Methods for measuring and optimizing the structure, location, and activity of natural and engineered microcomparments, organelles, and macromolecules
11952576 ยท 2024-04-09
Assignee
Inventors
- Jeffrey Carlyle Cameron (Erie, CO, US)
- Nicholas C. Hill (Boulder, CO, US)
- Jian Wei Tay (Boulder, CO, US)
- Sabina Altus (Denver, CO, US)
- David Matthew Bortz (Boulder, CO, US)
- Kristin Ann Moore (Broomfield, CO, US)
Cpc classification
C12N15/72
CHEMISTRY; METALLURGY
International classification
C12N15/72
CHEMISTRY; METALLURGY
Abstract
A novel method of diluting the structures in the cell population, such that individual cells, dependent on the activity of the structures, become single measurement devices. This can be applied to all Bacterial Microcomparments (BMCs), organelles, and macromolecules, and could provide a universal method for the design of novel ones and understanding of the diverse structures. In one aspect the present invention provides A method of creating a bacterial strain with inducible and detectable carboxysomes. The method includes the steps of incorporating a labeled carbon-fixation enzyme into the genome of a bacterium; deleting all or a portion of the ccm operon from the bacterium; and reintroducing a ccm operon comprising an inducible promoter to create a ?ccm+ strain.
Claims
1. A method of controlling growth, expression, or carboxysome number in a bacterial strain comprising the steps of: providing a bacterial strain having a ccm operon under the control of an inducible promoter; contacting the bacterial strain with an agent that induces the promoter, whereby inducing the promoter increases growth, expression, or carboxysome number; removing the agent from the bacterial strain; and maintaining the bacterial strain in ambient CO.sub.2 or other CO.sub.2 concentration wherein carboxysome expression is inhibited, whereby continued growth and division of the bacterial strain results in a decrease in the number of carboxysomes in progeny cells.
2. The method of controlling growth, expression, or carboxysome number in a bacterial strain according to claim 1 wherein all or a portion of the native ccm operon has been deleted.
3. The method of controlling growth, expression, or carboxysome number in a bacterial strain according to claim 1 further comprising the step of maintaining the bacterial strain in ambient CO.sub.2 or other CO.sub.2 concentration wherein carboxysome expression is inhibited, prior to the step of contacting the bacterial strain with the agent that induces the promoter.
4. A method of controlling carboxysome number, growth, or expression in a bacterial strain comprising the steps of: providing a bacterial strain having a labeled carbon-fixation enzyme and genetically-engineered to have all or a portion of a ccm operon of the bacterial strain under the control of an inducible promoter; maintaining a population of the bacterial strain in ambient CO.sub.2 or other concentration of CO.sub.2 wherein production of carboxysomes in the population is inhibited and expression from the ccm operon in the bacterial strain is not induced; contacting the population of the bacterial strain with an agent that induces the inducible promoter of the ccm operon, wherein inducing the promoter increases expression from the ccm operon whereby increasing expression from the ccm operon increases carboxysome numbers in the population; removing the agent from the population of the bacterial strain; maintaining the population of the bacterial strain in ambient CO.sub.2 or other CO.sub.2 concentration wherein expression from the ccm operon is inhibited, whereby continued growth and division of the population of bacterial strain results in a decrease on the number of carboxysomes in progeny cells in the population; detecting puncta in the population of cells resulting from labeled enzymes within in the carboxysomes of the bacterial strain, whereby punctum correspond to single carboxysomes; identifying a bacterial cell within the population containing only one punctum per cell; and following the identified bacterial cell through a plurality of timepoints.
5. The method of controlling carboxysome number, growth, or expression in a bacterial strain according to claim 4 further comprising the step of measuring the growth of the cell at two or more timepoints, wherein the growth is an indicator of carboxysome activity.
6. The method of controlling carboxysome number, growth, or expression in a bacterial strain according to claim 4 wherein all or a portion of the native ccm operon has been deleted.
7. The method of controlling carboxysome number, growth, or expression in a bacterial strain according to claim 4 further comprising the step of measuring one or more parameters of the identified bacterial cells at a plurality of timepoints.
8. The method of controlling carboxysome number, growth, or expression in a bacterial strain according to claim 7 wherein one of the measured parameters is cell length.
9. The method of controlling carboxysome number, growth, or expression in a bacterial strain according to claim 8 further comprising the step of contacting the cell with one or more agents and comparing the measured parameter to the parameter in an uncontacted control.
10. The method of controlling carboxysome number, growth, or expression in a bacterial strain according to claim 4 wherein puncta are detected by visualization.
11. The method of controlling carboxysome number, growth, or expression in a bacterial strain according to claim 10 wherein visualization is facilitated by fluorescence of the label.
12. The method of controlling carboxysome number, growth, or expression in a bacterial strain according to claim 4 wherein following the identified bacterial cell is performed by time-lapse fluorescence microscopy to facilitate tracking of fluorescently-labeled carboxysomes.
13. The method of controlling carboxysome number, growth, or expression in a bacterial strain according to claim 4 wherein the carbon-fixation enzyme is 1, 5-bisphosphate carboxylase/oxygenase (RuBisCO).
14. A method of controlling bacterial growth, expression, or microcompartment number in a bacterial strain comprising the steps of: providing a population of the bacterial strain genetically-engineered to have all or a portion of a ccm operon of the bacterial strain under the control of an inducible promoter; contacting the population of the bacterial strain with an agent that induces the inducible promoter of the ccm operon, wherein inducing the promoter increases expression from the ccm operon whereby increasing expression from the ccm operon increases carboxysome numbers in the population; removing the agent from the population of the bacterial strain; maintaining the population of the bacterial strain in ambient CO.sub.2 or other CO.sub.2 concentration wherein expression from the ccm operon is inhibited, whereby continued growth and division of the population of bacterial strain results in a decrease on the number of carboxysomes in progeny cells in the population; and following the identified bacterial cell through a plurality of timepoints.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) For a fuller understanding of the invention, reference should be made to the following detailed description, taken in connection with the accompanying drawings, in which:
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT
(22) Carboxysomes, prototypical bacterial microcompartments (BMCs) found in cyanobacteria, are large (?1 GDa) and essential protein complexes that enhance CO.sub.2 fixation. While carboxysome biogenesis has been elucidated, their activity dynamics, lifetime, and degradation have been unstudied due to an inability to analyze individual BMCs over time in vivo. Here, a fluorescence-imaging platform has been developed and is reported herein to simultaneously measure carboxysome number, position, and activity over time in a growing cyanobacterial population, allowing individual carboxysomes to be clustered based on activity and spatial dynamics. We discover BMC degradation, characterized by abrupt activity loss followed by polar recruitment of the deactivated complex, and a sub-class of ultra-productive carboxysomes. Altogether, the results uncover the BMC lifecycle post-biogenesis, and describe an important method for measuring activity of single macromolecular complexes in vivo.
(23) Bacterial microcompartments (BMCs) are a widespread class of protein-based organelles found in at least 23 bacterial phyla (1). Comprised of a protein shell encapsulating an enzymatic interior, they increase catalytic efficiency of luminal enzymes while preventing the escape of toxic or volatile intermediates into the cytoplasm. The carboxysome, an essential BMC in cyanobacteria, encapsulates the enzymes ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) and carbonic anhydrase (2, 3). The carboxysome functions in the CO.sub.2 concentrating mechanism (CCM) by sequestering CO.sub.2 in its interior, thereby maximizing Rubisco's carboxylation rate, while minimizing its oxygenation side reaction. The CCM of cyanobacteria is largely responsible for their efficient CO.sub.2 fixation; cyanobacteria perform more than 35% of global CO.sub.2 fixation, despite comprising less than 0.2% of photosynthetic biomass. The efficient CCM has inspired recent efforts to incorporate carboxysomes into plants for increased crop yields. Other BMCs are involved in metabolism of 1,2-propanediol, ethanolamine, and plant-derived polysaccharides. The shell proteins are evolutionarily conserved and targeting them could be used to modulate function. This includes homologs of BMC-hexamer, BMC-pentamer, and BMC-tandem domain shell proteins. Many BMCs are critical for pathogenesis (e.g Pdu Metabolosome in Salmonella sp.) and can thus be targets of novel antibiotics if their activity can be screened such as with the techniques taught herein.
(24) Previous studies of cyanobacterial carboxysomes revealed that the interior is formed first through a series of protein-protein interactions, followed by encapsulation through assembly of the protein shell. However, carboxysome functionality post-biogenesis, including CO.sub.2 fixation dynamics, lifetime, and turnover, has not been analyzed. To address this, a method for assessing carboxysome functionality at the single protein complex level in vivo was developed. Time-lapse fluorescence microscopy was employed to track fluorescently labeled carboxysomes in single Synechococcus sp. PCC 7002 (hereafter PCC 7002) cells, chosen for their fast growth rate and industrial. Unlike bulk culture techniques, microscopy enables analysis of individual carboxysomes, and has been used to describe carboxysome organization within the cell. However, previous studies were unable to assess carboxysome activity and its relation to cell growth.
(25) Here, individual carboxysomes were tracked over 63.5 hours as they were passed from mother to daughter cells until their eventual disappearance. As WT PCC 7002 cells generally contain 4-6 carboxysomes, a system for controlling carboxysome expression was developed to minimize the number of carboxysomes in each cell. Importantly, this system allows for determination of carboxysome activity; in a cell with only one carboxysome, under ambient (?0.04%) CO.sub.2 levels, all CO.sub.2 fixation and cell growth can be attributed to the catalytic activity of a single carboxysome, making growth rate an indicator of carboxysome activity over time.
