Recombinant foot-and-mouth disease virus with reduced immunosuppression activity, and preparation method and use thereof
11952401 ยท 2024-04-09
Assignee
Inventors
- Haixue Zheng (Lanzhou, CN)
- Fan Yang (Lanzhou, CN)
- Zixiang Zhu (Lanzhou, CN)
- Xiangle ZHANG (Lanzhou, CN)
- Weijun Cao (Lanzhou, CN)
- Congcong WANG (Lanzhou, CN)
- Kangli LI (Lanzhou, CN)
- Huisheng LIU (Lanzhou, CN)
- Hong Tian (Lanzhou, CN)
- Keshan Zhang (Lanzhou, CN)
- Xiangtao Liu (Lanzhou, CN)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2770/32151
CHEMISTRY; METALLURGY
C12N2770/32121
CHEMISTRY; METALLURGY
C12N2770/32152
CHEMISTRY; METALLURGY
C12N2770/32122
CHEMISTRY; METALLURGY
C12N2770/32134
CHEMISTRY; METALLURGY
A61P37/06
HUMAN NECESSITIES
International classification
A61K39/00
HUMAN NECESSITIES
A61P37/06
HUMAN NECESSITIES
Abstract
The present disclosure belongs to the technical field of biological products for veterinary medicine, and specifically relates to a recombinant foot-and-mouth disease virus (FMDV) with a reduced immunosuppressive activity, a preparation method and use thereof, and a recombinant vaccine strain. According to the present disclosure, it is firstly discovered that FMDV 3B protein has an immunosuppressive function, and key sites for exerting the immunosuppressive function are found. A recombinant FMDV vaccine strain with a lost immunosuppressive function in FMDV 3B protein is constructed by introducing amino acid mutations into three repeated copies of FMDV 3B protein.
Claims
1. A method for preparing a recombinant foot-and-mouth disease virus (FMDV), comprising mutating the amino acid at position 17 for each of 3B1, 3B2, and 3B3 of an FMDV 3B protein to glutamate to eliminate the immunosuppressive function of the FMDV 3B protein.
2. A recombinant FMDV, wherein the amino acid at position 17 for each of 3B1, 3B2, and 3B3 of an FMDV 3B protein is mutated to a polar amino acids using a gene mutation technology, thus eliminating the immunosuppressive function of the parental FMDV 3B protein.
3. A recombinant FMDV vaccine strain comprising the recombinant FMDV according to claim 2.
4. A method for preparing a recombinant FMDV, comprising the following steps: (1) constructing a full-length infectious clone of an FMDV; (2) mutating the amino acids at position 17 for each of 3B1, 3B2, and 3B3 of a 3B protein to a polar amino acids using a gene mutation technology or a gene synthesis technology to obtain a recombinant plasmid; (3) transfecting FMDV-sensitive cells with the recombinant plasmid, and culturing the transfected FMDV-sensitive cells to obtain the recombinant FMDV.
5. A recombinant FMDV prepared by the preparation method according to claim 4.
6. A recombinant FMDV vaccine strain comprising the recombinant FMDV according to claim 5.
7. An FMDV vaccine prepared from the recombinant FMDV vaccine strain according to claim 6.
8. The recombinant FMDV according to claim 2, wherein the amino acid sequence of the parental FMDV 3B protein is set forth in SEQ ID NO:4 and SEQ ID NO:7.
9. The recombinant FMDV according to claim 2, wherein the amino acids at position 17 for each of 3B1, 3B2, and 3B3 of the FMDV 3B protein is mutated to glutamate.
10. The recombinant FMDV according to claim 9, wherein the amino acid sequence of the mutated FMDV 3B protein is set forth in SEQ ID NO:2 and SEQ ID NO:6.
11. The method according to claim 4, wherein the FMDV-sensitive cell is the BHK-21 cell or porcine kidney (IBRS-2) cell.
12. The method according to claim 4, wherein the amino acids at position 17 for each of 3B1, 3B2 and 3B3 of the FMDV 3B protein are mutated to glutamate.
13. The method according to claim 12, wherein the mutated FMDV 3B protein has the amino acid sequence set forth in SEQ ID NO:2 or SEQ ID NO:6.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(10) In order to make the technical means, creative features, objectives, and efficacies of the disclosure easy to understand, the disclosure will be further described below in combination with examples. The protection scope of the present disclosure is not limited thereto.
(11) The relevant experiments described in the following examples have obtained a biosafety license and a FMD laboratory activity license.
(12) According to the relevant requirements of biosafety level 3 (BSL-3) laboratory and FMD-related biosafety, the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences has reported to the Biosafety Committee of the Lanzhou Veterinary Research Institute, the Biosafety Committee of the Chinese Academy of Agricultural Sciences, and the Laboratory Animal Ethics Committee of the Lanzhou Veterinary Research Institute. The Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences has obtained a permission of the Ministry of Agriculture to conduct research on highly-pathogenic FMDV pathogens and animals, and has put on record on the Ministry of Agriculture and Rural Affairs, thereby meeting the requirements of the national biosafety level.
