PROTOPORPHYRINOGEN OXIDASE VARIANTS AND METHODS AND COMPOSITIONS FOR CONFERRING AND/OR ENHANCING HERBICIDE TOLERANCE USING THE SAME
20190330650 ยท 2019-10-31
Inventors
- Soon-Kee Sung (Daejeon, KR)
- Joonseon Yoon (Daejeon, KR)
- Young Ock Ahn (Daejeon, KR)
- Yunjung Han (Daejeon, KR)
- Myoung-Ki Hong (Daejeon, KR)
- Joonghyuk Park (Daejeon, KR)
Cpc classification
International classification
Abstract
Provided is technology for conferring enhanced tolerance and/or enhancing tolerance to herbicide of a plant and/or algae using amino acid variants of protoporphyrinogen oxidase derived from prokaryotes.
Claims
1. A polypeptide selected from the followings: a polypeptide comprising an amino acid sequence wherein one or more selected from the group consisting of S63, P91, R92, F169, V173, A175, E228, L229, P316, V318, F337, L340, G351, T352, I353, and Y373 of the amino acid sequence of SEQ ID NO: 1 are independently deleted or substituted with an amino acid which is selected from the group consisting of M(Met), V(Val), I(Ile), T(Thr), L(Leu), C(Cys), A(Ala), S(Ser), F(Phe), P(Pro), W(Trp), N(Asn), Q(Gln), G(Gly), Y(Tyr), D(Asp), E(Glu), R(Arg), H(His), and K(Lys), and is different from the amino acid at the corresponding position in the wild type; a polypeptide comprising an amino acid sequence wherein one or more selected from the group consisting of N63, S64, S66, P67, P92, R93, F170, S172, G173, V174, Y175, A176, R190, E230, L231, P318, V320, F339, G340, N341, L342, L352, G353, T354, I355, Y375, 1424, V458, and R465 of the amino acid sequence of SEQ ID NO: 3 are independently deleted or substituted with an amino acid which is selected from the group consisting of M(Met), V(Val), I(Ile), T(Thr), L(Leu), C(Cys), A(Ala), S(Ser), F(Phe), P(Pro), W(Trp), N(Asn), Q(Gln), G(Gly), Y(Tyr), D(Asp), E(Glu), R(Arg), H(His), and K(Lys), and is different from the amino acid at the corresponding position in the wild type; a polypeptide comprising an amino acid sequence wherein one or more selected from the group consisting of P84, R85, F156, V160, A162, Q179, P306, V308, F327, L330, I343, N362, and F363 of the amino acid sequence of SEQ ID NO: 5 are independently deleted or substituted with an amino acid which is selected from the group consisting of M(Met), V(Val), I(Ile), T(Thr), L(Leu), C(Cys), A(Ala), S(Ser), F(Phe), P(Pro), W(Trp), N(Asn), Q(Gln), G(Gly), Y(Tyr), D(Asp), E(Glu), R(Arg), H(His), and K(Lys), and is different from the amino acid at the corresponding position in the wild type; and a polypeptide comprising an amino acid sequence having 95% or higher homology with the amino acid sequence of said polypeptides.
2. The polypeptide of claim 1, which is selected from the group consisting of: a polypeptide comprising an amino acid sequence wherein one or more selected from the group consisting of S63, P91, R92, F169, V173, A175, E228, L229, P316, V318, F337, L340, G351, T352, I353, and Y373 of the amino acid sequence of SEQ ID NO: 1 are independently substituted with an amino acid which is selected from the group consisting of M(Met), V(Val), I(Ile), T(Thr), L(Leu), C(Cys), A(Ala), S(Ser), and F(Phe); a polypeptide comprising an amino acid sequence wherein one or more selected from the group consisting of A176, P318, V320, and Y375 of the amino acid sequence of SEQ ID NO: 3 are independently substituted with an amino acid which is selected from the group consisting of M(Met), V(Val), I(Ile), T(Thr), L(Leu), C(Cys), and A(Ala); a polypeptide comprising an amino acid sequence wherein one or more kinds selected from the group consisting of P84, R85, F156, V160, A162, Q179, P306, V308, F327, L330, I343, N362, and F363 among the amino acid sequence of SEQ ID NO: 5 are independently substituted with an amino acid which is selected from the group consisting of M(Met), V(Val), I(Ile), T(Thr), L(Leu), C(Cys), A(Ala), S(Ser), H(His), and G(Gly); and a polypeptide comprising an amino acid sequence having 95% or higher homology with the amino acid sequence of said polypeptides.
3. The polypeptide of claim 1, which is selected from the group consisting of: a polypeptide comprising an amino acid sequence comprising one or more amino acid mutations selected from the group consisting of Y373V, Y373I, Y373T, Y373L, Y373C, Y373M, A175C, A175L, A175I, P316A, P316L, V318M, V318T, V318L, G351A, S63T, P91L, R92A, V173S, V173C, V173T, V173L, F169A, E228A, L229F, F337V, L340T, L340I, L340V, T352V, I353T, I353L, I353V, and I353C in the amino acid sequence of SEQ ID NO: 1; a polypeptide comprising an amino acid sequence comprising one or more amino acid mutations selected from the group consisting of Y375M, Y375V, Y375I, Y375T, Y375C, A176C, A176L, P318L, V320L, V320M, and P318A in the amino acid sequence of SEQ ID NO: 3; a polypeptide comprising an amino acid sequence comprising one or more amino acid mutations selected from the group consisting of P84L, R85A, R85C, R85H, R85L, R85T, R85V, F363M, F363V, F363L, F363C, F363I, F363T, A162C, A162L, P306L, P306A, V308L, V308M, N362S, V160S, V160C, I343V, I343T, F156A, Q179G, F327V, and L330T in the amino acid sequence of SEQ ID NO: 5; and a polypeptide comprising an amino acid sequence having 95% or higher homology with the amino acid sequence of said polypeptides.
4. The polypeptide of claim 3, which is selected from the group consisting of: a polypeptide comprising an amino acid sequence comprising amino acid mutation of Y373M, Y373V, Y373I, Y373T, Y373L, Y373C, F169A, A175C, A175L, A175I, P316A, P316L, V318M, V318T, V318L, G351A, S63T, P91L, R92A, V173S, V173C, V173T, V173L, E228A, L229F, F337V, L340T, L340I, L340V, T352V, I353T, I353L, I353V, I353C, S63T+Y373M, R92A+Y373M, V173S+Y373M, V173S+Y373I, V173S+Y373L, V173S+Y373V, V173C+Y373M, V173C+Y373I, V173T+Y373M, V173T+Y373I, V173L+Y373M, A175L+Y373M, A175L+Y373I, A175C+Y373M, A175C+Y373I, A175I+Y373M, E228A+Y373M, L229F+Y373T, V318M+Y373M, V318M+Y373I, V318M+Y373V, V318T+Y373I, L340I+Y373M, L340I+Y373I, L340V+Y373M, G351A+Y373M, I353T+Y373M, I353T+Y373I, I353T+Y373L, I353L+Y373M, I353V+Y373M, I353C+Y373M, S63T+V173S+Y373M, S36T+V173S+Y373I, S63T+I353T+Y373M, S63T+I353T+Y373I, V173S+V318M+Y373M, V173T+L340I+Y373M, V173S+A175C+Y373M, A175C+V318M+Y373M, A175L+V318M+Y373M, A175C+I353L+Y373M, A175C+I353V+Y373M, P316A+V318L, P316L+V318L, F337V+Y373M, T352V+Y373M, G351A+T352V+Y373M, or P91L+Y373M, in the amino acid sequence of SEQ ID NO: 1; a polypeptide comprising an amino acid sequence comprising amino acid mutation of Y375M, Y375V, Y375I, Y375T, Y375C, A176C, A176L, P318L+V320L, V320M, or P318A+V320L, in the amino acid sequence of SEQ ID NO: 3; a polypeptide comprising an amino acid sequence comprising amino acid mutation of P84L, R85A, R85C, R85H, R85L, R85T, R85V, F363M, F363V, F363L, F363C, F363I, F363T, A162C, A162L, P306L, P306A, V308L, V308M, N362S, V160S, V160C, I343V, I343T, F156A, Q179G, F327V, L330T, P84L+F363M, R85A+F363M, R85A+F363I, R85C+F363M, R85H+F363M, R85L+F363M, R85T+F363M, R85V+F363M, R85A+A 62L+F363M, R85A+A162L+F363I, R85A+A162C+F363M, R85A+A162C+F363I, R85A+V308M+F363M, V160S+F363M, V160S+F363I, V160S+V308M+F363I, A162L+F363M, A162C+F363M, A162C+F363I, A162C+F363L, A162C+V308M+F363M, A162C+V308L+F363M, A162L+Q179G+F363M, P306A+V308L, P306L+V308L, V308M+F363M, V308M+F363I, I343T+F363M, I343V+F363M, or N362S+F363M, in the amino acid sequence of SEQ ID NO: 5; and a polypeptide comprising an amino acid sequence having 95% or higher homology with the amino acid sequence of said polypeptides.
5. A polynucleotide encoding the polypeptide of claim 1.
6. A recombinant vector comprising the polynucleotide of claim 5.
7. A transformed cell comprising the recombinant vector of claim 6.
8. A composition for conferring or enhancing herbicide tolerance of a plant or algae, comprising one or more selected from the group consisting of the polypeptide of claim 1; a polynucleotide encoding the polypeptide; a recombinant vector comprising the polynucleotide; and a transformed cell comprising the recombinant vector.
9. The composition of claim 8, wherein the herbicide is an herbicide inhibiting protoporphyrinogen oxidase.
10. The composition of claim 9, wherein the herbicide is one or more selected from the group consisting of pyrimidinediones, diphenyl-ethers, phenylpyrazoles, N-phenylphthalimides, phenylesters, thiadiazoles, oxadiazoles, triazolinones, oxazolidinediones, pyraclonil, flufenpyr-ethyl and profluazol.
11. The composition of claim 10, wherein the herbicide is one or more selected from the group consisting of butafenacil, saflufenacil, benzfendizone, tiafenacil, fomesafen, oxyfluorfen, aclonifen, acifluorfen, bifenox, ethoxyfen, lactofen, chlomethoxyfen, chlorintrofen, fluoroglycofen-ethyl, halosafen, pyraflufen-ethyl, fluazolate, flumioxazin, cinidon-ethyl, flumiclorac-pentyl, fluthiacet, thidiazimin, oxadiargyl, oxadiazon, carfentrazone, sulfentrazone, azafenidin, pentoxazone, pyraclonil, flufenpyr-ethyl, profluazol, phenopylate, carbamate analogues of phenopylate, and agriculturally acceptable salt thereof.
12. The composition of claim 8, wherein the plant or algae further comprise a second herbicide-tolerant polypeptide or a gene encoding thereof, and tolerance to the second herbicide is conferred or enhanced.
13. The composition of claim 12, wherein the second herbicide is selected from the group consisting of glyphosate, glufosinate, dicamba, 2,4-D(2,4-Dichlorophenoxyacetic acid), isoxaflutole, ALS (acetolactate synthase)-inhibiting herbicide, photosystem II-inhibiting herbicide, phenylurea-based herbicide, bromoxynil-based herbicide, and combinations thereof.
14. The composition of claim 12, wherein the second herbicide-tolerant polypeptide is one or more selected from the group consisting of: glyphosate herbicide-tolerant EPSPS (glyphosate resistant 5-enolpyruvylshikimate-3-phosphate synthase), GOX (glyphosate oxidase), GAT (glyphosate-N-acetyltransferase) or glyphosate decarboxylase; glufosinate herbicide-tolerant PAT (phosphinothricin-N-acetyltransferase); dicamba herbicide-tolerant DMO (dicamba monooxygenase); 2,4-D (2,4-dichlorophenoxyacetic acid) herbicide-tolerant 2,4-D monooxygenase or AAD (aryloxyalkanoate dioxygenase); ALS (acetolactate synthase)-inhibiting sulfonylurea-based herbicide-tolerant ALS (acetolactate synthase), AHAS (acetohydroxyacid synthase) or AtAHASL (acetohydroxyacid synthase large subunit); photosystem II-inhibiting herbicide-tolerant photosystem II protein D1; phenylurea herbicide-tolerant Cytochrome P450; plastid-inhibiting herbicide-tolerant HPPD (hydorxylphenylpyruvate dioxygenase); bromoxynil herbicide-tolerant nitrilase; and combinations thereof.
