PEPTIDE HAVING SKIN-WHITENING ACTIVITY AND USE THEREOF

20190328642 ยท 2019-10-31

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides a peptide having skin-whitening activity. The peptide of the present invention exhibits an excellent skin whitening effect by inhibiting melanogenesis, inhibiting the activity of tyrosinase, inhibiting the expression of melanosis-involved factors, and inhibiting melanosome transfer. The peptide of the present invention has excellent skin permeability due to the small size thereof. Excellent activity and stability of the foregoing peptide of the present invention can be very favorably applied to cosmetics.

    Claims

    1. A peptide having the amino acid sequence of SEQ ID NO: 1, wherein ferulic acid is bound to the N-terminus of the amino acid sequence.

    2.-8. (canceled)

    9. A composition comprising an effective amount of the peptide of claim 1 and at least one excipient.

    10. A method for whitening skin comprising: administering to a subject in need thereof an effective amount of the peptide of claim 1.

    11. The method of claim 11, wherein the peptide inhibits melanogenesis.

    12. The method of claim 11, wherein the peptide inhibits the activity of tyrosinase.

    13. The method of claim 11, wherein the peptide inhibits the expression of a melanogenesis-involved factor.

    14. The method of claim 13, wherein the melanogenesis-involved factor is selected from the group consisting of microphthalmia-associated transcription factor (MITF), tyrosinase-related protein 1 (TRP1), and proteinase-activated receptor 2 (PAR2).

    15. The method of claim 11, wherein the peptide inhibits the phosphorylation of cAMP response element-binding protein (CREB) which is a signaling material involved in melanogenesis.

    16. The method of claim 11, wherein the peptide inhibits melanosome transfer.

    17. The method of claim 11, wherein the peptide exhibits the ability to promote melanosome degradation.

    18. A method for inhibiting hair growth comprising: administering to a subject in need thereof an effective amount of the peptide of claim 1.

    19. The method of claim 18, wherein the peptide inhibits melanogenesis.

    20. The method of claim 18, wherein the peptide inhibits the activity of tyrosinase.

    21. The method of claim 18, wherein the peptide inhibits the expression of a melanogenesis-involved factor.

    22. The method of claim 21, wherein the melanogenesis-involved factor is selected from the group consisting of microphthalmia-associated transcription factor (MITF), tyrosinase-related protein 1 (TRP1), and proteinase-activated receptor 2 (PAR2).

    23. The method of claim 18, wherein the peptide inhibits the phosphorylation of cAMP response element-binding protein (CREB) which is a signaling material involved in melanogenesis.

    24. The method of claim 18, wherein the peptide inhibits melanosome transfer.

    25. The method of claim 18, wherein the peptide exhibits the ability to promote melanosome degradation.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0034] FIG. 1 is a graph showing results of evaluation of the cytotoxicity of a peptide according to an embodiment of the present invention.

    [0035] FIG. 2a is a graph showing results of measurement of melanin production when melanoma cell line (B16F10) was treated with a peptide according to an embodiment of the present invention.

    [0036] FIG. 2b is an image showing results of measurement of melanin production when melanoma cell line (B16F10) was treated with a peptide according to an embodiment of the present invention.

    [0037] FIG. 3 provides images showing results of observation of melanogenesis when melanoma cell line (B16F10) was treated with a peptide according to an embodiment of the present invention.

    [0038] FIG. 4 is a graph showing results of measurement of tyrosinase activity in cells when melanoma cell line (B16F10) was treated with a peptide according to an embodiment of the present invention.

    [0039] FIG. 5 provides images showing results of confirming the tyrosinase expression level in cells using tyrosinase antibody when melanoma cell line (B16F10) was treated with a peptide according to an embodiment of the present invention.

    [0040] FIG. 6 provides images showing PCR results of confirming the gene expression change of melanogenesis factors when melanoma cell line (B16F10) was treated with a peptide according to an embodiment of the present invention.

    [0041] FIG. 7 provides images showing results of confirming changes in the protein expression of melanogenesis factors using antibodies specific to proteins of the melanogenesis factors when melanoma cell line (B16F10) was treated with a peptide according to an embodiment of the present invention.

    [0042] FIG. 8 provides images showing the results of confirming the degree of phosphorylation of CREB, which is a melanogenesis factor signaling material, when melanoma cell line (B16F10) was treated with a peptide according to an embodiment of the present invention.

