Methods of treating malignant tumour with IL-12 and anti-PD-1 antibody
11951157 ยท 2024-04-09
Assignee
Inventors
Cpc classification
C07K2319/30
CHEMISTRY; METALLURGY
A61K39/3955
HUMAN NECESSITIES
A61K9/0019
HUMAN NECESSITIES
A61K39/3955
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2039/545
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
C07K16/28
CHEMISTRY; METALLURGY
A61K39/395
HUMAN NECESSITIES
A61K9/00
HUMAN NECESSITIES
Abstract
The invention relates to a combination medicament for treatment of malignant neoplastic disease. The combination medicament comprises an IL-12 polypeptide having a biological activity of IL-12 or a nucleic acid expression vector comprising a sequence encoding such IL-12 polypeptide, and a non-agonist blockade of T-cell inhibitory molecules, including non-agonist LAG-3 ligand, non-agonist TIM-3 ligand, non-agonist BLTA ligand, non-agonist TIGIT ligand, non-agonist VISTA ligand, non-agonist B7/H3 ligand, non-agonist CTLA-4 ligand or non-agonist PD-1 ligand, particularly an anti-CTLA-4 or anti-PD-1 immunoglobulin G.
Claims
1. A method of treating a patient suffering from a malignant tumor, wherein the malignant tumor is melanoma, the method comprising a. administering into the malignant tumor, the vicinity of the malignant tumor, or the lymph node associated with the malignant tumor, an effective amount of a recombinant IL-12 polypeptide comprising i. a human IL-12 p35 comprising the amino acid sequence SEQ ID NO:5, ii. a human IL-12 p40 comprising the amino acid sequence SEQ ID NO:6 and iii. optionally, a human immunoglobulin G crystallisable fragment; and b. systemically administering an effective amount of a non-agonist blockade of T-cell inhibitory antibody, wherein the antibody is an anti-PD-1 antibody, thereby treating the malignant tumor.
2. The method of claim 1, wherein the recombinant IL-12 polypeptide comprises a human immunoglobulin G subgroup 4 crystallisable fragment.
3. The method of claim 1, wherein the recombinant IL-12 polypeptide is a fusion protein comprising the human IL-12 p40 and p35 subunits and the crystallisable fragment which is of human lgG4, said recombinant IL-12 polypeptide is provided as a dosage form for intratumoural delivery, and wherein said anti-PD-1 antibody is an immunoglobulin G provided as a dosage form for systemic delivery.
4. The method of claim 1, wherein the anti-PD-1 antibody is a gamma immunoglobulin that binds to PD-1.
5. The method of claim 1, wherein the anti-PD-1 antibody is selected from the group consisting of nivolumab, pembrolizumab, and cemiplimab.
6. The method of claim 1, wherein the recombinant IL-12 polypeptide is provided as a dosage form for intratumoral injection.
7. The method of claim 1, wherein the anti-PD-1 antibody is provided as a dosage form for intravenous injection.
8. The method of claim 1, wherein the malignant tumor is a primary tumor.
9. A method of treating a patient suffering from a malignant tumor, wherein the malignant tumor is melanoma, the method comprising a. administering into the malignant tumor, the vicinity of the malignant tumor, or the lymph node associated with the malignant tumor, an effective amount of a recombinant IL-12 polypeptide comprising the amino acid sequence SEQ ID NO: 1, and b. systemically administering an effective amount of an anti-PD-1 antibody, thereby treating the malignant tumor.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
BRIEF DESCRIPTION OF THE DESCRIBED SEQUENCES
(14) The nucleic and/or amino acid sequences provided herewith are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file named 95083_303_1001_seq, about 53 KB. In the Sequence Listing:
(15) SEQ ID NO: 1 is the amino acid sequence of a human fusion protein IL-12Fc.
(16) SEQ ID NO: 2 is the amino acid sequence of a murine IL-12 IgG3 Fc fusion construct.
(17) SEQ ID NO: 3 is the nucleic acid forward primer of IgG3fw: acacacagcctggacgc
(18) SEQ ID NO: 4 is the nucleic acid reverse primer of IgG3rev: catttgaactccttgcccct
(19) SEQ ID NO: 5 is the amino acid sequence of p35 polypeptide.
(20) SEQ ID NO: 6 is the amino acid sequence of p40 polypeptide.
(21) SEQ ID NO: 7 is the nucleic acid sequence expression construct, coding sequence for IL-12 IgG4 Fc fusion.
(22) SEQ ID NO: 8 is the nucleic acid sequence of plasmid vector encoding Fc tag (murine).
(23) SEQ ID NO: 9 is the nucleic acid sequence of plasmid vector encoding Fc-tag IL-12 fusion construct.
DETAILED DESCRIPTION
I. Overview of Several Embodiments
(24) Described herein are methods of treating a patient suffering from a malignant primary tumor such as glioma and glioblastoma multiform; including the administering into a malignant primary tumor, into the vicinity of a malignant primary tumor, or to the lymph node associated with a malignant primary tumor, an effective amount of a recombinant IL-12 polypeptide or a polypeptide comprising a polypeptide sequence at least 95% identical to the sequence of human p35 (SEQ ID NO:5), and a polypeptide sequence at least 95% identical to the sequence of human p40 (SEQ ID NO:6) and a human immunoglobulin G crystallisable fragment; and the systemic administration of an effective amount of a non-agonist CTLA-4 antibody, thereby treating the malignant primary tumor.