15. The composition of claim 12, wherein the gene encoding the second herbicide-tolerant polypeptide is one or more selected from the group consisting of: glyphosate herbicide-tolerant cp4 epsps, mepsps, 2mepsps, goxv247, gat4601 or gat4621 gene; glufosinate herbicide-tolerant BAR or PAT gene; dicamba herbicide-tolerant dmo gene; 2,4-D(2,4-dichlorophenoxyacetic acid) herbicide-tolerant AAD-1 or AAD-12 gene; isoxaflutole herbicide-tolerant HPPDPF W336 gene; sulfonylurea herbicide-tolerant ALS, Csrl, Csrl-1, Csrl-2, GM-HRA, S4-HRA, Zm-HRA, SurA or SurB gene; photosystem II-inhibiting herbicide-tolerant psbA gene; phenylurea herbicide-tolerant CYP76B1 gene; bromoxynil herbicide-tolerant bxn gene; and combinations thereof.
16. A transformant of a plant or algae having herbicide tolerance, or a clone or progeny thereof, comprising the polypeptide of claim 1 or a polynucleotide encoding thereof.
17. The transformant, clone, or progeny thereof of claim 16, wherein the transformant is a plant cell, protoplast, callus, hypocotyl, seed, cotyledon, shoot, or whole plant.
18. A method of preparing a transgenic plant or algae having herbicide tolerance, the method comprising transforming algae, a plant cell, protoplast, callus, hypocotyl, seed, cotyledon, shoot, or whole plant with the polypeptide of claim 1 or a polynucleotide encoding thereof.
19. A method of conferring or enhancing herbicide tolerance of a plant or algae, the method comprising transforming algae, a plant cell, protoplast, callus, hypocotyl, seed, cotyledon, shoot, or whole plant with the polypeptide of claim 1 or a polynucleotide encoding thereof.
20. A method of controlling weeds in a cropland, the method comprising: providing the cropland with a plant comprising the polypeptide of claim 1 or a polynucleotide encoding thereof, and applying an effective dosage of protoporphyrinogen oxidase-inhibiting herbicide to the cropland.
21. The method of claim 20, wherein the step of applying an effective dosage of protoporphyrinogen oxidase-inhibiting herbicide to the cropland is performed by applying an effective dosage of two or more kinds of protoporphyrinogen oxidase-inhibiting herbicides sequentially or simultaneously.
22. The method of claim 20, wherein the plant further comprises a second herbicide-tolerant polypeptide or a gene encoding thereof, and the step of applying an effective dosage of protoporphyrinogen oxidase-inhibiting herbicide to the cropland is performed by applying an effective dosage of the protoporphyrinogen oxidase-inhibiting herbicide and a second herbicide are applied sequentially or simultaneously.
23. A method of removing an undesired aquatic organism from a culture media, the method comprising: providing a culture media with algae comprising the polypeptide of claim 1 or a polynucleotide encoding thereof, and applying an effective dosage of protoporphyrinogen oxidase-inhibiting herbicide to the culture media.
Description
DESCRIPTION OF DRAWINGS
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177]
[0178]
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
[0220]
[0221]
[0222]
MODE FOR INVENTION
[0223] Hereinafter, the present invention will be described in detail with reference to Examples. However, these Examples are for illustrative purposes only, and the invention is not intended to be limited by these Examples.
Example 1. Isolation of PPO Gene from Prokaryote
[0224] Oscillatoria nigro-viridis PCC 7112, Lyngbya sp. PCC 8106 strain, and Halothece sp. PCC 7418 strain were provided by the Institut Pasteur (France), and PPO genes were isolated from each strain. Each PPO gene was synthesized using codon-optimized sequence information for efficient herbicide resistance screening in BT3 E. coli. The synthesized PPO genes were amplified using the primers of Table 1.
[0225] One microliter (1 l) of each template (genomic DNA of each strain), 5 l of 10 buffer, 1 l of dNTP mixture (each 10 mM), 1 l of a forward primer (refer to Table 1; 10 M), 1 l of a reverse primer (refer to Table 1; 10 M), 40 l of DDW, and 1 l of Pfu-X (Solgent, 2.5 unit/l) were mixed to prepare 50 l of PCR reaction mixture, and amplification was performed under conditions of at 94 C. for 4 minutes, and 25 cycles (at 94 C. for 30 seconds, at 56 C. for 30 seconds and at 72 C. for 1.5 minutes), at 72 C. for 5 minutes.
[0226] PPO isolated from Oscillatoria nigro-viridis PCC 7112 was designated as CyPPO2, PPO isolated from Lyngbya sp. PCC 8106 strain was designated as CyPPO4, and PPO isolated from Halothece sp. PCC 7418 strain was designated as CyPPO8.
[0227] Further, respective nucleotide sequences of CyPPO2, CyPPO4, and CyPPO8 and amino acid sequences encoded by the corresponding sequences were examined, and represented by SEQ ID NOS: 1 to 6.
TABLE-US-00002 TABLE1 Strain Primer Sequence SEQIDNO: Oscillatoria CyPPO2_F CCCCGGATCCATGGAACTTCTTGATACTCT 12 nigro-viridis CyPPO2_R CCCCCTCGAGGATTGACCTGGTATCACTCT 13 PCC7112 Lyngbyasp. CyPPO4_F CCCCGGATCCATGACCCATGTTTTGGATTC 14 PCC8106 CyPPO4_R CCCCCTCGAGCTGTCCTAAAAATGATAAAATCTCG 15 Halothecesp. CyPPO8_F CCCCGGATCCATGATAGATACTCTTATAGTGGG 16 PCC7418 CyPPO8_R CCCCCTCGAGTCCTAAGTAATCTAAAACTG 17
[0228] The herbicide tolerance of CyPPO2, CyPPO4, and CyPPO8 prepared above was tested using PPO-deficient E. coli (BT3 (PPO)). BT3 (PPO) strain was provided by Hokkaido University (Japan) and it is an E. coli strain which is deficient in hemG-type PPO and has Kanamycin tolerance (refer to Watanabe et al., Dual targeting of spinach protoporphyrinogen oxidase II to mitochondria and chloroplasts by alternative use of two in-frame inhibition codons, JBC 2001 276(23):20474-20481; Che et al., Molecular Characterization and Subcellular Localization of Protoporphyrinogen Oxidase in Spinach Chloroplasts, Plant Physiol. 2000 September; 124(1):59-70).
[0229] BT3 (PPO) was transformed with each CyPPO gene, and cultured on the LB (Luria-Bertani) agar media containing PPO-inhibiting herbicide, thereby examining whether the growth of the transformed E. coli was inhibited.
[0230] The Specific Test Process was as Follows:
[0231] CyPPO2, CyPPO4, and CyPPO8 genes prepared above are cloned in pACBB vector (Plasmid #32551; Addgene; refer to
[0232] Single colony of E. coli transformed with each CyPPO gene was cultured in 3 ml of LB broth containing chloramphenicol for overnight (220 rpm, 37 C.), and then the each culture was re-cultured with fresh media until absorbance (OD.sub.600) became 0.5 to 1. It was diluted with LB broth to absorbance (OD.sub.600) of 0.5. Again, the diluted solution was serially diluted 5 times by a factor of one tenth. Next, 10 l of each diluted solution was dropped on the LB agar media containing chloramphenicol (34 g/ml) and 0-400 M concentration of tiafenacil. The LB agar media were cultured at 37 C. under light condition, and level of growth inhibition was evaluated after 16 to 20 hours.
[0233] For comparison, the same test was conducted using BT3 E. coli transformant transformed with pACBB-eGFP vector (Plasmid #32551; Addgene; refer to
[0234] As shown in
Example 2. Determination of PPO Amino Acid Residues Interacting with PPO-Inhibiting Herbicides from PPO and PPO-Inhibiting Herbicide Complex
[0235] In order to confirm the binding structure information of PPO protein and herbicide, tiafenacil was used as a representative example of PPO-inhibiting herbicides.
[0236] In order to obtain a water-soluble CyPPO2 protein, 7 hydrophobic amino acid residues which were positioned in the thylakoid membrane binding domain in the amino acid of CyPPO2 (SEQ ID NO: 1) were substituted with hydrophilic residues. The gene encoding the amino acid residues-substituted variant protein of CyPPO2 was cloned to pET29b vector (Catalog Number: 69872-3; EMD Biosciences; refer to
[0237] And also, using the information derived from the structure of CyPPO2-tiafenacil complex, amino acid residues which interact with tiafenacil in CyPPO4 (SEQ ID NO: 3) and CyPPO8 (SEQ ID NO: 5) proteins (NCBI BLAST, http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch &LINK_LOC=blasthome) were determined by sequence homology analysis as below.
[0238] The amino acids of CyPPO4 protein (SEQ ID NO: 3) interacting with tiafenacil are N63, S64, S66, P67, P92, R93, F170, S172, G173, V174, Y175, A176, R190, E230, L231, P318, V320, F339, G340, N341, L342, L352, G353, T354, I355, Y375, 1424, V458, and R465. The amino acids of CyPPO8 protein (SEQ ID NO: 5) interacting with tiafenacil are P84, R85, F156, V160, A162, Q179, P306, V308, F327, L330, I343, N362, and F363.
Example 3. Verification of PPO-Inhibiting Herbicide Tolerance by PPO Variants (Test in E. coli)
[0239] In order to enhance PPO-inhibiting herbicide tolerance of CyPPO2, CyPPO4 and CyPPO8, a mutation(s) at the position interacting with herbicide obtained in the Example 2 was introduced, respectively. BT3 (PPO) was transformed with the mutated CyPPO gene, and cultured under the condition treated with PPO-inhibiting herbicide, thereby examining whether growth of transformed BT3 was inhibited. The wild type of each gene was used as a control.
[0240] The method of the experiment was as follows:
[0241] CyPPO2 and CyPPO4 cloned in pACBB vector (Plasmid #32551; Addgene; refer to
[0242] Fifty microliters of PCR reaction mixture was prepared by mixing 1 l of template, 5 l of 10 buffer, 1 l of dNTP mixture (each 10 mM), 1 l of a forward primer (10 M), 1 l of a reverse primer (10 M), 40 l of DDW, and 1 l of Pfu-X (Solgent, 2.5 unit/l), and amplification was performed under conditions of at 94 C. for 4 minutes, and 17-25 cycles (at 94 C. for 30 seconds, at 56-65 C. for 30 seconds and at 72 C. for 3 minutes), at 72 C. for 5 minutes. 0.5 l of DpnI (New England Biolabs) was treated to each 5 l of PCR product, and incubated at 37 C. for 30 minutes. Reaction solution was transformed with E. coli by heat shock method. Each transformant was cultured in LB agar media containing chloramphenicol or ampicillin. Each mutation was confirmed by plasmid DNA sequencing, and each plasmid was transformed to BT3 (PPO).
