GENETICALLY ENCODED LIPID-POLYPEPTIDE HYBRID BIOMATERIALS THAT EXHIBIT TEMPERATURE TRIGGERED HIERARCHICAL SELF-ASSEMBLY
20190328662 ยท 2019-10-31
Inventors
Cpc classification
C12Y203/01097
CHEMISTRY; METALLURGY
C07K2319/90
CHEMISTRY; METALLURGY
C07K14/78
CHEMISTRY; METALLURGY
C12N2501/00
CHEMISTRY; METALLURGY
C07K2319/033
CHEMISTRY; METALLURGY
A61K9/1075
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C07K2319/735
CHEMISTRY; METALLURGY
A61K9/0019
HUMAN NECESSITIES
C12N9/1029
CHEMISTRY; METALLURGY
A61K47/42
HUMAN NECESSITIES
International classification
A61K47/42
HUMAN NECESSITIES
Abstract
Disclosed herein are conjugates including a fatty acid, a self-assembly domain, and a polypeptide, where the conjugates have phase transition behavior. Further disclosed are methods of using the conjugates to treat disease, methods of delivering an agent, and methods of preparing the conjugates.
Claims
1. A conjugate comprising: a fatty acid; a self-assembly domain comprising a sequence of 5 to 10 amino acids that is a substrate of a lipid enzyme transferase and that adopts a secondary structure at about 25 C., a pH of about 7, and a salt concentration of about 150 mM; and a polypeptide, wherein the fatty acid is N-terminal to the self-assembly domain, the polypeptide is C-terminal to the self-assembly domain, and the conjugate has a first phase transition at a transition temperature (T.sub.t) and a second phase transition at a critical temperature (T.sub.c), the T.sub.c being higher than the T.sub.t.
2. The conjugate of claim 1, wherein the fatty acid is selected from myristic acid, palmitic acid, lauric acid, arachidic acid, strearic acid, erucic acid, oleic acid, arachidonic acid, linoleic acid, and linolenic acid.
3. The conjugate of claim 2, wherein the fatty acid is myristic acid.
4. The conjugate of claim 1, wherein the self-assembly domain comprises a glycine at the N-terminus.
5. The conjugate of claim 1, wherein the self-assembly domain comprises an amino acid sequence of (G[XZ].sub.n) (SEQ ID NO:1) wherein X is an amino acid, Z is an amino acid more polar than X, and n is an integer from 2 to 5.
6. The conjugate of claim 1, wherein the self-assembly domain comprises an amino acid sequence of (GAGA), (GAGAS) (SEQ ID NO:2), (GAGAGAY) (SEQ ID NO:3), or (GLSLS) (SEQ ID NO:4).
7. The conjugate of claim 1, wherein the self-assembly domain adopts a beta-sheet secondary structure at about 25 C., a pH of about 7, and a salt concentration of about 150 mM.
8. The conjugate of claim 1, wherein the conjugate further comprises a linker in between the self-assembly domain and the polypeptide.
9. The conjugate of claim 8, wherein the linker comprises an amino acid sequence selected from (GGC), ([GGC].sub.8) (SEQ ID NO:5), ([G.sub.4S].sub.3) (SEQ ID NO:6), and [GGS].sub.n (SEQ ID NO:7), wherein n is an integer from 1 to 10.
10. The conjugate of claim 1, wherein the polypeptide comprises a repeated unstructured polypeptide or a non-repeated unstructured polypeptide.
11. The conjugate of claim 1, wherein the polypeptide comprises a zwitterionic polypeptide.
12. The conjugate of claim 1, wherein the polypeptide comprises an amino acid sequence of [GVGVP].sub.n (SEQ ID NO:8), wherein n is an integer from 10 to 120.
