraries prepared by the conventional methods known to the skilled in the art were used as a template, and amplified and the relevant sequences were obtained. When the sequence is longer, two or more PCR amplifications are usually needed, and then each of the amplified fragments are spliced together in the correct order.
(76) Once the relevant sequence is obtained, the relevant sequence can be obtained in bulk using a recombination method. Usually cloned into a vector, then transferred into a cell, and then the relevant sequence is separated and obtained from the proliferation of host cells by the conventional method.
(77) In addition, the relevant sequence can also be synthesized using artificial synthesis methods, particularly when the fragment is shorter. In general, a very long fragment can be obtained by firstly synthesizing multiple small fragments and then ligating them.
(78) At present, a DNA sequence encoding the protein of the present invention (or fragments thereof, or derivatives thereof) can completely be obtained by chemical synthesis. The DNA sequence can then be introduced into a variety of existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequences of the present invention by chemical synthesis.
(79) The present invention also relates to a vector containing a polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector or the herbicide-resistance polypeptide encoding sequence of the present invention, and a method for producing the polypeptide of the present invention by recombinant techniques.
(80) With the conventional recombinant DNA technique (Science, 1984; 224: 1431), the polynucleotide of the present invention can be used to express or produce the recombinant herbicide-resistance polypeptide. Generally, the method comprises the following steps: (1) transforming or transfecting a suitable host cell with a polynucleotide or variant thereof encoding the herbicide-resistance polypeptide of the present invention or a recombinant expression vector containing said polynucleotide; (2) culturing the host cell in a suitable culture medium; (3) isolating and purifying protein from the culture medium or cell.
(81) The polynucleotide sequence of the present invention can be inserted into a recombinant expression vector. The term a recombinant expression vector refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses or other vectors well known in the art. In a word, any plasmid and vector can be used as long as it can be replicated and stabilized in the host. An important feature of an expression vector is that it usually contains a replication origin, a promoter, a marker gene, and a translation control element.
(82) An expression vector containing an encoding DNA sequence of herbicide-resistance polypeptide and a suitable transcription/translation control signal can be constructed by the methods well known to the skilled in the art. These methods comprise DNA recombinant technology in vitro, DNA synthesis technology, recombinant technology in vivo, and the like. The DNA sequence can be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. The expression vector also comprises a ribosome binding site for translation initiation and a transcription terminator.
(83) In addition, the expression vector preferably comprises one or more selectable marker genes to provide the selection of phenotypic traits for the transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and green fluorescent protein (GFP), or tetracycline or ampicillin resistance for E. coli.
(84) A vector comprising an appropriate DNA sequence and a suitable promoter or a control sequence as described above can be used to transform an appropriate host cell to enable it to express the protein.
(85) A host cell can be a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a plant cell (such as a cell of crop and forestry plant). Representative examples are: Escherichia coli, Streptomyces, Agrobacterium; a fungal cell such as yeast; a plant cell, an animal cell and the like.
(86) When the polynucleotides of the present invention are expressed in a higher eukaryotic cell, the transcription will be enhanced if an enhancer sequence is inserted into a vector. The enhancer is a cis-acting factor of DNA, usually about 10 to 300 base pairs, acting on the promoter to enhance the transcription of the gene.
(87) It will be apparent to the ordinary skilled in the art how to select an appropriate vector, promoter, enhancer and host cell.
(88) Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to the skilled in the art. When the host is a prokaryote such as E. coli, competent cells capable of absorbing DNA can be harvested after the exponential growth phase and treated with CaCl.sub.2, the steps used are well known in the art. Another method is to use MgCl.sub.2. If necessary, the transformation can also be carried out by means of electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate coprecipitation method, conventional mechanical method, such as micro-injection, electroporation, liposome packaging, etc.
(89) Agrobacterium or gene gun transformation method, such as leaf discs, can be used to transform a plant. For the transformed plant cell, tissue or organ, the conventional method can be used to regenerate a plant, thereby obtaining plants resistant to herbicide changes.
(90) Gene editing technology can also be used to directly edit the HPPD in the genome of the target plant, so that the plant cells express the herbicide-resistance polypeptide of the present invention. Representative gene editing techniques include CRISPR gene editing system, error-prone PCR, genetic recombination, TALEN and ZFN.
(91) The CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR-associated proteins) system is an acquired immune system that resists the invasion of exogenous viruses or plasmid DNA in bacteria and archaea. The nuclease of this system recognizes and degrades exogenous DNA under the guidance of crRNA. Wherein the type II CRISPR/Cas system is simple in composition, including only one nuclease Cas9 and tracrRNA: crRNA dimer to complete the recognition and cleavage functions. The CRISPR/Cas9 system has rapidly become a new generation of genome editing technology due to its advantages of easy design and manipulation, high editing efficiency and wide versatility. It has been widely used in humans, mice, rats, zebrafish, caenorhabditis elegans, plants, fungus and bacteria.
(92) The obtained transformants can be cultured by a conventional method to express a polypeptide encoded by a gene of the present invention. According to the host cell used, the medium used in the culture may be selected from a variety of conventional media. And the host cell can be cultured under conditions suitable for the growth of the host cell. After the host cell has grown to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction) and the cells are cultured for a further period of time.
(93) The recombinant polypeptide in the method above may be included in the cells, or expressed on the cell membrane, or secreted out of the cell. If desired, the physical, chemical and other properties can be utilized in various isolation methods to isolate and purify the recombinant protein. These methods are well-known to those skilled in the art. The examples of these methods include, but are not limited to, conventional renaturation treatment, treatment by protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, supercentrifugation, molecular sieve chromatography (gel chromatography), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC), and any other liquid chromatography, and the combination thereof.
(94) T recombinant herbicide-resistance polypeptide has uses in many aspects. For example, it can be used in screening compounds, polypeptides or other ligands that promote or antagonize the function of herbicide-resistance polypeptide. The expressed recombinant herbicide-resistance polypeptide can be used in screening valuable polypeptide molecules that can stimulate the function of herbicide-resistance polypeptide in a polypeptide library.
(95) In another aspect, the present invention further comprises a polyclonal antibody and a monoclonal antibody, especially a monoclonal antibody having specificity to the herbicide-resistance polypeptide of the present invention or the coding gene thereof. The present invention includes not only intact monoclonal or polyclonal antibodies, but also antibody fragments with immunological activity, or chimeric antibodies.
(96) The antibodies of the present invention may be prepared by various techniques known to the skilled in the art. For example, a purified herbicide-resistance polypeptide gene product or an antigenic fragment thereof can be administered to an animal to induce the production of a polyclonal antibody. Various antibodies of the present invention can be obtained by conventional immunization techniques using fragments or functional regions of the herbicide-resistance polypeptide gene product. These fragments or functional regions can be prepared using recombinant methods or synthesized using peptide synthesizers. An antibody that binds to an unmodified form of a herbicide-resistance polypeptide gene product can be produced by immunizing an animal with a gene product produced in a prokaryotic cell (e.g., E. coli); an antibody that binds to a post-translational modified form (such as a glycosylated or phosphorylated protein or polypeptide) can be obtained by immunizing an animal with a gene product produced in eukaryotic cells (e.g., a yeast or insect cell). Anti-herbicide-resistance polypeptide antibodies can be used to detect the herbicide-resistance polypeptide in a sample.