TABLE-US-00003 TABLE2 PrimerforCyPPO2mutation CyPPO2 No. mutation Primer(Forward:top;Reverse:bottom)(5->3) 1 Y373M GACCTCTATGATTGGTGGAGCTACTGATAG(SEQIDNO:18) ACCAATCATAGAGGTCAATGTTTGCCATCC(SEQIDNO:19) 2 Y373V GACCTCTGTGATTGGTGGAGCTACTGATAG(SEQIDNO:20) ACCAATCACAGAGGTCAATGTTTGCCATCC(SEQIDNO:21) 3 Y373I GACCTCTATCATTGGTGGAGCTACTGATAG(SEQIDNO:22) ACCAATGATAGAGGTCAATGTTTGCCATCC(SEQIDNO:23) 4 Y373T GACCTCTACAATTGGTGGAGCTACTGATAG(SEQIDNO:24) ACCAATTGTAGAGGTCAATGTTTGCCATCC(SEQIDNO:25) 5 Y373L GACCTCTTTGATTGGTGGAGCTACTGATAG(SEQIDNO:26) ACCAATCAAAGAGGTCAATGTTTGCCATCC(SEQIDNO:27) 6 Y373C GACCTCTTGTATTGGTGGAGCTACTGATAG(SEQIDNO:28) ACCAATACAAGAGGTCAATGTTTGCCATCC(SEQIDNO:29) 7 A175C GGTGTGTACTGTGGAGATCCTCAACAGCTC(SEQIDNO:30) AGGATCTCCACAGTACACACCAGAAACAAA(SEQIDNO:31) 8 A175L GGTGTGTACTTGGGAGATCCTCAACAGCTC(SEQIDNO:32) AGGATCTCCCAAGTACACACCAGAAACAAA(SEQIDNO:33) 9 V318M TATCCAACAATGGCTTCAGTTGTGTTGGCA(SEQIDNO:34) AACTGAAGCCATTGTTGGATAAGTGAATGC(SEQIDNO:35) 10 G351A CGCTGTCTCGCTACGATTTGGACATCGAGT(SEQIDNO:36) CCAAATCGTAGCGAGACAGCGAATTCCCTG(SEQIDNO:37) 11 S63T GCCCGAACACTTTTTCGCCGACGCCGGAATTG(SEQIDNO:38) GGCGAAAAAGTGTTCGGGCCCTCCTCCCAG(SEQIDNO:39) 12 R92A CAAATTGCCTGCTTTTGTGTATTGGGAAAATAAG(SEQIDNO:40) ATACACAAAAGCAGGCAATTTGCGATCGGC(SEQIDNO:41) 13 V173S GTTTCTGGGAGTTATGCCGGCGATCCGCAAC(SEQIDNO:42) CCGGCATAACTCCCAGAAACAAAAGGTTCC(SEQIDNO:43) 14 V173C GTTTCTGGGTGTTATGCCGGCGATCCGCAAC(SEQIDNO:44) CCGGCATAACACCCAGAAACAAAAGGTTCCAC(SEQIDNO:45) 15 V173T GTTTCTGGGACTTATGCCGGCGATCCGCAAC(SEQIDNO:46) CCGGCATAAGTCCCAGAAACAAAAGGTTCCAC(SEQIDNO:47) 16 L229F ACTAAGCCGGGGGAGTTCGGTTCGTTCAAGCAG(SEQIDNO:48) CTGCTTGAACGAACCGAACTCCCCCGGCTTAGT(SEQIDNO:49) 17 L340I TTTTGGAAATATAATTCCGAGGGGGCAGGG(SEQIDNO:50) CTCGGAATTATATTTCCAAAACCCACTAATTTAC(SEQIDNO:51) 18 I353T TCGGGACGACTTGGACATCGAGTTTATTTCC(SEQIDNO:52) GATGTCCAAGTCGTCCCGAGACAGCGAATTC(SEQIDNO:53) 19 I353L CTCGGGACGCTTTGGACATCGAGTTTATTT(SEQIDNO:54) ATGTCCAAAGCGTCCCGAGACAGCGAATTC(SEQIDNO:55) 20 I353V ACTAAGCCGGGGGAGTTCGGTTCGTTCAAGCAG(SEQIDNO:56) CTGCTTGAACGAACCGAACTCCCCCGGCTTAGT(SEQIDNO:57) 21 I353C TCGGGACGTGTTGGACATCGAGTTTATTTCC(SEQIDNO:58) GATGTCCAACACGTCCCGAGACAGCGAATTC(SEQIDNO:59) 22 V318T TATCCTACGACTGCCTCCGTTGTCTTAGCA(SEQIDNO:60) AACGGAGGCAGTCGTAGGATAAGTAAAAGC(SEQIDNO:61) 23 E228A AAAACTAAGCCGGGGGCGTTGGGTTCGTTCAAG(SEQIDNO:62) CTTGAACGAACCCAACGCCCCCGGCTTAGTTTT(SEQIDNO:63) 24 P91L AAACTTCTTAGATTCGTGTATTGGGAAAAC(SEQIDNO:64) ACGAATCTAAGAAGTTTTCTATCTGCGAAT(SEQIDNO:65) 25 P316A+ V318L GCTTTTACTTATGCTACGCTTGCCTCCGTT(SEQIDNO:66) GACAACGGAGGCAAGCGTAGCATAAGTAAA(SEQIDNO:67) 26 P316L+ V318L GCTTTTACTTATCTTACGCTTGCCTCCGTT(SEQIDNO:68) GACAACGGAGGCAAGCGTAAGATAAGTAAA(SEQIDNO:69) 27 F337V TTAGTGGGTGTTGGAAATTTAATTCCGAGGGG(SEQIDNO:70) TAAATTTCCAACACCCACTAATTTACCCTTGAC(SEQIDNO:71) 28 T352V TGTCTCGGGGTGATTTGGACATCGAGTTTATTT(SEQIDNO:72) GTCCAAATCACCCCGAGACAGCGAATTCCCTG(SEQIDNO:73) 29 V173L GTTTCTGGGCTTTATGCCGGCGATCCGCAAC(SEQIDNO:74) CGGCATAAAGCCCAGAAACAAAAGGTTCCAC(SEQIDNO:75) 30 A1751 GTTTCTGGGGTTTATATTGGCGATCCGCAA(SEQIDNO:76) TTGTTGCGGATCGCCAATATAAACCCCAGA(SEQIDNO:77) 31 L340V TTTTGGAAATGTTATTCCAAGAGGTCAAGGAATC(SEQIDNO:78) CTTGGAATAACATTTCCAAAACCCACGAGTTT(SEQIDNO:79) 32 L340T TTTTGGAAATACTATTCCAAGAGGTCAAGG(SEQIDNO:80) CTTGGAATAGTATTTCCAAAACCCACGAGTTTTC(SEQIDNO:81) 33 F169A CCAGAAACAGCAGGTTCCACCAACCGCTGCATC(SEQIDNO:82) GTGGAACCTGCTGTTTCTGGGGTTTATGCCG(SEQIDNO:83)
TABLE-US-00004 TABLE3 PrimerforCyPPO4mutation CyPPO4 No. mutation Primer(Forward:top;Reverse:bottom)(5>3) 1 Y375M CTTACATCTATGATTGGTGGAGCTACCGAT(SEQIDNO:84) CCACCAATCATAGATGTAAGAACCTGCCAT(SEQIDNO:85) 2 Y375V CTTACATCTGTTATTGGTGGAGCTACCGAT(SEQIDNO:86) CCACCAATAACAGATGTAAGAACCTGCCAT(SEQIDNO:87) 3 Y3751 CTTACATCTATCATTGGTGGAGCTACCGAT(SEQIDNO:88) CCACCAATGATAGATGTAAGAACCTGCCAT(SEQIDNO:89) 4 Y375T CTTACATCTACCATTGGTGGAGCTACCGAT(SEQIDNO:90) CCACCAATGGTAGATGTAAGAACCTGCCAT(SEQIDNO:91) 5 Y375C CTTACATCTTGTATTGGTGGAGCTACCGAT(SEQIDNO:92) CCACCAATACAAGATGTAAGAACCTGCCAT(SEQIDNO:93) 6 A176C GGTGTGTATTGTGGAGATCCACAACAGCTT(SEQIDNO:94) TGGATCTCCACAATACACACCAGAAACAAA(SEQIDNO:95) 7 A176L GGTGTGTATTTGGGAGATCCACAACAGCTT(SEQIDNO:96) TGGATCTCCCAAATACACACCAGAAACAAA(SEQIDNO:97) 8 P318L+ V320L ATTCCTTATTTGCCATTGGCTTGTGTTGTGCTC(SEQIDNO:98) AACACAAGCCAATGGCAAATAAGGAATTTCTGTA(SEQIDNO:99) 9 V320M TATCCTCCAATGGCTTGTGTTGTGCTCGCA(SEQIDNO:100) AACACAAGCCATTGGAGGATAAGGAATTTC(SEQIDNO:101) 10 P318A+ V320L ATTCCTTATGCTCCATTGGCTTGTGTTGTGCTC(SEQIDNO:102) AACACAAGCCAATGGAGCATAAGGAATTTCTGTA(SEQIDNO:103)
TABLE-US-00005 TABLE4 PrimerforCyPPO8mutation CyPPO8 No. mutation Primer(Forward:top;Reverse:bottom) 1 F363M TTGACAAATATGATTGGTGGAGCTACCGAT(SEQIDNO:104) CACCAATCATATTTGTCAAAAGGTGCCATC(SEQIDNO:105) 2 F363V CTTTTGACAAATGTTATTGGTGGAGCTACC(SEQIDNO:106) AGCTCCACCAATAACATTTGTCAAAAGGTG(SEQIDNO:107) 3 F363L CTTTTGACAAATCTTATTGGTGGAGCTACC(SEQIDNO:108) AGCTCCACCAATAAGATTTGTCAAAAGGTG(SEQIDNO:109) 4 F363C CTTTTGACAAATTGTATTGGTGGAGCTACC(SEQIDNO:110) AGCTCCACCAATACAATTTGTCAAAAGGTG(SEQIDNO:111) 5 A162C TCTGGTGTGTATTGTGGAGATGTTGATCAA(SEQIDNO:112) ATCAACATCTCCACAATACACACCAGAAAC(SEQIDNO:113) 6 A162L TCTGGTGTGTATCTTGGAGATGTTGATCAA(SEQIDNO:114) ATCAACATCTCCAAGATACACACCAGAAAC(SEQIDNO:115) 7 P306L+ V308L ATCTCATATCTTCCACTTGCTTGCGTTGTG(SEQIDNO:116) AACGCAAGCAAGTGGAAGATATGAGATTTC(SEQIDNO:117) 8 V308M TCATATCCTCCAATGGCTTGCGTTGTGCTC(SEQIDNO:118) CACAACGCAAGCCATTGGAGGATATGAGAT(SEQIDNO:119) 9 P306A+ V308L ATTTCCTATGCCCCCCTAGCTTGTGTGGTCTTAGCC(SEQIDNO:120) CACACAAGCTAGGGGGGCATAGGAAATTTCGTTTAAGG(SEQIDNO:121) 10 V1605 GTGTCTGGGTCTTATGCAGGGGATGTGGATC(SEQIDNO:122) CCTGCATAAGACCCAGACACAAACGGACTCAC(SEQIDNO:123) 11 I343T TTGGTACAACTTGGAGTTCAACACTCTTTCC(SEQIDNO:124) GAACTCCAAGTTGTACCAAGAGTGCGGATTC(SEQIDNO:125) 12 F363I CTTTTGACAAATATTATTGGTGGAGCTACC(SEQIDNO:126) AGCTCCACCAATAATATTTGTCAAAAGGTG(SEQIDNO:127) 13 F363T CTTTTGACAAATACTATTGGTGGAGCTACC(SEQIDNO:128) AGCTCCACCAATAGTATTTGTCAAAAGGTG(SEQIDNO:129) 14 R85A GGACTTCCCGCTTATGTTTATTGGGAGGGG(SEQIDNO:130) CAATAAACATAAGCGGGAAGTCCGCGATCAGC(SEQIDNO:131) 15 I343V CTTGGTACAGTTTGGAGTTCAACACTCTTTC(SEQIDNO:132) AACTCCAAACTGTACCAAGAGTGCGGATTC(SEQIDNO:133) 16 P84L AGGTTTACTTAGGTATGTTTACTGGGAGGG(SEQIDNO:134) CATACCTAAGTAAACCTCTATCTGCAAAGA(SEQIDNO:135) 17 R85C GACTTCCCTGTTATGTTTATTGGGAGGGGAAAC(SEQIDNO:136) TAAACATAACAGGGAAGTCCGCGATCAGCAAAG(SEQIDNO:137) 18 R85H ACTTCCCCATTATGTTTATTGGGAGGGGAAAC(SEQIDNO:138) CAATAAACATAATGGGGAAGTCCGCGATCAGC(SEQIDNO:139) 19 R85L ACTTCCCCTTTATGTTTATTGGGAGGGGAAAC(SEQIDNO:140) CAATAAACATAAAGGGGAAGTCCGCGATCAGC(SEQIDNO:141) 20 R85T GACTTCCCACTTATGTTTATTGGGAGGGGAAAC(SEQIDNO:142) ATAAACATAAGTGGGAAGTCCGCGATCAGCAAAG(SEQIDNO:143) 21 R85V GACTTCCCGTTTATGTTTATTGGGAGGGGAAAC(SEQIDNO:144) ATAAACATAAACGGGAAGTCCGCGATCAGCAAAG(SEQIDNO:145) 22 F156A GTGAGTCCGGCTGTGTCTGGGGTTTATGCA(SEQIDNO:146) CCCAGACACAGCCGGACTCACTAACCGTTG(SEQIDNO:147) 23 V160C CCGTTTGTGTCTGGGTGCTATGCAGGGGATGTG(SEQIDNO:148) CACATCCCCTGCATAGCACCCAGACACAAACGG(SEQIDNO:149) 24 Q179G TCCGCCAGTCCGGTAACTCGTCCAAATGCAG(SEQIDNO:150) CGAGTTACCGGACTGGCGGATGTGGGCGGTG(SEQIDNO:151) 25 F327V GTTTTCCCCTCAAAGGAGTGGGTAATCTTAACCCTC(SEQIDNO:152) GAGGGTTAAGATTACCCACTCCTTTGAGGGGAAAAC(SEQIDNO:153) 26 L330T TTTGGTAATACTAACCCTCGCAGTCAAGGA(SEQIDNO:154) GCGAGGGTTAGTATTACCAAATCCTTTGAG(SEQIDNO:155) 27 F363M+ N3625 CTTTTGACATCAATGATTGGTGGAGCTACC(SEQIDNO:156) CCAATCATTGATGTCAAAAGGTGCCATCCT(SEQIDNO:157)
[0243] Single colony of E. coli transformed with each CyPPO gene was cultured in 3 ml of LB broth containing chloramphenicol for overnight (220 rpm, 37 C.), and then the each culture was re-cultured with fresh media until absorbance (OD.sub.600) became 0.5 to 1. It was diluted with LB broth to absorbance (OD.sub.600) of 0.5. Again, the diluted solution was serially diluted 5 times by a factor of one tenth. Next, 10 l of each diluted solution was dropped on the LB agar media containing chloramphenicol (34 g/ml) and 0-400 M concentration of tiafenacil. The LB agar media were cultured at 37 C. under light condition, and level of growth inhibition was evaluated after 16 to 20 hours.
