Recombinant bacillus subtilis for increasing production of acetylglucosamine and construction method thereof

10465198 ยท 2019-11-05

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention discloses a method for improving the yield of Bacillus subtilis acetylglucosamine, which belongs to the technical field of genetic engineering. In the invention, the recombinant Bacillus subtilis S5 (S5-PxylA-glmS-P43-GNA1) is taken as a starting strain, and the glmS ribozyme is integrated into the mid of rbs and the promoter sequence of the glmM and pfkA gene, respectively. The ribozyme mutant has the advantage of prolonging the stability of the mRNA and integrated into the mid of rbs and the promoter sequence of the pgi gene. The yield of GlcNAc of the recombinant strain reaches 11.79-20.05 g/L. This laid the foundation for the further metabolic engineering of Bacillus subtilis to produce GlcNAc.

Claims

1. A recombinant strain of Bacillus subtilis for producing acetylglucosamine, wherein the recombinant Bacillus subtilis is competent to dynamically downregulate regulate glmM and pfkA and dynamically upregulate pgi expression using a glmS ribozyme and/or a glmS ribozyme mutant; wherein the recombinant Bacillus subtilis is constructed by homologous recombination to integrate a gene encoding glmS ribozyme into a genome of Bacillus subtilis between a promoter and a rbs sequence of glmM and pfkA, respectively, and integrate a gene encoding a mutant of glmS ribozyme into the genome between a promoter and a rbs sequence of pgi; wherein a sequence of the gene encoding glmS ribozyme is set forth in SEQ ID NO: 26; wherein a sequence of the gene encoding the mutant of glmS ribozyme is set forth in SEQ ID NO:1.

2. The recombinant strain of Bacillus subtilis of claim 1, wherein the Bacillus subtilis is used as a host.

3. The recombinant strain of Bacillus subtilis of claim 2, wherein the Bacillus subtilis is Bacillus subtilis 168, and the Bacillus subtilis 168 is used as a host.

4. The recombinant strain of Bacillus subtilis of claim 1, wherein the recombinant strain is SFMI, which is constructed by homologous recombination to integrate a gene encoding a glmS ribozyme into a genome of Bacillus subtilis between a promoter and a rbs sequence of glmM and pfkA, respectively, and integrate a gene encoding a mutant of glmS ribozyme into the genome between a promoter and a rbs sequence of pgi.

5. A method of making the recombinant strain of Bacillus subtilis of claim 1, comprising: (1) constructing an integrating cassette of a gene encoding a glmS ribozyme, wherein the integrating cassette comprises a glmM upstream homologous fragment, a resistance gene spc, a gene fragment encoding glmS ribozyme and a glmM downstream homologous fragment; and transforming the integrating cassette into a strain of Bacillus subtilis, to obtain a first strain of Bacillus subtilis through screening and PCR validation; (2) constructing an integrating cassette of a glmS ribozyme encoding gene, wherein the integrating cassette comprises a gene encoding a pfkA upstream homologous fragment, a resistance gene spc, a gene fragment encoding a glmS ribozyme and a pfkA downstream homologous fragment; and transforming the integrating cassette into the first strain of Bacillus subtilis, to obtain a second strain of Bacillus subtilis through screening and PCR validation; (3) constructing an integrating cassette of a glmS ribozyme mutant encoding gene, wherein the integrating cassette comprises a pgi upstream homologous fragment, a resistance gene spc, a gene fragment encoding a glmS ribozyme mutant and a pgi downstream homologous fragment; and transforming the integrating cassette into the second strain of Bacillus subtilis, to obtain the recombinant strain of Bacillus subtilis through screening and PCR validation; wherein the gene fragment encoding the glmS ribozyme is set forth in SEQ ID NO: 26 and wherein the gene fragment encoding the glmS ribozyme mutant is set forth in SEQ ID NO: 1.

6. A method, comprising inoculating the recombinant strain of Bacillus subtilis of claim 1 into a fermentation medium.

7. The method of claim 6, further comprising incubating at 37 C. for 72 hours.

8. The method of claim 7, wherein the fermentation medium comprises (g/L): glucose 100.0, KH.sub.2PO.sub.4 2.5, K.sub.2HPO.sub.4 12.5, (NH.sub.4).sub.2SO.sub.4 6.0, tryptophan 6.0, yeast abstract 12.0, MgSO.sub.4 3.0, and 10 mL/L trace element solution.

9. The method of claim 8, wherein the trace element solution comprises (g/L): MnSO.sub.4 1.0, CoCl.sub.2 0.4, Na.sub.2MoO.sub.4 0.2, ZnSO.sub.4 0.2, AlCl.sub.3 0.1, CuCl.sub.2 0.1, Boric Acid 0.05.