(97) A method for detecting the presence of herbicide-resistance polypeptide in a sample is to detect using a specific antibody against herbicide-resistance polypeptide, comprising: contacting the sample with the specific antibody against herbicide-resistance polypeptide; and observing the formation of an antibody complex; the formation of the antibody complex indicates that the presence of herbicide-resistance polypeptide in the sample.
(98) A portion or all of the polynucleotides of the present invention may be immobilized on a microarray or DNA chip (also referred to as a gene chip) as a probe for the analysis of differential expression analysis of genes in a tissue. The specific primers of herbicide-resistance polypeptide are used for in vitro amplification of RNA-polymerase chain reaction (RT-PCR), which can also detect the transcription product of herbicide-resistance polypeptide.
(99) In a preferred embodiment, the invention obtained a PaHPPD gene mutant library by PCR mutagenesis based on HPPD amino acid sequence of Pseudomonas aeruginosa. Then a high-throughput resistance screening system is established in E.coli. At the same time, herbicide-resistance HPPD gene was obtained by qualitative and quantitative detection. Then the resistance gene was over-expressed and transformed into plants (e.g. Arabidopsis, rice, soybean, tomato, etc.). Finally, the effectiveness of HPPD herbicide-resistance plant was verified.
(100) Sequence Listing Information
(101) The information of the sequence listing involved in this application is shown in Table C below, and the mutations involved are shown in Table D and Table E below.
(102) TABLE-US-00003 TABLE C SEQ ID Nucleic acid sequence encoding Pseudomonas NO: 1 aeruginosa HPPD (PaHPPD) SEQ ID Amino acid sequence of Pseudomonas NO: 2 aeruginosa HPPD (PaHPPD) SEQ ID Nucleic acid sequence encoding the mutant M3 NO: 3 of Pseudomonas aeruginosa HPPD (PaHPPD- M3) in first round error-prone PCR SEQ ID Amino acid sequence of the mutant M3 of NO: 4 Pseudomonas aeruginosa HPPD (PaHPPD- M3) in first round error-prone PCR SEQ ID Nucleic acid sequence encoding the HPPD NO: 5 mutant PaHPPD-DS18 of Pseudomonas aeruginosa SEQ ID Amino acid sequence of the HPPD NO: 6 mutant PaHPPD-DS18 of Pseudomonas aeruginosa SEQ ID Nucleic acid sequence encoding the NO: 7 HPPD mutant PaHPPD-DS73 of Pseudomonas aeruginosa SEQ ID Amino acid sequence of the HPPD mutant NO: 8 PaHPPD-DS73 of Pseudomonas aeruginosa SEQ ID Nucleic acid sequence encoding the HPPD NO: 9 mutant PaHPPD-SDM of Pseudomonas aeruginosa SEQ ID Amino acid sequence of the HPPD mutant NO: 10 PaHPPD-SDM of Pseudomonas aeruginosa
(103) Based on the wild-type Pseudomonas aeruginosa HPPD gene, through random mutagenesis of PaHPPD performed by error-prone PCR, the application screened and obtained M3 (PaHPPD-M3) mutant wherein the amino acid at position 282 was mutated from arginine to serine.
(104) Subsequently, based on the M3 mutant, through a first round of DNA shuffling of PaHPPD-M3, DS18 mutant was obtained wherein the amino acid at position 282 was mutated from arginine to serine and the amino acid at position 349 was mutated from glutamic acid to lysine.
(105) Subsequently, based on the M3 mutant, a second round of DNA shuffling was performed, and PaHPPD-DS73 mutant was screened and obtained wherein the amino acid at position 282 was mutated from arginine to serine and the amino acid at position 156 was mutated from alanine to valine.
(106) Finally, the three mutants of M3, DS18 and DS73 were combined by site-directed mutation to obtain PaHPPD-SDM mutant wherein the amino acid at position 282 was mutated from arginine to serine, the amino acid at position 349 was mutated from glutamic acid to lysine and the amino acid at position 156 was mutated from alanine to valine.
(107) TABLE-US-00004 TABLE D Representative mutant of PaHPPD obtained Original by random Base Amino acid gene mutation substitution substitution PaHPPD M1 G772T V258L M2 G386C G129A M3 C844A R282S M4 G422A, C621T R141H M5 C165T, A463T S155C M6 G396A No amino acid changes M7 C234A, C465T, N264D A790G
(108) TABLE-US-00005 TABLE E Base Amino acid method Mutant substitution substitution Error-prone PCR (ep-PCR) M3 C844A R282S DS18 C844A R282S First round of DNA G216A shuffling G1045A E349K (DNA shuffling round I, based on M3) Second round of DNA DS73 C844A R282S shuffling C467T A156V (DNA shuffling round II, based on M3) Site-directed mutation SDM C844A R282S (Site-directed mutagenesis, G216A based on DS18) G1045A E349K C467T A156V
(109) The main advantages of the present invention are: (a) The herbicide-resistance polypeptide of the present invention has obvious herbicide tolerance, and can tolerate herbicides with a concentration of at least 100 ?M. (b) By introducing the gene encoding the herbicide-resistance polypeptide, the resistance or tolerance of Arabidopsis to herbicides can be enhanced. (c) By introducing the gene PaHPPD-SDM encoding the herbicide-resistance polypeptide of the present invention, the resistance or tolerance of rice to herbicides can be enhanced, and the rice seedlings overexpressing the herbicide-resistance polypeptide can tolerate herbicides with a concentration of at least 200 ?M. (d) By introducing the gene PaHPPD-SDM encoding the herbicide-resistance polypeptide of the present invention, the resistance or tolerance of soybean to herbicides can be enhanced, and the soybean seedlings overexpressing the herbicide-resistance polypeptide can tolerate herbicides with a concentration of at least 40 ?M. (e) The herbicide-resistant polypeptide of the present invention can be used to cultivate new varieties of herbicide-tolerant plants.
(110) The present invention will be further illustrated below with reference to the specific examples. It is to be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention. The experimental methods with no specific conditions described in the following examples are generally performed under the conventional conditions, or according to the manufacturer's instructions. Percentages and parts are by weight unless otherwise stated.
(111) Commonly Used Materials and Methods
(112) The enzyme substrate tyrosine and chemical reagents (such as mesotrione, tembotrion, and sulcotrione) used in the present invention were purchased from Sigma (Mainland China); T4 DNA ligase DNase I, restriction enzyme DpnI and T4 polynucleotide kinase were purchased from New England Biolabs (USA); KOD-Plus Neo DNA polymerase was purchased from Toyo (Japan). Bacterial genomic DNA extraction kit was purchased from Beijing Biotech Biotechnology Co., Ltd. (China). The Gene Morphology II Random Mutagenesis Kit for ep-PCR was purchased from Agilent Technologies (USA). The Ultra-fast New Plant RNA Extraction Kit was purchased from Beijing Huayueyang Biotechnology Co., Ltd. (China). The oligonucleotide primers used (Table 1) and sequencing services were provided by Shanghai Jieli Biotechnology Co., Ltd. (Shanghai, China).