[0244] Herbicides used in the test were listed in Table 5:
TABLE-US-00006 TABLE 5 Family Herbicide Pyrimidinedione-based herbicide Tiafenacil Saflufenacil Diphenyl ether-based herbicide Fomesafen Acifluorfen N-phenylphthalimides-based herbicide Flumioxazin Triazolinones-based herbicide Sulfentrazone Oxazolidinediones-based herbicide Pentoxazone Phenylpyrazoles-based herbicide Pyraflufen-ethyl Others Pyraclonil
[0245] The results were shown in Tables 6 to 8 and
TABLE-US-00007 TABLE 6 Herbicide tolerance level conferred by CyPPO2 mutation CyPPO2 Tiafenacil Saflufenacil Flumioxazin CyPPO2 (wild type) Y373M + G351A +++++ +++++ +++++ Y373C ++++ +++++ +++++ Y373I ++++ +++++ +++++ Y373L ++++ +++++ +++++ Y373M ++++ +++++ +++++ Y373T ++++ +++++ +++++ Y373V +++ +++++ +++++ A175C +++ ++++ +++++ A175L ++ +++++ ++++ V318M ++ ++++ +++++ P316A + V318L + NT NT P316L + V318L + NT NT F337V + Y373M ++ NT NT T352V + Y373M ++++ NT NT G351A + T352V + Y373M +++ NT NT P91L + Y373M ++ NT NT (NT: Not Tested)
TABLE-US-00008 TABLE 7 Herbicide tolerance level conferred by CyPPO4 mutation CyPPO4 Tiafenacil Saflufenacil Flumioxazin CyPPO4 Y375M +++++ +++++ +++++ Y375V +++++ +++++ +++++ Y375I +++++ +++++ +++++ Y375T +++++ +++ +++++ Y375C +++++ +++ NT A176C +++++ +++++ +++++ A176L +++++ ++++ +++++ P318L + V320L +++++ ++++ NT V320M +++++ ++++ NT P318A + V320L +++++ ++++ NT (NT: Not Tested)
TABLE-US-00009 TABLE 8 Herbicide tolerance level conferred by CyPPO8 mutation Pyraflufen- CyPPO8 Tiafenacil Saflufenacil Fomesafen Acifluorfen Flumioxazin Sulfentrazone Pentoxazone ethyl Pyraclonil CyPPO8 F363C ++++ ++++ ++++ +++++ +++ ++++ +++++ +++++ +++++ F363L +++ +++ + +++ ++ ++ +++++ ++++ ++++ F363M +++ +++ + +++ ++ ++ +++++ ++++ ++++ F363V +++ +++ ++ +++ ++ +++++ ++++ +++++ A162L ++ ++ +++ ++++ ++++ ++++ ++++ ++++ +++ V308M ++ ++ +++ +++++ +++ ++++ ++++ ++++ ++++ P306A + + + + ++++ NT ++ +++ +++ + V308L P306L + + + ++ +++++ NT ++++ +++ ++++ + V308L A162C NT NT NT ++ NT + +++ ++++ + P84L + +++ NT NT NT NT NT NT NT NT F363M N362S + +++ NT NT NT NT NT NT NT NT F363M (NT: Not Tested)
[0246] The Tables 6 to 8 show the results of evaluating the herbicide tolerance of wild type and PPO variants. The level of herbicide tolerance of the wild type was represented by , and the level of herbicide tolerance was graduated by representing the equal level of tolerance by , and if higher, adding + to the max +++++.
[0247]
[0248] As shown in Table 6 and
[0249] As shown in Table 7 and
[0250] As shown in Table 8 and
Example 4: Measurement of Enzyme Activity and IC.SUB.50 .Value by Herbicides of PPO Wild Type and Variants
[0251] The enzyme activity of variants wherein amino acids of certain position of PPO protein were mutated to increase herbicide tolerance was examined and inhibition assay for the PPO-inhibiting herbicides was conducted. It was confirmed that the PPO protein had low water-solubility, but when the PPO protein was fused with MBP (maltose binding protein) (MBP-PPO), it was water-soluble and stably expressed. Therefore, the wild type and variant proteins which were expressed in the form of fusion protein with MBP were used in the present experiments (refer to
[0252] In order to clone wild type genes and variant genes of CyPPO2, CyPP04, and CyPPO8 (refer to Example 1 and Example 2), those genes were introduced into pMAL-c2X vector (refer to
[0253] The transformed E. coli were cultured under the following conditions to express introduced PPO genes:
[0254] Induction: OD.sub.600=0.2, addition of IPTG to 0.3 mM final concentration;
[0255] Expression temperature: 23 C., 200 rpm shaking culture;
[0256] Expression time: 16 hrs;
[0257] Culture scale: 200 ml/1,000 ml flask.
[0258] Cell lysis and protein extraction were performed by the following process to the cultured cells:
[0259] Extraction buffer: Column buffer (50 mM Tris-C1, pH 8.0, 200 mM NaCl) 5 ml buffer/g cell;
[0260] Sonication: SONICS&MATERIALS VCX130 (130 watts);
[0261] 15 sec ON, 10 sec OFF for 5 min on ice;
[0262] Centrifugation under the condition of 4 C. for 20 minutes (20,000g); and the supernatant obtained by the centrifugation was diluted at the ratio of 1:6 using column buffer.
[0263] The following process for purification of PPO protein was performed in a 4 C. cold room. Amylose resin (New England Biolabs) was packed to 1.515 cm column (Bio-Rad Econo Columns 1.510 cm, glass chromatography column, max. vol), and the obtained protein extracts were loaded to the column at the a flow rate of 0.2 ml/min. The column was washed with 3 column volumes of buffer and the amount of protein in the washing solution was checked. When the protein was no longer detected, the washing was terminated. Then, the MBP-PPO protein was eluted with approximately 2 column volumes of buffer containing 20 mM maltose. The protein concentration of each eluent was determined and the elution was stopped when the protein was no longer detected. Ten microliter of each fraction was investigated for protein quantification and SDS-PAGE analysis. The highly pure fractions of PPO protein variants (for example, CyPPO2-Y373M, CyPPO4-Y375M, CyPPO8-F363M) were taken for the enzyme assay.
[0264] The SDS-PAGE analysis of each PPO was shown in
[0265] Referring to the result shown in
[0266] Referring to the result shown in
[0267] The enzyme activity of the purified wild type protein and variant proteins of CyPPO2, CyPPO4 and CyPPO8 was measured by the following process.
[0268] Overall process was performed in dark under nitrogen stream. Since protoporphyrinogen IX, a substrate of PPO protein was not commercially available, it was chemically synthesized in the laboratory. Six micrograms of protoporphyrin IX was dissolved in 20 ml of 20% (v/v) EtOH, and stirred under dark condition for 30 minutes. The obtained protoporphyrin IX solution was put into a 15 ml screw tube in an amount of 800 l, and flushed with nitrogen gas for 5 minutes. To this, 1 g of sodium amalgam was added and vigorously shaken for 2 minutes. The lid was opened to exhaust hydrogen gas in the tube. Thereafter, the lid was closed and incubated for 3 minutes. The protoporphyrinogen IX solution was filtered using syringe and cellulose membrane filter. To 600 l of the obtained protoporphyrinogen IX solution, approximately 300 l of 2M MOPS [3-(N-morpholino)propanesulfonic acid] was added to adjust pH to 8.0. To determine the enzyme activity of PPO protein, a reaction mixture was prepared with the following composition (based on 10 ml): 50 mM Tris-C1 (pH 8.0); 50 mM NaCl; 0.04% (v/v) Tween 20; 40 mM glucose (0.072 g); 5 units glucose oxidase (16.6 mg); and 10 units catalase (1 l).
[0269] Two hundred microliters of a reaction mixture containing a purified PPO protein was placed in 96 well plates and preincubated for 30 min at room temperature to reduce the oxygen concentration by the coupled reaction of glucose oxidase-catalase. The mineral oil was layered and then the reaction was initiated by adding the substrate, protoporphyrinogen IX solution to a final concentration of 50 M. The reaction proceeded at room temperature for 30 min and the fluorescence of protoporphyrin IX was measured using Microplate reader (Sense, Hidex) (excitation: 405 nm; emission: 633 nm). To calculate the PPO enzyme activity, the protoporphyrinogen IX solution was kept open in the air to oxidize the solution (overnight). To this, 2.7 N HCl was added, and the absorbance at 408 nm was measured. A standard curve was generated using standard protoporphyrin IX, and PPO activity was measured by calibration of protoporphyrin IX using the standard curve of protoporphyrin IX.
[0270] The enzyme activity of the obtained PPO wild type and variants was shown in Tables 10 and 11.
[0271] Michaelis-Menten constant (Km) and the maximal velocity (Vmax) values of each enzyme were calculated in order to evaluate the kinetic study of CyPPO2 and CyPPO8. The initial reaction velocity was measured where the reaction velocity was proportional to concentration by varying the substrate concentration. The amount of produced protoporphyrin IX which is an enzyme reaction product was measured by time course at room temperature for 20 minutes. Km and Vmax values were calculated with the enzyme kinetics analysis program by Michaelis-Menten equation. The wild type AtPPO1 was used as a control. The result was shown in Table 9:
TABLE-US-00010 TABLE 9 Determination of Km and Vmax of CyPPO2 and CyPPO8 CyPPO2 CyPPO8 AtPPO1 Km (M) 9.1 0.5 7.7 0.2 9.6 1.8 Vmax 285 15 305 10 135 19 (M mg protein1 min1)
[0272] From the results, Km values of CyPPO2 and CyPPO8 were lower than that of AtPPO1, confirming that the affinity between enzyme and substrate was better, while Vmax values of CyPPO2 and CyPPO8 were more than two times higher than that of AtPPO1. In conclusion, PPO proteins of CyPPO2 and CyPPO8 show better ability as PPO enzyme than the plant-derived AtPPO1.
[0273] In addition, the concentration of the PPO-inhibiting herbicides that inhibits the PPO enzyme activity of each PPO wild type and variants by 50% (IC.sub.50) was measured for each herbicide. The final concentrations of each herbicide were as follows: [0274] Tiafenacil, saflufenacil, fomesafen, butafenacil, flumioxazin and sulfentrazone: 0, 10, 50, 100, 250, 500, 1,000, 2,500, 5,000 nM
[0275] The IC.sub.50 value was calculated as the concentration of the herbicide inhibiting the PPO enzyme activity to 50% before adding the herbicide at the above concentration.
[0276] The IC.sub.50 values of different herbicides were shown in the following Tables 10 and 11.