(26) To create a strain with inducible and fluorescent carboxysomes, a green fluorescent protein (GFP)-labeled Rubisco (named RbcL-GFP) was incorporated into the PCC 7002 genome for carboxysome visualization. The ccm operon, which contains the majority of carboxysome-associated genes (
(27) Once expected behavior of the ?ccm.sup.+ strain was confirmed, ?ccm.sup.+ cells were grown in air with 1 mM IPTG to initiate carboxysome expression. IPTG was then removed to prevent formation of new carboxysomes, and individual cells were imaged over time in ambient or elevated CO.sub.2. Family trees of representative cell lineages were created for each condition (
(28) Custom MATLAB scripts were used to count the number and position of GFP puncta per cell, measure single-cell growth rates based on change in cell length over time, and track individual carboxysome inheritance patterns across the population (see Methods, below and
(29) The growth rate of the ?ccm.sup.+ population gradually decreased from generation to generation, as carboxysomes were diluted across the population over time (
(30) In contrast to the ?ccm.sup.+ strain, WT and RbcL-GFP control cells maintained a high and constant growth rate over multiple generations (
(31) To further support the link between carboxysome activity and cell growth, changes in cell size from generation to generation were analyzed. Cell size has been shown to be a function of carbon uptake in E. coli. Similarly, cell size in PCC 7002 is regulated in response to light levels. Therefore cell size should gradually decrease with increasing generation number in the ?ccm.sup.+ population, as loss of carboxysomes leads to a decreased ability to assimilate carbon. As expected, length at birth gradually decreased with increasing generation number in the ?ccm.sup.+ strain in ambient CO.sub.2 upon IPTG removal (
(32) Single-cell data at single-carboxysome resolution was then analyzed to uncover differences in individual carboxysome activity profiles across the entire multi-generational population. The initial frame in which a cell contained one carboxysome was identified; from that frame onward, that cell and all of its descendants were grouped into a single-carboxysome tree. Cell lengths for each frame in the single-carboxysome tree were summed to obtain the length accumulation over time associated with that tree's carboxysome. Cell length provides a good proxy for biomass accumulation, as cell width remains constant in experimental conditions. This measurement, denoted net productivity, indicates the activity of a single carboxysome over time, as all biomass accumulation and cell growth can be attributed to a single carboxysome (
(33) The net productivity profiles of single-carboxysome trees were clustered into 4 categories: Too short, No growth, Growth, and Degradation (
(34) There was a large degree of heterogeneity in net productivity within the Growth cluster. Approximately 67% of carboxysomes within this cluster maintained a constant rate of increase in net productivity throughout the experiment, and are therefore referred to as non-aging (
(35) In the Degradation cluster, a sudden halt in the net productivity rate was observed, resulting in two distinct growth phases (
(36) To confirm that the sudden halt in cell growth observed in the Degradation cluster is caused by loss of carboxysome functionality as opposed to a sudden cell death event, an identical IPTG-washout experiment was performed, but this time the CO.sub.2 concentration was increased from ambient (0.04%) to elevated (3%) 42 hours after IPTG washout (
(37) Loss of carboxysome activity in the Degradation cluster was generally followed by a change in localization of the GFP punctum from the cytoplasm to a pole of the cell before disappearing completely (
(38) While a subtle phenotype, it was possible to detect carboxysome degradation events in cells with two carboxysomes, as seen by a sudden decrease in growth rate followed by loss of one carboxysome (
(39) This study shows the continuation of the carboxysome lifecycle post-biogenesis and characterizes the population-level heterogeneity and activity dynamics of individual carboxysomes during CO.sub.2-fixation. A small percentage (5%) of carboxysome in the Growth cluster are considered ultra-productive, capable of supporting over 10 ?m (?0.2 ?m/hour), or ?5+ generations, of cell growth on their own, and should inspire future efforts aimed at maximizing carbon fixation. The results also reveal that inactive carboxysomes are degraded, ending their lifecycle (
(40) Materials and Methods:
(41) Strain Cultivation
(42) Synechococcus sp. PCC 7002 strains were cultivated in AL-41L4 Environmental Chambers (Percival Scientific, Perry, IA) at 37? C. under constant illumination (?150 ?mol photons m.sup.?2 s.sup.?1) by cool white fluorescent lamps, in either ambient (air; 0.04%) or elevated (3%) CO.sub.2 conditions. Cultures were grown in 25 mL A.sup.+ media (20) in orbital shaking baffled flasks (125 mL) contained with foam stoppers (Jaece identi-plug), or on pH 8.2 A.sup.+ media solidified with Bacto Agar (1%; w/v). For growth on plates in elevated CO.sub.2, pH 11 A.sup.+ plates were used instead. Antibiotics were added for routine growth of strains (kanamycin, 100 ?g/mL; gentamycin, 30 ?g/mL; spectinomycin, 100 ?g/mL). Induction of the lac-controlled ccm operon was performed with 1 mM IPTG.
(43) Plasmid and Strain Construction
(44) All plasmids and strains used in this work are described in Tables 1 and 2. Plasmids were created through Gibson assembly of plasmid backbones (pUC19 or pALM179) and PCR amplified inserts, generated using Phusion polymerase (Thermo Scientific). Cyanobacterial strains were generated by transforming cells in exponential/early linear growth phase with 0.5 ng/mL-2 ?g/mL of plasmid DNA, containing the insert of interest flanked by 500 bp homology arms for recombination into a specified genomic locus. After incubation at 30-37? C. in constant illumination (50-150 ?mols photons m.sup.?2 s.sup.?1) for 24 hours, transformed cells were selected for with appropriate antibiotic either on plates in ambient CO.sub.2, or in liquid A.sup.+ in elevated CO.sub.2, for non-HCR strains and HCR strains, respectively. From plates, individual colonies were patched onto new plates and tested for segregation. For liquid transformations, antibiotic concentration was slowly increased to up to 2? the standard concentration over the course of a couple days. The ?ccm.sup.+ strain was first passaged 16? in ambient CO.sub.2 with 5 mM IPTG to ensure complete segregation and wild-type growth kinetics prior to experimentation. Upon segregation of the culture, cells were transferred to a pH 11 A.sup.+ plate. Confirmation of segregation was confirmed by PCR, using primers specific for either the insert, or the WT genome (
(45) Spot Plating
(46) Indicated strains in
(47) Quantitative Microscopy
(48) Fluorescence images were taken using a customized Nikon TiE inverted wide-field microscope with a Near-IR-based Perfect Focus system. Temperature and CO.sub.2 concentrations were controlled with a Lexan environmental chamber, and growth light was controlled via a transilluminating red LED light source (Lida Light Engine, Lumincor, Beaverton, OR). A high-speed light source with custom filter sets was used for imaging (Spectra X Light Engine, Lumencor, Beverton, OR), along with a hardware-triggered and synchronized shutter for control of imaging and growth light. NIS Elements software with Jobs acquisition upgrade was used to control the microscope. Image acquisition was performed using an ORCA Flash4.0 V2+ Digital sCMOS camera (Hamamatsu) with a Nikon CF160 Plan Apochromat Lambda 100? oil immersion objective (1.45 N.A.).
(49) For long-term time-lapse microscopy, cells in exponential or early linear phase were diluted to 0.04-0.07 OD.sub.730 nm, and 2 ?L was spotted onto a 1% agarose A.sup.+ pad that was pre-incubated at 37? C. for 1 hour. Cells were dried onto the pad and inverted onto a 35 mm glass bottom imaging dish (Ibidi), which was then wrapped in parafilm to keep the pad from drying out. No antibiotics were included on the agarose pad, but 1 mM IPTG was added when indicated. Cells were acclimated to microscope growth conditions (37? C. and 150 ?mol photons m.sup.?2 s.sup.?1 640 nm light) for 30 minutes before acquisition of images. Images were taken every 30 minutes using a 470 nm and 640 nm LED light source (Spectra X), and emission wavelengths were collected using standard YFP and Cy5 filters. Cells were constantly illuminated with red light except during fluorescent imaging.
(50) Image Processing and Analysis
(51) Cell Segmentation. Cell segmentation was performed using MATLAB version R2017b. To segment (identify) individual cells, we also captured images in brightfield, with the focal plane offset by 2 ?m. From initial testing, this offset produced the most reliable segmentation results. To remove uneven background shading, the brightfield offset image was first morphologically opened using a 30-pixel disk-shaped structuring element to obtain the background. This image was then subtracted from the original image. A gaussian filter with a standard deviation of two was then used to remove noise. Note that these images were only used for cell segmentationreported data was measured from the original images.
(52) Cells were then identified by applying an intensity threshold. To obtain this threshold, the intensity histogram of the background was fit to a Gaussian curve. The mean of the Gaussian plus 4-5.5 times its standard deviation was then used as the threshold to create an initial mask. This initial mask often contained touching cells. To separate these cells, the watershed algorithm was used to create the final mask. Manual mask correction was then performed to correct for mistakes prior to data analysis.
(53) Linking Data to Form Tracks. After segmenting each frame, the data was linked to create tracks of time series data for each individual cell, or object. A version of Jaqaman's tracking algorithm (21) was used to link data from a single object between frames, followed by computation of a cost matrix. Data for each object was then assigned between frames in a manner that minimized the total cost using the Jonker-Volgenant algorithm, thus linking cell tracks.