    [0043] FIG. 9 provides images showing PCR results of confirming the change in the expression of a gene involved in the activity and phagocytosis of keratinocytes when human keratinocyte cell line (HaCat) was treated with a peptide according to an embodiment of the present invention.

    [0044] FIG. 10 is a graph showing the results of confirming the inhibition of melanosome transfer into keratinocytes when human keratinocyte cell line (HaCat) was treated with a peptide according to an embodiment of the present invention.

    [0045] FIG. 11 provides images showing the results of confirming the inhibition of melanosome phagocytosis of keratinocytes when human keratinocyte cell line (HaCat) was treated with a peptide according to an embodiment of the present invention.

    [0046] FIG. 12 provides images showing the results of a keratinocyte phagocytosis assay using fluorescent-conjugated bioparticles in order to observe the melanosome transfer inhibitory effect according to an embodiment of the present invention.

    [0047] FIG. 13 is a graph showing the results of confirming the melanosome degradation ability in keratinocytes when human keratinocyte cell line (HaCat) was treated with a peptide according to an embodiment of the present invention.

    [0048] FIG. 14a provides an image showing results of observation of the in vivo whitening effect when a peptide according to an embodiment of the present invention was liposomized and applied to the tail of C57BL/6 mice.

    [0049] FIG. 14b provides an image showing results (comparative example) of observation of the in vivo whitening effect when a peptide according to an embodiment of the present invention was liposomized and applied to the tail of C57BL/6 mice.

    [0050] FIG. 14c provides an image showing results (example) of observation of the in vivo whitening effect when a peptide according to an embodiment of the present invention was liposomized and applied to the tail of C57BL/6 mice.

    MODE FOR CARRYING OUT THE INVENTION

    [0051] Hereinafter, the present invention will be described in detail with reference to examples. These examples are only for illustrating the present invention more specifically, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples.

    EXAMPLES

    Synthesis Example 1: Peptide Synthesis

    [0052] Into a reaction container, 700 mg of chloro trityl chloride resin (CTL resin, Nova Biochem Cat No. 01-64-0021) was placed, and 10 ml of methylene chloride (MC) was added, followed by stirring for 3 minutes. Thereafter, the solution was removed, 10 ml of dimethylform amide (DMF) was added, followed by stirring for 3 minutes, and then the solvent was again removed. Into a reactor, 10 ml of a dichloromethane solution was placed, and 200 mmole Fmoc-Asp(OtBu)-OH (Bachem, Swiss) and 400 mmole diisopropyl ethylamine (DIEA) were added. The mixture was thoroughly dissolved with stirring, and the reaction was conducted with stirring for 1 hour. After the reaction, the resulting material was washed, and methanol and DIEA (2:1) were dissolved in dichloromethane (DCM), followed by reaction for 10 minutes, and then the resulting material was washed with excess DCM/DMF (1:1). After the solution was removed, 10 ml of dimethylform amide (DMF) was added, followed by stirring for 3 minutes, and then the solvent was again removed. Into a reaction container, 10 ml of a deprotection solution (20% piperidine/DMF) was placed, followed by stirring at room temperature for 10 minutes, and then the solution was removed. An equal amount of a deprotection solution was added, and then the reaction was again allowed to continue for 10 minutes, followed by removal of the solution. The resulting material was washed twice with DMF, once with MC, and once with DMF, for 3 minutes each, thereby preparing Asp-CTL resin. Into a new reactor, 10 ml of a DMF solution was placed, and 200 mmol Fmoc-Gly-OH (Bachem, Swiss), 200 mmol HoBt, and 200 mmole Bop were added, and the mixture was thoroughly dissolved with stirring. Into a reactor, 400 mmole DIEA was added in two portions, and then stirring was conducted for at least 5 minutes until all solids were dissolved. The dissolved amino acid mixed solution was placed in the reactor containing the deprotected resin, and the reaction was conducted with stirring at room temperature for 1 hour. After the reaction liquid was removed, stirring was conducted using a DMF solution three times for 5 minutes each time, followed by removal of the DMF solution. A small amount of the reaction resin was taken to check the extent of the reaction using the Kaiser test (Ninhydrin test). Using the deprotection solution, the deprotection reaction was conducted twice in the same manner as described above to prepare Gly-Asp-CTL resin. After sufficient washing with DMF and MC, the Kaiser test was again conducted, and then the following amino acid attachment test was conducted in the same manner as described above. Based on the selected amino acid sequence, a chain reaction was carried out in the order of Fmoc-Arg(Pbf)-OH, Fmoc-Gly-OH, Fmoc-Gly-OH, Fmoc-Tyr(tBu)-OH, Fmoc-Gln(Trt)-OH, Fmoc-Thr(tBu)-OH, Fmoc-Asp(OtBu)-OH, Fmoc-Leu-OH, Fmoc-Ser(tBu)-OH, Fmoc-Trp-OH, and Fmoc-Ile-OH. The Fmoc-protective group was reacted twice with a deprotection solution for 10 minutes for each time, and then washed thoroughly. Thereafter, the activated ferulic acid was bound, and then the prepared peptidyl resin was washed three times with DMF, MC, and methanol for each time, dried under slow-flowing nitrogen gas, and completely dried by vacuum-drying under P.sub.2O.sub.5. Then, 30 ml of a missing solution (81.5% trifluoroacetic acid (TFA), 5% distilled water, 5% thioanisole, 5% phenol, 2.5% EDT, and 1% TIS) was added, and the reaction was allowed to continue for 2 hours while the mixture was intermittently stirred at room temperature. The resin was obtained through filtration, and the resin was washed with a small amount of a TFA solution, and then mixed with the stock solution. The distillation was conducted under reduced pressure to leave about half of the total volume, and then 50 ml of cold ether was added to induce precipitation. Thereafter, the precipitate was collected by centrifugation, followed by washing twice with cold ether. The stock solution was removed, and the precipitate was sufficiently dried under nitrogen, to synthesize 0.77 g of Feruloyl-Ile-Trp-Ser-Leu-Asp-Thr-Gln-Tyr-Gly-Gly-Arg-Gly-Asp-COOH, peptide 1 (SEQ ID No. 1) before purification (yield: 88.0%). The molecular weight of the peptide was found to be 1643.7 (theoretical value: 1643.7) when measured using a molecular weight meter.

