DEVELOPMENT OF OPTIMIZED RECOMBINANT EXPRESSION CONSTRUCT
20230212603 · 2023-07-06
Assignee
Inventors
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C07K14/4753
CHEMISTRY; METALLURGY
C12N2710/16143
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
C12N2770/20022
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
Abstract
The present disclosure relates to development of a eukaryotic cell expression vector satisfying optimized conditions for gene therapies and DNA vaccines. As a result of replacing the full HCMV regulatory and transcribed region including the immediate early (IE) gene intron A of the HCMV Towne strain and the same region of various HCMV strains at the pVAX1 promoter region and comparing the difference in gene expression efficiency for the different HCMV strains, the eukaryotic cell expression vector of the present disclosure could increase the expression of various genes by about 50-150% as compared to the HCMV Towne strain. Through this, pHP3 was developed as a vector exhibiting high expression in eukaryotic cells, and it can be usefully used for gene therapies or DNA vaccines.
Claims
1. A recombinant expression construct comprising a sequence of SEQ ID NO 24.
2. The recombinant expression construct according to claim 1, wherein the sequence of SEQ ID NO 24 is the full HCMV IE regulatory and transcribed region sequence of the HCMV 3157 strain.
3. The recombinant expression construct according to claim 1, wherein the recombinant expression construct comprises a multiple cloning site (MCS) for inserting a transgene.
4. The recombinant expression construct according to claim 1, wherein the recombinant expression construct further comprises a polyadenylation sequence (pA).
5. The recombinant expression construct according to claim 4, wherein the polyadenylation sequence is selected from a group consisting of an hGH (human growth hormone) pA sequence, a bGH (bovine growth hormone) pA sequence, an SV40 (simian vacuolating virus 40) early pA sequence and an SV40 late pA sequence.
6. The recombinant expression construct according to claim 5, wherein the polyadenylation sequence comprises a nucleotide sequence selected from a group consisting of SEQ ID NOS 29-32.
7. The recombinant expression construct according to claim 1, wherein the recombinant expression construct further comprises an antibiotic resistance gene.
8. The recombinant expression construct according to claim 7, wherein the antibiotic resistance gene is selected from a group consisting of ampicillin, kanamycin, neomycin, chloramphenicol, gentamicin, streptomycin, tetracycline, erythromycin, vancomycin, penicillin, spectinomycin, chloramphenicol, sulfadiazine and trimethoprim resistance genes.
9. The recombinant expression construct according to claim 8, wherein the antibiotic resistance gene comprises a sequence of SEQ ID NO 28.
10. The recombinant expression construct according to claim 1, wherein the recombinant expression construct has a cleavage map of FIG. 4.
11. A recombinant expression construct for expressing a transgene, wherein the transgene can be transcribed and translated in a host cell, comprising: (a) a transgene; and (b) a regulatory and transcribed region operationally linked (operably linked) to the transgene (regulatory and transcribed region), wherein the regulatory and transcribed region includes a sequence of SEQ ID NO 24.
12. The recombinant expression construct for expressing a transgene according to claim 11, wherein the sequence of SEQ ID NO 24 is the full HCMV IE regulatory and transcribed region sequence of the HCMV 3157 strain.
13. The recombinant expression construct for expressing a transgene according to claim 12, wherein the recombinant expression construct for expressing a transgene exhibits increased expression of a transgene as compared to when a regulatory and transcribed region selected from a group consisting of the full HCMV IE regulatory and transcribed region sequence of the HCMV Towne strain of SEQ ID NO 20, the full HCMV IE regulatory and transcribed region sequence of the HCMV AD 169 strain of SEQ ID NO 22 and the full HCMV IE regulatory and transcribed region sequence of the HCMV CINCY and Towne strain of SEQ ID NO 26 is inserted.
14. The recombinant expression construct for expressing a transgene according to claim 11, wherein the transgene comprises HGF or a variant gene thereof, a SARS-COV-2 spike gene or a SARS-COV-2 spike RBD (receptor-binding domain) gene.