(13) The experimental cells and plasmid sources described in the examples are as follows:
(14) FLAG-CMV-7.1 eukaryotic expression vector and POK12 vector are commercial plasmids; IFN-?, ISRE and NF-kB reporter systems are purchased from Miaoling Plasmid Sharing Platform; Trans5? Escherichia coli competent cells are purchased from TIANGEN Biotech (Beijing) Co., Ltd.; and HEK293T cells and BHK-21 cells are purchased from the National Infrastructure of Cell Line Resource.
(15) Unless otherwise specified, the operations in the experiment are known in the art.
Example 1 Immunosuppressive Effect of FMDV 3B Protein
(16) Amino acid sequences of 3B protein of different serotypes of FMDV were aligned, and it was found that three copies 3B1, 3B2, and 3B3 of 3B protein of different serotypes of FMDV, all had high homology. The results were shown in
(17) 1.1 Effect of FMDV 3B Protein on Innate Immune Response
(18) The immunosuppressive effect of 3B protein was detected using IFN-?, ISRE and NF-kB reporter systems: HEK293T cells were transfected with FLAG-3B plasmid and IFN-?, ISRE or NF-kB reporter system plasmids for 24 h, stimulated by an interferon-induced model virus, e.g. Sendai virus (SeV), and the expression change of the reporter system was detected using a Luciferase kit (Promega).
(19) A construction process of the FLAG-3B plasmid was as follows:
(20) The O/BY/CHA/2010 strain used was preserved by the National Foot-and-Mouth Disease Reference Laboratory designated by the Veterinary Bureau of the Ministry of Agriculture, and the public might obtain the strain through the authorization letter approved by the Veterinary Bureau of the Ministry of Agriculture.
(21) FMDV 3B gene sequence was deposited in the NCBI database, and primers were designed, a forward primer I was 3B-HindIII-F: CTCAAGCTTGCCACCATGGGACCCTACGCCGGACCACT (SEQ ID NO:9, the underlined part was a HindIII restriction site); and a reverse primer II was 3B-BamHI-R: ATGGATCCTCACTCAGTGACGATCAAGTTCT (SEQ ID NO:10, the underlined part was a BamHI restriction site). Total RNA from PK-15 cells infected with O/BY/CHA/2010 strain was extracted, cDNA was synthesized by reverse transcription with random primers, the cDNA was used as a template, PCR amplification was conducted using the 3B-HindIII-F and 3B-BamHI-R, purified and collected 3B fragments were digested with HindIII and BamHI restriction enzymes (the nucleotide sequence was set forth in SEQ ID NO:3, and the amino acid sequence was set forth in SEQ ID NO:4). FLAG-CMV-7.1 vector was digested with the same restriction enzymes at 37? C. for 2 h, and nucleic acid electrophoresis was conducted to recover linearized fragments of the FLAG-CMV-7.1 vector containing sticky terminuses.
(22) The purified and recovered linearized fragments of the FLAG-CMV-7.1 were ligated with the purified and recovered 3B fragments. A ligation product was placed overnight at 16? C., Trans5a Escherichia coli competent cells was transformed using the ligation product; after overnight culture, a single clone was picked and shaken in an ampicillin antibiotic-resistant LB liquid medium for 12 h, extracted using an Omega Plasmid Extraction Kit and the samples were sent for DNA sequencing to confirm the successful construction of the plasmid, and the obtained plasmid was named as FLAG-3B.
(23) Experimental methods for transfection and interferon reporter system detection were as follows:
(24) HEK293T cells were seeded in a 48-well culture plate; after the cells grew to 70% density, the reporter plasmid system was co-transfected with FLAG-CMV-7.1 vector or FLAG-3B plasmid for 24 h, an upper culture medium was aspirated, and the remaining culture was rinsed twice with PBS, and inoculated with the interferon-induced model virus SeV or the medium. 16 hours after SeV infection, the culture medium was discarded, the cell samples were rinsed with PBS twice, treated with Luciferase kit reagents, the fluorescence was measured with a Promega GloMax 20/20 luminescence detector, and the differential expression change in Luciferase of reporter system was analyzed. Remaining lysate was used for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) experiment; the expression of 3B protein was detected using a FLAG antibody.