13. The conjugate of claim 1, wherein the conjugate self-assembles into aggregates above the T.sub.t of the conjugate.
14. The conjugate of claim 13, wherein the conjugate self-assembles into aggregates in three phases relative to the T.sub.t and the T.sub.c of the conjugate, wherein the three phases comprise: (1) a first phase at a temperature below the T.sub.t, wherein the conjugate is soluble and self-assembles into nanoscale aggregates; (2) a second phase at a temperature above the T.sub.t and below the T.sub.c, wherein the conjugate forms micron-sized aggregates; and (3) a third phase at a temperature greater than the T.sub.c, wherein the conjugate forms macroscale aggregates that are visible to the naked eye.
15. The conjugate of claim 14, wherein the aggregate comprises a micelle.
16. The conjugate of claim 14, wherein the aggregate comprises a rod-like structure.
17. The conjugate of claim 14, wherein the aggregate comprises a sheet.
18. A drug delivery composition comprising: a plurality of conjugates as detailed in claim 1 self-assembled into a micelle; and an agent encapsulated within the micelle.
19.-32. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
DETAILED DESCRIPTION
[0058] Described herein are conjugates that include a fatty acid-modified polypeptide. The conjugates are thermally responsive and exhibit temperature-triggered hierarchical self-assembly into aggregates. The aggregates have a varied structure and material properties that can be tailored at the sequence level. The conjugates may be easily tailored and expressed recombinantly using a post-translational lipidation methodology, such that the synthesis of the conjugates may be easily regulated and amplified for commercial manufacturing. The control over the self-assembly of the aggregates conferred by the responsiveness of the conjugates to temperature makes the conjugates attractive for a range of applications, such as injectable biomaterials, and provides the ability to trigger the self-assembly of the conjugates on demand.
1. Definitions
[0059] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.
[0060] The terms comprise(s), include(s), having, has, can, contain(s), and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms a, and and the include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments comprising, consisting of and consisting essentially of, the embodiments or elements presented herein, whether explicitly set forth or not.
[0061] For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
[0062] The term about as used herein as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain aspects, the term about refers to a range of values that fall within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
[0063] Amino acid as used herein refers to naturally occurring and non-natural synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code. Amino acids can be referred to herein by either their commonly known three-letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Amino acids include the side chain and polypeptide backbone portions.
[0064] The terms control, reference level, and reference are used herein interchangeably. The reference level may be a predetermined value or range, which is employed as a benchmark against which to assess the measured result. Control group as used herein refers to a group of control subjects. The predetermined level may be a cutoff value from a control group. The predetermined level may be an average from a control group. Cutoff values (or predetermined cutoff values) may be determined by Adaptive Index Model (AIM) methodology. Cutoff values (or predetermined cutoff values) may be determined by a receiver operating curve (ROC) analysis from biological samples of the patient group. ROC analysis, as generally known in the biological arts, is a determination of the ability of a test to discriminate one condition from another, e.g., to determine the performance of each marker in identifying a patient having CRC. A description of ROC analysis is provided in P. J. Heagerty et al. (Biometrics 2000, 56, 337-44). Alternatively, cutoff values may be determined by a quartile analysis of biological samples of a patient group. For example, a cutoff value may be determined by selecting a value that corresponds to any value in the 25th-75th percentile range, preferably a value that corresponds to the 25th percentile, the 50th percentile or the 75th percentile, and more preferably the 75th percentile. Such statistical analyses may be performed using any method known in the art and can be implemented through any number of commercially available software packages (e.g., from Analyse-it Software Ltd., Leeds, UK; StataCorp LP, College Station, Tex.; SAS Institute Inc., Cary, N.C.). The healthy or normal levels or ranges for a target or for a protein activity may be defined in accordance with standard practice. A control may be a subject, or a sample therefrom, whose disease state is known. The subject, or sample therefrom, may be healthy, diseased, diseased prior to treatment, diseased during treatment, or diseased after treatment, or a combination thereof.