15. The recombinant expression construct for expressing a transgene according to claim 14, wherein the HGF or a variant gene thereof comprises a gene selected from a group consisting of SEQ ID NO 1 and SEQ ID NOS 16-19.
16. The recombinant expression construct for expressing a transgene according to claim 14, wherein the SARS-COV-2 spike gene comprises a gene of SEQ ID NO 4.
17. The recombinant expression construct for expressing a transgene according to claim 14, wherein the SARS-COV-2 spike RBD gene comprises a gene of SEQ ID NO 9.
18. A host cell transduced with the recombinant expression construct according to claim 1 or a recombinant expression construct for expressing a transgene, wherein the transgene can be transcribed and translated in a host cell, comprising: (a) a transgene; and (b) a regulatory and transcribed region operationally linked (operably linked) to the transgene (regulatory and transcribed region), wherein the regulatory and transcribed region includes a sequence of SEQ ID NO 24.
19. A method for preparing a recombinant expression construct, comprising a step of inserting a sequence of SEQ ID NO 24 into a pVAX1 vector.
20. The method for preparing a recombinant expression construct according to claim 19, which further comprises a step of inserting a transgene into the recombinant expression construct.
21. A method for preparing a recombinant expression construct for expressing a transgene, comprising a step of inserting a transgene into the recombinant expression construct according to claim 1.
22. (canceled)
23. A method for expressing a transgene, comprising a step of administering a therapeutically effective amount of the recombinant expression construct for expressing a transgene according to claim 11 to a subject in need thereof.
24. (canceled)
25. (canceled)
26. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
DETAILED DESCRIPTION
[0088] Hereinafter, the present disclosure will be described in more detail through examples. However, these examples are only for describing the present disclosure more specifically, and it will be obvious to those having ordinary knowledge in the art to which the present disclosure belongs that the scope of the present disclosure is not limited by the examples.
EXAMPLES
Materials and Methods
Genes
1. Human Hepatocyte Growth Factor (HGF)
[0089] A gene of human hepatocyte growth factor (HGF) represented by SEQ ID NO 1 (see NCBI base sequence NM_000601.6) was synthesized by Genscript (USA). The prepared gene was amplified by PCR using primers of SEQ ID NOS 2 and 3 of Table 1 and was inserted into a vector.
2. SARS-COV-2 (2019-nCoV) Spike
[0090] A SARS-COV-2 spike gene represented by SEQ ID NO 4 was synthesized using Spike ORF mammalian expression plasmid (Codon Optimized) sold by Sino Biological as a template. Primary PCR was conducted using primers of SEQ ID NOS 5 and 6 of Table 1, and secondary PCR was conducted using primers of SEQ ID NOS 7 and 8 of Table 1 for addition of a signal peptide sequence.
3. SARS-COV-2 (2019-nCoV) Spike Receptor-Binding Domain (RBD)
[0091] A gene represented by SEQ ID NO 9 was synthesized using Spike ORF mammalian expression plasmid (Codon Optimized) sold by Sino Biological as a template. Primary PCR was conducted using primers of SEQ ID NOS 10 and 11 of Table 1, and secondary PCR was conducted using primers of SEQ ID NOS 12 and 13 of Table 1 for addition of a signal peptide sequence.
Plasmids
[0092] The plasmids used in the present disclosure have the structures shown in
1. pVAX1
[0093] pVAX1-BMP2 (Plasmid #137909) was purchased from Addgene.