(25) In some embodiments the recombinant IL-12 polypeptide comprises a human immunoglobulin G subgroup 4 crystallisable fragment.
(26) In particular embodiments the recombinant IL-12 polypeptide includes an immunoglobulin G crystallisable fragment and a recombinant or synthetic human IL-12 sequence, or a sequence at least 95% identical to SEQ ID NO:1.
(27) In some embodiments the non-agonist CTLA-4 antibody is a gamma immunoglobulin that binds to CTLA-4.
(28) In particular embodiments the recombinant IL-12 polypeptide is provided as a dosage form for intratumoural injection.
(29) In some embodiments the non-agonist CTLA-4 antibody is provided as a dosage form for intravenous injection.
(30) In further embodiments the recombinant IL-12 polypeptide is a fusion protein including the human p40 p35 subunits and the crystallisable fragment of human IgG4, said recombinant IL-12 polypeptide is provided as a dosage form for intratumoural delivery, and wherein said non-agonist CTLA-4 antibody is an immunoglobulin G provided as a dosage form for systemic delivery.
(31) In particular embodiments the malignant primary tumor is glioblastoma multiforme.
(32) In some embodiments the method of treatment is a method of inhibiting growth of the malignant primary tumor. In other embodiments the treatment is a method of reducing the size of the malignant primary tumor.
II. Detailed Description of the Embodiments
(33) In the course of a study focused on the clinical therapeutic potential or IL-12 in advanced-stage GBM in a relevant rodent model, it was surprisingly found that the combination of IL-12 with a blockade of co-inhibitory signals with anti-CTLA-4 antibody leads to almost complete tumour eradication and cure even at advanced disease stages. The combination of IL-12 with a blockade of co-inhibitory signals with anti-PD-1 antibody as well leads to tumour regression.
(34) According to a first aspect of the invention, a combination medicament is provided for use in the therapy of solid tumours, particular brain tumours, particularly glioma, which comprises an IL-12 polypeptide and a T cell inhibition blocker agent selected from a non-agonist CTLA-4 ligand and a non-agonist PD-1 or PD-L1 or PD-L2 ligand.
(35) In the context of the present invention, an IL-12 polypeptide is a polypeptide having an amino acid sequence comprising the sequence of p35 (Uniprot ID 29459, SEQ ID 05) or a functional homologue thereof, and comprising the sequence of p40 (Uniprot ID29460, SEQ ID 06) or a functional homologue thereof. In one embodiment, the IL-12 polypeptide has an amino acid sequence comprising both p35 and p40 sequences or homologues thereof as part of the same continuous amino acid chain. In another embodiment, the IL-12 polypeptide comprises two distinct amino acid chains, one comprising the p35 sequence and another one comprising the p40 sequence. The terminology IL-12 polypeptide does not preclude the presence of non-IL-12 sequences, for example immunoglobulin sequences and fragments thereof, fused to the IL-12 sequences described herein.
(36) The IL-12 polypeptide has a biological activity of IL-12. A biological activity of IL-12 in the context of the present invention is the stimulation of NK or T cells by said IL-12 polypeptide, most prominently the stimulation of T effector cells acting through perforin.
(37) In one embodiment of the combination medicament, said IL-12 polypeptide comprises a polypeptide sequence at least 95%, 96%, 97%, 98% or 99% identical to the sequence of human p35 (SEQ ID 05), and a polypeptide sequence at least 95%, 96%, 97%, 98% or 99% identical to the sequence of human p40 (SEQ ID 06).
(38) In the context of the present specification, the terms sequence identity and percentage of sequence identity refer to a single quantitative parameter representing the result of a sequence comparison determined by comparing two aligned sequences position by position. Methods for alignment of sequences for comparison are well-known in the art. Alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981), by the global alignment algorithm of
(39) Needleman and Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Nat. Acad. Sci. 85:2444 (1988) or by computerized implementations of these algorithms, including, but not limited to: CLUSTAL, GAP, BESTFIT, BLAST, FASTA and TFASTA. Software for performing BLAST analyses is publicly available, e.g., through the National Center for Biotechnology-Information (http://blast.ncbi.nlm.nih.gov/).
(40) One example for comparison of amino acid sequences is the BLASTP algorithm that uses the default settings: Expect threshold: 10; Word size: 3; Max matches in a query range: 0; Matrix: BLOSUM62; Gap Costs: Existence 11, Extension 1; Compositional adjustments: Conditional compositional score matrix adjustment. One such example for comparison of nucleic acid sequences is the BLASTN algorithm that uses the default settings: Expect threshold: 10; Word size: 28; Max matches in a query range: 0; Match/Mismatch Scores: 1.-2; Gap costs: Linear. Unless stated otherwise, sequence identity values provided herein refer to the value obtained using the BLAST suite of programs (Altschul et al., J. Mol. Biol. 215:403-410 (1990)) using the above identified default parameters for protein and nucleic acid comparison, respectively. In one embodiment, said IL-12 polypeptide is a recombinant human IL-12. In one embodiment, said IL-12 polypeptide is a synthetic human IL-12. In one embodiment, said IL-12 polypeptide is a fusion peptide comprising the crystallisable fragment (Fc region) of a human immunoglobulin. According to one embodiment, the IL-12 polypeptide comprises a crystallisable fragment of human immunoglobulin G. A crystallizable fragment in the context of the present invention refers to the second and third constant domain of the IgG molecule. The fragment crystallizable region (Fc region) is the tail region of an immunoglobulin antibody that interacts with cell surface receptors (Fc receptors) and proteins of the complement system. In IgG antibody isotypes, the Fc region is composed of two identical protein fragments, derived from the second and third constant domains of the antibody's two heavy chains.