[0065] The term expression vector indicates a plasmid, a virus or another medium, known in the art, into which a nucleic acid sequence for encoding a desired protein can be inserted or introduced.
[0066] The term host cell is a cell that is susceptible to transformation, transfection, transduction, conjugation, and the like with a nucleic acid construct or expression vector. Host cells can be derived from plants, bacteria, yeast, fungi, insects, animals, etc. In some embodiments, the host cell includes Escherichia coli.
[0067] Polynucleotide as used herein can be single stranded or double stranded, or can contain portions of both double stranded and single stranded sequence. The polynucleotide can be nucleic acid, natural or synthetic, DNA, genomic DNA, cDNA, RNA, or a hybrid, where the polynucleotide can contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, and isoguanine. Polynucleotides can be obtained by chemical synthesis methods or by recombinant methods.
[0068] A peptide or polypeptide is a linked sequence of two or more amino acids linked by peptide bonds. The polypeptide can be natural, synthetic, or a modification or combination of natural and synthetic. Peptides and polypeptides include proteins such as binding proteins, receptors, and antibodies. The terms polypeptide, protein, and peptide are used interchangeably herein. Primary structure refers to the amino acid sequence of a particular peptide. Secondary structure refers to locally ordered, three dimensional structures within a polypeptide. These structures are commonly known as domains, e.g., enzymatic domains, extracellular domains, transmembrane domains, pore domains, and cytoplasmic tail domains. Domains are portions of a polypeptide that form a compact unit of the polypeptide and are typically 15 to 350 amino acids long. Exemplary domains include domains with enzymatic activity or ligand binding activity. Typical domains are made up of sections of lesser organization such as stretches of beta-sheet and alpha-helices. Tertiary structure refers to the complete three dimensional structure of a polypeptide monomer. Quaternary structure refers to the three dimensional structure formed by the noncovalent association of independent tertiary units. A motif is a portion of a polypeptide sequence and includes at least two amino acids. A motif may be 2 to 20, 2 to 15, or 2 to 10 amino acids in length. In some embodiments, a motif includes 3, 4, 5, 6, or 7 sequential amino acids.
[0069] Recombinant when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein, or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed, or not expressed at all.
[0070] Sample or test sample as used herein can mean any sample in which the presence and/or level of a polypeptide, conjugate, or target is to be detected or determined. Samples may include liquids, solutions, emulsions, or suspensions. Samples may include a medical sample. Samples may include any biological fluid or tissue, such as blood, whole blood, fractions of blood such as plasma and serum, muscle, interstitial fluid, sweat, saliva, urine, tears, synovial fluid, bone marrow, cerebrospinal fluid, nasal secretions, sputum, amniotic fluid, bronchoalveolar lavage fluid, gastric lavage, emesis, fecal matter, lung tissue, peripheral blood mononuclear cells, total white blood cells, lymph node cells, spleen cells, tonsil cells, cancer cells, tumor cells, bile, digestive fluid, skin, or combinations thereof. In some embodiments, the sample comprises an aliquot. In other embodiments, the sample comprises a biological fluid. Samples can be obtained by any means known in the art. The sample can be used directly as obtained from a patient or can be pre-treated, such as by filtration, distillation, extraction, concentration, centrifugation, inactivation of interfering components, addition of reagents, and the like, to modify the character of the sample in some manner as discussed herein or otherwise as is known in the art.
[0071] Subject as used herein can mean a mammal that wants or is in need of the herein described conjugates. The subject may be a human or a non-human animal. The subject may be a mammal. The mammal may be a primate or a non-primate. The mammal can be a primate such as a human; a non-primate such as, for example, dog, cat, horse, cow, pig, mouse, rat, camel, llama, goat, rabbit, sheep, hamster, and guinea pig; or non-human primate such as, for example, monkey, chimpanzee, gorilla, orangutan, and gibbon. The subject may be of any age or stage of development, such as, for example, an adult, an adolescent, or an infant.