(25) The results are shown in
(26) 1.2 Effect of a 3B Protein on SeV-Induced IFN-? mRNA Expression
(27) The effect of 3B protein on SeV-induced IFN-? mRNA expression was further detected using a real-time quantitative PCR method: HEK293T cells were seeded in a 6-well culture plate; after growing to 70% density, the cells were transfected with FLAG-CMV-7.1 vector or FLAG-3B plasmid for 24 h, an upper culture medium was aspirated, and the remaining culture was rinsed twice with PBS, and inoculated with SeV or the medium. 16 hours after SeV infection, the culture medium was discarded; the cell samples were rinsed twice with PBS, and collected. Total RNA from cell samples was extracted with an RNA extraction kit, and cDNA was synthesized by reverse transcription with random primers. The level of IFN-? mRNA expression was detected by real-time quantitative PCR. The results are shown in
(28) BHK-21 cells (a cell line with innate immune pathway immunodeficiency) were seeded in a 6-well plate, after growing to a monolayer, the cells were transfected with FLAG-CMV-7.1 vector or FLAG-3B plasmid for 24 h, FMDV was inoculated to infect the cells for 12 h, the culture medium was discarded, cell samples were rinsed twice with PBS, and collected. Total RNA from cell samples was extracted with an RNA extraction kit, and cDNA was synthesized by reverse transcription with random primers. FMDV RNA expression was detected by real-time quantitative PCR. The results are shown in
Example 2 Constructing Method of a Eukaryotic Expression Plasmid of FMDV 3B Protein Mutant
(29) On the basis of Example 1, the 3B protein of an FMDV O/BY/CHA/2010 strain was mutated, and a eukaryotic expression plasmid of FMDV 3B protein mutant was constructed. The eukaryotic expression plasmids of other serotypes of FMDV 3B protein mutants could also be constructed using the method described in the example. The specific process was as follows:
(30) A mutation strategy was shown in
Example 3 Effect of a 3B Protein Mutant on the Expression of a Type-I Interferon
(31) To further test the effect of 3B-A/E of 3B protein mutant with loss of the immunosuppressive sites on the expression of type-I interferon. HEK293T cells were seeded in a 6-well plate, after growing to 70% density, the cells were transfected with the same amount of FLAG-CMV-7.1 vector, FLAG-3B plasmid or FLAG-3B-A/E plasmid for 24 h; an upper culture medium was aspirated, the remaining culture was rinsed twice with PBS, and inoculated with an interferon-induced model virus SeV to infect for 16 h; the culture medium was discarded, the cell samples were rinsed twice with PBS, and collected at 16 h postinfection. Total RNA from cell samples was extracted with an RNA extraction kit, and cDNA was synthesized by reverse transcription with random primers. IFN-? mRNA expression change was evaluated using real-time quantitative PCR, samples were parallelly prepared, total cell protein was extracted, sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) was conducted, and expression of mutant 3B protein was detected by Western blotting.
(32) The experimental results are shown in
(33) In summary, although the above examples only mutate the amino acid at the position 17 of the three copies 3B1, 3B2, and 3B3 of the 3B protein of FMDV O/BY/CHA/2010 strain to glutamate, the 3B protein loses the ability to suppress host innate immune response. However, the three copies 3B1, 3B2 and 3B3 of FMDV 3B protein have high homology among different serotypes of FMDV, with a sequence alignment shown in
(34) In addition, the objective of the example is to remove the immunosuppressive function of FMDV 3B protein. The changes of the conformation, physical and chemical properties of FMDV 3B protein or the binding force of FMDV 3B protein to the host protein can cause the loss of the immunosuppressive function of FMDV 3B protein as well. The genetic engineering methods commonly-used in this field such as gene deletion technology, gene mutation technology, and gene insertion technology, etc., can change the conformation, physical and chemical properties of FMDV 3B protein or the binding force of FMDV 3B protein to the host protein, resulting in the loss of the immunosuppressive function of FMDV 3B protein. According to the common knowledge of those skilled in the art, in addition to the above ones, the loss of the immunosuppressive function of FMDV 3B protein may also be changed using other gene editing methods.
Example 4 Construction of a Recombinant FMDV with 3B Protein Mutation
(35) 4.1 Construction of an Infectious Clone of a Recombinant FMDV
(36) According to an FMDV genome sequence published in GenBank, an amplification primer that introduces rescue elements and the entire genome of FMDV was designed and synthesized, and appropriate restriction sites were introduced. Total viral RNA was extracted using RNAeasy Mini Kit (Qiagen), the first-strand cDNA was synthesized by reverse transcription using a primer oligNot I (5-ttttctagagcggccgct.sub.38-3, set forth in SEQ ID NO:11), a 20 ?L reaction system was prepared using a PrimeScript Reverse Transcriptase with extremely strong extension ability (from TaKaRa Bio) according to the product specification, and reacted at 42? C. for 1 h for later use; and gene fragments covering the entire virus genome were obtained by PCR amplification using a segmented amplification primer, and the reverse-transcribed first-strand cDNA was used as the template. The amplification adopted an LA Taq? polymerase (from TaKaRa Bio) that is suitable for long fragment amplification and has excellent performance, and a 50 ?L reaction system was prepared according to a product specification; the amplification was conducted at 94? C. for 5 min, 94? C. for 30 s, 57? C. for 30 s, 72? C. for 3 min (with an extension of 1 kb/min), 35 cycles; then 72? C. for 10 min; a PCR amplification product was purified and recovered, and ligated to obtain a full-length genome sequence of FMDV; where a 5-terminus upstream of the viral genome included sequences of a human cytomegalovirus RNA polymerase II promoter, a murine RNA polymerase I promoter and a ribozyme, and a 3-terminus downstream of the nucleic acid sequence of the virus included sequences of a ribozyme, a murine polymerase terminator I and a polymerase terminator II.
(37) On the basis of obtaining FMDV eukaryotic expression plasmids, the 3B gene in the FMDV genome was subjected to point mutations using PCR site-directed mutagenesis and other gene mutation techniques or gene synthesis techniques. Accordingly, a recombinant eukaryotic plasmid with the amino acids at the position 17 of three copies 3B1, 3B2, 3B3 of the 3B protein all mutated to glutamate was obtained.