2. pHP1
[0094] pEQ276 (Plasmid #83945) purchased from Addgene was used as a template and the full HCMV promoter of the Towne strain was prepared by PCR using primers of SEQ ID NOS 14 and 15 of Table 1. pHP1 of SEQ ID NO 21 was prepared by cleaving the pVAX1 promoter with Mlul and Nhel and inserting the prepared promoter at the same restriction enzyme sites. The vector map of pHP1 is shown in
3. pHP2
[0095] The full HCMV promoter of the AD169 strain was prepared by Bionics by referring to the NCBI base sequence X17403. pHP2 of SEQ ID NO 23 was prepared by cleaving the pVAX1 promoter with Mlul and Nhel and inserting the prepared promoter at the same restriction enzyme sites. The vector map of pHP2 is shown in
4. pHP3
[0096] The full HCMV promoter of the 3157 strain was prepared by Bionics by referring to the NCBI base sequence GQ221974. pHP3 of SEQ ID NO 25 was prepared by cleaving the pVAX1 promoter with Mlul and Nhel and inserting the prepared promoter at the same restriction enzyme sites. The vector map of pHP3 is shown in
5. pHP4
[0097] The full HCMV promoter of the CINCY+Towne fusion strain was prepared by Bionics by referring to the NCBI base sequence GU980198.1. pHP4 of SEQ ID NO 27 was prepared by cleaving the pVAX1 promoter with Mlul and Nhel and inserting the prepared promoter at the same restriction enzyme sites. The vector map of pHP4 is shown in
[0098] The prepared plasmid DNAs and genes are summarized in Table 2.
TABLE-US-00001 Primers SEQ ID NO Base sequence HGF (F) 2 GGATCCATGTGGGTGACCAAACTCCTGCCA HGF (R) 3 GCGGCTCTAGACTATGACTGTGGTACCTTATATGT Spike-1 (F) 5 CTGGTGGCCGCCGCCACACGGGTGCACAGCATGTTTGTGTTCCTGGTGCTGCTG Spike-1 (R) 6 TCTAGATCAGGTGTAGTGCAGTTTCACTCCTTTC Spike-2 (F) 7 CCGGGTACCATGGACTGGACCTGGATCCTGTTCCTGGTGGCCGCCGCCACA Spike-2 (R) 8 CTAGTCTAGATCAGGTGTAGTGCAGTTTCACTCCTTTC RBD-1 (F) 10 CTGGTGGCCGCCGCCACACGGGTGCACAGCCCAAACATCACCAACCTGTGTCCATTTGG RBD-1 (R) 11 CTAGTCTAGATCACTCCAAGGTCTGTGGGTCCCTC RBD-2 (F) 12 CCGGGTACCATGGACTGGACCTGGATCCTGTTCCTGGTGGCCGCCGCCACA RBD-2 (R) 13 CTAGTCTAGATCACTCCAAGGTCTGTGGGTCCCTC Towne (F) 14 ACGCGTTGACATTGATTATTGACTAGTTATTAATAG Towne (R) 15 GCTAGCCGTGTCAAGGACGGTGACTGCAGAAAAGAC
TABLE-US-00002 Gene or plasmid DNA SEQ ID NO Human hepatocyte growth factor (HGF) 1 HGF-X6 16 HGF-X7 17 HGF-X8 18 dHGF (deleted variant of HGF) 19 SARS-COV-2 (2019-nCoV) spike 4 SARS-COV-2 (2019-nCoV) spike receptor binding domain (RBD) 9 Full HCMV IE sequence (1563 bp) of Towne strain (AY315197) 20 pHP1 21 Full HCMV IE sequence (1564 bp) of AD169 strain (X17403) 22 pHP2 23 Full HCMV IE sequence (1552 bp) of 3157 strain (GQ221974) 24 pHP3 25 Full HCMV IE sequence (1563 bp) of CINCY+Towne fusion (GU980198.1) 26 pHP4 27 Neomycin/kanamycin resistance gene 28 hGH pA 29 bGH pA 30 SV40 early pA 31 SV40 late pA 32
Preparation of Plasmid DNAs Including Genes
[0099] Among the genes prepared above, each of a HGF gene and pHP plasmids was cleaved with BamHI and Xbal enzymes for 1 hour and fragments were separated by electrophoresis on agarose gel. The separated fragments were ligated for 30 minutes using T4 ligase and then transformed with E. coli and incubated overnight. The next day, DNA was isolated from the colony through mini-prep and identified with BamHI and Xbal.