TABLE-US-00011 TABLE 10 Mutation Activity IC.sub.50 (nM) No. site (%) Tiafenacil Saflufenacil Fomesafen Butafenacil Flumioxazin Sulfentrazone CyPPO2 WT 100 25 50 182 13 122 NT 1 Y373M 90 250 5,000 395 63 136 NT 2 Y373I 75 639 5,000 70 1516 464 NT 3 Y373L 44 300 NT NT NT NT NT 4 Y373V 35 525 NT NT NT NT NT 5 Y373C 39 225 NT NT NT NT NT 6 Y373T 10 2500 NT NT NT NT NT 7 A175L 41 230 NT NT NT NT NT 8 S63T + 90 246 NT NT NT NT NT Y373M 9 R92A + 50 219 NT NT NT 310 NT Y373M 10 V173S + 80 430 NT NT NT NT NT Y373M 11 V173S + 25 610 NT NT NT NT NT Y373I 12 V173S + 40 530 NT NT NT NT NT Y373L 13 V173S + 10 1,000 NT NT NT NT NT Y373V 14 V173C + 53 680 NT NT NT NT NT Y373M 15 V173C + 28 915 NT NT NT NT NT Y373I 16 V173T + 15 543 NT NT NT NT NT Y373M 17 V173T + 25 1,500 NT NT NT NT NT Y373I 18 V173L + 83 290 NT NT NT NT NT Y373M 19 A175L + 62 4,500 5,000 1,720 4,000 5,000 5,000 Y373M 20 A175L + 15 2,000 5,000 NT NT NT NT Y373I 21 A175C + 83 3,700 5,000 770 2,500 372 5,000 Y373M 22 A175C + 31 2,000 NT NT NT NT NT Y373I 23 A175I + 52 2,500 NT NT NT NT NT Y373M 24 E228A + 85 214 NT NT NT NT NT Y373M 25 L229F + 10 1,800 NT NT NT NT NT Y373T 26 V318M + 73 456 5,000 523 708 210 3776 Y373M 27 V318M + 50 2,765 5,000 145 1,232 1,021 5,000 Y373I 28 V318M + 42 2,140 5,000 NT NT NT NT Y373V 29 V318T + 25 1,500 NT NT NT NT NT Y373I 30 L340I + 80 259 NT NT NT NT NT Y373M 31 L340I + 85 584 NT NT NT NT NT Y373I 32 L340V + 80 257 NT NT NT NT NT Y373M 33 G351A + 23 706 5,000 300 36 NT NT Y373M 34 I353T + 32 1,152 NT NT NT NT NT Y373M 35 I353T + 20 1,300 NT NT NT NT NT Y373I 36 I353T + 10 3,000 NT NT NT NT NT Y373L 37 I353L + 80 271 NT NT NT NT NT Y373M 38 I353V + 63 445 NT NT NT NT NT Y373M 39 I353C + 12 550 NT NT NT NT NT Y373M 40 S63T + 60 430 NT NT NT NT NT V173S + Y373M 41 S63T + 60 427 NT NT NT NT NT V173S + Y373I 42 S63T + 15 278 NT NT NT NT NT I353T + Y373M 43 S63T + 5 1200 NT NT NT NT NT I353T + Y373I 44 V173S + 5 3,000 NT NT NT NT NT V318M + Y373M 45 V173T + 50 518 NT NT NT NT NT L340I + Y373M 46 V173S + 38 5,000 5,000 758 2,591 5,000 5,000 A175C + Y373M 47 A175C + 47 3,793 5,000 2,033 1,475 419 5,000 V318M + Y373M 48 A175L + 40 3,100 NT NT NT NT NT V318M + Y373M 49 A175C + 5 1,900 NT NT NT NT NT I353L + Y373M 50 A175C + 69 2,310 NT NT NT NT NT I353V + Y373M 51 R92A 66 125 NT NT NT NT NT 52 F169A 72 57 NT NT NT NT NT 53 V173C 68 79 NT NT NT NT NT 54 A175C 86 100 NT NT NT NT NT 55 A175L 68 325 NT NT NT NT NT 56 V318M 76 140 NT NT NT NT NT 57 F337V 20 148 NT NT NT NT NT 58 L340T 18 56 NT NT NT NT NT 59 I353T 40 162 NT NT NT NT NT CyPPO4 WT 100 22 33 28 10 NT NT 1 Y375M 95 124 5,000 133 39 NT NT (NT: not tested)
TABLE-US-00012 TABLE 11 CyPPO8 Mutation Activity IC.sub.50 (nM) No. site (%) Tiafenacil Saflufenacil Fomesafen Butafenacil Flumioxazin Sulfentrazone WT 100 4 11 13 2.8 NT NT 1 F363M 100 183 5,000 163 30 266 NT 2 F363C 17 36 500 38 53 NT NT 3 F363V 15 2,000 5,000 1,500 250 2,500 NT 4 F363L 54 322 NT NT NT NT NT 5 F363I 62 698 5,000 133 NT 1100 NT 6 F363T 5 3,000 5,000 1,500 NT 2,500 NT 7 R85A + 62 700 NT NT NT NT NT F363M 8 R85A + 40 2,350 NT NT NT NT NT F363I 9 A162L + 17 5,000 NT NT NT 5,000 NT F363M 10 A162C + 87 2,500 5,000 NT NT 1,166 NT F363M 11 V160S + 58 500 NT NT NT NT NT F363M 12 V160S + 26 2,280 NT NT NT NT NT F363I 13 V308M + 81 1,017 5,000 NT NT 210 NT F363M 14 V308M + 29 1,810 NT NT NT NT NT F363I 15 I343T + 10 2,100 NT NT NT NT NT F363M 16 I343V + 44 288 NT NT NT NT NT F363M 17 R85A + 39 2,347 5,000 NT NT NT NT V308M + F363M 18 V160S + 5 4,000 NT NT NT NT NT V308M + F363I 19 A162C + 29 2,450 NT NT NT NT NT F363I 20 A162C + 6 5,000 NT NT NT NT NT F363L 21 R85A + 11 5,000 NT NT NT NT NT A162L + F363M 22 R85A + 15 1,061 NT NT NT NT NT A162L + F363I 23 R85A + 19 5,000 5,000 5,000 4,310 2,700 5,000 A162C + F363M 24 R85A + 16 5,000 NT NT NT NT NT A162C + F363I 25 A162C + 45 3,580 5,000 420 2500 697 5,000 V308M + F363M 26 A162C + 53 2,041 NT NT NT NT NT V308L + F363M 27 R85C + 28 2,500 NT NT NT NT NT F363M 28 R85H + 30 622 NT NT NT NT NT F363M 29 R85L + 19 892 NT NT NT NT NT F363M 30 R85T + 24 1,356 NT NT NT NT NT F363M 31 R85V + 18 875 NT NT NT NT NT F363M 32 A162L + 39 5,000 5,000 630 4,000 5,000 5,000 Q179G + F363M 33 R85A 98 80 NT NT NT NT NT 34 F156A 85 28 NT NT NT NT NT 35 V160C 80 44 NT NT NT NT NT 36 A162C 76 75 NT NT NT NT NT 37 A162L 82 219 NT NT NT NT NT 38 V308M 93 76 NT NT NT NT NT 39 F327V 22 81 NT NT NT NT NT 40 L330T 27 69 NT NT NT NT NT 41 I343T 18 365 NT NT NT NT NT (NT: not tested)
[0277] As shown in the Tables 10 and 11, it was demonstrated that in case of variants of CyPPO proteins, the IC.sub.50 values of each herbicide were significantly increased compared to the wild type. Such results show that herbicide tolerance was increased by amino acid mutation at certain positions of PPO protein. Although the present data showed that CyPPO protein variants have reduced enzyme activity compared to the wild type, it might be caused by the different conditions of the protein folding, and/or hydrophobicity of recombinants PPOs compared to the native PPOs. While the native PPOs are hydrophobic and localize to the membranes of chloroplasts in plants, the recombinant PPOs produced in E. coli are hydrophilic containing a MBP as a fusion partner. Thus, when PPO variants are properly assembled and expressed to chloroplasts in plants, the enzyme activity would not be affected drastically.
Example 5. Generation of A. thaliana Transformants Using CyPPO Variants and PPO-Inhibiting Herbicide Tolerance Test
[0278] 5-1. Construction of A. thaliana Transformant Vectors and Generation of A. thaliana Transformants
[0279] A. thaliana was transformed with a binary vector having ORF of a selectable marker, Bar gene (glufosinate-tolerant gene) and ORF of each amino acid mutation gene of CyPPO2, CyPPO4 or CyPPO8. The transgenic plant was examined for cross-tolerance towards glufosinate and PPO-inhibiting herbicides. The bar gene was also used to examine whether the transgene was stably inherited during generations. NOS promoter and E9 terminator were used for bar gene expression.
[0280] In order to express CyPPO2 variants, CyPPO4 variants, and CyPPO8 variants, respectively in a plant, a CaMV35S promoter and NOS terminator were used. In addition, in order to transit protein to chloroplast, transit peptide (TP) of AtPPO1 gene (SEQ ID NO: 8) was inserted in front of 5 of the inserted gene using XbaI and XhoI restriction enzymes. Further, for identification of the expressed protein, hemagglutinin (HA) tag was fused to the 3-terminal region using BamHI and SacI restriction enzymes. The transit peptide region inserted into the vector was represented by SEQ ID NO: 10, and the inserted HA tag sequence was represented by SEQ ID NO: 11. Encoding genes of CyPPO2 variants, CyPPO4 variants, or CyPPO8 variants were inserted between the transit peptide and HA tag using XhoI and BamHI restriction enzymes. NOS terminator was inserted after HA tag, thereby terminating transcription of PPO gene. A schematic diagram of the plant transformation binary vector is shown in
[0281] Each constructed vector was transformed to Agrobacterium tumefaciens GV3101 competent cell by a freeze-thaw method. To prepare Agrobacterium GV3101 competent cell, Agrobacterium GV3101 strain was cultured in 5 ml LB media under the condition of 30 C. and 200 rpm for 12 hrs. The culture solution was poured to 200 ml LB media, and then cultured under the condition of 30 C. and 200 rpm for 3-4 hrs, and centrifuged at 4 C. for 20 minutes. The cell pellet was washed with sterile distilled water, and then resuspended in 20 ml LB media. Snap frozen 200 ul aliquots with liquid nitrogen were stored in a deep freezer.
[0282] Each transformed Agrobacterium was cultured in an antibiotic media (LB agar containing spectinomycin) and screened. The screened colony was liquid cultured in LB broth. After Agrobacterium cell was harvested from the culture solution, it was resuspended in a 5% (w/v) sucrose, 0.05% (v/v) Silwet L-77 solution (Momentive performance materials company) at an absorbance (OD.sub.600) of 0.8. By floral dipping method, A. thaliana wild type (Col-0 ecotype) was transformed, and then the seed (To) was harvested 1-2 months later.
[0283] Bar gene in the binary vector was used for screening of individual transformants. The obtained T.sub.0 seeds were sown in MS media (2.25 g/L MS salt, 10 g/L sucrose, 7 g/L Agar) supplemented with 25 M glufosinate, and the surviving plants were selected after 7 days of sowing, and transplanted into soil and grown, to obtain T.sub.1 plants.
[0284] In order to examine PPO-inhibiting herbicide tolerance of the transgenic plants, 4-week-old plants were evenly sprayed with 100 ml of 1 uM Tiafenacil solution (0.05% Silwet L-77) per 4060 cm area (0.24 m.sup.2). While wild type A. thaliana (Col-0 ecotype) completely died within 7 days after treatment, each transformant showed no damage to PPO-inhibiting herbicide treatment.
[0285] The T.sub.2 seeds were sown to MS media (2.25 g/L MS salt, 10 g/L sucrose, 7 g/L Agar) supplemented with 25 M glufosinate, and after 1 week, surviving plants were transplanted into soil.
[0286] The A. thaliana wild type PPO1 (wild type AtPPO1) was used as a negative control having PPO-inhibiting herbicides sensitivity (GenBank accession no. AX084732 (the nucleotide sequence of the gene was represented by SEQ ID NO: 8, and the amino acid sequence was represented by SEQ ID NO: 7)). Mutant AtPPO1 with amino acid substitutions of Y426M (the 426.sup.th amino acid, tyrosine was substituted with methionine) and S305L (the 305.sup.th amino acid, serine was substituted with leucine) in the amino acid sequence of the wild type AtPPO1 was used as a positive control (the amino acid sequence was represented by SEQ ID NO: 9) (Li et al. Development of protoporphyrinogen oxidase as an efficient selection marker for Agrobacterium tumefaciens-mediated transformation of maize. Plant physiol. 2003 133:736-747).