(38) 4.2 Rescue of a Recombinant Virus
(39) BHK-21 cells, when growing to 80% density, were used for transfection; 4 ?g of recombinant eukaryotic plasmid was transfected into BHK-21 cells under the mediation of a Lipofectamine? 2000 (Invitrogen); meanwhile, a liposome control and a normal cell control were set up, which were placed in a 37? C. incubator containing 5% CO.sub.2. The cell status was recorded to observe the cytopathic alterations; the recombinant virus was harvested when about 90% of the cells become round and refractile, and inoculated with BHK-21 cells again after repeated freezing and thawing for 3 times until the virus could stably produce cytopathic effect (CPE); the cells became rounded, aggregated into a botryoid distribution and finally disintegrated into fragments, and a recombinant virus with FMDV 3B protein losing an immunosuppressive function was obtained.
(40) In this example, only amino acids at the position 17 of three copies 3B1, 3B2, and 3B3 of the 3B protein of the FMDV strain were mutated to glutamate, such that the 3B protein lost the ability to suppress the innate immune response. Since the three copies 3B1, 3B2 and 3B3 of FMDV 3B protein had high homology among different serotypes of FMDV, with a sequence alignment shown in
(41) In addition, the objective of the example is to lose the immunosuppressive function of FMDV 3B protein. The conformation, physical and chemical properties of FMDV 3B protein or the binding force of FMDV 3B protein to the host protein could cause the loss of the immunosuppressive function of FMDV 3B protein. The genetic engineering methods commonly-used in this field such as gene deletion technology, gene mutation technology, and gene insertion technology, etc., change the conformation, physical and chemical properties of FMDV 3B protein or the binding force of FMDV 3B protein to the host protein, resulting in the loss of the immunosuppressive function of FMDV 3B protein. According to the common knowledge of those skilled in the art, in addition to the above ones, the loss of the immunosuppressive function of FMDV 3B protein may also be changed using other gene editing methods.
Example 5 Construction and Identification of a Recombinant Type-O FMDV Vaccine Strain with 3B Protein Mutation
(42) 5.1 Construction of an Infectious Clone of a Recombinant Type-O FMDV
(43) The O/JSCZ/2013 virus strain used was preserved by the National Foot-and-Mouth Disease Reference Laboratory designated by the Veterinary Bureau of the Ministry of Agriculture, and the public might obtain the strain through the authorization letter approved by the Veterinary Bureau of the Ministry of Agriculture.
(44) A pair of amplification primers, OP12A-F (5-TTTTCCTTAAGGGACAGGAACACGCCGTGTTTGCCTGCGT-3, set forth in SEQ ID NO:12) and OP12A-R (5-ACTCACATCGATGTCAAAGTGAAACCTTC-3, set forth in SEQ ID NO:13), were designed and synthesized according to the genome sequence of the O/JSCZ/2013 virus strain; the total viral RNA of O/JSCZ/2013 virus strain was extracted using RNAeasy Mini Kit (Qiagen), the first-strand cDNA was synthesized by reverse transcription using a primer oligNotI (5-ttttctagagcggccgct.sub.38-3), a 20 ?L reaction system was prepared using a PrimeScript Reverse Transcriptase with extremely strong extension ability (from TaKaRa Bio) according to a product specification, and reacted at 42? C. for 1 h for later use; and the primers OP12A-F and OP12A-R were mixed with cDNA nucleic acid of the O/JSCZ/2013 virus strain using a reverse-transcribed first-strand cDNA as the template, and the amplification was conducted to obtain gene fragments of the O/JSCZ/2013 virus strain. The amplification adopted an LA Taq? polymerase (from TaKaRa Bio) that is suitable for long fragment amplification and has excellent performance, and a 50 ?L reaction system was prepared according to a product specification; the amplification was conducted at 94? C. for 5 min, 94? C. for 30 s, 57? C. for 30 s, 72? C. for 3 min and 30 s, 35 cycles; then 72? C. for 10 min; a PCR amplification product was purified and recovered, with a size of 3591 bp, and the nucleotide sequence was set forth in SEQ ID NO:5.
(45) The obtained gene fragments containing a L gene, a P1 gene and a P2 gene of the O/JSCZ/2013 virus strain and an eukaryotic expression plasmid prO/CHA/99 of a rescue system of the O/CHA/99 strain of type-O FMDV were subjected to double digestion using AflII and ClaI, separately; corresponding target fragments were purified and recovered, and ligated and transformed into JM109 competent cells, and positive clones were identified by DNA sequencing to obtain a recombinant plasmid prO-FMDV containing the L gene, the P1 gene and the P2 gene of the O/JSCZ/2013 virus strain (disclosed in the authorized patent Recombinant bivalent inactivated vaccine for foot-and-mouth disease (FMD) and preparation method and use thereof, ZL201710256450.0, the full text of which was incorporated into this application by reference).