    TABLE-US-00001 TABLE1 Analyticalvalue (massspectrometer) SEQID Aminoacidsequence Analytical Theoretical NO (5->3) value value 1 FC-IWSLDTQYGGRGD 1643.7 1643.7

    Example 1: Cytotoxicity Test

    [0053] After melanin-forming cells (B16F10 cell line) dispensed in 48-well culture plates were incubated in a 37 C. incubator for 24 hours, the medium for each plate was removed and replaced with serum-free medium, and then the cells were treated with the peptide of the present invention at different concentrations (1, 10, 50, 100, 150, 200 uM). After the cells were incubated for 72 hours, the MTT reagent was added, followed by reaction for 4 hours. Then, the generated formazan was dissolved in DMSO, and the absorbance was measured at 560 nm. An MTT assay was performed to examine whether the cytotoxicity of the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 on melanocytes, and the results are shown in FIG. 1.

    [0054] As can be seen from FIG. 1, it was verified that no cytotoxicity was observed in the groups treated with 1 uM to 200 uM.

    Example 2: Measurement of Melanin Production

    [0055] After melanin-forming cells (B16F10 cell line) dispensed in 6-well culture plates were incubated in a 37 C. incubator for 24 hours, the medium for each plate was removed and then replaced with new medium (2% serum medium). Then, the cells were treated with -MSH (200 ng/ml), arbutin (200, 500 uM), or the peptide of the present invention at different concentrations (50, 100, 200 uM). Thereafter, the cells were incubated for 72 hours, and then the culture medium was removed. The cells were detached and then transferred into a 1.5 l tube, followed by centrifugation at 13,000 rpm for 3 minutes. The supernatant was removed, and cell pellets were collected to observe melanin. Then, 150 l of 2 M NaOH was added to the cell pellets to lyse intracellular melanin at 60 C. for 30 minutes. Then, 100 l of the supernatant obtained from the lysis was added into each well of a 96-well plate, and the absorbance at 490 nm was measured. The results are shown in FIGS. 2a and 2b.

    [0056] As can be seen from FIGS. 2a and 2b, the melanogenesis inhibitory effect of the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 in a dose-dependent manner was verified (**P0.01).