[0287] The CyPPO variants used in generation of A. thaliana transformants were listed in Table 12:
TABLE-US-00013 TABLE 12 CyPPO2 CyPPO4 CyPPO8 mutation Line No. mutation Line No. mutation Line No. Y373M 32 Y375M 14 F363M 22 34 31 51 38 52 39 F363V 1 40 18 Y373V 34 F363L 1 Y373I 23 33 34 A162L 1 Y373L 23 5 43 A162C + 46 Y373C 40 V308M + 48 F363M V318M + 1 Y373I 3 V173S + 3 A175C + 4 Y373M 51 72 84 A175C + 4 V318M + 8 Y373M
[0288] 5-2. Seed Germination
[0289] Tiafenacil tolerance of A. thaliana was confirmed using T.sub.2 seeds which survived under 1 M tiafenacil spray at T.sub.1 generation. The transformants were introduced Y373M mutant of CyPPO2, Y375M mutant of CyPPO4, or F363M mutant of CyPPO8 (CyPPO2 Y373M transformant, CyPPO4 Y375M transformant, and CyPPO8 F363M transformant, respectively). Glufosinate tolerance of the transformant was confirmed by sowing A. thaliana seeds in a medium supplemented with glufosinate (50 M PPT).
[0290] The result was shown in
[0291] No. 32, No. 34, and No. 28 of CyPPO2 Y373M transformants germinated, No. 14 and No. 31 of CyPPO4 Y375M transformants, and No. 22. No. 51 and No. 52 of CyPPO8 F363M transformants germinated even in MS media containing 1 M or higher concentration of tiafenacil. In addition, the wild type A. thaliana (Col-0) seeds used as a negative control did not germinate in MS media containing 70 nM tiafenacil, and mutant AtPPO1 transformants (AtPPO1 SLYM) used as a positive control germinated even in MS media containing 1 M tiafenacil.
[0292] 5-3. Confirmation of Segregation Ratio of Tolerance Trait in T.sub.2 Generation Seeds
[0293] In order to determine inheritance, segregation ratios were investigated with T.sub.2 seeds. The results were shown in Tables 13 to 15.
TABLE-US-00014 TABLE 13 CyPPO2 transformants (T.sub.2) Mutation Line No. Segregation ratio Y373M 32 2.53:1 34 3.21:1 38 3.18:1 39 3.17:1 Y373V 34 3.13:1 Y373I 23 2.70:1 34 3.55:1 Y373L 5 2.7:1 23 2.96:1 43 3.3:1 Y373C 40 3.32:1 V318M + Y373I 1 2.95:1 3 2.95:1 V173S + A175C + Y373M 3 3.27:1 4 2.5:1 72 3.08:1 84 2.95:1 51 3.32:1 A175C + V318M + Y373M 4 2.8:1 8 2.57:1
TABLE-US-00015 TABLE 14 CyPPO4 transformants (T.sub.2) Mutation Line No. Segregation ratio Y375M 14 2.53:1 31 3:1
TABLE-US-00016 TABLE 15 CyPPO8 transformants (T.sub.2) Mutation Line No. Segregation ratio F363M 22 3.08:1 51 3.54:1 52 3.04:1 F363V 1 2.52:1 18 2.57:1 F363L 1 2.54:1 33 2.77:1 A162L 1 2.5:1 5 3.5:1 A162C + V308M + 46 2.6:1 F363M 48 2.59:1
[0294] As shown in Table 13, in case of the CyPPO2 mutant gene inserted transformant, No. 32, No. 34, No. 38, and No. 39 lines of Y373M variant, No. 34 line of Y373V variant, No. 23, and No. 34 lines of Y373I variant, No. 23, and No. 43 lines of Y373L variant, No. 40 line of Y373C variant, No. 1 and No. 3 lines of V318M+Y373I variant, No. 3, No. 4, No. 72, No. 84, and No. 51 lines of V173S+A175C+Y373M variant, and No. 4 and No. 8 lines of A175C+V318M+Y373M variant exhibited approximately 3:1 of tolerance versus susceptible individuals, and thereby it was demonstrated that single copy of transgenes were integrated to A. thaliana genome according to Mendel's law.
[0295] As shown in Table 14, in case of the CyPPO4 mutant gene inserted transformant, No. 14 and No. 31 lines of Y375M variant exhibited approximately 3:1 of tolerance versus susceptible individuals, and thereby it was demonstrated that single copy of transgenes were integrated to A. thaliana genome.
[0296] As shown in Table 15, in case of the CyPPO8 mutant gene inserted transformant, No. 22, No. 51 and No. 52 lines of F363M variant, No. 1 and No. 18 lines of F363V variant, No. 1 and No. 33 lines of F363L variant, No. 1 and No. 5 lines of A162L variant, and No. 46 and No. 48 lines of A162C+V308M+F363M exhibited approximately 3:1 of tolerance versus susceptible individuals, and thereby it was demonstrated that single copy of transgenes integrated to the A. thaliana genome.
[0297] 5-4. Investigation of CyPPO Protein Expression in Herbicide-Tolerant A. thaliana (T.sub.2)
[0298] The expression of CyPPO2 Y373M, CyPPO4 Y375M or CyPPO8 F363M in protein level was examined the expression of introduced genes. After approximately 100 mg of A. thaliana T.sub.2 transformant leaves were pulverized together with liquid nitrogen, the protein was extracted by adding protein extraction buffer (0.05 M Tris-C1 pH 7.5, 0.1 M NaCl, 0.01 M EDTA, 1% Triton X-100, 1 mM DTT). Western blotting was conducted using the extracted protein. After electrophoresis, the proteins were transferred to PVDF (polyvinylidene difluoride) membrane, and then western blotting was conducted using anti-HA antibody (Santacruz) and anti-actin antibody (loading control, comparison of the amount of experimental protein; Abcam).
[0299] The result was shown in
[0300] The level of mutant PPO protein expression was similar in CyPPO2 Y373M transformant and CyPPO8 F363M transformant, whereas CyPPO4 Y375M exhibited low level of expression of PPO variant.
[0301] The transformant lines were further progressed by one generation (T.sub.3 generation), and it confirmed that each line of transformants had tolerance to herbicides (refer to the Example 5-5). This indicates that expression of introduced genes is maintained as progressing the generation and they conferred herbicide tolerance.
[0302] 5-5. Verification of Herbicide Tolerance of Transformed A. thaliana
[0303] In order to demonstrate the herbicide tolerance of amino acid variant encoding genes of CyPPO2, CyPPO4 and CyPPO8 in a plant, herbicide tolerance was tested to T.sub.2 generation or T.sub.3 generation. All spray tests was performed just before bolting, approximately 4 weeks after transplanting. One hundred milliliters of herbicides with solution (0.05% Silwet L-77) per 4060 cm area (0.24 m.sup.2) were sprayed.
[0304] The result observed at the 7th day after spraying to CyPPO2 Y373M variant, CyPPO4 Y375M variant, and CyPPO8 F363M variant were shown in
[0305] Tiafenacil 25 M or saflufenacil 75 M was treated to T.sub.3 transformants of Y373C, Y373I, Y373L, Y373M and Y373V mutant genes of CyPPO2. And tiafenacil 25 M or saflufenacil 100 M was sprayed to T.sub.3 transformant of F360L, F360V and A162L mutant genes of CyPPO8.
[0306] Tiafenacil 5 M was sprayed to T.sub.2 transformant of V318M+Y373I, V173S+A175C+Y373M and A175C+V318M+Y373M mutant genes of CyPPO2. Tiafenacil 10 M was sprayed to T.sub.2 generation of the transformant of A162C+V308M+F363M mutant gene of CyPPO8.
[0307] The result of observed at the 7th day after spraying was shown in Table 16 (Injury index) and
TABLE-US-00017 TABLE 16 Injury index Line No. Tiafenacil Saflufenacil Concentration 5 M 5 M Col-0 (wild type) 5 5 CyPPO2 5 NT CyPPO2 variants (T.sub.3) 25 M 75 M Y373M 40-4 2.5 NT Y373C 40-3 2 1.5 Y373I 23-2 0 1 34-2 0 0.75 Y373L 23-9 1.5 1.6 43-1 1.5 3 Y373V 34-10 2 2 CyPPO2 variants(T.sub.2) 5 M 75 M V318M + Y373I 1 0 NT 3 0 NT V173S + A175C + Y373M 3 1.5 NT 4 2 NT 51 2 NT 72 2 NT 84 3 NT A175C + V318M + Y373M 4 0 NT 8 3 NT CyPPO8 5 5 CyPPO8 variants (T.sub.3) 5 M 75 M F363M 22 0 NT 51 0 NT 52 0 NT 25 M 100 M F363L 33-7 1.5 2.5 1-3 2.5 1.5 F363V 1-7 0.5 0 18-1 0.5 0 A162L 1-6 3.4 4 5-4 3.4 3.8 5-7 3.9 3.8 CyPPO8 variants(T.sub.2) 10 M 100 M A162C + V308M + F363M 46 1 NT 48 1 NT CyPPO4 variants 5 M 5 M Y375M 14 4 2 NT: Not tested
[0308] Injury index of the Table 16 was evaluated by the criteria of the following Table 17 (this was equally applied to injury index provided in the context):
TABLE-US-00018 TABLE 17 Injury index Symptom 0 No damage 1 Dried leaf end 2 Over 20% and less than 30% of the plant was scorched 2.5 Over 30% and less than 50% of the plant was scorched 3 Over 50% and less than 70% of the plant was scorched 4 Over 70% of the plant was scorched 5 The whole plant was dried and died
[0309] As shown in Table 16 and
[0310] As shown in Table 16 and
[0311] In addition, the tolerance level of transformants (T.sub.3) in which CyPPO2 Y373I and CyPPO8 F363V were introduced respectively was confirmed in each 50 M of herbicides (flumioxazin, sulfentrazone, tiafenacil or saflufenacil). AtPPO1 SLYM was used as the tolerance control group (positive control). Tiafenacil, saflufenacil, flumioxazin, or sulfentrazone were treated at a concentration of 50 M respectively, and after 7 days, injury index was evaluated. The result was shown in
TABLE-US-00019 TABLE 18 Injury Index AtPPO1 CyPPO8 CyPPO2 SLYM F363V Y373I Tiafenacil 4 2 2 Saflufenacil 0-1 0-1 0-1 Flumioxazin 4-5 2 3 Sulfentrazone 0-1 0-1 0-1
[0312] As shown in
[0313] While wild type A. thaliana died after 0.8 M tiafenacil treatment, the PPO mutant transformants exhibited continuous growth in 5 M, 10 M, or 25 M tiafenacil treatment.
[0314] From this result, the CyPPO variants are expected to give various PPO-inhibition herbicide tolerances to other plants as well as A. thaliana.
[0315] 5-6. Confirmation of Transgene Stability During Generation Passage
[0316] This test is to confirm that genes introduced in A. thaliana were stably inherited and expressed even if generation progresses.
[0317] The CyPPO2 Y373I mutant and CyPPO8 F363V mutant transformants were developed to T.sub.4, or T.sub.5 generation as follow; T.sub.3 lines 23-2, 23-7, 34-2 of CyPPO2 Y373I and 1-7, 18-1, 18-7 of CyPPO8 F363V. The herbicide tolerance was maintained through T.sub.3 to T.sub.5 generation of each line indicating the stability of transgene during generations.
[0318] Specifically, 15 M tiafenacil or 150 M saflufenacil was treated to T.sub.4 or T.sub.5 lines, and 7 days after herbicide treatment, damage level was evaluated. The result was shown in
[0319] In addition, western blotting was conducted to confirm protein expression. The proteins were extracted from transformants. After grinding seedling using liquid nitrogen, protein extraction buffer (0.05 M Tris-C1 pH 7.5, 0.1 M NaCl, 0.01 M EDTA, 1% Triton X-100, 1 mM DTT) was added and the total protein was extracted. The extracted protein was transferred to PVDF membrane after electrophoresis, western blotting was conducted using anti-HA antibody (Santacruz). The expressed proteins in the transformant were detected. The result was shown in
[0320] As shown in
Example 6. Generation of Rice Transformants Using CyPPO Variants and PPO-Inhibiting Herbicide Tolerance Test
[0321] 6-1. Construction of Rice Transformation Vector and Generation of Rice Transformants
[0322] A binary vector having ORF of Bar gene (glufosinate-tolerant gene) and ORF of each amino acid mutant gene of CyPPO2 or CyPPO8 was constructed and used for rice transformation. Each gene were cloned in pCAMBIA3301 vector (refer to
[0323] In order to express mutant genes of CyPPO2 or CyPPO8 in a plant, the ubiquitin promoter of a corn and the NOS terminator were used. In addition, the transit peptide (TP) of AtPPO1 was fused in the N-terminal region of CyPPO2 or CyPPO8 mutant. Each vector constructed was transformed to Agrobacterium tumefaciens LBA4404 competent cell (Takara) by an electric shock method.