(41) According to one embodiment, the IL-12 polypeptide comprises a crystallisable fragment of human immunoglobulin G4. According to one embodiment, the IL-12 polypeptide has or comprises the sequence of SEQ ID 01. According to another embodiment, the IL-12 polypeptide comprises a sequence at least 95%, 96%, 97%, 98% or 99% identical to the sequence of SEQ ID 01.
(42) Embodiments wherein IL-12 polypeptide chains are fused to immunoglobulin Fc fragments show different pharmacokinetic behaviour in comparison to the recombinant cytokine, which for some applications may confer a benefit.
(43) In one embodiment, the IL-12 polypeptide component of the combination medicament is provided as a dosage form for local (intratumoural) administration or delivery. Such dosage form for local (intratumoural) administration may be a slow-release form or depot form, from which said IL-12 polypeptide is released over a number of hours to weeks. In one embodiment, the IL-12 polypeptide component of the combination medicament is administered via convection enhanced delivery (CED) or a variation thereof, for example the device shown in US2011137289 (A1) (incorporated herein by reference).
(44) In one embodiment, the IL-12 polypeptide is administered systemically together with systemic CTLA-4/PD-1/PD-L1/PD-L2 blockade. Heterodimeric recombinant IL-12 (peprotech) applied systemically together with systemic CTLA-4 blockade (i.p.) achieved a significant improvement in survival in comparison to either agent administered by itself (see
(45) In another embodiment, the IL-12 polypeptide is administered systemically together with systemic LAG-3, TIM-3, BLTA, TIGIT, VISTA or B7/H3 blockade.
(46) In the context of the present invention, a non-agonist CTLA-4 ligand is a molecule that binds selectively to CTLA-4 under conditions prevailing in peripheral blood, without triggering the biological effect of CTLA-4 interaction with any of the physiological ligands of CTLA-4, particularly CD80 and/or CD86.
(47) In the context of the present invention, a non-agonist PD-1 ligand is a molecule that binds selectively to PD-1 under conditions prevailing in peripheral blood, without triggering the biological effect of PD-1 interaction with any of the physiological ligands of PD-1, particularly PD-L1 or PD-L2. A non-agonist PD-L1 (PD-L2) ligand is a molecule that binds selectively to to PD-L1 (or to PD-L2) under conditions prevailing in peripheral blood, without triggering the biological effect of PD-L1 (PD-L2) interaction with any of its physiological ligands, particularly PD-1.
(48) Similarly, in the context of the present invention, a non-agonist LAG-3, TIM-3, BLTA, TIGIT, VISTA or B7/H3 ligand, such as a polypeptide ligand, is a molecule that binds selectively to LAG-3, TIM-3, BLTA, TIGIT, VISTA or B7/H3 under conditions prevailing in peripheral blood, without triggering the biological effect of LAG-3, TIM-3, BLTA, TIGIT, VISTA or B7/H3 with any of the physiological ligands of LAG-3, TIM-3, BLTA, TIGIT, VISTA or B7/H3.
(49) In some embodiments, said non-agonist CTLA-4 ligand is a polypeptide binding to CTLA-4. In some embodiments, said non-agonist PD-1 ligand is a polypeptide binding to PD-1.
(50) A non-agonist CTLA-4 ligand in the sense of the invention refers to a molecule that is capable of binding to CTLA-4 with a dissociation constant of at least 10.sup.?7 M.sup.?1, 10.sup.?8 M.sup.?1 or 10.sup.?9 M.sup.?1 and which inhibits the biological activity of its respective target. A a non-agonist PD-1 ligand or a non-agonist PD-L1 (PD-L2) ligand in the sense of the invention refers to a molecule that is capable of binding to PD-L1 (PD-L1, PD-L2) with a dissociation constant of at least 10.sup.?7 M.sup.?1, M.sup.?8 M.sup.?1 or 10.sup.?9 M.sup.?1 and which inhibits the biological activity of its respective target.
(51) A non-agonist polypeptide ligand may be an antibody, an antibody fragment, an antibody-like molecule or an oligopeptide, any of which binds to and thereby inhibits CTLA-4, PD-1 PD-L1 (PD-L2), LAG-3, TIM-3, BLTA, TIGIT, VISTA or B7/H3 respectively.
(52) An antibody fragment may be a Fab domain or an Fv domain of an antibody, or a single-chain antibody fragment, which is a fusion protein consisting of the variable regions of light and heavy chains of an antibody connected by a peptide linker. The inhibitor may also be a single domain antibody, consisting of an isolated variable domain from a heavy or light chain. Additionally, an antibody may also be a heavy-chain antibody consisting of only heavy chains such as antibodies found in camelids. An antibody-like molecule may be a repeat protein, such as a designed ankyrin repeat protein (Molecular Partners, Zurich).