(46) The N-terminus of PolyA of the FMDV genome sequence 3UTR in the recombinant plasmid prO-FMDV was a restriction endonuclease cleavage site SbfI; the recombinant plasmid prO-FMDV was subjected to double digestion with ClaI and SbfI and ligated into the POK12 vector to obtain a plasmid POK-3B containing the 3B gene fragment; point mutation was conducted on the 3B gene using the plasmid as a template and using mutation primers as follows: m3B1-F(5-AAAACCTCTGAAAGTGAGAgagAAGCTCCCACAGCAG-3, set forth in SEQ ID NO:14); m3B1-R(5-CTGCTGTGGGAGCTTctcTCTCACTTTCAGAGGTTTT-3, set forth in SEQ ID NO:15); m3B2-F(5-GAAACCGCTGAAAGTGAAAgagAAAGCCCCGGTCGTT-3, set forth in SEQ ID NO:16); m3B2-R(5-AACGACCGGGGCTTTctcTTTCACTTTCAGCGGTTTC-3, set forth in SEQ ID NO:17); m3B3-F(5-TGTCGCTTTGAAAGTGAAAgagAAGAACTTGATTGTC-3, set forth in SEQ ID NO:18); m3B3-R(5-GACAATCAAGTTCTTctcTTTCACTTTCAAAGCGACA-3, set forth in SEQ ID NO:19). The process specifically included: mutation for 3B1 was conducted using the POK-3B as the template, with m3B1-F and m3B1-R mutation primers, to obtain a 3B1 mutant plasmid; mutation for 3B2 was conducted using the 3B1 mutant plasmid as the template, with m3B2-F and m3B2-R mutation primers, to obtain a 3B2 mutant plasmid; and mutation for 3B3 was conducted using the 3B2 mutant plasmid as the template, with m3B3-F and m3B3-R mutation primers, to obtain a recombinant plasmid in which the amino acids of position 17 of the 3B1, 3B2, and 3B3 were all mutated to glutamate. The amplification adopted a high-fidelity PrimeSTAR? HS DNA polymerase (from TaKaRa Bio), and a 50 ?L reaction system was prepared according to a product specification; the amplification was conducted at 95? C. for 5 min, 95? C. for 1 min, 55? C. for 1 min, 68? C. for 6 min, 20 cycles; then 68? C. for 10 min. The PCR amplification product was digested with DpnI to digest and remove the template plasmid, and then transformed into DH5a competent cells, and the positive clones were identified by DNA sequencing. A mutated 3B plasmid POK-m3B was obtained, where an amino acid encoded by the mutated 3B gene was set forth in SEQ ID NO:6.
(47) The obtained recombinant plasmid POK-m3B containing the 3B with the amino acids of position 17 of the 3B1, 3B2, and 3B3 all mutated to glutamate was subjected to double digestion with ClaI and SbfI to prepare target fragments; the target fragments were ligated with vector fragments recovered from the recombinant type-O eukaryotic plasmid prO-FMDV that was subjected to double digestion with ClaI and SbfI, the recombinant plasmids were then transformed into DH5a competent cells, and the positive samples were sent for DNA sequencing analysis to confirm the successful mutations in 3 amino acid sites of 3B gene, and obtain a recombinant plasmid prO-m3B-FMDV containing the 3B gene mutation.
(48) 5.2 Rescue of a Recombinant Virus
(49) BHK-21 cells, when growing to 80% density, were used for transfection; 4 ?g of recombinant plasmid prO-m3B-FMDV was transfected into BHK-21 cells under the mediation of a Lipofectamine? 2000 (Invitrogen); meanwhile, a liposome control and a normal cell control were set up, which were placed in a 37? C. incubator containing 5% CO.sub.2 to observe the CPE; the virus was harvested when about 90% of the cells had CPE, and inoculated onto BHK-21 cells again after repeated freezing and thawing for 3 times until the virus could stably produce CPE; the cells became rounded, aggregated into a botryoid distribution and finally disintegrated into fragments. The results are shown in
(50) 5.3 Identification of Recombinant Virus by RT-PCR
(51) The supernatant of BHK-21 cells that were infected with the stably-passaged recombinant virus rO-m3B-FMDV was collected, and the total RNA was extracted with RNAeasy Mini Kit (Qiagen); after reverse transcription, the 3B-containing gene fragments were amplified, purified and recovered, and sent for DNA sequencing. The results show that the 3B gene of the obtained recombinant type-O FMDV vaccine strain is consistent with the theoretical sequence, and the amino acids at the position of 17 in the three copies 3B1, 3B2, and 3B3 are all glutamate.
(52) In summary, in order to improve the antigen matching and antigen broad spectrum of the recombinant FMDV, the example provides a constructing method of a recombinant type-O vaccine strain: using an established reverse genetic operating system of a virus strain with a relatively strong cellular immune response induction activity as the framework (a eukaryotic expression plasmid prO/CHA/99 of the type-O FMDV O/CHA/99 strain rescue system), and replacing with the screening-obtained O/JSCZ/2013 antigen genes that are cross-protective to different lineages of type-O FMDV; meanwhile, this provides a method of mutating the immunosuppressive sites of 3B protein to construct a recombinant type-O FMDV vaccine strain with reduced immunosuppression activity. Although in this example, only the amino acids at the position 17 of the three copies 3B1, 3B2, and 3B3 of the virus framework (type-O FMDV O/CHA/99) 3B protein are mutated to glutamate, such that the 3B protein loses the ability to suppress host innate immune response, and the recombinant type-O FMDV vaccine strain with reduced immunosuppression activity is constructed. Since the three copies 3B1, 3B2 and 3B3 of FMDV 3B protein have high homology among different serotypes of FMDV, with a sequence alignment shown in
(53) In addition, the objective of the example is to lose the immunosuppressive function of FMDV 3B protein. The changes of the conformation, physical and chemical properties of FMDV 3B protein or the binding force of FMDV 3B protein to the host protein can cause the loss of the immunosuppressive function of FMDV 3B protein. The genetic engineering methods commonly-used in this field such as gene deletion technology, gene mutation technology, and gene insertion technology, etc., can change the conformation, physical and chemical properties of FMDV 3B protein or the binding force of FMDV 3B protein to the host protein, resulting in the loss of the immunosuppressive function of FMDV 3B protein. According to the common knowledge of those skilled in the art, in addition to the above ones, the loss of the immunosuppressive function of FMDV 3B protein may also be changed using other gene editing methods.
