Method for increasing yield of L-arginine by knocking out Flavin reductases
10465218 ยท 2019-11-05
Assignee
Inventors
- Zhiming Rao (Wuxi, CN)
- Zaiwei Man (Wuxi, CN)
- Meijuan Xu (Wuxi, CN)
- Taowei Yang (Wuxi, CN)
- Xian Zhang (Wuxi, CN)
Cpc classification
International classification
Abstract
The invention discloses a method for increasing the yield of L-arginine by knocking out flavin reductases, and belongs to the technical field of amino acid production by microbial fermentation. Genes frd1 and frd2 for encoding hypothetic NADPH-dependent FMN reductase in Corynebacterium crenatum SDNN403 are over-expressed in E. coli BL21 and are purified to form target proteins Frd181 and Frd188, and functions of the target proteins are identified to obtain a result showing that the proteins Frd181 and Frd188 both are NAD(P)H-dependent flavin reductases producing H.sub.2O.sub.2. By taking a genome of the Corynebacterium crenatum SDNN403 as a template, frd1 and frd2 gene deletion fragments are obtained by overlap extension PCR; connecting pK18mobsacB to obtain knockout plasmids pK18mobsacB-frd1 and pK18mobsacB-frd2; carrying out electric shock to transform the Corynebacterium crenatum SDNN403; and carrying out secondary screening to obtain recombinant strains 403frd1 and 403frd2. Found by flask shaking fermentation, the yield of L-arginine is obviously increased by knocking out the genes frd1 and frd2.
Claims
1. A recombinant strain of Corynebacterium crenatum comprising a gene knockout of NADPH-dependent flavin mononucleotide (FMN) reductase gene frd1, or frd2, or both frd1 and frd2.
2. The recombinant strain of the Corynebacterium crenatum of claim 1, wherein amino acid sequences of the NADPH-dependent FMN reductase genes frd1 and frd2 are respectively amino acid sequences of SEQ ID NO:2 and SEQ ID NO:4.
3. The recombinant strain of the Corynebacterium crenatum of claim 1, wherein the recombinant strain of the Corynebacterium crenatum is obtained by knocking out NADPH-dependent FMN reductase genes in Corynebacterium crenatum CGMCC NO:0890.
4. The recombinant strain of the Corynebacterium crenatum of claim 1, wherein nucleotide sequences of the NADPH-dependent FMN reductase genes frd1 and frd2 are respectively nucleotide sequences of SEQ ID NO:1 and SEQ ID NO:3.
5. A method for synthesizing L-arginine, comprising culturing a recombinant strain of Corynebacterium crenatum of claim 1 as a production strain.
6. The method of claim 5, wherein: the culturing step is performed at a temperature of 28 C. to 32 C.; and the culturing step is performed in a medium comprising: 120 g/L glucose, 40 g/L corn steep liquor, 810.sup.5 g/L biotin, 510.sup.4 g/L histidine, 0.02 g/L manganese sulfate, 20 g/L ammonium sulfate, 0.5 g/L magnesium sulfate, 1.5 g/L monopotassium phosphate, and 0.02 g/L ferrous sulfate.
7. A method for promoting synthesis of L-arginine by knocking out flavin reductases, comprising: knocking out NADPH-dependent FMN reductase genes frd1, or frd2, or both frd1 and frd2 in Corynebacterium crenatum to obtain a recombinant strain, and synthesizing L-arginine by culturing the recombinant strain as a production strain.
8. The method of claim 7, wherein amino acid sequences of the NADPH-dependent FMN reductase genes frd1 and frd2 are respectively amino acid sequences of SEQ ID NO:2 and SEQ ID NO:4.
9. The method of claim 7, wherein the Corynebacterium crenatum is Corynebacterium crenatum CGMCC NO:0890.
10. A method of use of the recombinant strain of the Corynebacterium crenatum of claim 1 to medicines, food or feed industry, comprising culturing the recombinant strain of Corynebacterium crenatum, and synthesizing L-arginine from a culture thereof.
Description
DETAILED DESCRIPTION
(1) For A strain used by the invention was Corynebacterium crenatum SDNN403, was a mutant strain for high-yield arginine obtained by laboratory screening, had a collection number of CGMCC NO.0890, had been disclosed in a patent document with a patent number of ZL 03112896.3, and was a known biological material.
Example 1: Purification and Functional Identification of Hypothetic NADPH-Dependent FMN Reductases Frd181 and Frd188
(2) Hypothetic NADPH-dependent FMN reductases Frd181 and Frd188 were subjected to over-expression, purification and functional identification by an inventor. The specific steps were as follows:
(3) Over-Expression and Purification
(4) By taking a genome of C. crenatum SDNN403 (namely Corynebacterium crenatum CGMCC NO.0890) as a template, genes frd1 (corresponding to a gene cg3223 of C. glutamicum ATCC13032) and frd2 (corresponding to a gene cg1150 of the C. glutamicum ATCC13032) for encoding the hypothetic NADPH-dependent FMN reductases were subjected to primer amplification by using a PCR method by taking a genome of C. crenatum SDNN403 (namely Corynebacterium crenatum CGMCC NO.0890) as a template, and primer sequences were as follows (nucleotide sequences were respectively shown as SEQ ID NO:5-SEQ ID NO:8):
(5) TABLE-US-00001 28a-frd1F:CCGGAATTCATGAAAATCGGCGTCATTCTAG 28a-frd1R:CCGCTCGAGTTAATCGCGGACAGCCGTTAGGAGGC 28a-frd2F:CCGGAATTCATGAGCAAGATCGCCATCATCAC 28a-frd2R:CCCAAGCTTTTAGACGTTTGCAGACTC
(6) Recombinant strains BL21/pET-28a-frd1 and BL21/pET-28a-frd2 were obtained by connecting the obtained frd1 and frd2 gene fragments with pET-28a linearized plasmids, transforming E. coli BL21 by heat shock and selecting positive transformants. The recombinant strains BL21/pET-28a-frd1 and BL21/pET-28a-frd2 were induced to over-express target proteins Frd181 and Frd188. The target proteins Frd181 and Frd188 were obtained by nickel column affinity chromatography purification after ultrasonic cell breakage.