(53) An oligopeptide according to the above aspect of the invention may be a peptide derived from the recognition site of a physiological ligand of CTLA-4, PD-1 or PD-L1 or PD-L2. Such oligopeptide ligand competes with the physiological ligand for binding to CTLA-4, PD-1 or PD-L1 or PD-L2, respectively.
(54) An oligopeptide according to the above aspect of the invention may be a peptide derived from the recognition site of a physiological ligand of LAG-3, TIM-3, BLTA, TIGIT, VISTA or B7/H3. Such oligopeptide ligand competes with the physiological ligand for binding to LAG-3, TIM-3, BLTA, TIGIT, VISTA or B7/H3. Particularly, a non-agonist CTLA-4 ligand or non-agonist PD-1 ligand or non-agonist PD-L1 ligand or non-agonist PD-L2 ligand does not lead to attenuated T cell activity when binding to CTLA-4, PD-1, PD-L1 or PD-L2, respectively, on the surface on a T-cell. In certain embodiments, the term non-agonist CTLA-4 ligand or non-agonist PD-1 ligand covers both antagonists of CTLA-4 or PD-1 and ligands that are neutral vis-?-vis CTLA-4 or PD-1 signalling. In some embodiments, non-agonist CTLA-4 ligands used in the present invention are able, when bound to CTLA-4, to sterically block interaction of CTLA-4 with its binding partners CD80 and/or CD86 and non-agonist PD-1 ligands used in the present invention are able, when bound to PD-1, to sterically block interaction of PD-1 with its binding partners PD-L1 and/or PD-L2.
(55) In one embodiment, said non-agonist CTLA-4 ligand is a gamma immunoglobulin binding to CTLA-4, without triggering the physiological response of CTLA-4 interaction with its binding partners CD80 and/or CD86.
(56) In some embodiments, said non-agonist PD-1 ligand is a gamma immunoglobulin binding to PD-1, without triggering the physiological response of PD-1 interaction with its binding partners PD-L1 and/or PD-L2.
(57) In some embodiments, said non-agonist PD-L1 (PD-L2) ligand is a gamma immunoglobulin binding to PD-L1 (PD-L2), without triggering the physiological response of PD-1 interaction with its binding partners PD-L1 and/or PD-L2.
(58) Non-limiting examples for a CTLA-4 ligand are the clinically approved antibodies tremelimumab (CAS 745013-59-6) and ipilimumab (CAS No. 477202-00-9; Yervoy).
(59) Non-limiting examples for a PD-1/PD-L1 or PD-L2 ligands are the antibodies MDX-1105/BMS-936559, MDX-1106/BMS-936558/ONO-4538, MK-3475/SCH 900475 or AMP-224 currently undergoing clinical development
(60) The term gamma immunoglobulin in this context is intended to encompass both complete immunoglobulin molecules and functional fragments thereof, wherein the function is binding to CTLA-4, PD-1 or PD-L1 (PD-L2) as laid out above.
(61) In one embodiment, the combination therapy comprises two distinct dosage forms, wherein said IL-12 polypeptide is provided as a dosage form for intratumoural delivery or local delivery in the vicinity of the tumour, and said non-agonist CTLA-4 ligand or non-agonist PD-1 ligand is provided as a dosage form for systemic delivery, particularly by intravenous injection. However, said non-agonist CTLA-4 ligand or non-agonist PD-1 ligand may also be locally applied in the same way as the IL-12 polypeptide. According to another embodiment, the IL-12 polypeptide is applied directly to the tumour draining lymph node.
(62) According to another embodiment, the combination therapy comprises a dosage form whereby said IL-12 polypeptide is provided for intracranial delivery, e.g. by injection.
(63) According to another aspect of the invention, a combination medicament is provided as set forth above, for use in a method of therapy of a malignant neoplastic disease, particularly solid cancerous lesions. In one embodiment, the malignant neoplastic disease is glioma. In one embodiment, the malignant neoplastic disease is a secondary brain tumour (brain metastasis of a neoplastic lesion arising outside the brain). In one embodiment, the disease is glioblastoma multiforme. In one embodiment, the malignant neoplastic disease is meningioma. In one embodiment, the malignant neoplastic disease is melanoma. In one embodiment, the malignant neoplastic disease is pancreatic cancer. In one embodiment, the malignant neoplastic disease is lung cancer. In one embodiment, the malignant neoplastic disease is prostate cancer. In one embodiment, the malignant neoplastic disease is bladder cancer.
(64) Cancerous lesions have the propensity to spread into neighbouring tissue as well as distinct locations in the body, depending on their origin. 20-40% of all cancers develop brain metastasis; among those lung, breast and skin (melanoma) cancer are the most common sources of brain metastases (Sofietti et al., J Neurol 249, 1357-1369 (2002)). Similar to primary malignant brain tumours, brain metastases have a poor prognosis despite treatment and are quickly fatal. T-cells are the crucial effector cell population for IL-12 mediated tumor rejection in the brain. IL-12 together with anti-CTLA-4, anti-PD-1, anti-PD-L1 or anti-PD-L2 combination treatment addresses especially the T-cells to activate and repolarize them.