(54) We defined a cost function as the inverse of the ratio of the number of intersecting pixels over the total number of pixels between objects in consecutive frames. The inverse was used as the Jonker-Volgenant algorithm minimizes total cost. If required, before calculating the cost matrix, image registration was performed to correct for drifts in x and y dimensions that sometimes occurred during time-lapse experiments. After registration, the cost matrix was created by calculating costs for each object in a given frame with each object in the next frame. As PCC 7002 cells are non-motile, a maximum linking distance was specified to avoid linking objects over physically impossible distances. Objects between frames that were separated by a distance larger than this maximum linking distance were assigned a cost of infinity. After computing all costs and assignments, some objects were left unassigned (e.g. if they were too far apart from other unlinked cells). In these instances, we checked for cell division by calculating the overlapping cost function between the unassigned object with all objects from the previous frame. If the cost fell between a set value (1 and 8), then cell division occurred and two daughter tracks were created.
(55) Counting Carboxysomes. Puncta in the GFP channel, corresponding to labeled carboxysomes, were identified by computing the difference of Gaussians with standard deviations of 1.16 and 1.64 pixels. To eliminate invalid spots, only puncta brighter than 1.5 times the background were kept.
(56) After raw carboxysome counts were calculated for each frame of every cell track for the ?ccm.sup.+ strain after IPTG removal in ambient CO.sub.2, counts were corrected to increase accuracy. Raw spot counts often fluctuated slightly due to carboxysomes drifting behind one another, or drifting slightly out of focus. Carboxysome counts were corrected, or smoothed, based on the assumption that carboxysome counts cannot increase over time within a cell track due to an inability to create new carboxysomes, and the following rules. If a cell is in the first generation, set the carboxysome count of every frame to the maximum raw carboxysome count for that cell trace. If the number of carboxysomes in the first frame of a daughter cell was larger than the carboxysome count in the final frame of its mother's cell trace, then the carboxysome counts for the first two frames of the daughter track were set to the carboxysome count of the final frame of the mother track. If the carboxysome count of a given frame is greater than the previous frame, it is set to the count of the previous frame to eliminate counting of spurious spots. If the carboxysome count of a given frame is less than the count of the previous frame and the carboxysome count of the next frame, then it is set to the carboxysome count of the previous frame to correct for spurious carboxysome disappearances. If the three frames after the current frame all have higher counts than the current frame, they are assumed to be real counts. In this case, all previous frames of the cell trace are set to the nearest integer of the average of the three frames, thus correcting the problem of a carboxysome artificially disappearing for more than one frame in a row. The reappearance of the carboxysome for three consecutive frames was considered an indication that the carboxysome was present throughout the trace, as three consecutive spurious carboxysome counts were extremely rare. Finally, carboxysome counts were not allowed to decrease in the final frame of the cell trace.
(57) Manually correcting spot counts for 82 cell traces, consisting of 3961 individual frames, showed that corrected spot counts were more accurate than raw spot counts. Raw spot counts agreed with the manually corrected spot counts 87.4% of the time, whereas the corrected spot counts agreed with the manually corrected spot counts 91.1% of the time. Many of the disagreements in the corrected spot counts come from the first ten hours of the video, where it is most difficult to resolve 4+ carboxysomes in a single cell. As analysis focuses mostly on cells with a single carboxysome, these inaccuracies have a minimal negative impact. The rest of the disagreements arise due to slight variations in determining the precise frame in which a carboxysome degradation event occurred, as GFP puncta gradually disappeared over time during carboxysome degradation events. Generally, the MATLAB script lost track of a carboxysome before the human eye lost track of it. As the precise timing of the complete disappearance of a GFP punctum was unimportant in the analysis, the functional accuracy of carboxysome count correcting was ?99%.
(58) Growth rate. The growth rate of each cell track was calculated by fitting the natural log of the cell length over time to a linear polynomial:
ln(L(t))=?t+ln(L.sub.b)
where L(t) is the length of the cell at time t, a is the growth rate, and L.sub.b is the length at birth. If a ?ccm.sup.+ cell contained a carboxysome degradation event that split its growth into a growth and no growth phase, only the growth phase was used to calculate the growth rate. It should be noted that exponential growth may not necessarily be the most accurate way to calculate growth rates of the ?ccm.sup.+ population after IPTG washout in ambient CO.sub.2, but this analysis was used in
(59) Single-carboxysome trees and net productivities. Single-carboxysome trees were defined as a sub-tree in a ?ccm.sup.+ family tree that only contains one carboxysome. Net productivity of the tree was calculated at each frame by adding the lengths of all cells in the tree at that time point. The length of the cell at the first frame of the single-carboxysome tree was subtracted at each time point to normalize for differences in the starting length of each tree. All biomass generated by this carboxysome before the start of the single-carboxysome tree (i.e. when it was in other cells from previous generations with more carboxysomes) is not taken into account in the net productivity calculation. For aging trees, net productivity was fit to the following exponential decay function:
P(t)=A*(1?e.sup.?t/k)+b
where P(t) is net productivity at time t, A is the maximum net productivity, k is the time constant, and b is the Y offset. The half life of net productivity was then calculated by multiplying ln(2) by the time constant k.
(60) All single-carboxysomes trees were manually clustered into the Growth, No growth, and Degradation clusters based on their shape. If the carboxysome lasted less than 13 hours in the single-carboxysome tree, it was instead clustered into the Too short cluster and ignored in all further analysis. Net productivity rates were calculated as the slope of the line of best fit to the data. For single-carboxysome trees in the Degradation cluster, the growth phase and the no growth phase were separated to calculate a net productivity rate for each. For aging single-carboxysome trees, the initial ten frames were used to estimate their net productivity rates in
(61) In
(62) Statistics
(63) No statistical methods were used to pre-determine sample size. A one-way ANOVA with Tukey-Kramer multiple comparison test was used in
REFERENCES (PART 1)
(64) 1. S. D. Axen, O. Erbilgin, C. A. Kerfeld, A taxonomy of bacterial microcompartment loci constructed by a novel scoring method. PLoS Comput. Biol. 10, e1003898 (2014). 2. B. D. Rae, B. M. Long, M. R. Badger, G. D. Price, Functions, Compositions, and Evolution of the Two Types of Carboxysomes: Polyhedral Microcompartments ThatFacilitate CO2 Fixation in Cyanobacteria and Some Proteobacteria. Microbiol. Mol. Biol. Rev. 77, 357-379 (2013). 3. A. Turmo, C. R. Gonzalez-Esquer, C. A. Kerfeld, Carboxysomes: metabolic modules for CO2 fixation. FEMS Microbiol. Lett. 364 (2017), doi:10.1093/femsle/fnx176. 4. G. D. Price, M. R. Badger, Evidence for the role of carboxysomes in the cyanobacterial CO.sub.2-concentrating mechanism. Can. J. Bot. 69, 963-973 (1991). 5. G. D. Price, M. R. Badger, F. J. Woodger, B. M. Long, Advances in understanding the cyanobacterial CO2-concentrating-mechanism (CCM): functional components, Ci transporters, diversity, genetic regulation and prospects for engineering into plants. J. Exp. Bot. 59, 1441-1461 (2008). 6. M. Dworkin, S. Falkow, E. Rosenberg, K.-H. Schleifer, E. Stackebrandt, Eds., The Prokaryotes (Springer New York, New York, NY, 2006; http://link.springer.com/10.1007/0-387-30742-7). 7. C. R. Gonzalez-Esquer, S. E. Newnham, C. A. Kerfeld, Bacterial microcompartments as metabolic modules for plant synthetic biology. Plant J. 87, 66-75 (2016). 8. B. M. Long et al., Carboxysome encapsulation of the CO2-fixing enzyme Rubisco in tobacco chloroplasts. Nat. Commun. 9, 3570 (2018). 9. J. C. Cameron, S. C. Wilson, S. L. Bernstein, C. A. Kerfeld, Biogenesis of a Bacterial Organelle: The Carboxysome Assembly Pathway. Cell. 155, 1131-1140 (2013). 10. H. Wang et al., Rubisco condensate formation by CcmM in ?-carboxysome biogenesis. Nature. 566, 131-135 (2019). 11. H. C. Bernstein et al., Unlocking the Constraints of Cyanobacterial Productivity: Acclimations Enabling Ultrafast Growth. M Bio. 7, e00949-16 (2016). 12. A. M. Ruffing, T. J. Jensen, L. M. Strickland, Genetic tools for advancement of Synechococcus sp. PCC 7002 as a cyanobacterial chassis. Microb. Cell Fact. 15, (2016). 13. G. C. Gordon et al., CRISPR interference as a titratable, trans-acting regulatory tool for metabolic engineering in the cyanobacterium Synechococcus sp. strain PCC 7002. Metab. Eng. 38, 170-179 (2016). 14. A. L. Markley, M. B. Begemann, R. E. Clarke, G. C. Gordon, B. F. Pfleger, Synthetic Biology Toolbox for Controlling Gene Expression in the Cyanobacterium Synechococcus sp. strain PCC 7002. ACS Synth. Biol. 4, 595-603 (2015). 15. J. S. MacCready et al., Protein gradients on the nucleoid position the carbon-fixing organelles of cyanobacteria. Elife. 7 (2018), doi:10.7554/eLife.39723. 16. D. F. Savage, B. Afonso, A. H. Chen, P. A. Silver, Spatially ordered dynamics of the bacterial carbon fixation machinery. Science. 327, 1258-61 (2010). 17. M. Campos et al., A Constant Size Extension Drives Bacterial Cell Size Homeostasis. Cell. 159, 1433-1446 (2014). 18. C. Chowdhury, S. Sinha, S. Chun, T. O. Yeates, T. A. Bobik, Diverse bacterial microcompartment organelles. Microbiol. Mol. Biol. Rev. 78, 438-68 (2014). 19. C. M. Jakobson, D. Tullman-Ercek, Dumpster Diving in the Gut: Bacterial Microcompartments as Part of a Host-Associated Lifestyle. PLoS Pathog. 12, e1005558 (2016). 20. S. E. Stevens, C. O. P. Patterson, J. Myers, THE PRODUCTION OF HYDROGEN PEROXIDE BY BLUE-GREEN ALGAE: A SURVEY. J. Phycol. 9, 427-430 (1973). 21. K. Jaqaman et al., Robust single-particle tracking in live-cell time-lapse sequences. Nat. Methods. 5, 695-702 (2008). 22. R. Jonker, A. Volgenant, A shortest augmenting path algorithm for dense and sparse linear assignment problems. Computing. 38, 325-340 (1987). 23. D. G. Lowe, Object Recognition from Local Scale-Invariant Features (1999), (available at https://www.cs.ubc.ca/?lowe/papers/iccv99.pdf).