[0072] Treatment or treating, when referring to protection of a subject from a disease, means preventing, suppressing, repressing, ameliorating, or completely eliminating the disease. Preventing the disease involves administering a composition of the present invention to a subject prior to onset of the disease. Suppressing the disease involves administering a composition of the present invention to a subject after induction of the disease but before its clinical appearance. Repressing or ameliorating the disease involves administering a composition of the present invention to a subject after clinical appearance of the disease.
[0073] Zwitterionic or zwitterion refers to a molecule with net charge of zero, but including negative and positive charges on independent individual atoms within the molecule. The charged atoms are joined by one or more covalent bonds. A polypeptide may be zwitterionic.
2. Conjugates
[0074] Provided herein are conjugates including a fatty acid, a self-assembly domain, and a polypeptide. The self-assembling domain may adopt a secondary structure at physiological conditions, such as about 25 C., a pH of about 7, and a salt concentration of about 150 mM, and may be a substrate of a lipid enzyme transferase, where the lipid enzyme transferase can conjugate the fatty acid to the self-assembly domain. The conjugate may have at least two phase transitions at two distinct temperatures. For example, the conjugate may have a first phase transition at about a transition temperature (T.sub.twhich is further described below) and a second phase transition at about a critical temperature (T.sub.awhich is further described below), the T.sub.c being higher than the T.sub.t. The phase transitions of the conjugate can result in the conjugate forming different aggregate structures.
[0075] a. Fatty Acid
[0076] The conjugates may include at least one fatty acid. Fatty acids include a carboxylic acid head and an aliphatic hydrocarbon chain tail. The hydrocarbon chain may be saturated or unsaturated. In some embodiments, the hydrocarbon chain comprises 2 carbon atoms to 28 carbon atoms (e.g., C2-C28), such as C2-C20, C4-C28 or C6-C18. In some embodiments, the hydrocarbon chain comprises an even number of carbon atoms. In some embodiments, the hydrocarbon chain is branched. In some embodiments, the hydrocarbon chain is linear with no branches. The fatty acid may be any substrate of a lipid enzyme transferase. In some embodiments, the fatty acid may be a substrate of N-myristoyl transferase (NMT), including natural substrates and unnatural substrates. The fatty acid may be selected from, for example, myristic acid, and natural and unnatural analogues thereof. In some embodiments, the fatty acid comprises myristic acid. In some embodiments, the fatty acid is myristic acid.
[0077] In addition, the fatty acid may have a melting temperature when not part of the disclosed conjugate (e.g., as an individual molecule not conjugated to the self-assembling domain). The melting temperature of the unconjugated fatty acid may correspond to an upper limit of the T.sub.c of the conjugate. For example, the T.sub.c of the conjugate may not be greater than the melting point of the unconjugated fatty acid.
[0078] b. Self-Assembly Domain
[0079] The conjugate may include a self-assembly domain. The self-assembling domain may serve as a substrate for a lipid enzyme transferase to conjugate a fatty acid thereto. For example, the self-assembling domain may serve as a substrate for N-myristoyl transferase to conjugate myristic acid thereto. In addition, the self-assembly domain is a polypeptide that can adopt a secondary structure under physiological conditions, such as at about 25 C., a pH of about 7, and a salt concentration of about 150 mM (e.g., the conditions found in phosphate buffered saline). For example, the self-assembly domain may form a -sheet secondary structure at about 25 C., a pH of about 7, and a salt concentration of about 150 mM.