(113) TABLE-US-00006 TABLE1 PCRprimersusedinthepresentinvention S. No Primername Primersequence SEQIDNO. 1 GXPaHPPDF 5TATGGATCCATGAACGCCGTGGCCAAGATC3 SEQIDNO:11 GXPaHPPDR 5TCGCGGCCGCTCAGATCACGCCGCGGCGAAT3 SEQIDNO:12 2 GEXAtHPPD 5TATGGATCCTATGTGTCTATCGTTAGCTTCTA SEQIDNO:13 F CAGCTC3 GEXAtHPPD 5CTATCTCGAGGGTTCTTCTTCTTGTTCATCCC SEQIDNO:14 R A3 3 GWAtHPPD 5GGGACAAGTTTGTACAAAAAAGCAGGCTTCAT SEQIDNO:15 F GTGTCTATCGTTAGCTTCTACAG3 GWAtHPPD 5GGGACCACTTTGTACAAGAAAGCTGGGTCGGT SEQIDNO:16 R TCTTCTTCTTGTTCATCCCA3 4 GWPaHPPD 5GGGACAAGTTTGTACAAAAAAGCAGGCTTCAT SEQIDNO:17 F GAACGCCGTGGCCAAGATCGAAC3 GWPaHPPD 5GGGGACCACTTTGTACAAGAAAGCTGGGTCTC SEQIDNO:18 R AGATCACGCCGCGGCGAAT3 5 SDMHPPDF 5GGCCGCAGCGtCAACGACAAC3 SEQIDNO:19 SDMHPPDR 5TTCGATGAACTCGAAGTCGACGTCATAG3 SEQIDNO:20 6 OsSDMF 5TTGTACAATGAACGCCGTGGCCAAGATC3 SEQIDNO:21 OsSDMR 5CTCAAGCTTGATCACGCCGCGGCGAATCTGGT3 SEQIDNO:22 7 GmHPPDF 5TCCTGCAGATGCCCATGTACACTCCATCACT3 SEQIDNO:23 GmHPPDR 5CTCAAGCTTCGCGGTTCTTTTAGCTTCCAAAG3 SEQIDNO:24 8 GmSDMF 5TTGTACAATGAACGCCGTGGCCAAGATC3 SEQIDNO:25 GmSDMR 5CTCAAGCTTGATCACGCCGCGGCGAATCTGGT3 SEQIDNO:26
(114) Strain, Plasmid, Medium Composition and Culture Conditions
(115) The host strain E. coli DH5? used for mutant library construction and gene cloning is cultured at 37? C. in the Luria-Bertani medium (LB medium) containing ampicillin/carbenicillin (100 ?g/mL L). Plasmid pGEX-6P-1 was used as a gene cloning vector.
(116) Formula of LB medium (1 L)
(117) Peptone 10 g
(118) E. coli extract 5 g
(119) NaCl 10 g
(120) Formula of LBT (LB +0.1% tyrosine) medium (1 L)
(121) 20 mL of 5% tyrosine (prepared by adding 1N HCl) was added to the sterilized and cooled LB medium to obtain LBT medium containing a final concentration of 0.1% tyrosine. Then the pH was adjust with 1 N KOH.
(122) Note: methanol was used to prepare a stock solution of 100 ?M HPPD inhibitors (mesotrione, tembotrion and sulcotrione). Antibiotics (ampicillin/carbenicillin) and HPPD inhibitors (mesotrione, tembotrion and sulcotrione) were added together to the sterilized and cooled LBT medium to the required final concentration.
(123) Isolation and Cloning of HPPD Gene from Pseudomonas aeruginosa
(124) The PaHPPD gene from the genomic DNA of Pseudomonas aeruginosa was amplified using primers GEXPaHPPD F and GEXPaHPPD R (Table 1). The conditions of polymerase chain reaction (PCR) were as follows:
(125) TABLE-US-00007 Pre-denaturation 94? C. 5 min Denaturation 98? C. 10 sec Annealing 60? C. 30 sec Extension 68? C. 45 sec {close oversize brace} 34 cycles Final extension 72? C. 5 min
(126) The 1074 bp PCR amplification product was cloned into pGEX-6P-1 vector with BamHI and NotI, and then transformed into E. coli DH5? cells. The integrity of the construct was verified by sequencing.
(127) In order to compare the HPPD activity of plants with the HPPD activity from Pseudomonas aeruginosa in the E. coli screening system, the inventors extracted total RNA of Arabidopsis (Col 0) seedlings, and amplified the coding sequence of AtHPPD by RT-PCR using cDNA as a template.
(128) PCR reactions were performed using PCR primers GEXAtHPPD F and GEXAtHPPD R (Table 1). PCR conditions were as follows:
(129) TABLE-US-00008 Pre-denaturation 94? C. 5 min Denaturation 98? C. 10 sec Annealing 61? C. 30 sec Extension 68? C. 1 min {close oversize brace} 34 cycles Final extension 72? C. 5 min
(130) The 1438 bp PCR amplification product was cloned into pGEX-6P-1 vector with BamHI and XhoI, and then transformed into E. coli DH5? cells. The integrity of the construct was verified by sequencing.
(131) Generation of HPPD Mutants and Screening for Herbicide-Resistance
(132) Random Mutagenesis by Using Error-Prone PCR
(133) Random mutagenesis of PaHPPD was performed by error-prone (ep) PCR using the Gene Morphology II Random Mutagenesis Kit, and the PaHPPD mutants generated by the first round of ep-PCR were combined and cloned into the pGEX-6P-1 vector, and transformed into E. coli DH5? competent cells. Then all putative mutants were cultured in 96-well plates containing LBT (LB+0.1% tyrosine) medium, and the HPPD activity was evaluated based on the shade of brown pigments produced by the mutants during tyrosine metabolism. Mutants was selected according to the shade of metabolite color for sequencing and subsequent analysis.
(134) Analysis of HPPD Activity of E. coil Cells Based on Colorimetry
(135) E. coli lacks HPPD and homogentisic acid metabolism pathway, thus it cannot mineralize phenylalanine and tyrosine. E. coli was used as a PaHPPD screening system of herbicide insensitive and/or herbicide-resistance, based on the differences in the ability to restore pigmentation in LBT (LB+0.1% tyrosine) medium containing different doses (0-100 ?M) of HPPD inhibitors (sulcotrione, mesotrione and tembotrion). The PaHPPD mutants obtained by random mutation was cloned into E. coli cells together with wild-type PaHPPD and AtHPPD for comparation and screening.