(7) The target proteins Frd181 and Frd188 were obtained by nickel column affinity chromatography purification, the purification conditions of the proteins were analyzed by virtue of SDS-PAGE, and the result showed that the purification effect was relatively good.
(8) Functional Identification Carried Out on Proteins Frd181 and Frd188
(9) A reaction system: 0.1M of pH7.5 Tris-HCl, 75 M of NAD(P)H, 50 M of flavin (FMN, FAD and riboflavin) and a proper quantity of enzyme liquid. The consumption condition of NAD(P)H was monitored by measuring the change of OD340. Meanwhile, the production condition of H.sub.2O.sub.2 in the reaction system was measured by using a phenol red-horseradish peroxidase method and a biological sensor.
(10) A result of functional identification on Frd181 and Frd188 showed that Frd181 was capable of oxidizing NADPH in the existence of FMN and FAD, was capable of oxidizing NADH in the existence of FMN, FAD and riboflavin, and had very high NADH oxidation activity in the existence of FAD and riboflavin. The H.sub.2O.sub.2 production analysis shows that H.sub.2O.sub.2 was produced in each of catalytic reaction systems of Frd181 and Frd188. The foregoing results showed that Frd181 and Frd188 were NAD(P)H-dependent flavin reductases producing H.sub.2O.sub.2.
Example 2: Construction of Gene Knocked-Out Strain
(11) By taking the genome of the C. crenatum SDNN403 as a template, frd1 and frd2 gene deletion fragments were obtained by using an overlap extension PCR method, and primer sequences were as follows (nucleotide sequences were respectively shown as SEQ ID NO:9-SEQ ID NO:16):
(12) TABLE-US-00002 frd1-1: CCGGAATTCATGAAAATCGGCGTCATTCTAG frd1-2: GTTGGCAGCACCTGGAACAGTGG frd1-3: CCACTGTTCCAGGTGCTGCCAACGAAGGTGTCCGTGCTGTTGAGCAG frd1-4: CTAGTCTAGATTAATCGCGGACAGCCGTTAGGAGGC frd2-1: CCGGAATTCATGAGCAAGATCGCCATCATCAC frd2-2: CTGGCATTGCTTCGTCGAG frd2-3: CTCGACGAAGCAATGCCAGCAGATCGCACACGTTC frd2-4: CCCAAGCTTTTAGACGTTTGCAGACTC
(13) Plasmids pK18mobsacB-frd1 and pK18mobsacB-frd2 were constructed by connecting the obtained frd1 and frd2 gene deletion fragments with pK18mobsacB linearized vectors, shifting to E. coli JM109 and selecting positive transformants.
(14) The plasmids pK18mobsacB-frd1 and pK18mobsacB-frd2 were subjected to electric shock to transform the C. crenatum SDNN403, a solid culture medium plate containing LBG+Km was coated with the C. crenatum SDNN403 after 1800V electric shock was carried out for 5 ms, the C. crenatum SDNN403 was cultured at 30 C. for 24-36 h, and then, first homologous recombinant transformants grew. Then, target transformants were respectively subjected to forced secondary recombination screening in a culture medium containing saccharose, finally, streaking was carried out on an LBG plate, several transformants were selected, and strains subjected to second homologous recombination were subjected to wild-type/gene deleted-type restoration identification by PCR. The strains identified to be correct were respectively named as 403frd1 and 403frd2. A strain 403frd12 was obtained by further knocking out the gene frd2 in the strain 403frd1.
Example 3: Influences of Frd1 or Frd2 Gene Knockout to Synthesis of L-Arginine
(15) 403frd1, 403frd2 and 403frd12 were subjected to flask shaking fermentation. Fermentation culture medium components: 120 g.Math.L.sup.1 of glucose, 40 g/L of corn steep liquor, 8*10-5 g.Math.L.sup.1 of biotin, 5*10-4 g.Math.L.sup.1 of histidine, 0.02 g.Math.L.sup.1 of manganese sulfate, 20 g.Math.L.sup.1 of ammonium sulfate, 0.5 g.Math.L.sup.1 of magnesium sulfate, 1.5 g.Math.L.sup.1 of monopotassium phosphate and 0.02 g.Math.L.sup.1 of ferrous sulfate. The fermentation temperature was 30 DEG C., and the rotating speed of a shaking table was 220 r.Math.min.sup.1. After being fermented for 60 h, the strains 403frd1, 403frd2 and 403frd12 respectively produce 18.4 g.Math.L.sup.1 of L-arginine, 16.3 g.Math.L.sup.1 of L-arginine and 18.7 g.Math.L.sup.1 of L-arginine.
(16) Comparative embodiment: the C. crenatum SDNN403 was subjected to flask shaking fermentation, and fermentation culture medium components and fermentation conditions were the same as those of the embodiment 3. After fermentation for 60 h, the yield of L-arginine was 15.8 g.Math.L.sup.1.
(17) The data proved that the L-arginine yield of the strain could be respectively increased by 16.46% and 3.16% by knocking out the gene(s) frd1 and/or frd2.