Description

BRIEF DESCRIPTION OF FIGURES

(1) FIG. 1 shows the effects of glmS ribozyme systems regulation on cell growth and production of N-acetylglucosamine (GlcNAc). (a) cell growth, (b) GlcNAc concentration, (c) yield.

(2) FIG. 2 shows PFK, GlmM, Pgi activities and intracellular GlcN6P concentration in crude lysates indicate the dynamic regulation. (a) PFK activities under dynamic regulation of glmS ribozyme at given times; (b) GlmM activities under dynamic regulation of glmS ribozyme at given times; (c) PGI activities under dynamic regulation of glmS ribozyme mutant at given times; (d) Intracellular GlcN6P concentrations profiles at a given time.

DETAILED DESCRIPTION

(3) Recombinant Bacillus subtilis seed medium and fermentation medium:

(4) Seed medium (g/L): tryptophan 10, yeast abstract 5, NaCl 10.

(5) Fermentation medium (g/L): glucose 100.0, KH.sub.2PO.sub.4 2.5, K.sub.2HPO.sub.4 12.5, (NH.sub.4).sub.2SO.sub.4 6.0, tryptophan 6.0, yeast abstract 12.0, MgSO.sub.4 3.0, and 10 mL/L trace element solution.

(6) In one embodiment of the present invention, trace element solution comprises (g/L): MnSO.sub.4 1.0, CoCl.sub.2 0.4, Na.sub.2MoO.sub.4 0.2, ZnSO.sub.4 0.2, AlCl.sub.3 0.1, CuCl.sub.2 0.1, Boric Acid 0.05.

(7) Culture conditions: Seeds cultured at 37 C. and 200 rpm for 12 h were transferred into fermentation medium at 5% inoculum volume and cultured at 37 C. and 200 rpm for 72 h.

(8) Determination of acetylglucosamine and glucosamine-6-phosphate:

(9) The concentrations of GlcNAc, GlcN6P, were measured by high-performance liquid chromatography (HPLC) (Agilent 1260; NH.sub.2 column) and a refractive index detector using 70% acetonitrile as the mobile phase at a flow rate of 0.75 mL/min and 30 C.

(10) Determination of key enzyme activity: PFK enzyme activity determination methods was refer to the reference Site-directed mutagenesis in Bacillus stearothermophilus fructose-6-phosphate 1-kinase (Journal of Biology Chemical, 264 (1989) p 131-135); GlmM enzyme activity determination methods was refer to the reference Characterization of the essential gene glmM encoding phosphoglucosamine mutase in Escherichia coli (Journal of Biology Chemical, 271 (1996) p 32-39); PGI enzyme activity determination methods was refer to the reference Model-driven redox pathway manipulation for improved isobutanol production in Bacillus subtilis complemented with experimental validation and metabolic profiling analysis (PLoS One, 9 (2014)).

Example 1 glmS Ribozyme Regulate the Expression of pfkA

(11) The amplification primers are designed based on the up-stream and down-stream sequences of glmS ribozyme encoding gene of Bacillus subtilis (Bacillus subtilis 168, available from American Type Culture Collection, ATCC No. 27370) published in NCBI.

(12) The up-stream primers: GlmS-F

(13) TABLE-US-00001 Theup-streamprimers:GlmS-F (SEQIDNO.2) GCATACATTATACGAACGGTAGAGCTTGTCTTGTTCTTATTTTCTCAATA GG; Thedown-streamprimers:GlmS-R (SEQIDNO.3) TTCTCCATTCACCTCAGCAACAAGATTGTAAAAGGAGACGAAGAAAGTCA AA.

(14) The amplification primers are designed based on the up-stream and down-stream sequences of pfkA encoding gene of Bacillus subtilis published in NCBI.

(15) The up-stream homologous arm primers were:

(16) TABLE-US-00002 pfk-U-F: (SEQIDNO.4) CGAACACCTGTTTACCGACTT, pfk-U-R: (SEQIDNO.5) GCTATACGAACGGTAGAATCTCCCCTCAGCAACATATATGATTAAACATA ACA;

(17) The down-stream homologous arm primers were:

(18) TABLE-US-00003 pfk-D-F: (SEQIDNO.6) TTTGACTTTCTTCGTCTCCTTTTACAATCTTGTTGCTGAGGTGAATGGAGA A, pfk-D-R: (SEQIDNO.7) AATACTGTGCTTCTTGCCGCGTT.