Example 2Multi-Generational Analysis and Manipulation of Chromosomes in a Polyploid Cyanobacterium
(65) Faithful replication and inheritance of genetic material is essential for life. Models of microbial DNA replication and inheritance are based on data from monoploid bacteria containing a single chromosome. However, emerging research on polyploid bacteria calls into question whether the established mechanisms of chromosome maintenance are conserved across the bacterial kingdom. We utilized time-lapse microscopy and computational image-analysis in conjunction with inducible CRISPR-interference to simultaneously modulate gene expression, track labeled chromosomes, and monitor physiology in a polyploid cyanobacterium for multiple generations at single cell resolution. We found that the chromosome number to cell size ratio was not impacted by manipulating cell growth, division, or septum placement. Surprisingly, diluting chromosomes over time resulted functional cells for multiple generations. We also demonstrate that rapid depletion of chromosomes vis mis-segregation also results in functional cells that lack chromosomes. These results indicate that polyploid cells may be especially resistant to disruptions in chromosome content.
(66) Strict mechanisms have been described throughout all kingdoms of life to ensure that genetic material is reliably inherited in future generations (O'Donnell, Langston, & Stillman, 2013). These mechanisms include regulating how and when DNA is replicated and the process of symmetric DNA segregation to progeny. In bacterial cells, the vast majority of the work describing DNA replication and segregation machinery has occurred in a small number of well-studied model systems (Reyes-Lamothe, Nicolas, & Sherratt, 2012). However, model systems represent only a tiny fraction of microbial diversity, and it is now evident that this diversity plays a pivotal role in the macroscale world (Liu & Deutschbauer, 2018; Locey & Lennon, 2016). To expand mechanistic and functional understanding of these critical processes, chromosome dynamics was investigated in the cyanobacterium Synechococcus sp. PCC 7002 (hereafter PCC 7002), a polyploid photosynthetic bacterium.
(67) Polyploidy, the presence of multiple, identical chromosome copies, is not often associated with bacteria. However, both industrially and medically relevant bacteria, as well as bacterially-derived organelles, such as mitochondria and chloroplasts, are polyploid (Clay Montier, Deng, & Bai, 2009; Sakamoto & Takami, 2018; Soppa, 2017). Polyploidy is distinct from mero-oligoploidy, which occurs in rapidly growing monoploid bacteria, such as E. coli, when multiple rounds of DNA replication initiation begin prior to termination (Cooper & Helmstetter, 1968). In contrast, polyploid bacteria obligately contain multiple complete copies of their chromosome. DNA replication in polyploid bacterial cells appears to be stochastic and is not correlated with cell division (Chen, Afonso, Silver, & Savage, 2012; Jain, Vijayan, & O'Shea, 2012). However, the mechanisms controlling DNA copy number and segregation are not well defined, nor is it well understood how ploidy levels in one generation affect future generations.
(68) The physiological consequences of polyploidy in bacteria have not been thoroughly investigated. Increasing plasmid copy number in E. coli results in increased gene expression (Segall-Shapiro, Sontag, & Voigt, 2018). However, the effect of increasing chromosome copy number in bacterial cells is less clear, with recent evidence indicating that growth rate and limited translational machinery are the major regulators of constitutive gene expression (Bryant, Sellars, Busby, & Lee, 2014; Chandler & Pritchard, 1975). Additional consequences of polyploidy may include increased adaptability in extreme environments as has been shown for polyploid varieties of both plants and yeast (Selmecki et al., 2015; Van de Peer, Mizrachi, & Marchal, 2017), protection from DNA insults (Ohbayashi et al., 2019), or as nutrient storage (Zerulla et al., 2014). Increasing the understanding of both the mechanisms and consequences of polyploidy in bacteria is essential to gaining a broader perspective on the microbial world and its interactions with eukaryotes and the environment.
(69) To address these gaps in knowledge, fluorescently labeled chromosomes were imaged in actively growing cells for multiple generations, while simultaneously collecting quantitative information on cellular physiology, including growth rate and gene expression data. Using this method, the effect of growth rate on chromosome copy number and protein expression in PCC 7002 was defined. Inducible CRISPR-interference was also used to determine the consequences of inhibiting essential cell functions, such as cell division and DNA replication, on chromosome homeostasis. Although polyploid cells are able to maintain a consistent chromosome to cell size ratio during changes in growth rate and manipulations of cell division, PCC 7002 is found to be surprisingly resilient to chromosome depletion or loss, indicating that they may be able to survive in conditions that result in decreased or damaged chromosomes.
(70) Materials and Methods
(71) Experimental Model and Subject Details
(72) All Strains of Synechococcus sp. PCC 7002 were cultivated in A.sup.+ media (Stevens, Patterson, & Myers, 1973) in an AL-41L4 Environmental Chamber (Percival Scientific, Perry, IA) maintained at 37? C. with atmospheric CO.sub.2 conditions, with continuous illumination (?150 ?mol photons m.sup.?2 s.sup.?1) provided by cool white fluorescent lamps. All strains were grown in 25 ml liquid cultures in baffled flasks (125 ml) contained with a foam stopper (Jaece identi-plug) and on an orbital shaker (200 rpm), or on medium solidified with Bacto Agar (1%; w/v). For maintenance, all 240x tetO-array:TetR-sfGFP strains were grown with 0.5 ?g/mL anhydrotetracycline (aTC). Antibiotics were provided to solid medium for routine maintenance of mutants when necessary (km, 30 ?g/ml; sp, 25 ?g/ml; gm, 15 ?g/ml).
(73) Method Details
(74) Strain and plasmid construction: All oligos, sgRNAs, plasmids, and strains used in this work are described in Tables 5-8. WT PCC 7002 is the background genotype for all strains described. To create strains in Table 8, noted plasmids, or amplicons containing homologous recombination arms and inserts, were transformed into WT or mutant backgrounds, and transformants were selected on the specified antibiotic(s). To transform, ?1 ug of plasmid or amplicon was mixed with day old cells and allowed to incubate for 4-14 hr before plating on 1% Bacto-agar plates with antibiotics. Plates also included 0.5 ?g/mL aTC for all 240x tetO-array: TetR-sfGFP strains. Once individual colonies were detectable, they were patched to new plates with single or combined antibiotics and aTC. After ?48 hr of growth patches were checked for segregation and intact tetO arrays. Strains were considered segregated when no WT products could be detected from PCR using primers flanking the insert and/or gene specific primers (Table 5). All CRISPRi strains were freshly transformed for each experiment due to genetic instability of the constructs following repeated passaging. Strains were transformed in the following order: 1) 240x tetO array containing construct, 2) TetR-sfGFP containing construct, and 3) mOrange2, sgRNA, or deletion construct. In this system, the strand specificity of the TetR-sfGFP gene had an effect on tetO array stability, with negative strand constructs being more stable than positive stand constructs.
(75) All plasmids described in Table 7, except KAMc0006, were created using gibson assembly of PCR amplified inserts and backbones from base plasmids described in the STAR Methods Resource Table or the PCC 7002 genome. mOrange2 was subcloned from mOrange2-pBAD, a gift from Michael Davidson, Nathan Shaner, and Roger Tsien (Addgene plasmid #54531). KAMc0006 was created with restriction digest cloning to insert the 240x tetO:GmR array from PRS316-240xtetO into the JCC257 backbone. PRS316-240xtetO was a gift from Narendra Maheshri (Addgene plasmid #44755).
(76) Hoechst Staining: Cells were stained with Hoechst dye at specific growth phases. Cells were briefly centrifuged and resuspended in low salt (10% of normal) A+ media and mixed with 5 ?g/mL 33342 Hoechst stain (Fisher, CAS #23491-52-3). Cells were then incubated in the dark for ?35 min before being washed twice in full salt A+ media. Cells were imaged using 395 nm excitation and collected light emitted between 425-477 nm.
(77) Quantitative Real Time PCR (qRT-PCR): To determine average chromosome copy number from bulk culture, we followed the procedure described by Pecoraro et al., (2011) was followed. Briefly, either WT or scJC0147 cells were counted at the noted growth phase and then extracted DNA using phenol:chloroform extraction (Green, Sambrook, & Sambrook, 2012) after initial treatment with 5 mg/mL lysozyme for 1 hr shaking prior to SDS/proteinase K lysis. To create samples for a standard curve, we purified and quantified 1000 bp PCR products amplified from the PCC7002 genome. These fragments were serially diluted to create standards of known concentrations. The ThermoFisher QuantStudio6 platform was used to perform qRT-PCR. Samples were prepared with PerfeCTa SYBR Green SuperMix Reaction Mix (QuantasBio, Catalog #95056-500) and primers that annealed within our 1000 bp standards (Table 5). Samples were run in triplicate to control for pipetting error. The average chromosome copy number was determined by measuring the amount of DNA in each sample and dividing by original cell count. Averages and standard deviations were calculated from 2-3 biological replicates of each strain in each condition.