(136) The bacteria solution shaking cultured overnight at 37? C. was centrifuged, and 200 ?L of supernatant was transferred to a sterile 96-well plate (microplate with high throughput characteristics) using a 200 ?L pipette on an ultra-clean workbench. The pigment content was measured with a microtiter plate reader at a wavelength of 405 nm (OD405 nm), and the HPPD activity was evaluated according to the size of the OD value.
(137) DNA Shuffling
(138) Single mutated PaHPPD-M3 (PaHPPD-M3 mutant with one amino acid mutation site obtained by random mutation of PaHPPD) was subjected to DNA shuffling to produce mutants with significantly improved resistance to HPPD inhibitors. The PaHPPD-M3 mutant gene was amplified from the recombinant plasmid pGEX-6P-1-M3 using specific primers and then gel purified. Digesting 1 ?g of DNA with DNase I into a 50-100 bp fragment was taken about 5 minutes. The DNA fragment was purified with 1.5% agarose gel electrophoresis and recombined by primer-free PCR. The primer-free PCR products were PCR amplified using specific primers GEXPaHPPD F and GEXPaHPPD R, and the PaHPPD-M3 gene was amplified to full length. After primer-free PCR and primer PCR, a group of full-length M3 gene mutants were obtained and digested with Bam HI and Not I enzymes. The isolated fragment was ligated into the prokaryotic expression vector pGEX-6P-1, and the resulting second-generation mutant library was transformed into E. coli for screening.
(139) Then all putative mutants were cultured in the LBT (LB+0.1% tyrosine) medium on the microtiter plate to observe the activity of HPPD. According to the brown shade of the medium, the highly active HPPD clones were selected for sequencing and analysis. The resistance to herbicides of the mutants with new amino acid substitutions were detected with colorimetric assay. In the presence of HPPD inhibitors, the E. coli color screening system was used to detect the second-generation mutants produced by the first round of DNA shuffling. These mutants were identified by the ability to restore brown pigments under the conditions of increasing concentration range (0-100 ?M) of HPPD inhibitors, to increase the stringency of screening. PaHPPD-DS18 mutant (mutant PaHPPD-M3 with 1 amino acid mutation site R282S was obtained by random mutation of PaHPPD, and then a first round of DNA shuffling was preformed based on PaHPPD-M3, and mutant PaHPPD-DS18 with 2 amino acid mutation sites R282S and E349K was obtained) was obtained by screening.
(140) In order to generate more mutants with high resistance to HPPD inhibitors, after the first round of DNA shuffling, a second round of DNA shuffling was performed based on PaHPPD-M3. Through the second round of DNA shuffling, more HPPD mutants were generated. In the presence of HPPD inhibitors (sulcotrione, mesotrione and tembotrion) at a concentration of 100 ?M, the HPPD mutant PaHPPD-DS73 with higher activity was screened according to the amount of brown pigmentation. The mutant (PaHPPD-DS73) selected in the second round of DNA shuffling were sequenced, and further analyzed and compared with the first-generation mutant (PaHPPD-M3) and the second-generation mutant (PaHPPD-DS18) by activity.
(141) Generation of PaHPPD-SDM
(142) In order to further improve the resistance of E. coli to herbicides, three mutants of PaHPPD-M3, PaHPPD-DS18 and PaHPPD-DS73 were combined by site-directed mutation. In order to combine all the mutations from the three mutants, reverse PCR amplification was performed using SDMHPPD-F and SDMHPPD-R as reverse PCR mutation primers (Table 1) and pGEX-6P-1-DS18 plasmid DNA as a template. After PCR, the PCR product was gel purified and the plasmid DNA was digested with DpnI. Then the self-ligation of PCR products was performed by the action of T4 polynucleotide kinase and T4 DNA ligase. The self-ligated PCR products were then transformed into E. coli cells. The obtained recombinant pGEX-6P-1 SDM was sequenced and analyzed. It contains all three amino acid substitutions from PaHPPD-M3, PaHPPD-DS18 and PaHPPD-DS73. Then the obtained PaHPPD-SDM mutant was compared with its parental mutants (PaHPPD-M3, PaHPPD-DS18, and PaHPPD-DS73) to understand their ability of brown pigmentation in the presence of triketone herbicides at different doses (0-60 ?M). The calculation formula of HPPD activity (%) is as follows:
HPPD activity(%)=(Am/Ac)?100
(143) Wherein Am refers to the average value of the absorbance at a specific herbicide dose, and Ac refers to the average value of the absorbance without the herbicide.
(144) PaHPPD Sequence Analysis of Pseudomonas aeruginosa
(145) In order to study the evolutionary relationship between PaHPPD and HPPD homologues of dicotyledonous and monocotyledonous plants, Clustal W2 was used to preform amino acid sequence alignment between PaHPPD (Pa), its mutant PaHPPD-SDM (SDM), and HPPDs of various plants (such as AtHPPD of Arabidopsis, GmHPPD of soybean, OsHPPD of rice, and S1HPPD of tomato) (
(146) Construction of Expression Vector and Transformation of Plant
(147) The expression vectors of AtHPPD, PaHPPD and its mutant PaHPPD-M3were constructed using the Gateway system binary vector pGWB6 (35S promoter, N-sGFP). The vectors were over-expressed and transformed into Arabidopsis. AtHPPD (OE At), PaHPPD (OE Pa) and PaHPPD-M3 (OE M3) overexpression Arabidopsis plants were obtained. The expression vector used for Arabidopsis transformation is shown in
(148) The 1438 bp full-length coding sequence of AtHPPD was cloned into pGWB6 vector (35S promoter, N-GFP) using primers GWAtHPPD F and GWAtHPPD R, and a 35Spro: AtHPPD (OE At) construct was generated. Constructs of 35Spro: PaHPPD (35S promoter, N-GFP) and 35Spro: M3PaHPPD (35S promoter, N-GFP) were generated by similar methods using primers GWPaHPPD F and GWPaHPPD R. All primers used for DNA construct generation are listed in Table 1. The above constructs were then transformed into Agrobacterium tumefaciens strain GV3101, and then transformed into Arabidopsis by floral-dip method. At the same time, the successfully transformed Arabidopsis strains were selected based on resistance to hygromycin. The homozygous T3 generation transgenosis Arabidopsis seedling was used for phenotypic and physiological analysis and molecular identification.