Example 6 Construction and Identification of a Recombinant Type-A FMDV Vaccine Strain with 3B Protein Mutation
(54) 6.1 Construction of an Infectious Clone of a Recombinant Type-A FMDV
(55) The A/WH/CHA/09 virus strain used was preserved by the National Foot-and-Mouth Disease Reference Laboratory designated by the Veterinary Bureau of the Ministry of Agriculture, and the public might obtain the strain through the authorization letter approved by the Veterinary Bureau of the Ministry of Agriculture.
(56) A pair of amplification primers, AP1-F(5-TTTTCCTTAAGGGACAGGAACATGCTGTGTTTGCCTGCGT-3, set forth in SEQ ID NO:20) and AP1-R(5-TATTTTCACCGGTGCAATAATTTTCTGCTTGTGTCTGTC-3, set forth in SEQ ID NO:21), were designed and synthesized according to a genome sequence of the A/WH/CHA/09 virus strain; the total viral RNA of A/WH/CHA/09 virus strain was extracted using RNAeasy Mini Kit (Qiagen), the first-strand cDNA was synthesized by reverse transcription using a primer oligNot I (5-ttttctagagcggccgct.sub.38-3), a 20 ?L reaction system was prepared using a PrimeScript Reverse Transcriptase with extremely strong extension ability (from TaKaRa Bio) according to a product specification, and reacted at 42? C. for 1 h for later use; and amplification was conducted using primers AP1-F and AP1-R. A reverse-transcribed first-strand Cdna was used as the template to obtain gene fragments of the A/WH/CHA/09 virus strain. The amplification adopted an LA Taq? polymerase (from TaKaRa Bio) that is suitable for long fragment amplification which has excellent performance, and a 50 ?L reaction system was prepared according to a product specification; the amplification was conducted at 94? C. for 5 min, 94? C. for 30 s, 57? C. for 30 s, 72? C. for 2 min and 30 s, 35 cycles; then 72? C. for 10 min; a PCR amplification product was purified and collected, with the nucleotide sequence set forth in SEQ ID NO:8.
(57) Gene fragments containing a part of the L gene and P1 gene of the obtained A/WH/CHA/09 virus strain and the plasmid prO/CHA/99 of the rescue system of the O/CHA/99 virus strain of the type-O FMDV were subjected to double digestion using AflII and SgrAI, separately; corresponding target fragments were purified and collected, and ligated and transformed into JM109 competent cells, and the positive clones were identified by DNA sequencing to obtain a recombinant plasmid prA-FMDV containing a part of the L gene and P1 gene of the A/WH/CHA/09 virus strain (disclosed in the authorized patents Recombinant bivalent inactivated vaccine for foot-and-mouth disease (FMD) and preparation method and use thereof, ZL201710256450.0, and Recombinant type-A foot-and-mouth disease (FMD) vaccine strain and preparation method and use thereof, ZL201310175324.4, the full text of which were incorporated into this application by reference).
(58) The N-terminus of PolyA of the FMDV genome sequence 3UTR in the recombinant plasmid prA-FMDV was a restriction endonuclease cleavage site SbfI; the recombinant plasmid prA-FMDV was subjected to double digestion with SgrAI and SbfI and ligated into the POK12 vector to obtain a plasmid POK-s3B containing the 3B gene fragments; point mutation was conducted on the 3B gene using the plasmid as the template and using the mutation primers and the method described in 5.1 of Example 5; and the plasmid POK-ms3B of the mutated 3B was obtained, and the amino acids encoded by the mutated 3B was set forth in SEQ ID NO:6.
(59) The obtained recombinant plasmid POK-ms3B containing the amino acids of position 17 of the 3B1, 3B2, and 3B3 all mutated to glutamate was subjected to double digestion with SgrAI and SbfI to prepare target fragments; the target fragments were ligated with vector fragments recovered from the recombinant type-A eukaryotic plasmid prA-FMDV that was subjected to double digestion with SgrAI and SbfI, and then transformed into DH5? competent cells. The DNA sequencing was carried out to identify positive clones, and confirmed successful mutations in 3 amino acid sites of 3B gene, to obtain a recombinant plasmid prA-m3B-FMDV containing the 3B gene mutation.