(65) Since brain metastases grow in the same immune-compartment as primary brain tumors, patients suffering from secondary brain tumors also benefit from the combination treatment.
(66) In one embodiment, the combination medicament comprises an IL-12 polypeptide having a biological activity of IL-12 provided as a fusion protein comprising the amino acid of human p40, the amino acid sequence of human p35 and the crystallisable fragment of human IgG4, said IL-12 polypeptide being formulated as a dosage form for intratumoural delivery. According to this embodiment, the combination medicament further comprises an immunoglobulin G raised against CTLA-4 or PD-1 as a non-agonist CTLA-4 ligand and/or a non-agonist PD-1 ligand formulated as a dosage form for systemic delivery. According to this embodiment, the combination medicament is provided for the treatment of malignant neoplastic disease, particularly for glioma, glioblastoma multiforme, meningioma, melanoma, pancreatic cancer, breast cancer, lung cancer, prostate cancer or bladder cancer.
(67) According to yet another aspect of the invention, an IL-12 polypeptide having a biological activity of IL-12, and a non-agonist CTLA-4 ligand and/or non-agonist PD-1 ligand are used in the manufacture of a combination medicament for use in a method of therapy of a malignant neoplastic disease, particularly of glioma and other solid tissue tumours, such as glioblastoma multiforme, meningioma, melanoma, pancreatic cancer, breast cancer, lung cancer, prostate cancer or bladder cancer.
(68) According to yet another aspect of the invention, a method is provided for treating a patient suffering from malignant neoplastic disease, particularly glioma and other solid tissue tumours, comprising the administration of an IL-12 polypeptide having a biological activity of IL-12, and a non-agonist CTLA-4 ligand and/or a non-agonist PD-1 ligand to said patient.
(69) According to an alternative aspect of the invention, a combination therapy comprises an IL-12 nucleic acid expression vector encoding an encoded IL-12 polypeptide having a biological activity of IL-12, and a T cell inhibition blocker agent selected from a non-agonist CTLA-4 ligand and a non-agonist PD-1 or PD-L1 or PD-L2 ligand.
(70) The CTLA-4 ligand and a non-agonist PD-1 ligand may be embodied by polypeptides, particularly by antibodies, as set forth above. One non-limiting example for an encoded IL-12 polypeptide is a crystallisable immunoglobulin G fragment fused to the IL-12 constituent polypeptide chains, human IL-12 or a functional equivalent thereof. One non-limiting example is a fusion construct having the constituent polypeptides of IL-12 linked by a short amino acid sequence as depicted in
(71) According to yet another aspect of the invention, a polypeptide peptide is provided comprising a. a polypeptide sequence at least 95% identical to the sequence of human p35 (SEQ ID 05), and b. a polypeptide sequence at least 95% identical to the sequence of human p40 (SEQ ID 06) and c. a human immunoglobulin G subgroup 4 crystallisable fragment.
(72) In some embodiments, the polypeptide comprises or essentially consists of a sequence at least 95%, 96%, 97%, 98%, 99% identical to SEQ ID 01, or is SEQ ID 01.
(73) The advantage of using fusion proteins cytokines and the crystallisable fragment of immunoglobulins rather than the recombinant cytokine is improved pharmacokinetics (Belladonna et al. J Immunol 168, 5448-5454 (2002); Schmidt, Curr Opin Drug Discov Devel 12, 284-295 (2009); Eisenring et al., Nat Immunol 11, 1030-1038 (2010)).
(74) The IL-12 nucleic acid expression vector according to this aspect of the invention may, by way of non-limiting example, be a naked DNA expression plasmid comprising a nucleic acid sequence encoding the IL-12 polypeptide under control of a promoter sequence operable in a human tumour cell, for delivery into the tumour, for example by intracranial injection. The IL-12 nucleic acid expression vector may similarly be a viral vector, for example an adeno-associated virus, an adenovirus, a lentivirus or a herpes virus.
(75) Such IL-12 nucleic acid expression vector may be provided as a dosage form for intratumoural delivery in combination with a protein non-agonist CTLA-4 ligand and/or a non-agonist PD-1 ligand as set forth above. Similarly, the scope of the present invention encompasses the use of such IL-12 nucleic acid expression vector, in combination with a non-agonist CTLA-4 ligand and/or a non-agonist PD-1 ligand, in a method of making a combination medicament for use in therapy of malignant neoplastic disease, particularly glioma, glioblastoma multiforme, meningioma, melanoma, pancreatic cancer, lung cancer, prostate cancer or bladder cancer. Likewise, a method is provided for treating a patient suffering from malignant neoplastic disease, particularly glioma or other solid tissue tumours, comprising the administration of an IL-12 nucleic acid expression vector having a biological activity of IL-12, and a non-agonist CTLA-4 ligand and/or a non-agonist PD-1 ligand to said patient.