(149) Using OsSDM F and OsSDM R (Table 1) as PCR primers and using pGEX-6P-1-SDM plasmid as a template, SDM gene without termination codon was amplified and the fragment length thereof was 1074 bp. Using enzyme digestion and recombination method, the SDM gene was then integrated into the 35S-pCAMBIA1305-3FLAG vector (with two restriction sites of BsrG I and HindIII) to construct the 35S-pCAMBIA1305-SDMPaHPPD-3FLAG expression vector, which can express the SDMPaHPPD-3FLAG fusion protein (
(150) Using PCR primers GmHPPD F and GmHPPD R (Table 1), the 1332bp full-length coding sequence of GmHPPD was cloned into the 35S-pCAMBIA1305-3FLAG vector (with two restriction sites of BsrGI and HindIII) to obtain 35S-pCAMBIA1305 -GmHPPD-3FLAG expression vector. The 35S-pCAMBIA1305-SDMPaHPPD-3FLAG expression vector was generated by similar method. Using GmSDM F and GmSDM R as primers and using pGEX-6P-1-SDM plasmid as a template, SDM gene without termination codon was obtained by PCR amplification and the fragment length thereof was 1074 bp. Using enzyme digestion and recombination method, the SDM gene was then integrated into the 355-pCAMBIA1305-3FLAG vector (with two restriction sites of BsrG I and HindIII) to construct the 35S-pCAMBIA1305-SDMPaHPPD-3FLAG expression vector, which can express the SDMPaHPPD-3FLAG fusion protein (
(151) Determination of oxidative Stress Indexes of Arabidopsis Treated with Herbicides
(152) Determination of Superoxide Content in Leaves of Arabidopsis by Nitroblue Tetrazolium (NBT) Staining Method
(153) 2 week-old Arabidopsis seedlings were cultured continuously in ? MS mediums with 100 nM mesotrione and without mesotrione for 72 h, and then transferred to 3.5 mg/mL NBT staining solution (prepared with potassium phosphate buffer containing 10 mM NaN.sub.3) and soaked in vacuum for 2 min, and then placed on a shaker overnight. The NBT-stained plants were placed in a mixed solution of acetic acid:glycerol:ethanol=1:1:3 (v/v/v) and destained at 100? C. for 5 min, then reserved in a mixed solution of glycerol:ethanol=1:4 (v/v), and was used to take photos to record the test results.
(154) Determination of Hydrogen Peroxide Content in Leaves of Arabidopsis by 3,3-Diaminobenzidine (DAB) Staining Method
(155) H.sub.2O.sub.2 staining reagent-3,3-diaminobenzidine (3,3-diaminobenzidine, DAB, D5637, Sigma-Aldrich) was dissolved in water and adjusted to pH 3.8 with KOH, which was the prepared 1.25 mg/mL DAB staining solution (prepared when it is in need to avoid oxidation).
(156) 2 week-old Arabidopsis seedlings were cultured continuously in ? MS mediums with 100 nM mesotrione and without mesotrione for 72 h, and then transferred to DAB staining solution, and soaked in vacuum for 2 min, and then placed on a shaker for 7-8 hours. The DAB-stained plants were placed in a mixed solution of acetic acid:glycerol:ethanol=1:1:3 (v/v/v) and destained at 100? C. for 5 min, then reserved in a mixed solution of glycerol: ethanol=1:4 (v/v), and was used to take photos to record the test results.
(157) Evaluation of Herbicide-Resistance of T0 Generation Rice
(158) 35S-pCAMBIA1305-SDM-3FLAG (OE-SDM) expression vector was used to evaluate the potential of SDM overexpressing line PaHPPD-SDM in rice, and then the tolerance responses of T0 generation line of OE SDM and wild type rice (WT) to herbicides were compared to evaluate the resistance of T0 generation plants to herbicides.
(159) Analysis of Rice Resistance to Herbicides at Pot Level
(160) Transgenic T0 generation OE SDM and WT rice seedlings were planted in pots containing soil and placed in an artificial climate room (30? C. 16 h light/28? C. 8 h dark) for growth. 3 weeks later, when the rice seedlings reached a height of 15-20 cm, 200 ?M mesotrione (prepared with 0.1% Tween-20) and 0.1% Tween-20 were sprayed to OE SDM and WT rice seedlings, respectively. Then, the phenotype should be observed every week. The oxidative stress index was measured 1 week after the treatment, the chlorophyll content of the leaves was measured 2 weeks after the treatment, and the experimental result was photographed 3 weeks after the treatment.
(161) Determination of Total Chlorophyll Content in Rice Leaves
(162) Referring to the method of Lichtenthaler HK (1987), chlorophyll was extracted from the leaves of wild-type and T0 generation OE SDM rice seedlings which were sprayed with 200 ?M mesotrione (prepared with 0.1% Tween-20) and sprayed with control 0.1% Tween-20 after 2 weeks and its content was determined. All experiments were repeated biologically 3 times, and the average value was taken.
(163) Determination of Oxidative Stress Indexes of Rice Treated with Herbicides
(164) Herbicides cause the production of reactive oxygen species (ROS), leading to cell death. In order to determine the oxidation state of rice, leaves of wild-type and TO-generation OE SDM rice which were sprayed with 200 ?M mesotrione (prepared with 0.1% Tween-20) and sprayed with control 0.1% Tween-20 were collected, and stained with nitroblue tetrazolium (NBT) and 3,3-diaminobenzidine (DAB), respectively, to analyze the accumulation of superoxide (O.sub.2.sup.?) and hydrogen peroxide (H.sub.2O.sub.2).
(165) Determination of Superoxide Content in Leaves of Rice by Nitroblue Tetrazolium (NBT) Staining Method
(166) At the end of the herbicide treatment, leaves of 4 week-old rice (normal growth for 3 weeks and herbicide spray treatment for 1 week) were placed in a 3.5 mg mL.sup.?1 nitroblue tetrazolium (N6876, Sigma-Aldrich) staining solution (potassium phosphate buffer containing 10 mM NaN3), soaked in vacuum, and shaked on a shaker overnight. The NBT-stained plants were destained with a mixed solution of acetic acid:glycerol:ethanol=1:1:3 (v/v/v) at 100? C. for 5 min, and then reserved in a mixed solution of glycerol:ethanol=1:4 (v/v). The deposition of O.sub.2 and NBT shows blue.
(167) Determination of Hydrogen Peroxide Content in Leaves of Rice by 3,3-diaminobenzidine (DAB) Staining Method
(168) H.sub.2O.sub.2 staining reagent-3,3-diaminobenzidine (3,3-diaminobenzidine, DAB, D5637, Sigma-Aldrich) was dissolved in water and adjusted to pH 3.8 with KOH to prepare 1.25 mg/mL DAB staining solution (prepared the staining solution when it is in need to avoid oxidation).
(169) Rice seedling leaves were soaked in DAB staining solution for 2 min under vacuum, and then placed in a shaker for 7-8 h. The DAB-stained plants were destained with a mixed solution of acetic acid:glycerol:ethanol=1:1:3 (v/v/v) at 100? C. for 5 min, and then reserved in a mixed solution of glycerol:ethanol=1:4 (v/v). The polymerization of H.sub.2O.sub.2 and DAB shows brown.
(170) Determination of Malondialdehyde Content in Rice Leaves
(171) Malondialdehyde (MDA) is an important marker of the degree of oxide film damage. The previous method (Heath and Packer, 1968) for the determination of malondialdehyde content was referred with slight modifications. 1 g of rice leaves were accurately weighed and place to a pre-cooling mortar. 10 mL of pre-cooling 10% trichloroacetic acid (TCA, v/v) was added and grind thoroughly. Then the lapping solution was transfered to a 10 mL centrifuge tube and centrifuged at 4000 rpm for 10 min (4? C.). 2 mL of supernatant was pipetted and mixed with an equal volume of 0.6% 2-Thiobarbituric acid (TBA, v/v), and incubated at 100? C. for 15 min.