(60) 6.2 Rescue of a Recombinant Virus
(61) BHK-21 cells, when growing to 80% density, were used for transfection; 4 ?g of recombinant plasmid prA-m3B-FMDV was transfected into BHK-21 cells under the mediation of a Lipofectamine? 2000 (Invitrogen); meanwhile, a liposome control and a normal cell control were set up, which were placed in a 37? C. incubator containing 5% CO.sub.2 to observe the CPE; the virus was harvested when about 90% of the cells had CPE, and inoculated to BHK-21 cells again after repeated freezing and thawing for 3 times until the virus could stably produce CPE; the cells became rounded, aggregated into a botryoid distribution and finally disintegrated into fragments. The results are shown in
(62) 6.3 RT-PCR Identification of Recombinant Virus
(63) The supernatant of BHK-21 cells that were infected with the stably-passaged recombinant virus rA-m3B-FMDV was collected, and the total RNA was extracted with RNAeasy Mini Kit (Qiagen). After reverse transcription, the 3B-containing gene fragments were amplified, purified and recovered, and sent for DNA sequencing. The results show that the 3B gene of the obtained recombinant type-A FMDV is consistent with the theoretical sequence, and the amino acids at the position of 17 in the three copies 3B1, 3B2, and 3B3 are all glutamate.
(64) In summary, in order to improve the antigen matching and antigen broad spectrum of the recombinant FMDV, the example provides a constructing method of a recombinant type-A vaccine strain: using an established reverse genetic operating system of a virus strain with a relatively strong cellular immune response induction activity as a framework (a eukaryotic expression plasmid prO/CHA/99 of the type-O FMDV O/CHA/99 strain rescue system), and replacing with the screening-obtained A/WH/09 antigen genes that have high antigen matching and strong cross-immunity protection; meanwhile, this provides a method of mutating the immunosuppressive site of 3B protein to construct a recombinant type-A FMDV vaccine strain with reduced immunosuppression activity. Although in this example, only the amino acids at the position 17 of the three copies 3B1, 3B2, and 3B3 of the virus framework (type-O FMDV O/CHA/99) 3B protein are mutated to glutamate, such that the 3B protein loses the ability to suppress host innate immune response, and the recombinant type-A FMDV vaccine strain with reduced immunosuppression activity is constructed. Since the three copies 3B1, 3B2 and 3B3 of FMDV 3B protein have high homology among different serotypes of FMDV, with a sequence alignment shown in
(65) In addition, the objective of the example is to lose the immunosuppressive function of FMDV 3B protein. The changes of conformation, physical and chemical properties of FMDV 3B protein or the binding force of FMDV 3B protein to the host protein can cause the loss of the immunosuppressive function of FMDV 3B protein. The genetic engineering methods commonly-used in this field such as gene deletion technology, gene mutation technology, and gene insertion technology, etc., can change the conformation, physical and chemical properties of FMDV 3B protein or the binding force of FMDV 3B protein to the host protein, resulting in the loss of the immunosuppressive function of FMDV 3B protein. According to the common knowledge of those skilled in the art, in addition to the above ones, the loss of the immunosuppressive function of FMDV 3B protein may also be changed using other gene editing methods.
Example 7 Detection and Analysis of Immunosuppressive Ability of a Recombinant FMDV with Mutations in 3B Protein
(66) Pig-derived PK-15 cells were infected with same amount of recombinant FMDV vaccine strain with 3B protein mutation, rO-m3B-FMDV, and its parental virus for 12 h, respectively. Cells were collected to extract RNA, and mRNA expression changes of IFN-? and interferon-induced antiviral genes ISG15, ISG56 and MX1 were detected by qPCR.
(67) The experiment results are shown in
Example 8 Pathogenicity Test of a Recombinant FMDV with 3B Protein Mutation on BHK-21 Cells
(68) BHK-21 cells were cultured according to a conventional method using the MEM culture medium containing 10% fetal bovine serum. The cells were seeded in a 12-well plate, and cultivated in an incubator containing 5% CO.sub.2 at 37? C. until the cell monolayer reached about 90% confluence. Virus solution was diluted with MEM at a tenfold multiple proportion, the virus solutions of each dilution (10.sup.?4.0 to 10.sup.?9.0) were added to the cell plate, with each dilution in 4 wells, placed in an incubator containing 5% CO.sub.2 at 37? C. for cultivation and observed for 3 days, and the media tissue culture infective dose (TCID.sub.50) to BHK-21 cells was determined by Reed-Muench's calculation method. The titer of rO-m3B-FMDV and rA-m3B-FMDV and the corresponding parental viruses rO-FMDV and rA-FMDV was determined according to the Reed-Muench's calculation method; the TCID.sub.50 of rO-m3B-FMDV was calculated to be 10.sup.?8.33/mL, and the TCID.sub.50 of control parental virus rO-FMDV was calculated to be 10.sup.?8.23/mL; meanwhile, the TCID.sub.50 of rA-m3B-FMDV was calculated to be 10.sup.?8.33/mL, and the TCID.sub.50 of control parental virus rA-FMDV was calculated to be 10.sup.?8.5/mL. The results indicate that the replication ability of the recombinant FMDV with 3B protein mutation in an FMDV engineering production cell line has no difference with its parent virus. In combination with the Example 7, the recombinant FMDV with mutations in 3B protein has a significantly-reduced pathogenicity to host cells, and a greatly-increased ability to induce host innate immune responses. Therefore, the recombinant FMDV with mutations in 3B protein can be used as a vaccine seed for FMDV, and has good production performance and higher biological safety.