EXAMPLES
Example 1
Methods
(76) Animals
(77) C57BL/6 mice were obtained from Janvier; b2m.sup.?/?, Ia(b).sup.?/?, Il12rb2.sup.?/?, Rag1.sup.?/?, Rag2.sup.?/?Il2rg.sup.?/?, Prf1.sup.?/? and Ifng.sup.?/? mice were obtained from Jackson Laboratories. Il15ra.sup.?/?mice were provided by S. Bulfone-Paus. All animals were kept in house under specific pathogen-free conditions at a 12 hour light/dark cycle with food and water provided ad libitum. All animal experiments were approved by the Swiss Cantonary veterinary office (16/2009).
(78) Mouse Tumour Cell Lines
(79) C57/B16 murine glioma (G1261) cells (kindly provided by A. Fontana, Experimental Immunology, University of Zurich) were transfected with pG13-ctrl (Promega) and pGK-Puro (kindly provided by T. Buch, Technical University Munich). Linearized constructs were electroporated in a 10:1 ratio using an eppendorf multiporator, then selected with 0.8 ?g/ml puromycin (Sigma-Aldrich) to generate luciferase-stable G1261 cells. A single clone was isolated by limiting dilution and passaged in vivo by intracranial tumour inoculation, followed by tumour dissociation after 4 weeks and re-selection in 0.8 ?g/ml puromycin. Subsequently, cells were electroporated with pCEP4-mIgG3, pCEP4-ml-12mIgG3 (SEQ ID 09) and pCEP4-mII-23mIgG3 (SEQ ID 08) (Eisenring et al, 2010) and bulk-selected with 0.8 ?g/ml puromycin and 0.23 mg/ml hygromycin (Sigma-Aldrich). Cytokine production was detetected by ELISA (OptEIA Il-12/23p40, BD Pharmingen) and rt-PCR (IgG3fw: ACACACAGCCTGGACGC (SEQ ID 03) IgG3rev: CATTTGAACTCCTTGCCCCT (SEQ ID 04)). G1261 cells and derived cell lines were maintained in Dulbecco's modified Eagle's medium (Gibco, Invitrogen) supplemented with 10% fetal calf serum (FCS) in presence of selection antibiotics as indicated above at 37? C. and 10% CO.sub.2. B16-F10 murine melanoma cells were purchased from ATCC.
(80) Expression and Purification of IL-12Fc
(81) IL-12Fc (SEQ ID 02) was expressed in 293T cells after calcium phosphate-mediated transfection according to standard protocols with 45 ?g of vector DNA (pCEP4-mIL-12IgG3, SEQ ID 09)/15 cm tissue culture plate. Supernatant was harvested 3 days and 6 days after transfection, sterile filtered and diluted 1:1 in PBS. The protein was purified using a purifier (AktaPrime) over a protein G column (1 ml, HiTrap, GE Healthcare) eluted with 0.1 M glycine pH 2 and dialyzed over night in PBS pH 7.4. Concentration and purity of IL-12Fc (SEQ ID 02) was measured by ELISA (OptEIA Il-12/23p40, BD Pharmingen) and SDS-PAGE followed by silverstaining and immunoblotting. IL-12Fc was detected with a rat anti mouse IL-12p40 antibody (C17.8, BioExpress) and a goat anti-rat HRP coupled antibody (Jackson). The same procedure was used for the expression of human IL-12Fc (SEQ ID 01, 07).
(82) Characterization of Human IL-12Fc
(83) Concentration and purity of human IL-12Fc (SEQ ID 01) was measured by ELISA (Human IL-12 (p70), Mabtech, #2455-1H-6) and SDS-PAGE followed by silver staining and immunoblotting. The human IgG4 tag was detected with an HRP-coupled goat anti human IgG antibody (#A0170, Sigma). For functional characterization of human IL-12Fc (SEQ ID 01) PBMCs, acquired according to the ethical guidelines of the University of Zurich, were plated at 100000 cells per well in RPMI medium supplemented with 10% fetal calf serum (FCS) in 96 well plates and stimulated with either recombinant human IL-12 (Peprotech) or human IL-12Fc (SEQ ID 01). Both cytokines were normalized to each other according to concentrations derived from human IL-12p70 ELISA (Mabtech, #2455-1H-6). PBMCs were stimulated in the presence of 1 ?g/ml of a mouse IgG2a anti-human CD3 antibody (OKT3, Bio-X-cell). After two days of culture in 5% CO.sub.2 and 37? C., supernatant was harvested and subjected to an anti-human IFN-? ELISA (Mabtech, #3420-1H-6).
(84) Orthotopic Glioma Inoculation
(85) Briefly, 6-10 week old mice were i.p. injected with Fluniximin (Biokema, 5 mg/kg body weight) before being anaesthesized with 3-5% isoflurane (Minrad) in an induction chamber. Their heads were shaved with an electric hair-trimmer. After being mounted onto a stereotactic frame (David Kopf Instruments), the animals' scalp was disinfected with 10% iodine solution and a skin incision was made along the midline. Anaesthesia on the stereotactic frame was maintained at 3% isoflurane delivered through a nose adaptor (David Kopf Instruments). Subsequently, a blunt ended syringe (Hamilton, 75N, 26s/2/2, 5 ?l) was mounted on a microinjection pump on the manipulator arm and placed 1.5 mm lateral and 1 mm frontal of bregma. The needle was lowered into the manually drilled burr hole at a depth of 4 mm below the dura surface and retracted 1 mm to form a small reservoir. Using the microinjection pump (UMP-3, World Precision Instruments Inc.) 2?10.sup.4 cells were injected in a volume of 2 ?l at 1 ?l/min. After leaving the needle in place for 2 min, it was retracted at 1 mm/min. The burr hole was closed with bone wax (Aesculap, Braun) and the scalp wound was sealed with tissue glue (Indermil, Henkel).