[0080] The self-assembly domain may be 2 to 20 amino acids in length, such as 2 to 18 or 5 to 10 amino acids in length. In some embodiments, the self-assembly domain comprises 5-6 amino acids. The self-assembly domain may comprise alternating polar and non-polar amino acids. In some embodiments, the self-assembly domain comprises an amino acid sequence of (G[XZ].sub.n) (SEQ ID NO:1) wherein X is an amino acid, Z is an amino acid more polar than X, and n is an integer from 2 to 5. Z may participate in hydrogen bonds as a proton donor or acceptor. Z may be charged positive or negative, or may be uncharged or neutral. Z may include Gin, Asn, Cys, Gly, Ser, Thr, Tyr, Arg, Asp, Glu, Lys, His, and Trp. In some embodiments, Z is selected from the group consisting of Gin, Asn, Cys, Gly, Ser, Thr, Tyr, Arg, Asp, Glu, Lys, His, and Trp. X may be hydrophobic. X may be uncharged or neutral. X may include Ala, lie, Leu, Met, Phe, Val, Pro, Gly, and Trp. In some embodiments, X is selected from the group consisting of Ala, Ile, Leu, Met, Phe, Val, Pro, Gly, and Trp. In some embodiments, the self-assembly domain comprises a glycine at the N-terminal end. In some embodiments, the self-assembly domain comprises an amino acid sequence of (GAGA), (GAGAS) (SEQ ID NO:2), (GAGAGAY) (SEQ ID NO:3), or (GLSLS) (SEQ ID NO:4), or a combination thereof. In some embodiments, the conjugate may further include an arginine residue at the N-terminal end of the self-assembly domain. The arginine may facilitate tryptic digest of the conjugate.
[0081] c. Polypeptide
[0082] The conjugate may include a polypeptide. In some embodiments, the polypeptide comprises a repeated unstructured polypeptide, a non-repeated unstructured polypeptide, or a zwitterionic polypeptide, or a combination thereof. The unconjugated polypeptide (e.g., the polypeptide as an individual molecule not conjugated to the self-assembling domain) has phase transition behavior, wherein the unconjugated polypeptide changes phase at a transition temperature T.sub.t. The T.sub.t of the unconjugated polypeptide may affect the T.sub.t of the conjugate.
[0083] In some embodiments, the polypeptide comprises an amino acid sequence of [GVGVP].sub.n (SEQ ID NO:8), wherein n is an integer from 1 to 200. In some embodiments, the polypeptide comprises an amino acid sequence of [GVGVP].sub.n (SEQ ID NO:8), wherein n is an integer from 10 to 120. In some embodiments, the polypeptide comprises an amino acid sequence of [GVGVP].sub.n (SEQ ID NO:8), wherein n is an integer from 20 to 60.
[0084] (1) Repeated Unstructured Polypeptide
[0085] The polypeptide may comprise a repeated unstructured polypeptide. The repeated unstructured polypeptide may comprise any polypeptide that has minimal or no secondary structure as observed by CD, having phase transition behavior, and comprising a repeated amino acid sequence.
[0086] In some embodiments, the repeated unstructured polypeptide comprises an amino acid sequence that is rich in proline and glycine. In some embodiments, the repeated unstructured polypeptide comprises a PG motif. In some embodiments, the repeated unstructured polypeptide comprises a plurality of repeated PG motifs. A PG motif comprises an amino acid sequence selected from PG, P(X).sub.nG (SEQ ID NO:9), and (U).sub.mP(X).sub.nG(Z).sub.p (SEQ ID NO: 10), or a combination thereof, wherein m, n, and p are independently an integer from 1 to 15, and wherein U, X, and Z are independently any amino acid. P(X).sub.nG (SEQ ID NO:9) may include PXG, PXXG, PXXXG (SEQ ID NO:11), PXXXXG (SEQ ID NO:12), PXXXXXG (SEQ ID NO:13), PXXXXXXG (SEQ ID NO:14), PXXXXXXXG (SEQ ID NO:15), PXXXXXXXXG (SEQ ID NO:16), PXXXXXXXXXG (SEQ ID NO:17), PXXXXXXXXXXG (SEQ ID NO:18), PXXXXXXXXXXXG (SEQ ID NO:19), PXXXXXXXXXXXXG (SEQ ID NO:20), PXXXXXXXXXXXXXG (SEQ ID NO:21), PXXXXXXXXXXXXXXG (SEQ ID NO:22), and/or PXXXXXXXXXXXXXXXG (SEQ ID NO:23). The repeated unstructured polypeptide may further include additional amino acids at the C-terminal and/or N-terminal end of the PG motif. These amino acids surrounding the PG motif may also be part of the overall repeated motif. The amino acids that surround the PG motif may balance the overall hydrophobicity and/or charge so as to control the T.sub.t of the repeated unstructured polypeptide.