(172) Then the reaction solution was cooled at room temperature. The cooled reaction solution was centrifuged at 4000 rpm for 10 min (4? C.). The supernatant was taken and measured absorbance at wavelengths of 450 nm, 532 nm and 600 nm using ultraviolet spectrophotometers, respectively. Each sample was repeated 3 times. The unit of MDA content is nmol g.sup.?1 FW.
(173) Analysis of Rice Resistance to Herbicides at Leave Level
(174) Transgenic T0 generation OE SDMHPPD and WT soybean (William 82) seedlings were planted in pots and placed in an artificial climate room (27? C., 14 h/8 h, light/dark) for growth. After 4 weeks, 0, 1, 5, 10 and 30 ?M of mesotrione (prepared with 0.1% Tween-20) and 0.1% Tween-20 were dipped with cotton swabs and evenly coated to the leaves of OE SDMHPPD (OE SDM #12 and OE SDM #13) T0 generation and WT seedlings having a height of 30-40 cm. Then, the phenotype was observed every week, and the experimental result was recorded by taking photos 2 weeks after the treatment.
(175) To further test the resistance of transgenic soybeans to herbicides, 20 ?M mesotrione (prepared with 0.1% Tween-20) and 0.1% Tween-20 were dipped with cotton swabs and evenly coated to the trifoliate leaves of 2 week-old WT, OE GmHPPD (OE GmHPPD #9) T1 generation seedlings and OE SDMHPPD (OE SDMHPPD #12) T1 generation. Then, the phenotype was observed every day, and the experimental result was recorded by taking photos 10 days after the treatment.
(176) Analysis of Rice Resistance to Herbicides at Whole Plant Level
(177) 20 ?M mesotrione (prepared with 0.1% Tween-20) and 0.1% Tween-20 were spray to 4 week-old transgenic T1 generation OE SDMHPPD, T1 generation OE GmHPPD and WT soybean which were grown in an artificial climate chamber (27? C., 14 h/8 h, light/dark) for the first time. A second spray was applied after 1 week. Then the phenotype of the plants was observed very day, and the experimental result was recorded by taking photos 2 weeks after the treatment.
(178) Determination of Total Chlorophyll Content and Plant Height of T1 Generation Soybean
(179) Wild type soybean William 82, T1 generation OE PaHPPD-SDM soybean and T1 generation OE GmHPPD soybean seedlings were sprayed with 20 ?M mesotrione (prepared with 0.1% Tween-20) and 0.1% Tween-20 for twice, respectively. The interval between two sprays is 1 week. Two weeks after spray treatment, the total chlorophyll of the leaves was extracted and the content was determined by referring to the method of Lichtenthaler HK (1987). All experiments were repeated biologically 3 times, and the average value was taken.
EXAMPLE 1
Generation of PaHPPD-M3 Mutant and Screening for Herbicide-Resistance
(180) 1.1 Random Mutation and Sequencing Using Error-Prone PCR
(181) By using error-prone PCR, several putative mutant colonies were obtained and cultured on LBT (LB+0.1% tyrosine) medium. The activity of HPPD was evaluated depending on their ability to produce brown pigment during tyrosine metabolism.
(182) Only a few putative mutants can produce brown pigment on LBT medium, and then the putative mutants with HPPD activity were sequenced and analyzed. Sequencing analysis showed that the selected mutants had mutations at different nucleic acid sites (Table 2). Compared with the wild type PaHPPD, 6 (M1, M2, M3, M4, M5, M7) mutants showed new amino acid substitutions in their polypeptides, while M6 showed only base substitution G396A but no amino acid changes (
(183) TABLE-US-00009 TABLE 2 PaHPPD mutants obtained by random mutation (ep-PCR) Base Amino acid method Mutants substitution substitution Random M1 G772T V258L Mutation M2 G386C G129A (ep-PCR) M3 C844A R282S M4 G422A, C621T R141H M5 C165T, A463T S155C M6 G396A No amino acid changes M7 C234A, C465T, N264D A790G
(184) 1.2 Screening of Herbicide-Resistance Based on the E. coli Screening System
(185) Based on the E. coli screening system, the amount of melanin formed in the presence of different doses (0-50 ?M) of triketone herbicides was determined at a wavelength of OD405 nm to analyze the activity of HPPD. As can be seen from
(186) When the concentration of the herbicide was 10 ?M or even higher, it can be seen that PaHPPD-M3 has shown stronger resistance to the triketone herbicide by measuring the amount of melanin formed. Based on this, the concentration of the herbicide was increased to 100 ?M, and the mutant PaHPPD-M3 was significantly more resistant to the three different herbicides (sulcotrione, mesotrione and tembotrion) than the wild-type WT (
EXAMPLE 2
Generation of HPPD-DS18 Mutant and Screening for Herbicide-Resistance
(187) The DNA shuffling system was used to shuffle the PaHPPD-M3 mutant obtained in Example 1 to produce more HPPD mutants. Several putative mutant colonies were obtained. Sequencing analysis of the second generation mutants (or Ds I mutants) with active HPPD revealed the mutation results (Table 3), respectively. It was found that all these mutants further had a unique base mutation or amino acid substitution in the PaHPPD-M3 mutant.
(188) In the presence of triketone herbicides (sulcotrione, mesotrione and tembotrion), the HPPD activities of mutants with unique mutations or amino acid substitutions (DS7, DS8, DS18, DS23 and DS44) were compared with wild-type PaHPPD and first generation mutant PaHPPD-M3.