(86) In Vivo Bioluminescent Imaging
(87) Tumour bearing mice were carefully weighed, anaesthesized with isoflurane (2-3%) and injected with D-Luciferin (150 mg/kg body weight, CaliperLifesciences). Animals were transferred to the dark chamber of a Xenogen IVIS 100 (CaliperLifesciences) imaging system, anaesthesia was maintained at 2% isoflurane via nosecones. 10 min after injection luminescence was recorded. Data was subsequently analyzed using Living Image 2.5 software (CaliperLifesciences). A circular region of interest (ROI; 1.46 cm ?) was defined around the animals' head and photon flux of this region was read out and plotted.
(88) Treatment of Established Gliomas
(89) At d21 after implantation of the glioma cells, the tumour bearing animals were evenly distributed among experimental groups based on their ROI-photon flux. Animals with an ROI flux of less than 1?10.sup.5 p/s were considered as non-takers and excluded. 40-48 h prior to implantation (2 days before beginning of treatment), osmotic pumps (Model 2004, 0.25 ?l/h; Alzet) were filled with murine IL-12Fc (SEQ ID 02, 8.33 ng/?l in PBS) or PBS alone and primed at 37? C. in PBS. Immediately prior to surgery, mice were injected with Fluniximini.p. (Biokema, 5 mg/kg body weight). Mice were anaesthesized with 3-5% isoflurane, the scalp was disinfected and a midline incision was made. The previous burr hole of the glioma injection was located, the bone wax and periost removed and the pump placed into a skin pouch formed at the animal's back. The infusion cannula was lowered through the burr hole 3 mm into the putative center of the tumour. The cannula was connected to the pump (brain infusion kit III 1-3 mm, Alzet) via a silicon tube and held in place with cyanoacrylate adhesive. The skin was sutured with a 4-0 nylon thread. Following surgery, mice were treated for 3 days with 0.1% (v/v) Borgal (Intervet) in the drinking water. Pumps were explanted at day 49. Five doses of anti mouse-CTLA-4 mouse-IgG2b antibodies (clone 9D9, bio-X-cell; Peggs et al.; J Exp Med 206, 1717-1725 (2009)) or an equivalent volume of PBS were i.p. injected at days 22 (200 ?g), 26 (100 ?g), 29 (100 ?g), 35 (100 ?g) and 42 (100 ?g).
(90) Alternatively, animals received anti-mouse-PD-1 rat IgG2a (clone RMP1-14, bio-X-cell) or rat IgG2a isotype control antibodies (clone 2A3, bio-X-cell) for the experiment depicted in
(91) Survival Analysis of Tumour Bearing Animals
(92) Tumour bearing animals were monitored by BLI, checked for neurological symptoms and weighed weekly until day 21 post glioma inoculation. G1261 Fc animals exhibiting an ROI flux of less than 1?10.sup.5 p/s at day 21 were considered as non or slow-tumour takers and excluded from the survival analysis (5-10%). From day 21 onwards animals were checked daily. Animals that showed symptoms as apathy, severe hunchback posture and/or weight loss of over 20% of peak weight were euthanized. B16-F10 tumour bearing mice were scored daily starting at day 5 until the end of experiment according to the same scheme.
(93) Histology
(94) For histology, animals were euthanized with CO.sub.2, transcardially perfused with ice-cold PBS and decapitated. Whole brains were carefully isolated, fixed in 4% Formalin, embedded in Paraffin and 3 ?m sections were processed for HE staining and/or immunohistochemistry to detect F4/80 (BM8; BMA biomedicals). Primary antibodies were detected with HorseRadish Peroxidase-coupled secondary antibodies. Staining was visualized with 3,3-Diaminobenzidin (DAB) as the HRP substrate. Pictures were generated using an Olympus BX41 light microscope equipped with an Olympus ColorViewIIIu camera and Olympus cell{circumflex over ()}B image acquisition software. Overviews of whole brains slices were cropped using Adobe Photoshop CS3.
(95) Statistical Analysis
(96) For statistical analysis of Kaplan-Meier survival curves, a Log-rank (Mantel-Cox) Test was used to calculate the p-values indicated in respective figures. P values of less than 0.05 were considered statistically significant. Analysis was performed with GraphPad Prism version 5.0a for Mac OSX (GraphPad Software Inc).