(78) sgRNA design and CRISPR-interference: sgRNAs described in Table 6 were designed using the CRISPy-web platform (Blin, Pedersen, Weber, & Lee, 2016). sgRNAs were chosen based on guidelines described by Gordon et al., (2016). To create an inducible sgRNA construct that was compatible with our chromosome labeling, the sgRNA was placed downstream of the Isopropyl ?-D-thiogalactopyranoside (IPTG) inducible cLac94 promoter (Markley et al., 2015). 5 mM IPTG (Fisher, CAS #367-93-1) was used to induce sgRNA expression. Strains were maintained in the absence of IPTG.
(79) Quantitative Long-term Timelapse microscopy: We used a customized Nikon TiE inverted wide-field microscope setup equipped with a Near-IR-based Perfect Focus system, a custom Lexan environmental enclosure for temperature and CO.sub.2 control, an individually controllable RGB LED light source for transillumination (Lida Light Engine, Lumincor, Beaverton, OR), a high-speed light source with customized filter sets for imaging (Spectra X Light Engine, Lumencor, Beverton, OR), and a synchronized and hardware-triggered motorized shutter for light control for all microscopy described. We specifically used 395 nm 470 nm, 555 nm, and 640 nm excitation wavelengths. Emissions were collected using standard BFP, FITC, mOrange2, or Cy5 filters. Images were acquired on an ORCA Flash4.0 V2+ Digital sCMOS camera (Hamamatsu) and a Nikon CFI60 Plan Apochromat Lamda 100? oil immersion objective (1.45 N.A.). NIS Elements Software was used with Jobs acquisition upgrade for image capture. Fiji (Schindelin et al., 2012) was used to crop and reformat images for publication.
(80) For either single frame or time-lapse microscopy, ?2 ?L of exponential-phase cells was spotted on A+ media pads (1% agarose w/v) and allowed them to air dry before inverting them on to 35 mm glass bottom dishes (Ibidi). Unless otherwise noted, all long-term imaging of strains with the tetO array was performed with 0.05 ?g/mL aTC added to the imaging pad prior to solidification. Additionally, 5 mM IPTG was added to induce sgRNA expression, 1.25 ?g/mL rifampicin (Fisher, CAS #13292-46-1) to inhibit transcription, or 3.4 ?g/ml chloramphenicol (Fisher, CAS #591-50-4) to inhibit translation in noted experiments. For CRISPRi induction as well as rifampicin and chloramphenicol treatment, imaging pads were placed at 30? C. for ?1 hr before cells were spotted on to pads. Imaging was started ?15 min after spots air dried. For all other imaging, cells were acclimated to imaging conditions (30? C. and noted 640 nm transmitted light intensity) for ?1 hr prior to initial imaging. Images were taken at a 30 min frame rate for all experiments, except those described in
(81) Image Processing and Analysis: Image processing was carried out using custom MATLAB programs. From initial testing, segmentation was most reliable on brightfield images of the cell, but with the focus offset by 2 ?m. In brief, cell identification (segmentation) was performed by thresholding this brightfield offset image. The threshold level was chosen by computing the intensity histogram of the image. Since the images contained both dark background and bright cells, the intensity histogram appeared bimodal, allowing the peak of the background intensity distribution to be identified. A Gaussian model was then fit to this background intensity. The threshold intensity was then chosen to be the mean+F * standard deviation of the fitted Gaussian. The threshold factor, F, was optimized for each set of images, and ranged from 2.0-3.5.
(82) Once the threshold intensity was determined, an initial binary mask was created by setting pixels in the image which were brighter than the threshold to true, and all other pixels to false. This initial mask often contained connected cells that were physically close to each other. Individual cells were then separated using the watershed algorithm. Data from individual cells were then tracked over time using the linear assignment algorithm (Jaqaman et al., 2008). When necessary cell masks were corrected by hand to avoid obvious tracking and/or size errors.
(83) To count chromosomes in the images, sfGFP labeled puncta were identified using the difference of Gaussians method (Lowe, 1999). Here, two Gaussian blur filters were applied to the original image, with standard deviations ? of 1.12 and 1.58 pixels. The difference between the two images was then computed, and puncta were identified by intensity thresholding. Individual puncta were then counted to obtain chromosome numbers in each cell.
(84) Quantification and Statistical Analysis
(85) During growth, the length of cells was assumed to be increasing exponentially. Hence, we obtained a growth rate by fitting the log of cell length over time to the linear function
ln(L(t))=at+ln(L.sub.b),
where L(t) is the length of the cell at time t, a is the growth rate, and L.sub.b is the length at birth. Doubling times were calculated by dividing ln(2) by the growth rate a.
(86) Corrected Chromosome Counting Algorithm: Because chromosome labeling is a dynamic process, an algorithm was developed based on both previous and future chromosome counts to create a more accurate representation of chromosome number during time lapse imaging. The following rules were used to define chromosome number: 1. Chromosome number could not decrease 2. Chromosome number only increased in the nth frame if the chromosome number in the n+1 frame was equal to or greater than the number recorded in the nth frame 3. For the final frame of a cell trace chromosome number only increased if the sum of chromosome counts in the two daughter cells was equal to or greater than the number recorded in the final frame
(87) Representations of original and corrected chromosome counts are displayed in
(88) Data and Statistics: The number of cells analyzed in each experiment is recorded in the figure descriptions. For analyses performed in
(89) For
(90) All boxplots denote the median (light gray line), the 25.sup.th and 75.sup.th quartiles of the data (dark gray boxes), and the most extreme values not considered outliers (whiskers). Whisker values correspond to approximately +/?2.7 ? and represent ?99.3% of the data, assuming normal distribution. For all histogram and single frame data, chromosome counts are only displayed for cells within 3 standard deviations of the mean of the data. To determine if the variation between cell populations was statistically significant, we used the two sample Kolmogorov-Smirnov test. Significance was determined using Bonferroni corrected p-values, which are denoted by *, **, *** to represent <0.01, 0.001, and 0.0001, respectively.
(91) Chromosome Labeling and Computational Quantification in PCC 7002
(92) To study polyploidy at the single cell level in PCC 7002, individual chromosomes were fluorescently labeled using a 240x tetO arrayTetR-sfGFP (super folder GFP)-based approach adapted from previously described studies in yeast and bacteria (Chen et al., 2012; Jain et al., 2012; Michaelis, Ciosk, & Nasmyth, 1997). Because this system relies on inducible TetR-tetO binding we were able to modulate chromosome labeling with the small molecule anhydrotetracyclene (aTC) (
(93) To analyze chromosome numbers in large populations of cells, we developed customized software to identify individual chromosomes, as well as measure gene expression via fluorescence intensity to generate quantitative data.
(94) To determine whether growth phase has an effect on chromosome number, as observed for other polyploid bacterial strains (Ohbayashi et al., 2019; Soppa, 2017), we grew chromosome labeled cells to either mid-exponential or late-linear phase and imaged cells. Due to the light-dependent autotrophic nature of cyanobacterial cell growth, as cells grow in batch culture they become light-limited due to self-shading. This nutrient limitation results in decreased growth rate following exponential phase, but prior to stationary phase. This phase is termed linear growth (Clark et al., 2018). Cells in exponential phase were both larger in size and had higher average chromosome numbers than cells in linear phase (
(95) Chromosome Dynamics are Consistent Over Multiple Generations
(96) We captured chromosome dynamics in growing cells by performing time-lapse microscopy of chromosome labeled strains. Unless otherwise noted cells were grown on 1% (w/v) agarose pads made with A+ media under 150 ?mol photons m.sup.?2 s.sup.?1 of red light (640 nm) as previously described (Moore et al., 2020). Using this method, we were able to image chromosome labeled cells for ?24 hr with a 30 minute (min) frame rate allowing us to track lineages for 3-4 generations (
(97) To quantify chromosome dynamics over we time, we calculated per frame chromosome number using the image analysis software (
(98) Because the system enabled tracking information within single-cell derived lineages, we were able to determine whether total chromosome number or the ratio of chromosome number to cell area correlated with measured values for daughter cells. The average chromosome number over a cell lifespan varied between 2.6-7.2 with a median value of 4.7, and did not appear to depend on microcolony position or lineage (
(99) As we and others have observed in non-time lapse imaged cells (
(100) Growth Rate Dictates the Timing of Chromosome Replication and Protein Expression
(101) Because PCC 7002 can use photosynthesis as its sole energy source, growth rate can be controlled by varying growth light intensity. To determine how changing growth conditions affects chromosome replication and inheritance, cells were grown with 45 ?mol photons m.sup.?2 s.sup.?1 of red light (low lightLL) rather than 150 ?mol photons m.sup.?2 s.sup.?1 (high lightHL) as described above. Under these conditions cells still formed similar microcolony formations during growth, and had similar chromosome dynamics (
(102) Interestingly, mean mOrange2 intensity increased in cells grown at low light (
(103) To determine the time scale of the impacts of changing growth conditions cells were transitioned from either a HL to LL or LL to HL environment while continuously imaging (
(104) Conversely, for cells shifted either into or out of LL conditions, mean mOrange2 intensity was 30-50% higher in the final frame of the cell trace compared to the initial frame (
(105) To determine whether the impacts of transitioning growth conditions could be measured within a single generation, cells were observed with traces that spanned the light transition. A correlation between chromosome replication per hour and growth rate is immediately apparent when cells are shifted from HL to LL. These changes are evident within the first hour after the light transition (
(106) Chromosome Replication and Segregation are Dependent on Cell Size
(107) To investigate the impact of manipulating genes that drive essential processes such as DNA replication and segregation, the CRISPR interference (CRISPRi) system described for PCC 7002 by Gordon et al., (2016) was modified to make an IPTG inducible guide RNA (sgRNA), and engineered it into a strain expressing dCas9, TetR-sfGFP, and the tetO array. This system allowed us to temporally control essential gene expression. Cells were grown in an uninduced state followed by addition of IPTG immediately prior to time-lapse imaging. With this platform we were able to observe the dynamics of chromosome replication and division as essential gene expression decreased over time.