(19) The screening marker expression cassette primers were:

(20) TABLE-US-00004 spc1-F: (SEQIDNO.8) TGTTATGTTTAATCATATATGTTGCTGAGGGGAGATTCTACCGT TCGTATAGC spc1-R: (SEQIDNO.9) CCTATTGAGAAAATAAGAACAAGACAAGCTCTACCGTTCGTATA ATGTATGC

(21) An up-stream homologous arm, glmS ribozyme and a down-stream homologous arm were amplified from the genome of Bacillus subtilis by using the above primers, and a screening marker expression cassette containing spectinomycin resistance gene was amplified from the vector PDGREF. The up-stream homologous arm, the screening marker, glmS ribozyme and the down-stream homologous arm were fused by fusion PCR technology, and an integrating cassette of glmS ribozyme encoding gene was obtained.

Example 2 glmS Ribozyme Regulate the Expression of glmM

(22) The amplification primers are designed based on the up-stream and down-stream sequences of glmS ribozyme encoding gene of Bacillus subtilis (Bacillus subtilis 168, available from American Type Culture Collection, ATCC No. 27370) published in NCBI.

(23) TABLE-US-00005 Theup-streamprimers:GlmS-F (SEQIDNO.10) GCATACATTATACGAACGGTAGAGCTTGTCTTGTTCTTATTTTCTCAATA GG; Thedown-streamprimers:GlmS-R (SEQIDNO.11) CTTGCCCATTTTATAATCGCTTCCTCCTAAGATTGTAAGATTGTAAAAGG AGACGAAGAA.

(24) The amplification primers are designed based on the up-stream and down-stream sequences of glmM encoding gene of Bacillus subtilis published in NCBI.

(25) The up-stream homologous arm primers were:

(26) TABLE-US-00006 glm-U-F: (SEQIDNO.12) AAATTGAACGGACAGGAAGCC, glm-U-R: (SEQIDNO.13) CTATACGAACGGTAGAATCTCCTTATTCCGATGAGGATTGTG;

(27) The down-stream homologous arm primers were:

(28) TABLE-US-00007 glm-D-F: (SEQIDNO.14) TTTGACTTTCTTCGTCTCCTTTTACAATCTTACAATCTTAGGAGGAAGCG ATTATAAAATGGGCAAG, glm-D-R: (SEQIDNO.15) CAAGACCGAGATCCGCGTTTTT.

(29) The screening marker expression cassette primers were:

(30) TABLE-US-00008 spc1-F: (SEQIDNO.16) CACAATCCTCATCGGAATAAGGAGATTCTACCGTTCGTATAGC spc1-R: (SEQIDNO.17) CCTATTGAGAAAATAAGAACAAGACAAGCTCTACCGTTCGTATAATGTAT GC

(31) An up-stream homologous arm, glmS ribozyme and a down-stream homologous arm were amplified from the genome of Bacillus subtilis by using the above primers, and a screening marker expression cassette containing spectinomycin resistance gene was amplified from the vector PDGREF. The up-stream homologous arm, the screening marker, glmS ribozyme and the down-stream homologous arm were fused by fusion PCR technology, and a integrating cassette of glmS ribozyme encoding gene was obtained.

Example 3 glmS Ribozyme Mutant Regulate the Expression of Pgi

(32) The amplification primers are designed based on the up-stream and down-stream sequences of glmS ribozyme encoding gene of Bacillus subtilis (Bacillus subtilis 168, available from American Type Culture Collection, ATCC No. 27370) published in NCBI.

(33) The up-stream primers: GlmS-F

(34) TABLE-US-00009 Theup-streamprimers:GlmS-F (SEQIDNO.18) GCATACATTATACGAACGGTAGGCTTTACCTATAATTATCCCGCCCG. Thedown-streamprimers:GlmS-R (SEQIDNO.19) GTCATTGCTTGTCCCTCCATAACGGACTTTCAATCGTCCCCTCCTACAT G.

(35) The amplification primers are designed based on the up-stream and down-stream sequences of pgi encoding gene of Bacillus subtilis published in NCBI.

(36) The up-stream homologous arm primers were:

(37) TABLE-US-00010 pgi-U-F: (SEQIDNO.20) GGTTGACATGATGAGCCACGTATTC, pgi-U-R: (SEQIDNO.21) GCTATACGAACGGTAGAATCTCCCCATAACGGTATAATGTTTTCATCTTT CACTTTAT;

(38) The down-stream homologous arm primers were:

(39) TABLE-US-00011 pgi-D-F: (SEQIDNO.22) CATGTAGGAGGGGACGATTGAAAGTCCGTTATGGAGGGACAAGCAATGA C, pgi-D-R: (SEQIDNO.23) CTGACAGCAATCGGCAAGAGACCTA.