Example 2
Intratumoural Expression of IL-12Fc Promotes Clearance of Experimental Gliomas
(97) We have designed and cloned a fusion protein consisting of the p40 subunit of human IL-12 linked via a flexible peptide linker to the p35 subunit. This single chain construct was then fused to the constant region of human IgG4 heavy chain (
(98) We next implanted G1261 IL-12Fc and Fc into the right striatum of syngenic C57B1/6 mice and followed tumour growth via non invasive bioluminescence imaging (BLI). After an initial increase in luminescence all groups showed a depression around day 14 post injection. Animals bearing Fc-expressing tumours exhibited a steep increase in BLI and soon reached withdrawal criteria, sometimes even before day 35 post injection. In contrast, BLI-readings for animals that had been injected with IL-12Fc expressing G1261 tumours dropped to levels close to the detection limit at day 21 onwards (data not shown). In agreement with this observation, we could only detect a residual tumour in some animals in this group, while Fc control-injected animals showed robust tumour formation when analyzed histologically (
Example 3
T-cells are the Major Effector Cell Type of IL-12Fc Mediated Glioma Rejection
(99) To confirm that the secretion of IL-12Fc by G1261 IL-12Fc acts on the host rather than the tumour cells themselves, we observed the growth of G1261 IL-12Fc and G1261 Fc to be the same in mice lacking the receptor to IL-12. The unbridled growth of G1261 IL-12 in IL-12r?2.sup.?/? animals demonstrates that IL-12Fc acts specifically on a cell type in the recipient mouse (data not shown). T and NK cells are among the most prominent IL-12 responsive leukocytes. To systematically test the functional relevance of the IL-12Fc mediated influx of these cells, we challenged a series of mouse mutants with intracranial G1261 IL-12Fc. We implanted G1261 IL-12Fc cells in mice that lack T and B cells (Rag1.sup.?/?) or conventional Nk-cells (Il-15ra.sup.?/?) or in mice lacking both T-, B-, Nk-cells and lymphoid tissue inducer-like cells (Rag2.sup.?/?) (
(100) We next investigated the contribution of CD4- and CD8 positive T-cells using MHCII (Ia(b).sup.?/?) and MHCI (?2m.sup.?/?) deficient mice. In contrast to wt mice, Ia(b).sup.?/? mice lacking CD4 T cells could not control G1261 IL-12Fc tumours, and ?2m.sup.?/? mice succumbed to the glioma shortly afterwards (
Example 4
The Antitumoural Memory Response is Independent of Ectopically Expressed IL-12Fc
(101) To further investigate the character of the T-cell dependent tumour control, we tested the surviving wt animals that had been previously challenged with G1261 IL-12Fc cells for T cell memory formation (
Example 5
CTLs are the Main Effector Cells of IL-12Fc-mediated Glioma Rejection
(102) It is well established that IL-12 polarizes naive T-cells to adopt a T.sub.H1 phenotype (Trinchieri, Nat Rev Immunol 3, 133-146 (2003)). To shed further light on the mechanistic underpinnings underlying the IL-12 induced rejection of experimental glioma, we challenged mice deficient in the T.sub.H1 hallmark cytokine IFN-? (Ifng.sup.?/?) with IL-12Fc expressing G1261 cells (
(103) When we analyzed the role of Perforin, a cytolytic molecule primarily expressed on CD8.sup.+ CTLs and Nk-cells, we observed a clear difference in survival 0 CTLs and NK cells but also CD.sup.4+ T-cells. To further investigate the mechanism of IL-12Fc induced rejection of glioma, perforin-deficient mice (prf1.sup.?/?) were challenged with IL-12Fc expressing G1261 cells. In contrast to Ifng.sup.?/?, Perforin deficient animals (prf1.sup.?/?) were not able to control the tumour. This further supports the notion that CTLs are the main effector cells of IL-12Fc mediated glioma rejection. A clear difference in the survival curves of wt and prf1.sup.?/? was observed.
Example 6
Local Administration of IL-12Fc in Combination with Systemic CTLA-4 Blockade is Effective Against Advanced Stage Experimental Gliomas
(104) To further boost and prolong the activated phenotype of T-cells, we blocked the co-inhibitory molecule CTLA-4 via neutralizing antibodies in the next set of experiments. IL-12 was administered locally to mice with advanced stage tumours. Treatment was administered to animals that had been challenged with G1261 Fc 21 days before and that already exhibited strong bioluminescence signals, indicating an advanced stage of glioma growth. Local treatment: At day 21, osmotic minipumps delivering 50 ng IL-12Fc/day (or PBS) into the tumour were implanted into glioma bearing animals. After 28 days (day 49 after tumour injection) the empty pumps were explanted from surviving animals. Systemic treatment: At day 22, tumour bearing animals received 200 ?g ?CTLA-4 mouse IgG2b (9D9) or PBS i.p. Treatment was sustained with 100 ?g ?CTLA-4 at days 26, 29, 35 and 42 (
(105) Preventive treatment of tumours in preclinical models may allow the study of immunological mechanisms and the interactions between tumour cells and tumour microenvironment. However, preventive therapy is of limited clinical relevance in the translation to treat cancer patients. We thus decided to choose an exceptionally late timepoint for intervention in a progressing and aggressive disease model. To closely mimic a clinical situation, we allowed the tumour to progress to a size that is highly likely to cause significant neurological symptoms in humans. Here, monotherapy with locally applied (intratumoural) IL-12 had a minimal albeit significant survival effect. We already observed a weak synergistic effect when we combined systemic IL-12 treatment with systemic CTLA-4 blockade. When local IL-12 infusion was combined with systemic CTLA-4 blockade, the anti-glioma effect was striking.