(189) The results are shown in
(190) TABLE-US-00010 TABLE 3 PaHPPD mutants obtained by DNA shuffling Base Amino acid method Mutants substitution substitution First round of DNA DS7 C844A R282S shuffling A238G K80E (DNA shuffling DS8 C844A R282S round I, G1064C G355A based on M3) DS18 C844A R282S G216A No amino acid changes G1045A E349K DS23 C844A R282S A758G D253G Ds44 C844A R282S C819T No amino acid changes
EXAMPLE 3
Generation of HPPD-DS73 Mutant and Screening for Herbicide-Resistance
(191) The second round of DNA shuffling mutants (PaHPPD-DS73) having active HPPD were cloned and screened for their resistance to herbicides by the amount of pigmentation in the presence of 100 ?M HPPD inhibitors (sulcotrione, mesotrione and tembotrion). It was observed that PaHPPD-DS73 showed (or retained) pigmentation in the LBT medium in the presence of 100 ?M HPPD inhibitors (sulcotrione, mesotrione and tembotrion) (
(192) In the presence of 100 ?M triketone herbicides (sulcotrione, mesotrione and tembotrion), the HPPD activities of WT, PaHPPD-M3, PaHPPD-DS18 and PaHPPD-DS73 were qualitatively and quantitatively analyzed at 405 nm. It was shown that the resistances of PaHPPD-M3, PaHPPD-DS18 and PaHPPD-DS73 to herbicide were significantly higher than that of WT. There is no significant difference between the three mutants, which are highly resistant to triketone herbicides (
EXAMPLE 4
Generation of PaHPPD-SDM Mutant and HPPD Activity Comparison with Its Parental
(193) PaHPPD-M3 mutant with 1 amino acid mutation site (arginine at position 282 was mutated to serine) was obtained by random mutation of the gene (PaHPPD) from Pseudomonas aeruginosa. PaHPPD-DS18 mutant with 2 amino acid mutation sites (arginine at position 282 was mutated to serine and glutamic acid at position 349 was mutated to lysine) was obtained by the first round of DNA shuffling based on PaHPPD-M3. Then PaHPPD-DS73 mutant with 2 amino acid mutation sites (the alanine at position 156 was mutated to valine and the arginine at position 282 was mutated to serine) was obtained by the second round of DNA shuffling based on PaHPPD-M3 mutant. Finally, the three mutants of PaHPPD- M3, PaHPPD- DS18 and PaHPPD- DS73 were combined by site-directed mutation to form PaHPPD- SDM with three amino acid mutation sites (alanine at position 156 was mutated to valine, arginine at position 282 to was mutated serine, and glutamate at position 349 was mutated to lysine).
(194) By amino acid sequence alignment of WT (PaHPPD), PaHPPD- M3, PaHPPD-DS18, PaHPPD-DS73 and PaHPPD-SDM, it was found that the sequence of PaHPPD-SDM comprised all of the amino acid mutations of PaHPPD-M3, PaHPPD-DS18 and PaHPPD-DS73 (
EXAMPLE 5
Sequence Analysis of PaHPPD Gene Derived from Pseudomonas aeruginosa
(195) The comparison and analysis of the amino acid sequences of PaHPPD (Pa), PaHPPD-SDM (SDM) and plant-derived HPPD genes-Arabidopsis (AtHPPD), soybean (GmHPPD), rice (OsHPPD) and tomato (S1HPPD) revealed that the two sites of amino acid substitutions (R282S and E349K) in PaHPPD are highly conserved in Arabidopsis, soybean, rice and tomato (
EXAMPLE 6
Herbicide Resistance Analysis Before Arabidopsis Germination of Overexpression Line OE M3
(196) In order to evaluate the resistance of different HPPD overexpression lines to herbicides, Arabidopsis seed germination tests were performed on media containing different concentrations of herbicides. T3 generation Arabidopsis seeds and Co10 (WT) seeds were performed steam surface sterilization (concentrated HCl: NaClO=1:5, v/v) for 3 h. Seeds of OE At (OE At #1, OE At #2), OE Pa (OE Pa #1, OE Pa #2), OE M3 (OE M3 #1, OE M3 #2) and Co10 (WT) were dibbled together in .sup.1/.sub.2 MS medium (0.5 x MS salt, 1% sucrose and 0.8% agar) in a 24-well plate, and the medium contained different concentrations (0, 31.25, 62.5, 125, 500 and 2000 nM) of mesotrione (Sigma Aldrich, USA) and sulcotrione (Sigma Aldrich, USA). Then, the plate dibbled seeds was placed in the dark at 4? C. for 3 d, and then transferred to a growth chamber at 22? C. (16 h light/8 h dark) for 2 weeks. Three biological replicates were performed per treatment per species. After 2 weeks, the test results were photographed.
(197) The results are shown in
Example 7
Herbicide Resistance Analysis After Arabidopsis Germination of Overexpression Line OE M3
(198) In order to further confirm the correctness of the results obtained in the germination test, an analysis experiment on herbicide resistance after Arabidopsis germination was conducted. Arabidopsis seedlings germinated by OE At, OE Pa, OE M3 and WT for 7 days were transferred to ? MS medium containing different concentrations (0, 100, 250, 500, and 1000 nM) of mesotrione and grown for 1 week. 5 seedlings were treated per genotype with 3 biological replicates. After 1 week, the effect of the herbicide treatment (i.e., albino) was photographed.
(199) The results are shown in
(200) (WT), OE At, OE Pa and OE M3 Arabidopsis lines without herbicide treatment. After treatment with different concentrations of mesotrione, it was found that the cotyledons of WT were albino at 100 nM, and OE M3 grew well at 250 nM, while the cotyledons of other overexpression lines (OE At and OE Pa) were albino at this concentration. It is indicated that the OE PaHPPD-M3 Arabidopsis line has higher resistance to triketone herbicides after germination.
EXAMPLE 8
Content of Total Chlorophyll and Carotenoid of Overexpression Line OE M3 Arabidopsis Leaf (Rosette Leaf)
(201) The leaves (rosette leaves) of 2 week-old plants grown in .sup.1/.sub.2 MS medium containing different concentrations (0, 100, 250, 500 and 1000 nM) of mesotrione were collected, including leaves of OE At, OE Pa, OE M3 and WT. The total chlorophyll and carotenoid were extracted and the content thereof was detected by referring to the method of Lichtenthaler HK (1987). All experiments were repeated biologically 3 times, and the average value was taken.
(202) The results are shown in
EXAMPLE 9
Herbicide Resistance Analysis of Overexpression Line OE M3 Arabidopsisat Pot Level
(203) 2 week-old Arabidopsis seedlings of WT, OE At, OE Pa, and OE M3 were transplanted into soil-filled pots (12 seedlings per pot) and growth in a phytotron (22? C., 14 h light/10 h dark, 120 ?mol m.sup.?2 s.sup.?1 light intensity) for 4 weeks. Then, 5 ?M mesotrione solution (prepared with 0.05% Tween-20) were sprayed twice with a treatment interval of 3 days, and compared with the control treatment (0.05% Tween-20 without herbicide). The spray treatment was biologically repeated 3 times. Two weeks after the first herbicide spray, the test results were photographed.
(204) The results are shown in
EXAMPLE 10
Expression of Biosynthesis Genes of AtHPPD and Vitamin E in Arabidopsis
(205) 2 week-old T3 generation seedlings of WT, OE At, OE Pa and OE M3 were used as materials to set up a treatment group and a control group, respectively, wherein the treatment group was continuously cultured in ? MS liquid medium containing 250 nM mesotrione for 6 h. The total RNA of related materials was extracted using Super Fast Plant RNA Extraction Kit (Beijing Huayueyang Biological Technology Co., Ltd., China). The concentration of RNA samples was measured using NanoDrop ND1000 (Thermo Scientific, USA). RNA samples with an absorbance ratio (at wavelengths of 260/280 nm and 260/230 nm) of approximately 2.0 were selected. The total RNA (1,000 ng) was then used for synthesis of cDNA for reverse transcription using a cDNA synthesis kit (One-step Removal of Transcript gDNA and cDNA Synthesis Super Kit, TransGen).