    Example 3: Visual Observation of Melanin Production

    [0057] After melanin-forming cells (B16F10 cell line) dispensed in 6-well culture plates were incubated in a 37 C. incubator for 24 hours, the medium for each plate was removed and replaced with new medium (10% serum medium). Then, the cells were treated with -MSH (200 ng/ml), arbutin (500 uM), or the peptide of the present invention at different concentrations (50, 100, 200 uM). The cells were incubated for 72 hours, and then the formed melanin was observed through an optical microscope. The results are shown in FIG. 3.

    [0058] As can be seen from FIG. 3, the melanogenesis inhibitory effect of the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 in a dose-dependent manner was verified through cell morphology.

    Example 4: Measurement of Intercellular Tyrosinase Activity

    [0059] Melanoma cells (B16F10) were incubated in 6-well culture plates, and then the cells were treated with -MSH (200 ng/ml), the peptide at different concentrations (50, 100, 200 uM), or arbutin (200, 500 uM) as a positive control, followed by incubation for 72 hours. The 6-well culture plates were loaded on ice and washed with cool PBS, and then 300 l of 0.1 M sodium phosphate buffer (pH 6.8 lysis buffer) containing 1% Triton X-100 was added. The cells were collected in a 1.5 mL tube, and then cell membranes were disrupted by repeating rapid-freezing at 270 C. and thawing, five times. Then, the tube was centrifuged at 13,000 rpm for 20 minutes, and then the supernatant was collected in another 1.5 mL tube, and the protein content of the samples was quantified. The samples were diluted to have the same protein concentration and then dispensed in three wells each in a 96-well culture plate, and then 20 l of 10 mM L-dopa was added, followed by incubation at 37 C. for 1 hour. The absorbance was measured at 475 nm, and the results are shown in FIG. 4.

    [0060] As can be seen from FIG. 4, the tyrosinase activity inhibitory effect of the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 in a dose-dependent manner was verified (**P0.01).

    Example 5: Measurement of Tyrosinase Expression Level

    [0061] After melanin-forming cells (B16F10 cell line) dispensed in 6-well culture plates were incubated in a 37 C. incubator for 24 hours, the medium for each plate was removed and replaced with new medium (10% serum medium). Then, the cells were treated with -MSH (200 ng/ml) or the peptide of the present invention at different concentrations (50, 100 uM). Then, the cells were incubated for 48 hours, and the intracellular expression protein was stained with FITC-conjugated tyrosinase antibody (Santa Cruz biotechnology, USA) and FITC-conjugated secondary IgG antibody (Santa Cruz biotechnology, USA). The expression level thereof was measured through a fluorescence microscope, and the results are shown in FIG. 5.

    [0062] As can be seen from FIG. 5, the tyrosinase expression inhibitory effect of the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 in a dose-dependent manner was verified.

    Example 6: Observation of Change in Gene Expression of Melanin-Forming Factors

    [0063] After melanin-forming cells (B16F10 cell line) were incubated in 6-well culture plates for 24 hours, the cells were treated with -MSH (200 ng/ml), arbutin (500 uM), or the present peptide at different concentrations (100, 200 uM). After RNA was extracted from the cells incubated for 24 hours, cDNA was prepared. Then, PCR was conducted using the primers shown in Table 2 below, which are specific to MITF, tyrosinase, and TRP1, respectively, as melanogenesis-involved factors, and then the change in the expression of each gene was observed. The results are shown in FIG. 6.

    TABLE-US-00002 TABLE2 SEQ ID Sequencelisting NO Name (5->3) Note 2 MITF_F CCAGCCTGGCGATCATGTCAT Annealing 3 MITF_R GGTCTGGACAGGAGTTGCTG tempera- ture, 60 C. 4 Tyrosinase_F GGCCAGCTTTCAGGCAGAGG Annealing 5 Tyrosinase_R TGGTGCTTCATGGGCAAAAT tempera- ture, 60 C. 6 TRP1_F TCTGTGAAGGTGTGCAGGAG Annealing 7 TRP1_R CCGAAACAGAGTGGAAGGTT tempera- ture, 60 C.

    [0064] As can be seen from FIG. 6, it was verified that the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 had strong effects of inhibiting MITF, tyrosinase, and TRP1 genes.