[0087] In some embodiments, the repeated unstructured polypeptide comprises an amino acid sequence of [GVGVP].sub.n (SEQ ID NO:8), wherein n is an integer from 1 to 200.
[0088] In some embodiments, the repeated unstructured polypeptide comprises one or more thermally responsive polypeptides. Thermally responsive polypeptides may include, for example, elastin-like polypeptides (ELP). ELP refers to a polypeptide comprising the pentapeptide repeat sequence (VPGXG).sub.n (SEQ ID NO:24), wherein X is any amino acid except proline and n is an integer greater than or equal to 1. The repeated unstructured polypeptide may comprise an amino acid sequence consisting of (VPGXG).sub.n (SEQ ID NO:24). In some embodiments, X is not proline. In some embodiments, n is 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300. In some embodiments, n may be less than 500, less than 400, less than 300, less than 200, or less than 100. In some embodiments, n may be from 1 and 500, from 1 and 400, from 1 and 300, or from 1 and 200. In some embodiments, n is 60, 120, or 180.
[0089] In other embodiments, the thermally responsive polypeptide comprises a resilin-like polypeptide (RLP). RLPs are derived from Rec1-resilin. Rec1-resilin is environmentally responsive and exhibits a dual phase transition behavior. The thermally responsive RLPs can have LCST and UCST (Li et. al, Macromol. Rapid Commun. 2015, 36, 90-95). Additional examples of suitable thermally responsive polypeptides are described in U.S. Patent Application Publication Nos. US 2012/0121709, filed May 17, 2012, and US 2015/0112022, filed Apr. 23, 2015.
[0090] (2) Non-Repeated Unstructured Polypeptide
[0091] The polypeptide may comprise a non-repetitive unstructured polypeptide. In some embodiments, the non-repeated unstructured polypeptide comprises a sequence of at least 60 amino acids, wherein at least about 10% of the amino acids are proline (P), and wherein at least about 20% of the amino acids are glycine (G). In some embodiments, the non-repeated unstructured polypeptide comprises a sequence wherein at least about 40% of the amino acids are selected from the group consisting of valine (V), alanine (A), leucine (L), lysine (K), threonine (T), isoleucine (I), tyrosine (Y), serine (S), and phenylalanine (F). In some embodiments, the non-repeated unstructured polypeptide comprises a sequence that does not contain three contiguous identical amino acids, wherein any 5-10 amino acid subsequence does not occur more than once in the non-repeated unstructured polypeptide, and wherein when the non-repeated unstructured polypeptide comprises a subsequence starting and ending with proline (P), the subsequence further comprises at least one glycine (G). As used herein, the term subsequence refers to a sequence of contiguous amino acids that occurs within another sequence of contiguous amino acids. A subsequence includes at least two amino acids. In some embodiments, a subsequence is 2 to 20, 2 to 15, or 2 to 10 sequential amino acids in length. In some embodiments, a subsequence includes 3, 4, 5, 6, 7, 8, 9, or 10 sequential amino acids. In some embodiments, the non-repeated unstructured polypeptide comprises a sequence of at least 60 amino acids, wherein at least about 10% of the amino acids are proline (P), wherein at least about 20% of the amino acids are glycine (G), wherein at least about 40% of the amino acids are selected from the group consisting of valine (V), alanine (A), leucine (L), lysine (K), threonine (T), isoleucine (I), tyrosine (Y), serine (S), and phenylalanine (F), wherein the sequence does not contain three contiguous identical amino acids, wherein any 5-10 amino acid subsequence does not occur more than once in the non-repeated unstructured polypeptide, and wherein when the non-repeated unstructured polypeptide comprises a subsequence starting and ending with proline (P), the subsequence further comprises at least one glycine (G).