[0100] Among the genes prepared above, each of SARS-COV-2 spike or spike RBD and pHP plasmids was cleaved with Kpnl and Apal enzymes for 1 hour and fragments were separated by electrophoresis on agarose gel. The separated fragments were ligated for 30 minutes using T4 ligase and then transformed with E. coli and incubated overnight. The next day, DNA was isolated from the colony through mini-prep and identified with Kpnl and Apal. After adding the E. coli supernatant containing the cloned DNA in two 200 mL flasks together with kanamycin and incubating overnight, plasmid DNAs were produced using a maxi prep. kit (Qiagen, USA).
Experimental Results
Experimental Example 1: Comparison of HGF Protein Expression in Cells
[0101] In order to compare the expression level of the four pHP-HGF plasmid DNAs with the HGF gene inserted, HEK293 cells (Korean Cell Line Bank) cultured in DMEM (Dulbecco’s modified Eagle’s medium; Sigma-Aldrich, USA) containing 10% FBS (fetal bovine serum; Sigma-Aldrich, USA) were spread onto a 6-well plate (SPL, USA) with 1x10.sup.6 cells per each well. The next day, when cell confluency was 60-80%, 3 .Math.g of each plasmid DNA was mixed with 200 .Math.L of a transfection reagent (jetPEI®, Polyplus transfection, USA). After incubation for 30 minutes at room temperature, the mixture was uniformly spread on each well. The next day, after replacing the medium with DMEM containing 10% FBS, the supernatant was collected 48 hours later and the expression of HGF protein was measured using an ELISA kit (R&D systems, USA).
[0102] As seen from
Experimental Example 2: Comparison of SARS-COV-2 Spike mRNA Expression in Cells
[0103] In order to compare the expression level of the four pHP-spike plasmid DNAs with the SARS-COV-2 spike gene inserted, HEK293 cells (Korean Cell Line Bank) cultured in DMEM (Dulbecco’s modified Eagle’s medium; Sigma-Aldrich, USA) containing 10% FBS (fetal bovine serum; Sigma-Aldrich, USA) were spread onto a 6-well plate (SPL, USA) with 1x10.sup.6 cells per each well. The next day, when cell confluency was 60-80%, 3 .Math.g of each plasmid DNA was mixed with 200 .Math.L of a transfection reagent (jetPEI®, Polyplus transfection, USA). After incubation for 30 minutes at room temperature, the mixture was uniformly spread on each well. The next day, after replacing the medium with DMEM containing 10% FBS, the cells were collected 48 hours later and the mRNA expression of the spike gene was measured by quantitative PCR. GAPDH was used as an internal control for normalization.
[0104] As seen from
Experimental Example 3: Comparison of SARS-COV-2 RBD mRNA Expression in Cells
[0105] In order to compare the expression level of the four pHP-RBD plasmid DNAs with the SARS-COV-2 spike RBD gene inserted, HEK293 cells (Korean Cell Line Bank) cultured in DMEM (Dulbecco’s modified Eagle’s medium; Sigma-Aldrich, USA) containing 10% FBS (fetal bovine serum; Sigma-Aldrich, USA) were spread onto a 6-well plate (SPL, USA) with 1x10.sup.6 cells per each well. The next day, when cell confluency was 60-80%, 3 .Math.g of each plasmid DNA was mixed with 200 .Math.L of a transfection reagent (jetPEI®, Polyplus transfection, USA). After incubation for 30 minutes at room temperature, the mixture was uniformly spread on each well. The next day, after replacing the medium with DMEM containing 10% FBS, the cells were collected 48 hours later and the mRNA expression of the spike RBD gene was measured by quantitative PCR. GAPDH was used as an internal control for normalization.
[0106] As seen from
[0107] Through this, it was confirmed that there is difference in expression efficiency depending on the HCMV strains and the promoter of the HCMV 3157 strain, which is the basis of pHP3 exhibits the most superior expression efficiency.
[0108] Although the exemplary embodiments of the present disclosure have been described, those having ordinary knowledge in the art will be able to modify and change the present disclosure variously through supplementation, change, deletion, addition, etc. of constituent elements without departing from the technical idea of the present disclosure set forth in the claims, and such modifications and changes are included in the scope of the present disclosure.