(108) Previous studies have noted that inhibiting cell division in monoploid bacteria does not immediately impact nucleoid number or spacing (Dai & Lutkenhaus, 1991). However, upon prolonged blockage of cell division, DNA replication is inhibited (Arjes et al., 2014). To determine whether cell division regulates DNA replication, resulting in disruption of the chromosome to cell area ratio observed in control PCC 7002 cells, cells were imaged for 20 hr after induction of an sgRNA targeting ftsZ, an essential gene for cell division (
(109) To determine whether uneven division of cells could result in disrupted chromosome to cell area ratios we depleted minD with CRISPRi. MinD depleted cells have irregular septum placement, resulting in both larger and smaller cells than control cells (
(110) Cell Growth is Independent of Chromosome Replication
(111) Previous work in several polyploid bacteria has indicated that current models of DNA replication, specifically the requirement for dnaA and a well-defined oriC site, may not be conserved across the bacterial kingdom, including in PCC 7002 (Gehring et al., 2017; Ohbayashi et al., 2020, 2016; Richter, Hagemann, & Messer, 1998). In further support of this assertion, we found that in PCC 7002, dnaA (Synpcc7002_A0001) was not required for DNA replication for any conditions tested (
(112) To determine the effects of inhibiting DNA replication on PCC 7002, we used CRISPRi to target dnaX, an essential component of the DNA polymerase holoenzyme (Blinkova et al., 1993). This method allowed us to visualize dilution of chromosomes over time (
(113) Interestingly, decreased chromosome per area ratios do not appear to impact cells in early generations as growth rate for the majority of 2nd and 3 rd generation cells remain consistent even in cells with diluted chromosome content. Only in later generations or cells with extremely low chromosome to area ratios are slower growth rates commonly observed (
(114) Surprisingly in a very small percentage (?2%) of dnaX CRISPRi induced cell lineages, we observed cells in which chromosomes were only segregated into one of two daughter cells early in a lineage (
(115) Continued Growth and Division of PCC 7002 in Absence of Chromosomal DNA
(116) To further investigate the impacts of chromosome loss that occurred early in cell lineages, we took advantage of the extensive TetR binding to the tetO array that occurs in the absence of aTC, to disrupt chromosome replication and segregation, as previously observed in monoploid bacteria (Bernard, Marquis, & Rudner, 2010). Under standard growth and imaging procedures, we grew cells with aTC to ensure that chromosome dynamics were minimally perturbed. However, to determine whether excessive TetR binding could result in rapid mis-segregation of chromosome aggregates, chromosome labeled cells were grown to stationary phase without aTC in shaking flasks and cells were imaged on fresh media without aTC over a 65 hr time frame. Under these conditions, cells with single GFP-labeled puncta were observed, which may represent one or more chromosomes (
(117) Cells with single chromosome puncta grew, albeit at a slower rate than cells with normal chromosome dynamics. These cells also divided resulting in uneven segregation of the chromosome puncta between daughter cells (
(118) After ?1-2 generation periods, cell division became impaired and eventually growth arrested in all cells lacking chromosomes. After ?24 hr, an increase in endogenous fluorescence was observed originating from the thylakoid membranes, evidenced by the increased emission after 640 nm excitation, indicating that the photosynthetic machinery had become dysfunctional. This is likely because repair of damaged photosystems requires de novo gene expression which is impossible without genetic inputs (Maxwell & Johnson, 2000) (
(119) To determine whether inhibiting transcription or translation resulted in similar effects on photosynthetic machinery, cells were treated with either rifampicin to block transcription or chloramphenicol to block translation. Similar increases in endogenous fluorescence were observed with both inhibitors indicating that the effect of blocking downstream mechanisms required for de novo gene expression results in similar cellular disfunction as chromosome loss. (
(120) Although the regulation of DNA replication and inheritance has been long-studied in model strains of monoploid bacteria, the results demonstrated herein raise questions about the fundamental understanding of these processes across bacterial species. Here, single-cell time-lapse imaging was used to demonstrate both conserved and variable characteristics of bacterial DNA regulation between traditionally studied monoploid bacteria and polyploid strains. The data herein support the theory that the ratio of chromosome content to cell size is preserved in polyploid strains under different growth conditions (
(121) In contrast to the canonical model of chromosome segregation we did not observe strictly even partitioning of chromosomes into daughter cells (
(122) In a move towards determining the consequences of polyploidy on cell physiology, we monitored constitutive gene expression in polyploid cells. We found that chromosome copy number is not a major factor in determining protein content within a cell or its progeny in polyploid bacteria (
(123) Gene expression in these experiments was driven by non-native promoters that are expected to be independent of growth light intensity and may respond differently than endogenous promoter systems. Furthermore, in polyploid cells, it is possible that heterozygous alleles may be present on different chromosomes. It will be interesting for future studies to determine whether copy number may in fact be important for relative gene expression from allelic variants in polyploid cells. A more thorough understanding of how chromosome copy number and growth rate affect nuanced types of gene expression, such as inducible and native promoter systems, in both monoploid and polyploid cells, will be essential for understanding general bacterial physiology, as well as for designing functional synthetic biology circuits in bacteria.
(124) Lastly, we demonstrated that polyploid cells have the capacity to compensate for disruption to chromosome replication and even chromosome loss at points early in a cell lineage. Cells with excessively diminished chromosomes numbers and even those lacking chromosomes are able to grow and divide (
REFERENCES (PART 2)
(125) Anderson, J. (2006). Registry of Standard Biological Parts. Retrieved Aug. 28, 2019, from http://parts.igem.org/Part:BBa_J23119 Arjes, H. A., Kriel, A., Sorto, N. A., Shaw, J. T., Wang, J. D., & Levin, P. A. (2014). Failsafe Mechanisms Couple Division and DNA Replication in Bacteria. Current Biology, 24(18), 2149 2155. Aro, E.-M., Virgin, I., & Andersson, B. (1993). Photoinhibition of Photosystem II. Inactivation, protein damage and turnover. Biochimica et Biophysica Acta (BBA)Bioenergetics, 1143(2), 113-134. Bernard, R., Marquis, K. A., & Rudner, D. Z. (2010). Nucleoid occlusion prevents cell division during replication fork arrest in Bacillus subtilis. Molecular Microbiology, 78(4), 866-882. Blin, K., Pedersen, L. E., Weber, T., & Lee, S. Y. (2016). CRISPy-web: An online resource to design sgRNAs for CRISPR applications. Synthetic and Systems Biotechnology, 1(2), 118-121. Blinkova, A., Hervas, C., Stukenberg, P. T., Onrust, R., O'Donnell, M. E., & Walker, J. R. (1993). The Escherichia coli DNA polymerase III holoenzyme contains both products of the dnaX gene, tau and gamma, but only tau is essential. Journal of Bacteriology, 175(18), 6018-6027. Retrieved from Bryant, J. A., Sellars, L. E., Busby, S. J. W., & Lee, D. J. (2014). Chromosome position effects on gene expression in Escherichia coli K-12. Nucleic Acids Research, 42(18), 11383-11392. Chandler, M. G., & Pritchard, R. H. (1975). The Effect of Gene Concentration and Relative Gene Dosage on Gene Output in Escherichia coli (Vol. 138). Springer-Verlag. Chen, A. H., Afonso, B., Silver, P. A., & Savage, D. F. (2012). Spatial and Temporal Organization of Chromosome Duplication and Segregation in the Cyanobacterium Synechococcus elongatus PCC 7942. PLoS ONE, 7(10), 1-10. Clark, R. L., McGinley, L. L., Purdy, H. M., Korosh, T. C., Reed, J. L., Root, T. W., & Pfleger, B. F. (2018). Light-optimized growth of cyanobacterial cultures: Growth phases and productivity of biomass and secreted molecules in light-limited batch growth. Metabolic Engineering, 47, 230-242. Clay Montier, L. L., Deng, J. J., & Bai, Y. (2009). Number matters: control of mammalian mitochondrial DNA copy number. Journal of Genetics and Genomics, 36(3), 125-131. Cooper, S., & Helmstetter, C. E. (1968). Chromosome replication and the division cycle of Escherichia coliBr. Journal of Molecular Biology, 31(3), 519-540. Dai, K., & Lutkenhaus, J. (1991). ftsZ Is an Essential Cell Division Gene in Escherichia coli. JOURNAL OF BACTERIOLOGY (Vol. 173). Davies, F. K., Work, V. H., Beliaev, A. S., & Posewitz, M. C. (2014). Engineering Limonene and Bisabolene Production in Wild Type and a Glycogen-Deficient Mutant of Synechococcus sp. PCC 7002. Frontiers in Bioengineering and Biotechnology, 2, 21. Donachie, W. D., & Begg, K. J. (1989). Cell length, nucleoid separation, and cell division of rod-shaped and spherical cells of Escherichia coli. Journal of Bacteriology, 171(9), 4633-4639. Gehring, A. M., Astling, D. P., Matsumi, R., Burkhart, B. W., Kelman, Z., Reeve, J. N., Santangelo, T. J. (2017). Genome Replication in Thermococcus kodakarensis Independent of Cdc6 and an Origin of Replication. Frontiers in Microbiology, 8, 2084. Green, M. R. (Michael R., Sambrook, J., & Sambrook, J. (2012). Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press. Jain, I. H., Vijayan, V., & O'Shea, E. K. (2012). Spatial ordering of chromosomes enhances the fidelity of chromosome partitioning in cyanobacteria. Proceedings of the National Academy of Sciences, 109(34), 13638-13643. Jaqaman, K., Loerke, D., Mettlen, M., Kuwata, H., Grinstein, S., Schmid, S. L., & Danuser, G. (2008). Robust single-particle tracking in live-cell time-lapse sequences. Nature Methods, 5(8), 695-702. Klumpp, S., Zhang, Z., & Hwa, T. (2009). Growth Rate-Dependent Global Effects on Gene Expression in Bacteria. Cell, 139(7), 1366-1375. Lin, J., & Amir, A. (2018). Homeostasis of protein and mRNA concentrations in growing cells. Nature Communications, 9(1), 4496. Liu, H., & Deutschbauer, A. M. (2018). Rapidly moving new bacteria to model-organism status. Current Opinion in Biotechnology, 51, 116-122. Locey, K. J., & Lennon, J. T. (2016). Scaling laws predict global microbial diversity. Proceedings of the National Academy of Sciences of the United States of America, 113(21), 5970-5975. Lowe, D. G. (1999). Object recognition from local scale-invariant features. In Proceedings of the Seventh IEEE International Conference on Computer Vision (pp. 1150-1157 vo1.2). IEEE. Markley, A. L., Begemann, M. B., Clarke, R. E., Gordon, G. C., & Pfleger, B. F. (2015). Synthetic biology toolbox for controlling gene expression in the cyanobacterium Synechococcus sp. strain PCC 7002. ACS Synthetic Biology, 4(5), 595-603. Maxwell, K., & Johnson, G. N. (2000). Chlorophyll fluorescencea practical guide. Journal of Experimental Botany, 51(345), 659-668. Michaelis, C., Ciosk, R., & Nasmyth, K. (1997). Cohesins: Chromosomal Proteins that Prevent Premature Separation of Sister Chromatids. Cell, 91(1), 35-45. Moore, K. A., Altus, S., Tay, J. W., Meehl, J. B., Johnson, E. B., Bortz, D. M., & Cameron, J. C. (2020). Mechanical regulation of photosynthesis in cyanobacteria. Nature Microbiology, 5(5), 757-767. O'Donnell, M., Langston, L., & Stillman, B. (2013). Principles and concepts of DNA replication in bacteria, archaea, and eukarya. Cold Spring Harbor Perspectives in Biology, 5(7). Ohbayashi, R., Hirooka, S., Onuma, R., Kanesaki, Y., Hirose, Y., Kobayashi, Y., Miyagishima, S. Y. (2020). Evolutionary Changes in DnaA-Dependent Chromosomal Replication in Cyanobacteria. Frontiers in Microbiology, 11. Ohbayashi, R., Nakamachi, A., Hatakeyama, T. S., Watanabe, S., Kanesaki, Y., Chibazakura, T., Miyagishima, S.-Y. (2019). Coordination of Polyploid Chromosome Replication with Cell Size and Growth in a Cyanobacterium. M Bio, 10(2), e00510-19. Ohbayashi, R., Watanabe, S., Ehira, S., Kanesaki, Y., Chibazakura, T., & Yoshikawa, H. (2016). Diversification of DnaA dependency for DNA replication in cyanobacterial evolution. The ISME Journal, 10(5), 1113-1121. Pecoraro, V., Zerulla, K., Lange, C., & Soppa, J. (2011). Quantification of ploidy in proteobacteria revealed the existence of monoploid, (mero-)oligoploid and polyploid species. PLoS ONE, 6(1). Reyes-Lamothe, R., Nicolas, E., & Sherratt, D. J. (2012). Chromosome Replication and Segregation in Bacteria. Annual Review of Genetics, 46(1), 121-143. Richter, S., Hagemann, M., & Messer, W. (1998). Transcriptional analysis and mutation of a dnaA-like gene in Synechocystis sp. strain PCC 6803. Journal of Bacteriology, 180(18), 4946-4949. Sakamoto, W., & Takami, T. (2018). Chloroplast DNA Dynamics: Copy Number, Quality Control and Degradation. Plant and Cell Physiology, 59(6), 1120-1127. Sargent, M. G. (1975). Control of cell length in Bacillus subtilis. Journal of Bacteriology, 123(1), 7-19. Sass, L., Spetea, C., Mate, Z., Nagy, F., & Vass, I. (1997). Repair of UV-B induced damage of Photosystem II via de novo synthesis of the D1 and D2 reaction centre subunits in Synechocystis sp. PCC 6803. Photosynthesis Research (Vol. 54). Kluwer Academic Publishers. Schindelin, J., Arganda-Carreras, I., Frise, E., Kaynig, V., Longair, M., Pietzsch, T., Cardona, A. (2012). Fiji: an open-source platform for biological-image analysis. Nature Methods, 9(7), 676-682. Segall-Shapiro, T. H., Sontag, E. D., & Voigt, C. A. (2018). Engineered promoters enable constant gene expression at any copy number in bacteria. Nature Biotechnology, 36(4), 352-358. Selmecki, A. M., Maruvka, Y. E., Richmond, P. A., Guillet, M., Shoresh, N., Sorenson, A. L., . . . Pellman, D. (2015). Polyploidy can drive rapid adaptation in yeast. Nature, 519(7543), 349-351. Soppa, J. (2017). Polyploidy and community structure. Nature Microbiology, 2 (January), 1-2. Stevens, S. E., Patterson, C. O. P., & Myers, J. (1973). THE PRODUCTION OF HYDROGEN PEROXIDE BY BLUE-GREEN ALGAE: A SURVEY. Journal of Phycology, 9(4), 427-430. Van de Peer, Y., Mizrachi, E., & Marchal, K. (2017). The evolutionary significance of polyploidy. Nature Reviews Genetics, 18(7), 411-424. Vass, I.-Z., K?s, P. B., Sass, L., Nagy, C. I., & Vass, I. (2013). The Ability of Cyanobacterial Cells to Restore UV-B Radiation Induced Damage to Photosystem II is Influenced by Photolyase Dependent DNA Repair. Photochemistry and Photobiology, 89(2), 384-390. Zerulla, K., Chimileski, S., Nather, D., Gophna, U., Papke, R. T., & Soppa, J. (2014). DNA as a phosphate storage polymer and the alternative advantages of polyploidy for growth or survival. PLoS ONE, 9(4). Zheng, X. yu, & O'Shea, E. K. (2017). Cyanobacteria Maintain Constant Protein Concentration despite Genome Copy-Number Variation. Cell Reports, 19(3), 497-504
Definitions
(126) As used throughout the entire application, the terms a and an are used in the sense that they mean at least one, at least a first, one or more or a plurality of the referenced components or steps, unless the context clearly dictates otherwise. For example, the term a cell includes a plurality of cells, including mixtures thereof.
(127) The term and/or wherever used herein includes the meaning of and, or and all or any other combination of the elements connected by said term.
(128) The term about or approximately as used herein means within 20%, preferably within 10%, and more preferably within 5% of a given value or range.
(129) Other than in the operating examples, or unless otherwise expressly specified, all of the numerical ranges, amounts, values and percentages such as those for amounts of materials, times and temperatures of reaction, ratios of amounts, values for molecular weight (whether number average molecular weight (M.sub.n) or weight average molecular weight (M.sub.w), and others in the following portion of the specification may be read as if prefaced by the word about even though the term about may not expressly appear with the value, amount or range. Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present disclosure. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
(130) Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the disclosure are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical value, however, inherently contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Furthermore, when numerical ranges of varying scope are set forth herein, it is contemplated that any combination of these values inclusive of the recited values may be used.
(131) As used herein, the term comprising is intended to mean that the products, compositions and methods include the referenced components or steps, but not excluding others. Consisting essentially of when used to define products, compositions and methods, shall mean excluding other components or steps of any essential significance. Thus, a composition consisting essentially of the recited components would not exclude trace contaminants and pharmaceutically acceptable carriers. Consisting of shall mean excluding more than trace elements of other components or steps.
(132) The advantages set forth above, and those made apparent from the foregoing description, are efficiently attained. Since certain changes may be made in the above construction without departing from the scope of the invention, it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense.
(133) All references cited in the present application are incorporated in their entirety herein by reference to the extent not inconsistent herewith.
(134) It will be seen that the advantages set forth above, and those made apparent from the foregoing description, are efficiently attained and since certain changes may be made in the above construction without departing from the scope of the invention, it is intended that all matters contained in the foregoing description or shown in the accompanying drawings shall be interpreted as illustrative and not in a limiting sense.