    Example 7: Observation of Change in Protein Expression of Melanin-Forming Factors

    [0065] After melanin-forming cells (B16F10 cell line) were incubated in 6-well culture plates for 24 hours, the cells were treated with -MSH (200 ng/ml) or the present peptide at different concentrations (50, 100 uM). After the cells were incubated for 72 hours, the cells were lysed, and the expression of MITF (Santa Cruz Biotechnology, USA) and tyrosinase (Santa Cruz Biotechnology, USA), which are core factors involved in melanogenesis, was observed using a western blot method using specific antibodies. The results are shown in FIG. 7.

    [0066] As can be seen from FIG. 7, the MITF and tyrosinase protein expression inhibitory effects of the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 was verified.

    Example 8: Observation of Melanogenesis Signaling Material

    [0067] After melanin-forming cells (B16F10 cell line) were incubated in 6-well culture plates for 24 hours, the cells were treated with -MSH (200 ng/ml) or the present peptide at different concentrations (50, 100 uM). After the cells were incubated for 10 minutes, the cells were lysed, and the degree of phosphorylation of CREB, which is a signaling material involved in melanogenesis, was observed using a western blot method using a specific antibody (Santa Cruz Biotechnology, USA). The results are shown in FIG. 8.

    [0068] As can be seen from FIG. 8, the CREB phosphorylation inhibitory effect of the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 was verified.

    [0069] Through the above results, the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 inhibits the MC1R signaling pathway activated by -MSH, thereby exhibiting a melanogenesis inhibitory effect.

    Example 9: Observation of Change in Expression of Gene Involved in Activity and Phagocytosis of Keratinocytes

    [0070] After a human keratinocyte line (HaCaT) was incubated in 6-well culture plates for 24 hours, the cells were treated with trypsin as an activity-inducing material and the present peptide at different concentrations (100, 200 uM). After RNA was extracted from the cells incubated for 16 hours, cDNA was prepared.

    [0071] PCR was conducted using a primer pair (see table 3 below) specific to PAR2, which is one of surface receptors of keratocytes activated by a trypsin action, and then the change in the expression of each gene was observed. The results are shown in FIG. 9.

    TABLE-US-00003 TABLE3 SEQ ID Sequencelisting NO Name (5->3) Note 8 PAR2_F TGCTAGCAGCCTCTCTCTCC Annealing 9 PAR2_R CTTCAAGGGGAACCAGATGA temperature, 60 C.

    [0072] As can be seen from FIG. 9, the gene expression was induced by the activation of PAR2 of keratocytes resulting from the treatment with trypsin as serine protease, and it was observed that the treatment with the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 reduced the expression of PAR2 gene in a dose-dependent manner.

    Example 10: Verification of Inhibition of Melanosome Transfer into Keratinocytes (Using Isolated Melanosomes)

    [0073] After human keratinocyte line (HaCaT) was cultured in 6-well culture plates for 24 hours, the melanosomes isolated from mouse melanoma cell line (B16F10) were pretreated for 3 hours in serum-free culture medium, and then the cells were treated with the present peptide at different concentrations (10, 50, 100, 200 uM) or arbutin (200 uM) as a positive control, followed by incubation for 48 hours. Then, the plates were washed with PBS to remove un-transferred melanosomes, and 1 N NaOH was added to pellets, which had been obtained through cell collection and precipitation. Then, 1 M NaOH was added to the pellets, and the pellets were dissolved in an oven at 80 C., and then the OD value at 490 nm was measured. In order to observe the melanosome transfer inhibitory effect of the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 according to the concentration, a keratinocyte phagocytosis assay was performed using the melanosomes isolated from melanoma. The results are shown in FIG. 10.

    [0074] As can be seen from FIG. 10, as a result of examining the amount of melanosomes transferred into keratinocytes through the measurement of absorbance, the phagocytosis inhibitory effect of the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 was verified.