[0092] (3) Zwitterionic Polypeptide
[0093] The polypeptide may comprise a zwitterionic polypeptide (ZiPP). ZiPPs are overall neutral polypeptides that include both amino acids with negative charge and amino acids with positive charge. ZiPPs may comprise one or more charged motifs. The charged motif includes one or more positively charged amino acids and one or more negatively charged amino acids, wherein the positively charged amino acids and negatively charged amino acids are present in a ratio of 1:1. In some embodiments, the net charge of the motif is neutral. In some embodiments, the charged motif is a zwitterionic motif. The positively charged amino acids within one motif may be the same or different. The negatively charged amino acids within one motif may be the same or different. As used herein, the charge of an amino acid (positive and/or negative) refers to the charge of the amino acid side chain. A charged amino acid is positively and/or negatively charged at neutral pH, at physiological pH, or at the local pH within the protein fold, or a combination thereof. The charged motif may further include one or more uncharged amino acids. In some embodiments, the charged motif has an amino acid sequence of VPX.sub.1X.sub.2G (SEQ ID NO:25), wherein X, is a negatively or positively charged amino acid, and wherein X.sub.2 is the other of a negatively or positively charged amino acid.
[0094] In some embodiments, the zwitterionic polypeptide comprises a plurality of charged motifs. The plurality of charged motifs may be repeated. In some embodiments, the zwitterionic polypeptide comprises the amino acid sequence of (VPX.sub.1X.sub.2G).sub.n, wherein X.sub.1 is a negatively or positively charged amino acid, X.sub.2 is the other of a negatively or positively charged amino acid, and n is an integer greater than or equal to 1. For example, X.sub.1 may not be the same charge as X.sub.2. X.sub.1 may be the same or different between adjacent motifs. X.sub.2 may be the same or different between adjacent motifs. In some embodiments, n is an integer less than or equal to about 100, 200, 300, 400, or 500. In some embodiments, n is an integer greater than or equal to about 1, 10, 50, 100, 150, or 200. In some embodiments, n is an integer from about 10 to about 500, from about 10 to about 200, from about 10 to about 100, from about 10 to about 50, from about 1 to about 500, from about 1 to about 200, from about 1 to about 100, or from about 1 to about 50. In some embodiments, n is an integer equal to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or 500. In some embodiments, a zwitterionic polypeptide comprises the amino acid sequence of (VPX.sub.1X.sub.2G).sub.n (SEQ ID NO:25), wherein X.sub.1 is a negatively or positively charged amino acid, X.sub.2 is the other of a negatively or positively charged amino acid, and n is an integer greater than or equal to 1, may be referred to as a homopolymer.
[0095] In some embodiments, the zwitterionic polypeptide includes one or more uncharged motifs in addition to the one or more charged motifs. The uncharged motif includes uncharged amino acids. In some embodiments, the uncharged motif does not include any charged amino acids. In some embodiments, the uncharged motif has an amino acid sequence consisting of VPGXG (SEQ ID NO:26), wherein X is any amino acid except proline.