[0324] The transformed Agrobacterium was used to transform Dongjin rice (wild type cultivar). After removing seed husk of Dongjin rice, disinfecting, and dark culturing in N6D media at 32 C. for 5 days, rice seeds were mixed with the transformed Agrobacterium solution, and then transplanted on 2N6-AS100 media. It was incubated at 28 C. for 1 day in dark, and then incubated at 23.5 C. for 4 days in dark. Seeds were incubated on N6D cf500 ppt4 media supplemented with appropriate concentration of phosphinothricin (Duchefa) at 28 C. for 10 days under light, and transformed callus was selected among infected seeds. The selected callus was moved on REIII cf500 ppt4 media supplemented with appropriate concentration of phosphinothricin (Duchefa), thereby inducing a plant.
[0325] The composition of the used media was listed in Table 19:
TABLE-US-00020 TABLE 19 Media name Ingredient Usage N6D N6 powder 4 g Sucrose 30 g L-Proline 2.878 g Casamino acid 0.3 g Myo-Inositol 0.1 g 2,4-Dichlorophenoxy 2 mg (dissolve in ethanol) Phytagel 4 g Distilled Water up to 1 L (pH 5.8) 2N6-AS100 N6 powder 4 g Sucrose 30 g D-glucose (Monohydrate) 10 g Casamino acid 0.3 g 2,4-Dichlorophenoxy 2 mg (dissolve in ethanol) Phytagel 4 g Acetosyringone 1 ml (20 mg/ml, dissolve in DMSO) Distilled Water up to 1 L (pH 5.2) N6D cf500 ppt4 N6 powder 4 g Sucrose 30 g L-proline 2.878 g Casamino acid 0.3 g Myo-inositol 0.1 g 2,4-Dichlorophenoxy 1 ml (2 mg/ml in ethanol) Phytagel 4 g Cefotaxime sodium 500 mg Distilled Water up to 1 L (pH 5.8) REIII cf500 ppt4 MS vitamin powder 4.41 g Sucrose 30 g Sorbitol 30 g Casamino acid 2 g NAA (1 mg/ml) 20 l Kinetin 2 mg Myo-inositol 0.1 g Phytagel 4 g Cefotaxime sodium 500 mg Distilled Water up to 1 L (pH 5.8)
[0326] 6-2. Verification of PPO-Inhibiting Herbicide Tolerance of Transformed Rice
[0327] In order to examine the level of herbicide tolerance of transformants of CyPPO2 and CyPPO8 mutant genes in a monocotyledon crop, herbicide tolerance was tested in T.sub.0 generation plant of Dongjin rice in which each gene was transformed.
[0328] After taking tillers of 5-week-old rice of T.sub.0 generation of CyPPO2 Y373M transformant and CyPPO8 F363M transformant, they were allowed to grow, and tiafenacil or saflufenacil were treated, respectively. Two hundreds milliliters of 200 M tiafenacil (corresponding to 853 g ai/ha) or 500 M saflufenacil (corresponding to 2,085 g ai/ha) was treated in the area of 4060 cm. For reference, the recommended treatment dosage of tiafenacil for weed control is approximately 150 g ai/ha, and the recommended treatment dosage of saflufenacil for weed control is under 145 g ai/ha.
[0329] T.sub.2 transformants of CyPPO2 Y373M and CyPPO8 F363M were used for herbicide treatment at 47.sup.th day after sowing. One hundred milliliters of 200 M tiafenacil (corresponding to 420 g ai/ha) and 400 M saflufenacil (corresponding to 840 g ai/ha) were sprayed respectively in the area of 4060 cm. The result observed at the 7.sup.th day after spraying was shown in
[0330] As shown in
[0331] All CyPPO2 Y373M transformant and CyPPO8 F363M transformant rice plants exhibited tolerance after the treatment of tiafenacil or saflufenacil of higher concentration than the recommended concentration for weed control. This indicated that the genes introduced to rice plants were inherited and expressed stably, showing PPO-inhibiting herbicide tolerance through generations.
[0332] 6-3. Verification of Protein Expression in Rice Transformants
[0333] In order to confirm that mutant protein (CyPPO2 Y373M or CyPPO8 F363M) was expressed in CyPPO2 Y373M transformant and CyPPO8 F363M transformant, the protein was extracted in a leaf from each transformant line, and western blotting was conducted.
[0334] For this, 5 ml/g tissue of extraction buffer (50 mM Tris-C1, pH 7.5, 150 mM NaCl, 1 mM EDTA, 0.5% NP-40) and protease inhibitor (Xpert Protease Inhibitor Cocktail Solution, GenDepot) were added to ground leaf tissue of each transformant. The extracted protein was loaded to SDS-PAGE gel, and transferred to PVDF membrane. The membrane was incubated with CyPPO2 or CyPPO8 peptide-specific primary antibody (GenScript) at the ratio of 1:1000. Protein was detected by HRP-conjugated secondary antibody using ECL reagent and Luminograph (Atto).
[0335] The obtained images were shown in
[0336] 6-4. Copy Number Analysis of Introduced Genes in Transformed Rice
[0337] The genomic DNA was extracted from leaf tissues of CyPPO8 F363M transformant to analyze the copy number of the transgene.
[0338] Genomic DNA was extracted as follows. After grinding leaf tissue of the transformed rice using a pestle and a mortar in liquid nitrogen, 5 ml/g tissue of DNA isolation buffer (2% (w/v) CTAB, 1.5 M NaCl, 25 mM EDTA, 0.2% (v/v) beta-mercaptoethanol, 100 mM Tris-C1 (pH 8.0)) was added and vortexed. After heating at 60 C. for over 1 hour, 1 volume of chloroform:isoamyl alcohol (24:1) was added and mixed with inverting. After centrifugation at the condition of 7000g for 10 minutes at 4 C., supernatant was moved to a new tube, and 2.5 volume of ethanol was mixed. After centrifugation at 5000g for 5 minutes at 4 C., supernatant was discarded and the pellet was dissolved in TE buffer (LPSS). After adding 20 g/ml RNase A (Bioneer), it was incubated at 37 C. for 30 minutes. After adding 1 volume of phenol:chloroform (1:1), it was mixed and centrifuged at 10,000g for 10 minutes at 4 C. Supernatant was moved to a new tube, and then 1 volume of chloroform:isoamyl alcohol (24:1) was added and mixed. After centrifugation at 10,000g for 10 minutes for 4 C., supernatant was moved to a new tube, and 0.1 volume of NaOAc (pH 5.2) and 2 volume of ethanol were added and mixed. Then, it was centrifuged at 5,000g for 5 minutes at 4 C., and the pellet was washed with 70% ethanol. After air dry, genomic DNA was dissolved in an appropriate amount of TE buffer.
[0339] The 10-40 g of extracted DNA was digested for overnight using EcoRI (Enzynomics).
[0340] Then, after 0.8% (w/v) Agarose gel electrophoresis (50 V), gel was treated as follows:
[0341] 1) depurination: 0.25 N HCl, 15 minutes shaking
[0342] 2) denaturation: 0.5 M NaOH, 1.5 M NaCl, 30 minutes shaking
[0343] 3) neutralization: 0.5 M Tris (pH 7.5), 1.5 M NaCl, 20 minutes shaking
[0344] Thereafter, DNA fragments were moved to nitrocellulose membrane (GE healthcare) using a capillary transfer method, cross linking was performed using UV Crosslinker (UVC-508; ULTRA LUM Inc.).
[0345] Hybridization was performed by the following method: The nitrocellulose membrane was dipped in Easyhybridization solution (Roche), and incubated at 42 C. for 3 hrs. Then, the solution was discarded, substituted with a new DIG Easyhybridization solution, and incubated for overnight at 42 C.
[0346] The probe (DIG-labeled CyPPO8-M probe) was labelled by PCR reaction as follows:
TABLE-US-00021 Materials Template (CyPPO8 plasmid DNA) 0.5 l 10X buffer 3 l DIG-dNTP 2 l forward primer (10 M) 3 l reverse primer (10 M) 3 l DDW 18 l e-Taq polymerase (Solgent Inc.) 0.5 l total 30 l
TABLE-US-00022 TABLE 20 Conditions for PCR reaction 94 C. 3 min 94 C. 30 sec 35 cycles 58 C. 30 sec 72 C. 1 min 72 C. 5 min
[0347] Sequences for Primers
TABLE-US-00023 ForwardprimerforCyPPO8F363Mprobe: (SEQIDNO:158) GCGTTAACGGGTGCATTAGGC ReverseprimerforCyPPO8F363Mprobe: (SEQIDNO:159) TGGAAAGAGTGTTGAACTCC
[0348] After PCR product was electrophoresed in agarose gel, the labelled probe band was extracted.
[0349] After hybridization with labelled probe, membrane was washed in low stringency washing buffer (2SSC, 0.1% SDS) followed by high stringency washing buffer (0.5SSC, 0.1% SDS). Southern blotting signal was detected as follows: 1) shaking for 30 minutes after adding blocking buffer (Roche) to the membrane
[0350] 2) shaking for 30 minutes after adding DIG antibody (anti-digoxigenin-AP Fab fragments, Roche)
[0351] 3) shaking for 15 minutes in washing buffer (Roche)
[0352] 4) shaking for 3 minutes after adding detection buffer (Roche)
[0353] 5) After applying CDP-Star, ready-to-use (Roche) on the membrane, developing the blot on x-ray film.
[0354] The result was shown in
Example 7. Generation of Soybean Transformants Using CyPPO Variants and PPO-Inhibiting Herbicides Tolerance Test
[0355] 7-1. Generation of Soybean Transformants
[0356] Vectors to transform soybean plant with CyPPO2 Y373M or CyPPO8 F363M gene were constructed.
[0357] The sequence of transit peptide of A. thaliana PPO1 was fused to 5 region of CyPPO2 Y373M or CyPPO8 F363M (refer to
[0358] PCR reaction mixture (total 50 l) was prepared by mixing 1 l of template (the vector which was used for A. thaliana transformation), 5 l of 10 buffer, 1 l of dNTP mixture (each 10 mM), 1 l of TOPO-cTP_F primer (10 M), 1 l of TOPO-CyPPO2_R or TOPO-CyPPO8_R primer (10 M), 40 l of DDW, and 1 l of Pfu-X (Solgent, 2.5 unit/l), and amplification was performed under conditions of 1 cycle of 94 C. for 4 minutes, and 25 cycles of 94 C. for 30 seconds, 56 C. for 30 seconds and 72 C. for 1.5 minutes, and 1 cycle of 72 C. for 5 minutes.
[0359] Primers used were summarized in Table 21:
TABLE-US-00024 TABLE21 Primer Sequence TOPO-cTP_F CACCATGGAGTTATCTCTTC (SEQIDNO:160) TOPO-CyPPO2_R TCAGATCGATCGAGTATCTG (SEQIDNO:161) TOPO-CyPPO8_R TTAACCCAAATAATCTAACA (SEQIDNO:162)
[0360] Each amplified product was ligated into pENTR-TOPO vector (Invitrogen, refer to
[0361] Cloned gene in pENTR-TOPO vector was transferred to pB2GW7.0 binary vector to transform plants. Gateway LR Clonase II Enzyme Mix kit (Invitrogen) was used for pB2GW7.0 vector construction. After mixing pENTR/D-TOPO vector in which CyPPO2YM or CyPPO8FM gene was inserted, TE buffer, and LR Clonase II enzyme mix, the mixture was incubated at 25 C. for 1 hr. After Proteinase K solution (Invitrogen) was added to the reaction mixture, it was incubated at 37 C. for 10 minutes, and it was transformed to DH5 alpha competent cell.
[0362] Agrobacterium tumefaciens EHA105 (Hood et al., New Agrobacterium helper plasmids for gene transfer to plants (EHA105). Trans Res. 1993 2:208-218) was electro-transformed with the binary vector constructs above. Kwangan soybean plant was used for transformation. After removing seed coat from soybean seed, hypocotyl was cut and wounded 7-8 times by surgical scalpel (#11 blade). Approximately 50 pieces of explants were mixed with transformed Agrobacterium EHA105, and the mixture was sonicated for 20 seconds and then incubated for 30 minutes for inoculation. It was placed on CCM (Co-cultivation media; 0.32 g/L Gamborg B5, 4.26 g/L MES, 30 g/L sucrose, 0.7% agar) media. Then, it was co-cultured in a growth chamber (25 C., 18 hr light/6 hr dark) for 5 days.