(206) As for quantitative reverse transcription PCR analysis, 3.0 ?L cDNA was used as a template in a 20 ?L reaction system to detect the expression levels of HPPD as well as VTE1 and VTE3 genes which encode the key enzymes in the biosynthesis of vitamin E, and actin was used as an internal reference gene. The primer sequences used are listed in Table 4. Three technical repetitions were performed on the Bio-Rad CFX96 real-time system. REST software was used for statistical analysis.
(207) TABLE-US-00011 TABLE4 qRT-PCRprimersusedinthepresentinvention S.No. Primername Primersequence SEQIDNO. 1 qACT3F 5GGTCGTACTACTGGTATTGTGCT3 SEQIDNO:27 qACT3R 5TGACAATTTCACGCTCAGCT3 SEQIDNO:28 2 qAtHPPDF 5GCGGTTTAAATTCAGCGGTCCTG3 SEQIDNO:29 qAtHPPDR 5TCCGTGCACTGGCTCGTTAATC3 SEQIDNO:30 3 qVTE1F 5TGTCCGAAGGGTTCCAAGCTAC3 SEQIDNO:31 qVTE1R 5CACAGTTTCCGCATAGTCAGTACG3 SEQIDNO:32 4 qVTE3F 5AAGATCGTCGAGGGAGATGCTG3 SEQIDNO:33 qVTE3R 5TCCGGCCAGTACTCAATGCTTC3 SEQIDNO:34 5 qGmACT3F 5ATCTTGACTGAGCGTGGTTATTCC3 SEQIDNO:35 GmACT3R 5GCTGGTCCTGGCTGTCTCC-3 SEQIDNO:36 6 qGmHPPDF 5GACAGGCCAACGATATTCATAGA3 SEQIDNO:37 qGmHPPDR 5CTATGCCACATTGATTCCTCATT3 SEQIDNO:38 7 qGmHSTF 5TTTCAGGCGTTGGTTACTCATAC3 SEQIDNO:39 qGmHSTR 5TCTAACTATGCACGTATGCACCTT3 SEQIDNO:40 8 qGmHPTF 5GGCTTCAATTCTCTGGTTTCA3 SEQIDNO:41 qGmHPTR 5CTGACAAAGGCAGCACCAT3 SEQIDNO:42 9 qGmMPQMT 5GTTTATTCCAAAAGGGTGTGCT3 SEQIDNO:43 F qGmMPQMT 5GCGGTTGTAGAGATCAGCA3 SEQIDNO:44 R 10 qGmTCF 5ATGGAAGCCAAGCTCTGG3 SEQIDNO:45 qGmTCR 5CTACAGGCCAGGCGGTTT3 SEQIDNO:46
(208)
EXAMPLE 11
Oxidative Stress Marker of the Overexpression Line OE M3 Arabidopsis
(209) Herbicides cause the production of reactive oxygen species (ROS), leading to cell death. In order to clarify the oxidation state of plants, the leaves of plants treated with herbicide mesotrione and control were stained with nitroblue tetrazolium (NBT) and 3,3-diaminobenzidine (DAB) to analyze the accumulation of superoxide (O.sub.2) and hydrogen peroxide (H.sub.2O.sub.2).
(210) 2 week-old T3 generation Arabidopsis seedlings of WT, OE At, OE Pa and OE M3 were transfered to different control (? MS medium) and treatment medium (? MS medium containing 100 nM mesotrione) for 72 h, and then stained with NBT and DAB to detect the accumulation of reactive oxygen species.
(211) The results are shown in
EXAMPLE 12
Evaluation of Herbicide Resistance of T0 Generation OE SDM Rice Lines
(212) Analysis of Resistance of OE SDM Rice to Herbicides at Pot Level
(213) As can be seen from
(214) Total Chlorophyll Content of Rice Leaves
(215)
(216) Oxidative Stress Markers in Rice Leaves
(217) 1 week after the treatment of control (spray 0.1% Tween-20) and 200 ?M mesotrione (prepared with 0.1% Tween-20), the leaves of WT and OE SDM rice were stained with NBT (
(218) Malondialdehyde (MDA) Content in Rice Leaves
(219)
Example 13
Herbicide Resistance of T0 and T1 Generation OE SDM Soybean Lines-Leaf Spread
(220) The resistance of T0 and T1 soybean lines of OE PaHPPD-SDM and the wild-type soybean William 82 to herbicides was detected and compared by coating herbicides to the leaves. As can be seen from
EXAMPLE 14
Herbicide Resistance of T1 Generation OE SDM Soybean Line-Whole Plant Spraying
(221) The herbicide resistance of OE PaHPPD-SDM soybean T1 generation line, OE GmHPPD soybean T1 generation line and wild type soybean William 82 was detected and compared by the method of whole plant spraying.
EXAMPLE 15
Chlorophyll Content and Plant Height of T1 Generation OE SDM Soybean-Whole Plant Spraying
(222) The herbicide resistance of OE PaHPPD-SDM soybean T1 generation line, OE GmHPPD soybean T1 generation line and wild type soybean William 82 was detected and compared by the method of whole plant spraying.
EXAMPLE 16
qPCR Analysis of the Expression of HPPD and Tocopherol Biosynthesis Genes in Soybean
(223) 4 week-old T1 generation seedlings of WT, OE GmHPPD and OE PaHPPD-SDM were used as materials to set up a treatment group and a control group, respectively, wherein the treatment group was continuously cultured in ? MS liquid medium containing 20 ?M mesotrione for 12 h. The total RNA of related materials was extracted using Super Fast Plant RNA Extraction Kit (Beijing Huayueyang Biological Technology Co., Ltd., China). The concentration of RNA samples was measured using NanoDrop ND1000 (Thermo Scientific, USA). RNA samples with an absorbance ratio (at wavelengths of 260/280 nm and 260/230 nm) of approximately 2.0 were selected. The total RNA (1,000 ng) was then used for synthesis of cDNA for reverse transcription using a cDNA synthesis kit (One-step Removal of Transcript gDNA and cDNA Synthesis Super Kit, TransGen).
(224) As for quantitative reverse transcription PCR analysis, 3.0 ?L cDNA was used as a template in a 20 ?L reaction system, and gene-specific primers such as qGmHPPD F and qGmHPPD R were used for GmHPPD gene, qGmHST F and qGmHST R were used for GmHPT gene (alkapton lycopene transferase gene), qGmHPT F and qGmHPT R were used for GmHPT or VTE2 genes, GmMPQMT F and MPQMT R were used for GmMPQMT methyl transferase genes (also known as VTE3), GmTC F and GmTC R were used for GmTC genes (also known as VTE1, tocopherol cyclase gene). These VTE (1, 2 and 3) genes were selected because they encode the key enzymes involved in tocopherol biosynthesis. The primer sequences used in the present invention are listed in Table 4. Three technical repetitions were performed on the Bio-Rad CFX96 real-time system. REST software was used for statistical analysis.
(225)
(226) All literatures mentioned in the present application are incorporated herein by reference, as though each one is individually incorporated by reference. In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications, equivalents of which falls in the scope of claims as defined in the appended claims.