    Example 11: Verification of Inhibition of Melanosome Transfer into Keratinocytes (Using Isolated Melanosomes)

    [0075] After human keratinocyte line (HaCaT) was cultured in 6-well culture plates for 24 hours, the melanosomes isolated from mouse melanoma cell line (B16F10) were pretreated for 3 hours in serum-free culture medium. Then, the cells were treated with the present peptide at different concentrations (10, 50, 100, 200 uM) or arbutin (200 uM) as a positive control, followed by incubation for 48 hours. Then, the plates were washed with PBS to remove un-transferred melanosomes, and subjected to Fontana-Masson staining to observe the inhibition of the melanosome phagocytosis by keratinocytes through a microscope. In order to observe the melanosome transfer inhibitory effect of the peptide consisting of a peptide having ferulic acid bound to the N-term inus of the amino acid sequence of SEQ ID NO: 1 according to the concentration, a keratinocyte phagocytosis assay was performed using melanosomes isolated from melanoma. The results are shown in FIG. 11.

    [0076] As can be seen from FIG. 11, as a result of examining the amount of melanosomes transferred into keratinocytes through optical microscope image analysis, the phagocytosis inhibitory effect of the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 in a dose-dependent manner was verified.

    Example 12: Verification of Inhibition of Melanosome Transfer into Keratinocytes (Using Bioparticles)

    [0077] After human keratinocyte line (HaCaT) was cultured in 24-well culture plates for 24 hours, the cells were treated with the present peptide at different concentrations (100, 200 uM) or arbutin (200 uM) as a positive control in 0.5% FBS culture medium, followed by incubation for 24 hours. Thereafter, the inhibition of phagocytosis of the human keratinocyte line was observed using the Vybrant Phagocytosis Assay Kit (V-6694). In order to observe the melanosome transfer inhibitory effect of the peptide consisting of a peptide having ferulic acid bound to the N-term inus of the amino acid sequence of SEQ ID NO: 1 according to the concentration, a keratinocyte phagocytosis assay was performed using fluorescent-conjugated bioparticles. The results are shown in FIG. 12.

    [0078] As can be seen from FIG. 12, as a result of examining the amount of bioparticles transferred into keratinocytes through fluorescent microscopic image analysis, the distinctive phagocytosis inhibitory effect of the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 was verified.

    Example 13: Observation of Melanosome Degradation Ability in Keratinocytes

    [0079] After human keratinocyte line (HaCaT) was cultured in 6-well culture plates for 24 hours, melanosomes isolated from mouse melanoma cell line (B16F10) were pretreated for 48 hours in serum-free culture medium. The plates were washed with PBS to remove un-transferred melanosomes, and then the cells were treated with the peptide at different concentrations (100, 200 uM) or arbutin (200 uM) as a positive control, and TGF-1, followed by incubation for 48 hours. In order to measure the degradation of melanosomes phagocytized into keratinocytes, 1 M NaOH was added to pellets obtained by keratinocyte collection and precipitation, and the pellets were dissolved in an oven at 80 C., and then the OD value at 490 nm was measured. The results are shown in FIG. 13.

    [0080] As can be seen from FIG. 13, as a result of observing the effect of the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 to promote the degradation of the melanosomes transferred into the keratinocytes, the effect in a dose-dependent manner was verified.

    Example 14: Observation of In Vivo Whitening Effect

    [0081] Liposomal peptide (5,000 ppm) or arbutin as a positive control was applied to the tail of 8-week-old C57BL/6 mice once a day, and the experiment was conducted for about 8 weeks. After the completion of the experiment, the mice were sacrificed to extract tail skin tissues, which were then embedded in paraffin to manufacture paraffin blocks. Then, the paraffin blocks were made into paraffin sections and morphologically observed through Fontana-Masson staining. The results are shown in FIGS. 14a to 14c.

    [0082] As can be seen from FIG. 14a, as a result of the 8-week application experiment, it was observed that the tail color in the group treated with the liposomes including the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 was brighter than the tail color in the control group.

    [0083] In addition, as a result of confirmation of melanin distribution through F&M staining in FIGS. 14b and 14c, it can be verified that the amount of melanin distributed in the basal layer of the epidermis in the group treated with the peptide consisting of a peptide having ferulic acid bound to the N-terminus of the amino acid sequence of SEQ ID NO: 1 was significantly smaller than that in the control group.

    [0084] Although the present invention has been described in detail with reference to the specific features, it will be apparent to those skilled in the art that this description is only for a preferred embodiment and does not limit the scope of the present invention. Thus, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

    [0085] This application contains references to amino acid sequences and/or nucleic acid sequences which have been submitted herewith as the sequence listing text file. The aforementioned sequence listing is hereby incorporated by reference in its entirety pursuant to 37 C.F.R. 1.52(e).