[0363] Then it was washed for 10 minutes in liquid SIM (shoot induction media; 3.2 g/L B5 salt, 1.67 mg/L BA, 3 mM MES, 0.8% (w/v) agar, 3% (w/v) sucrose, 250 mg/L cefotaxime, 50 mg/L vancomycin, 100 mg/L ticarcillin, pH 5.6) and was placed on SIM without antibiotics and cultured in a growth chamber (25 C., 18 hr light/6 hr dark) for 2 weeks.
[0364] The shoot-induced explants were transplanted on SIM-1 (SIM media supplemented with 10 mg/L DL-phosphinothricin, pH 5.6). The browned shoots were transplanted on SEM (shoot elongation media; 4.4 g/L MS salt, 3 mM MES, 0.5 mg/L GA3, 50 mg/L asparagine, 100 mg/L pyroglutamic acid, 0.1 mg/L IAA, 1 mg/L zeatin, 3% (w/v) sucrose, 0.8% (w/v) agar, 250 mg/L cefotaxime, 50 mg/L vancomycin, 100 mg/L ticarcillin, 5 mg/L DL-phosphinothricin, pH 5.6). The elongated shoots over 4 cm height were transferred on RIM (root induction medium; 4.4 g/L MS salt, 3 mM MES, 3% sucrose, 0.8% agar, 50 mg/L cefotaxime, 50 mg/L vancomycin, 50 mg/L ticarcillin, 25 mg/L asparagine, 25 mg/L pyroglutamic acid, pH 5.6).
[0365] When the roots grew sufficiently, the plants were moved to bed soil (Bioplug No. 2, Farmhannong) mixed with vermiculite in 2:1 (v/v). After 10 days, leaves were painted with 100 mg/L DL-phosphinothricin.
[0366] 7-2. Analysis of Introduced Genes in Soybean Transformants
[0367] In order to analyze the copy number of introduced genes in CyPPO2 Y373M transformed soybean T.sub.0 plants (line no. 12, 14, 16, 24, 25, 27, 28, 34, and 41) and CyPPO8 F363M transformed soybean T.sub.1 plant (line no. 3, 5, 7, 9, 11, 14, 17, 36, and 44), genomic DNA was extracted with 250 mg of leaf tissue of each transformed plant referring to Example 6-4.
[0368] The 10-40 g of genomic DNA was digested with EcoRI (Enzynomics) for overnight, and southern blotting was performed following the method in Example 6-4.
[0369] The Bar DNA probe for hybridization was prepared by labelling with DIG (Digoxigenin)-dNTP by PCR reaction. PCR reaction mixture (total 50 l) was prepared by mixing 0.5 l of template (the vector which was used for soybean transformation), 5 l of 10 buffer, 10 l of DIG-dNTP mixture (dATP, dCTP, dGTP, respectively, 0.5 mM, dTTP 0.32 mM, DIG-11-dUTP 0.18 mM), 0.5 l of forward primer (100 M), 0.5 l of reverse primer (100 M), 33 l of DDW, and 0.5 l of e-Taq (Solgent, 2.5 unit/l), and amplification was performed under conditions of 1 cycle of 94 C. for 4 minutes, and 35 cycles of 94 C. for 30 seconds, 56 C. for 30 seconds and 72 C. for 30 seconds, and 1 cycle of 72 C. for 5 minutes.
[0370] Bar Probe Primer:
TABLE-US-00025 Forwardprimerforbarprobe: (SEQIDNO:163) 5-TTCCGTACCGAGCCGCAGGA-3 Reverseprimerforbarprobe: (SEQIDNO:164) 5-CGTTGGGCAGCCCGATGACA-3
[0371] For comparison, the genomic DNA of non-transformed Kwangan soybean (WT) was used as a negative control.
[0372] The result was shown in
[0373] Hereinafter, using the single copy inserted transformant lines, herbicide tolerance was evaluated and CyPPO protein expression was tested.
[0374] 7-3. Verification of Herbicide Tolerance of Transformed Soybeans
[0375] In order to examine the level of herbicide tolerance of CyPPO2 Y373M or CyPPO8 F363M transformed soybean plants, herbicide was applied to soybean transformants (T.sub.2 generation).
[0376] Twenty micromolar of tiafenacil (corresponding to 42 g ai/ha) or 150 M (corresponding to 315 g ai/ha) or 300 M (corresponding to 630 g ai/ha) of saflufenacil was sprayed respectively to the soybean of V2-3 stage. The 100 ml herbicide of the concentration above was evenly sprayed on the area of 4060 cm, and after 5 days, herbicide tolerance was evaluated. Non-transformed soybean (represented by Kwangan soybean) was used as a control.
[0377]
TABLE-US-00026 TABLE 22 Injury Index Damage description by herbicide treatment 0 No damage 1 Very week level, very small part of leaves was damaged or chlorosis was observed. 2 Weak damage symptom with a little severe chlorosis, no effect on the whole growth condition 3 No effect on the primary leaf and growing point, a little severe damage was observed in the secondary leaf tissue 4 The whole plant shape was little changed. There was no effect on stem, but chlorosis and necrosis were observed in the secondary growing point and leaf tissues. Considered that re-growth is possible within one week. 5 The whole plant shape was definitely changed. Chlorosis and necrosis were observed in many leaves and growing point. The primary growing point was not damaged, and stem had green color. Considered that re-growth is possible within one week. 6 Strong damage on the growth of a newly growing small leaf was observed. Considered that the plant could survive by the growth in the different growing point. Chlorosis and necrosis were observed in most of leaves, and stem had green color. Considered that re-growth is possible, but damage symptoms were severely observed. 7 Chlorosis was exhibited in most of growing points. Re-growth in one of growing point could be possible, and two leaves had green color partially. Partial chlorosis, necrosis, and green color. The rest part of plants including stem exhibited necrosis. 8 All the growing points were necrosed, and plants are likely to die. One leaf had green color partially. 9 Plant necrosed.
[0378] The result shows that while the wild type Kwangan soybean died with herbicide treatment at each concentration, the transformants exhibited weak damage with tiafenacil treatment and hardly exhibited damage with saflufenacil treatment. As a reference, IC.sub.50 value for tiafenacil or saflufenacil of CyPPO2 Y373M was 250 nM or 5,000 nM, respectively, and IC.sub.50 value for tiafenacil or saflufenacil of CyPPO8 F363M was 183 nM or 5,000 nM, respectively (Tables 10 to 11).
[0379] 7-4. Verification of Protein Expression in Transformed Soybeans
[0380] The expression of CyPPO2 Y373M protein or CyPPO8 F363M protein in transformed plants was examined.
[0381] In order to examine protein expression, the total protein was extracted in each transformant (T.sub.1) and western blot analysis was conducted. After triturating the leaf tissue of each transformant with liquid nitrogen, protein extraction buffer (0.8% SDS, 4% glycerol, 2% beta-mercaptoethanol, 0.0008% bromophenol blue, 0.125M Tris-C1, pH 7.4) was added and the total protein was extracted.
[0382] The extracted protein was electrophoresed in SDS-PAGE gel and transferred to PVDF membrane. The membrane was labeled with antibody specific to each inserted protein (CyPPO2-specific antibody for CyPPO2 Y373M transformant, CyPPO8-specific antibody for CyPPO8 F363M transformant; GenScript).
[0383] The result demonstrated that CyPPO2 Y373M protein or CyPPO8 F363M protein was expressed in all transformant individuals (
Example 8. Generation of Rapeseed Transformants Using CyPPO Variants and PPO-Inhibiting Herbicides Tolerance Test
[0384] 8-1. Generation of Rapeseed Transformants
[0385] The vector, in which CyPPO8 F363M gene was inserted, constructed in the Example 5-1 was used to generate rapeseed transformants.
[0386] The seeds of rapeseed were sterilized with 70% (v/v) ethanol for 4 minutes and then with 1.3% (v/v) sodium hypochlorite acid for 30 minutes. After washing 5 times with sterile water, moisture was removed on a sterile filter paper, and the seeds were transplanted to MSO media (4.43 g/L MS salt, 30 g/L sucrose, 3 g/L phytagel, pH 5.8), and cultured for 5 days in a culture room at 251 C. under the light condition (16 h light/8 h dark, 25,000 Lux).
[0387] After Agrobacterium was transformed with the vector inserted with CyPPO8 F363M gene, it was inoculated in LB media supplemented with spectinomycin (100 mg/L) and rifampicin (50 mg/L), and cultured for over 16 hrs in a shaking incubator at 28 C. Cotyledons and hypocotyls of a rapeseed plant were cut and co-cultured with the Agrobacterium for 3 days (dark condition, 251 C.). The inoculated plant tissues were transferred to a selection media (4.43 g/L MS salt, 20 g/L sucrose, 0.2 mg/L NAA, 8 M TDZ, 0.01 mg/L GA3, 50 M silver thiosulfate, 10 mg/L PPT, 500 mg/L carbenicillin, 4 g/L phytagel, pH 5.8) and cultured in a growth chamber (251 C., 16 h light/8 h dark).
[0388] The inoculated plant tissues were subcultured every two weeks and then redifferentiated shoots from callus were transferred to root induction media (4.43 g/L MS salt, 30 g/L sucrose, 3 g/L phytagel, activated charcoal 3 g/L, pH 5.8), thereby inducing roots. Root-induced small plants were transferred to pots, and then transformants were confirmed using excised leaves.
[0389] 8-2. Verification of Herbicide Tolerance of Transformants
[0390] After seeds of the rapeseed transformants (T.sub.1) and Youngsan rapeseed (wild type rapeseed, control) were sterilized with 50% (v/v) sodium hypochlorite for 30 minutes, they were washed 5 times with sterile water. Transformants were sown in a selection media ( MS, 50 nM tiafenacil, pH 5.8) and the wild type rapeseeds were sown in MS media. Individuals survived after 7 days were transplanted to pots and cultured in a growth chamber (251 C., 16 h light/8 h dark). After 35 days of transplantation, 10 M tiafenacil and 10 M saflufenacil were treated respectively by 100 mL (0.05% Silwet L-77) per a tray (4060 cm, 0.24 m.sup.2) in which the pot placed.
[0391] The results of 7 days after treatment of the herbicide were shown in
TABLE-US-00027 TABLE 23 10 M Tiafenacil 10 M Saflufenacil WT (Youngsan) 4 4 CyPPO8 F363M 2-4 2 NT CyPPO8 F363M 2-7 2 NT CyPPO8 F363M 2-8 1 NT CyPPO8 F363M 2-6 NT 0 CyPPO8 F363M 2-9 NT 0 CyPPO8 F363M 2-10 NT 0 (NT: Not tested)
[0392] While Youngsan (wild type rapeseed, control) exhibited injury level 4, CyPPO8 F363M-2 lines exhibited tolerance injury level 1-2 to 10 M tiafenacil (
[0393] 8-3. Verification of Protein Expression of Transformed Rapeseed
[0394] The expression of inserted genes in CyPPO8 F363M rapeseed transformants was confirmed. Among CyPPO8 F363M lines, 5 individuals (2-1, 2-2, 2-6, 2-9, and 2-10) confirmed to have herbicide tolerance were selected for western blotting.
[0395] After approximately 200 mg of leaves of each rapeseed transformant was ground using liquid nitrogen and a pestle, 0.8 mL phenol (Tris-buffered, pH 8.0) and 0.8 mL dense SDS buffer (30% (w/v) sucrose, 2% (w/v) SDS, 0.1 M Tris-C1, pH 8.0, 5% (v/v) beta-mercaptoethanol) were added and mixed by vortexing for 30 seconds, and centrifugation was conducted at 10,000g for 3 minutes. Supernatant was transferred to a new tube, and 5-volume of methanol (4 C., 0.1 M ammonium acetate) was added and mixed, and then left at 20 C. for 30 minutes. Proteins were precipitated by centrifugation at 10,000g for 5 minutes, and washed with 1 mL methanol (4 C., 0.1 M ammonium acetate) twice and 80% acetone (4 C.) twice, and dried. The dried proteins were dissolved with 2% (w/v) SDS buffer (50 mM Tris-C1, pH 6.8, 1 mM DTT).
[0396] Since the CyPPO8 F363M vector was constructed with HA tag (refer to Example 5-1), western blotting was conducted with HA antibody (Santa Cruz) to confirm the CyPPO8 F363M protein expression.
[0397] The western blot result was shown in the top of
[0398] Additionally, the Coomassie blue staining result of the PVDF membrane was shown in the bottom of