(69) Reed-Muench's calculation method is the existing technology in the art. The existing literature Reed, L. J. and Muench, H. (1938). A Simple Method of Estimating Fifty Percent Endpoints. The American Journal of Hygiene 27:493-497 has been described the method in detail; this literature is incorporated into this application for reference.
Example 9 Immune Evaluation of an Inactivated Vaccine Prepared by a Recombinant FMDV with 3B Protein Mutation
(70) 9.1 Preparation of FMDV Antigen
(71) The recombinant rO-m3B-FMDV and an epidemic virus strain O/BY/CHA/2010 were prepared using suspended BHK-21 cells (a preparation method of the suspended cells and parameters used were disclosed in the authorized patent Recombinant bivalent inactivated vaccine for foot-and-mouth disease (FMD) and preparation method and use thereof, ZL201710256450.0, the full text of which was incorporated into this application by reference), the harvested virus liquid was the virus culture, and stored at ?40? C. The virus cultures of the rO-m3B-FMDV and the O/BY/CHA/2010 were separately inactivated with a 3 mmol/L binary ethylenimine (BEI) (from Sigma-Aldrich) at 30? C. for 30 h; a blocking agent sodium thiosulfate solution was added, maintained overnight at 4? C., and stored for later use. After passing the security check, the inactivated antigen was tested for antigen content, and mixed with an ISA206 adjuvant (from SEPPIC, France) at a ratio of 1:1 to prepare the vaccine. The vaccine was specifically prepared in accordance with the procedures for inactivated vaccines against FMDV in veterinary biological products in the Chinese Pharmacopoeia.
(72) 9.2 Comparison Test of Vaccine Immune Effectiveness of Recombinant Vaccine Strain and Epidemic Virus Strain
(73) The experimental pigs were purchased from an FMD non-epidemic area, and tested by an FMDV liquid-phase blocking ELISA (LPB-ELISA) produced by the National Foot-and-Mouth Disease Reference Laboratory to detect Type-O antibodies, and the antibody titers are all less than 1:4. The 3ABC-ELISA antibody test result of FMD non-structural proteins detection was negative as well.
(74) 7 pigs were immunized with a vaccine of recombinant Type-O FMDV with 3B protein mutation (rO-m3B-FMDV) and 7 pigs were immunized with a vaccine prepared from epidemic virus strain (O/BY/CHA/2010) in the same dose of antigen separately; and on the 7 d, 14 d, 21 d, and 28 d after immunization, the antibody levels in serum were detected by type-O FMDV liquid-phase blocking ELISA (LPB-ELISA). 28 days later, a challenge experiment was conducted using the epidemic virus strain (O/BY/CHA/2010) with 1000 times of the SID.sub.50 dose, 3 non-vaccinated pigs were set up as control, and the observation was recorded for 15 days.
(75) The results are shown in Table 1. Recombinant type-O FMDV vaccine with 3B protein mutation can induce an early immune response and a prolongation of the duration of immunity leading to the rising of the antibody titer after immunization. The antibody response induced by the recombinant virus vaccine is earlier than that induced by the vaccine of epidemic virus strain, and the level of antibodies produced is also higher in the recombinant virus antigen vaccinated pigs than that vaccinated with the epidemic virus strain antigen. The virus challenge results show that the protection rate of the recombinant vaccine strain is 100%, which is higher than the protection rate (85.7%) of the vaccine prepared by the epidemic virus strain. The above results indicate that in comparison with the vaccine prepared by the epidemic virus strain, the vaccine prepared by the recombinant type-O FMDV vaccine with 3B protein mutation described in the present disclosure can achieve better immune response in animals.
(76) TABLE-US-00001 TABLE 1 Comparison of antibody response and protection rate of recombinant type-O FMDV vaccine with 3B protein mutation and the vaccine prepared by epidemic virus strains in pigs. Immunizing Protection Group SN dose 7 d 14 d 21 d 28 d status rO-m3B-FMDV 0487 2 mL 1:22 1:64 1:128 1:360 7/7 vaccine 0476 2 mL 1:45 1:90 1:256 1:256 0492 2 mL 1:45 1:90 1:128 1:360 0495 2 mL 1:180 1:256 1:360 1:720 0491 2 mL 1:45 1:256 1:512 1:512 0478 2 mL 1:64 1:90 1:128 1:180 0477 2 mL 1:90 1:256 1:360 1:512 O/BY/CHA/2010 0488 2 mL 1:16 1:90 1:90 1:128 6/7 vaccine 0497 2 mL 1:22 1:45 1:128 1:180 0499 2 mL 1:22 1:45 1:90 1:360 0489 2 mL 1:11 1:22 1:45 1:90 0493 2 mL <1:8 1:16 1:45 1:45 0475 2 mL 1:22 1:64 1:128 1:360 0479 2 mL 1:22 1:45 1:90 1:256 Control 0490 0 <1:8 <1:8 <1:8 <1:8 0/3 0496 0 <1:8 <1:8 <1:8 <1:8 0494 0 <1:8 <1:8 <1:8 <1:8
(77) The foregoing descriptions are only preferred implementations of the present disclosure. It should be noted that several improvements and modifications may further be made by a person of ordinary skill in the art without departing from the principle of the present disclosure, and such improvements and modifications should also be deemed as falling within the protection scope of the present disclosure.