(40) The screening marker expression cassette primers were:

(41) TABLE-US-00012 spc1-F: (SEQIDNO.24) ATAAAGTGAAAGATGAAAACATTATACCGTTATGGGGAGATTCTACCGTT CGTATAGC, spc1-R: (SEQIDNO.25) CGGGCGGGATAATTATAGGTAAAGCCTACCGTTCGTATAATGTATGC.

(42) An up-stream homologous arm, glmS ribozyme mutant and a down-stream homologous arm were amplified from the genome of Bacillus subtilis by using the above primers, and a screening marker expression cassette containing spectinomycin resistance gene was amplified from the vector PDGREF. The up-stream homologous arm, the screening marker, glmS ribozyme mutant and the down-stream homologous arm were fused by fusion PCR technology, and a integrating cassette of glmS ribozyme encoding gene was obtained.

Example 4 the Construction of Recombinant Bacillus subtilis

(43) The integrating cassette obtained in Example 1-3 was transformed into Bacillus subtilis S5 (S5-P.sub.xylA-glmS-P.sub.43-GNA1, short for S5), wherein the S5 is obtained by controlling recombinant expression of glmS, GNA1 by promoters of PxylA, P43 respectively, taking B. subtilis 168nagPgamPgamAnagAnagBldhptaglmS5UTR::lox72 as a host. The construction of the strain was according to the patent application number WO/2016/015469. The correct transformants were screened and determined by PCR validation. The strains with glmS ribozyme integrated were obtained.

(44) The positive transformant was obtained through the protocol of spectinomycin resistant plate screening, colony PCR validation. The recombinant strain SF was obtained by inserting the glmS ribozyme gene into the 5UTR of pfkA. The recombinant strain SM was obtained by inserting the glmS ribozyme gene into the 5UTR of glmM. The recombinant strain SI was obtained by inserting the glmS ribozyme mutant gene into the 5UTR of pgi. The recombinant strain SFM was obtained by inserting the glmS ribozyme gene into the 5UTR of pfkA and glmM, respectively. The recombinant strain SFI was obtained by inserting the glmS ribozyme gene into the 5UTR of pfkA and the glmS ribozyme mutant gene into the 5UTR of pgi, respectively. The recombinant strain SMI was obtained by inserting the glmS ribozyme gene into the 5UTR of glmM and the glmS ribozyme mutant gene into the 5UTR of pgi, respectively. The recombinant strain SFMI was obtained by inserting the glmS ribozyme gene into the 5UTR of pfkA, glmM and the glmS ribozyme mutant gene into the 5UTR of pgi, respectively.

Example 5 the Recombinant Produce Acetylglucosamie

(45) Seeds cultured at 37 C. and 200 rpm for 12 h were transferred into fermentation medium at 5% inoculum volume at 37 C., 200 rpm for 72 h. The yield of GlcNAc of starting strain S5 reached 12.23 g/L at 72 h. The yields of GlcNAc in recombinant strain SI, SF, SM, SFI, SMI, SFM and SFMI was 12.93, 13.27, 11.79, 13.89, 12.27, 14.54, and 20.05 g/L, respectively (FIG. 1). Compared with S5, the yield of GlcNAc was increased by 63.9%.

(46) As shown in FIG. 1, the yielding of GlcNAc of SFMI is 0.39 g/g glucose, and the GlcNAc produce reaches 20.05 g/L, yielding 2.35-fold and 1.639-fold in GlcNAC synthesis compared with that of S5. In this work, we establish a multiple setpoint dynamic control of metabolism in B. subtilis for the production of GlcNAc using the glmS ribozyme system.

Example 6 Activity Profiles and Intracellular GlcN6P Concentration

(47) Seeds cultured at 37 C. and 200 rpm for 12 h were transferred into fermentation medium at 5% inoculum volume at 37 C., 200 rpm for 72 h. At 10 h, intracellular GlcN6P content and enzyme activity were analyzed.

(48) As shown in FIG. 2, the enzyme activities of PFK and GlmM decreased with the increasing of GlcN6P concentration, continuously. When the concentration of intracellular GlcN6P was increased from 6.9 mM to 18.9 mM, the activity of PFK decreased from 861.8 U/mg to 173.0 U/mg. Meanwhile, the activity of GlmM decreased from 157.6 U/mg to 50.6 U/mg. These shows that the concentration of intracellular GlcN6P can regulate glmS ribozyme activity, in turn glmS ribozyme regulated expression of pfkA and glmM. When glmS ribozyme mutant was inserted into the mRNA of pgi gene of SI strain, the activity of PGI increased from 180.6 U/mg to 287.6 U/mg. When glmS ribozyme mutant was inserted into the pgi gene mRNA of SFMI, PGI activity increased from 170.4 U/mg to 202.1 U/mg.