(135) It is also to be understood that the following claims are intended to cover all of the generic and specific features of the invention herein described, and all statements of the scope of the invention which, as a matter of language, might be said to fall therebetween. Now that the invention has been described,
(136) TABLE-US-00001 TABLE 1 Strains used in this study. Name Number Description Resistance WT Wild-type Synechococcus sp. None PCC 7002 RbcL-GFP scJC0029 WT cells transformed with Gm sJC0028 ?ccm scJC0062 RbcL-GFP cells transformed Km, Gm with sJC0103 ?ccm.sup.+ scJC0138 ?ccm cells transformed with Km, Gm, sJC0187 Spec
(137) TABLE-US-00002 TABLE 2 Plasmids used in this study. Name Number Description Neutral Site RbcL-GFP_Gm sJC0028 pK2-RbcL-sfGFP downstream glpK of Gm cassette ?ccmOp_Km sJC0103 Km cassette flanked by ccm operon upstream and downstream homology arms cLac_ccmOp sJC0187 lac promoter-controlled ccm acsA operon, upstream of lac repressor and spec cassette
(138) TABLE-US-00003 TABLE 3 Primers used in this study. Name Description Sequence (5-3) NCH17F_seq To test via colony PCR for agcctggcccgtgaaggtaa [SEQ ID NO: 1] presence of RbcL-GFP insert in PCC 7002 genome NCH_10r To test via colony PCR for presence of gtcttttttaaattcaatgggtttacgttagag RbcL-GFP insert in [SEQ ID NO: 2] PCC 7002 genome KAMo0034 To test via colony PCR for taaccaagattccggtacgc [SEQ ID NO: 3] presence of glpK neutral site in PCC 7002 genome EBJp0091 To test via colony PCR for presence of gatgctgtaggcaagag [SEQ ID NO: 4] glpK neutral site in PCC 7002 genome KAMo0113 To test via colony PCR for presence of cgactgaatccggtgagaat [SEQ ID NO: 5] ?ccm insert in PCC 7002 genome EBJp0006 To test via colony PCR for ataggttctgaattgttctacttcttcggtgt presence of native ccm operon in PCC [SEQ ID NO: 6] 7002 genome EBJp0048 To use in colony PCR with both cggtggagacgatgatccg [SEQ ID NO: 7] KAMo0113 and EBJp0006 PET_218 To test via colony PCR for presence of gtttctggaaatcacagaggatgcgtg ?ccm.sup.+ insert in PCC [SEQ ID NO: 8] 7002 genome EBJp0181 To test via colony PCR for tcatcctctataccagc [SEQ ID NO: 9] presence of acsA neutral site in PCC 7002 genome EBJp0092 To use in colony PCR with both atgaatcgggtcaacag [SEQ ID NO: 10] PET_218 and EBJp0181 NCH92F_V Vector amplification of pALM179 tgagccttagcgagggcggtgctttgg (14) derivative, containing acsA [SEQ ID NO: 11] neutral sites with cLac143 promoter, LacI, and spec resistance cassette NCH92R_V Vector amplification of pALM179 ctcgcttatcacttgactttatgagttgg tgtgtgaaat (14) derivative, containing acsA [SEQ ID NO: 12] neutral sites with cLac143 promoter, LacI, and spec resistance cassette NCH93F_F Insert amplification of ccm aaagtcaagtgataagcgaggataaa ttagatgcctattgcag operon from PCC 7002 genome [SEQ ID NO: 13] NCH93R_F Insert amplification of ccm accgccctcgctaaggctcatctggtt gatttgg operon from PCC 7002 genome [SEQ ID NO: 14]
(139) TABLE-US-00004 TABLE 4 Average chromosome counts from bulk culture (related to FIG. 9). Average Chromosome Standard Strain Growth Phase Number Deviation scJC0147 Exponential 3.8 +/?0.4 scJC0147 Stationary 1.8 +/?0.3 PCC 7002 Exponential 3.3 +/?0.6 PCC 7002 Stationary 2.3 +/?0.1
Average chromosome counts from bulk culture mOrange2::240x tetO array::TetR-sfGFP (scJC0147) or WT PCC 7002 cells grown to exponential or stationary phase. mOrange2::240x tetO array::TetR-sfGFP cultures were resupplied with 0.5 ?g/mL every 48 hr.
(140) TABLE-US-00005 TABLE 5 Oligo Name Description Sequence 5-3 Used For JCC388 F glpK upstream CAATGGCGAAGGTTTTCTGT [SEQ ID NO: 15] glpK insertion and segregation JCC389 R glpK GGGAGATGCTGTAGGCAAGA [SEQ ID NO: 16] glpK insertion downstream and segregation KAMo0252 F NSI upstream CAAGTGGGCAGCAACTGTAG [SEQ ID NO: NSI insertion 17] and segregation KAMo0061 R NSI CTGCATGTCAACAACCACAA [SEQ ID NO: 18] NSI insertion downstream and segregation EBJp0180 F acsA internal GTAATCATCACACCACC [SEQ ID NO: 19] acsA segregation EBJp0181 R acsA internal TCATCCTCTATACCAGC [SEQ ID NO: 20] acsA segregation EBJp0087 R GmR CGGCAGAATGCTTAATG [SEQ ID NO: 21] GmR insertion EBJp0083 R KmR CTAGAGCAAGACGTTTC [SEQ ID NO: 22] KmR insertion EBJp0178 F glpK internal CTTGGGCAAGATCATTC [SEQ ID NO: 23] glpK segregation EBJp0179 R glpK internal GATCACAGTAATGCCAG [SEQ ID NO: 24] glpK segregation EBJp0060 F parA upstream TCGAGCTCGGTACCCGGGTGCGTCGAGGGTG ?parA insertion CCTTG [SEQ ID NO: 25] and segregation EBJp0103 R parA internal GGCGAGATTGACTACTG [SEQ ID NO: 26] ?parA segregation KAMo0575 F dnaA upstream ACGGCCAGTGAATTCGAGCTAGCAGGACTTC ?dnaA insertion ATTGCATCG [SEQ ID NO: 27] and segregation KAMo0579 R dnaA internal AAGTGAGGCGTACCTTAACG [SEQ ID NO: 28] ?dnaA segregation KAMo0398 F PCC7002 TTGTTCTCGCGAGCGATCG [SEQ ID NO: 29] qPCR standard 1000 bp curve KAMo0499 R PCC7002 GCACAAACATCGCACTGATC [SEQ ID NO: 30] qPCR standard 1000 bp curve KAMo0143 F PCC7002 GATCTCTGGCCTACCGATGA [SEQ ID NO: 31] qPCR 200 bp KAMo0145 R PCC7002 TGTTGGCGCATCAAATACAT [SEQ ID NO: 32] qPCR 200 bp
Strain Segmentation and qPCR Oligonucleotides. PCC 7002 gene names are italicized. NSI is a neutral site described by Davies, Work, Beliaev, & Posewitz, 2014)
(141) TABLE-US-00006 TABLE 6 Gene Name Protein ID sgRNA sequence 5-3 ftsZ ACA98042.1 UGCGACUUCGGCGACGAUGG [SEQ ID NO: 33] dnaX ACA99693.1 ACCAACUGCGCAAAAGUCUG [SEQ ID NO: 34] minD ACA98521.1 GCCGACGCCUCCUUUUCCGG [SEQ ID NO: 35] murE ACA98136.1 UUGACAACUUGCUGUAGCAU [SEQ ID NO: 36] mreB ACA99516.1 CUACAACAGACGGUUCCUGG [SEQ ID NO: 37]
Gene name, protein ID, and sgRNA sequences.
(142) TABLE-US-00007 TABLE 7 Plasmid Name Description Neutral Site KAMc0006 120x tetO-array flanking GmR Cassette glpK KAMc0064 pJ23113:tetR-sfGFP:SpR cassette acsA KAMc0084 pJ23113:tetR-sfGFP:dCas9:SpR cassette acsA KAMc0131 pCpt:mOrange2:KmR cassette NSI KAMc0189 pJ23119:mOrange2:KmR cassette NSI KAMc0197 dnaA upstream and downstream regions N/A flanking KmR cassette KAMc0205 cLac94:ftsZ-sgRNA3:LacI:KmR cassette NSI KAMc0208 cLac94:dnaX-sgRNA:LacI:KmR cassette NSI KAMc0211 cLac94:minD-sgRNA:LacI:KmR cassette NSI KAMc0217 cLac94:murE-sgRNA:LacI:KmR cassette NSI KAMc0223 cLac94:mreB-sgRNA2:LacI:KmR NSI cassette EBJc0022 parA upstream and downstream regions N/A flanking KmR cassette
Plasmids used in this study. GmR=gentamycin resistance. KmR=kanamycin resistance, SpR=spectinomycin resistance. NSI is a neutral site described by Davies et al., 2014. PCC7002 gene names are italicized.
(143) TABLE-US-00008 TABLE 8 Strain Name Description Transformed Plasmids Ab Resistance Wild Type Synechococcus PCC 7002 None None (WT) scJC0134 ?glpK:240x tetO array:GmR:: KAMc0006, Gm, Sp ?acsA:tetR-sfGFP:SpR KAMc0064 scJC0147 ?glpK:240x tetO array:GmR:: KAMc0006, Gm, Sp, Km ?acsA:tetR- KAMc0064, sfGFP:SpR::?NS1:pCpt- KAMc0131 mOrange2:KmR scJC0164 ?glpK:240x tetO array:GmR:: KAMc0006, Gm, Sp ?acsA:tetR-sfGFP:dCas9:SpR KAMc0084 scJC0182 ?glpK:240x tetO array:GmR:: KAMc0006, Gm, Sp, Km ?acsA:tetR-sfGFP:SpR::?NS1: KAMc0064, pJ23119-mOrange2:KmR KAMc0189 scJC0189 ?glpK:240x tetO array:GmR:: KAMc0006, Gm, Sp, Km ?acsA:tetR- KAMc0064, sfGFP:SpR::?dnaA:KmR KAMc0197 KAMs0003 ?glpK:240x tetO array:GmR:: KAMc0006, Gm, Sp, Km ?acsA:tetR- KAMc0064, EBJc0022 sfGFP:SpR::?parA:KmR
PCC7002 derived strains. Plasmid descriptions can be found in Table S4. GmRgentamycin resistance, Gmgentamycin, KmRkanamycin resistance, Kmkanamycin, SpRspectinomycin resistance, Spspectinomycin. Genotypes are italicized.