[0096] A plurality of uncharged motifs may be repeated in tandem. In some embodiments, the zwitterionic polypeptide comprises the amino acid sequence of (VPGXG).sub.n (SEQ ID NO:24) in addition to the one or more charged motifs, wherein X is any amino acid except proline, and n is an integer greater than or equal to 1. In some embodiments, n is an integer less than or equal to about 100, 200, 300, 400, or 500. In some embodiments, n is an integer greater than or equal to about 1, 10, 50, 100, 150, or 200. In some embodiments, n is an integer from about 10 to about 500, from about 10 to about 200, from about 10 to about 100, from about 10 to about 50, from about 1 to about 500, from about 1 to about 200, from about 1 to about 100, or from about 1 to about 50. In some embodiments, n is an integer equal to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or 500. In some embodiments, zwitterionic polypeptides comprising an uncharged motif having an amino acid sequence consisting of (VPGXG).sub.n (SEQ ID NO:24) in addition to the one or more charged motifs, wherein X is any amino acid except proline, and n is an integer greater than or equal to 1, are referred to as elastin-like polypeptides (ELP).
[0097] The motifs of the zwitterionic polypeptide can be arranged in any number of possible ways. Examples of possible arrangements and architectures include a homopolymer, a diblock polymer, and a multiblock polymer. A homopolymer is wherein each unit is a repeat of the pentapeptide sequence VPX.sub.1X.sub.2G, or charged motif. In a diblock architecture, one block of polymer is made with a repeating charged motif, while the other part includes a repeating uncharged motif. In a multiblock polymer, the charged motifs and uncharged motifs are placed at different sites to increase diversity of the polymer. The particular number, identity, and arrangement of motifs may be designed and varied. In some embodiments, one or more uncharged motifs are positioned between at least two adjacent charged motifs of the zwitterionic polypeptide. In some embodiments, the zwitterionic polypeptide includes a plurality of charged motifs repeated in tandem and a plurality of uncharged motifs repeated in tandem. In some embodiments, the plurality of charged motifs repeated in tandem are positioned C-terminal to the plurality of uncharged motifs repeated in tandem. In some embodiments, the plurality of charged motifs repeated in tandem are positioned N-terminal to the plurality of uncharged motifs repeated in tandem.
[0098] In some embodiments, the zwitterionic polypeptide comprises the amino acid sequence of (VPX.sub.1X.sub.2G).sub.n(VPGXG).sub.m (SEQ ID NO:27), wherein X.sub.1 is a negatively or positively charged amino acid, X.sub.2 is the other of a negatively or positively charged amino acid, X is any amino acid except proline, and n and m are independently an integer greater than or equal to 1. In some embodiments, n is an integer less than or equal to about 100, 200, 300, 400, or 500. In some embodiments, n is an integer greater than or equal to about 1, 10, 50, 100, 150, or 200. In some embodiments, n is an integer from about 10 to about 500, from about 10 to about 200, from about 10 to about 100, from about 10 to about 50, from about 1 to about 500, from about 1 to about 200, from about 1 to about 100, or from about 1 to about 50. In some embodiments, n is an integer equal to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or 500. In some embodiments, m is an integer less than or equal to about 100, 200, 300, 400, or 500. In some embodiments, m is an integer greater than or equal to about 1, 10, 50, 100, 150, or 200. In some embodiments, m is an integer from about 10 to about 500, from about 10 to about 200, from about 10 to about 100, from about 10 to about 50, from about 1 to about 500, from about 1 to about 200, from about 1 to about 100, or from about 1 to about 50. In some embodiments, m is an integer equal to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or 500. In some embodiments, a zwitterionic polypeptide comprising the amino acid sequence of (VPX.sub.1X.sub.2G).sub.n(VPGXG).sub.m (SEQ ID NO:27), wherein X.sub.1 is a negatively or positively charged amino acid, X.sub.2 is the other of a negatively or positively charged amino acid, X is any amino acid except proline, and n and m are independently an integer greater than or equal to 1, may be referred to as a diblock polymer.
[0099] In some embodiments, the zwitterionic polypeptide comprises the amino acid sequence of (VPGXG).sub.m(VPX.sub.1X.sub.2G).sub.n (SEQ ID NO:28), wherein X.sub.1 is a negatively or positively charged amino acid, X.sub.2 is the other of a negatively or positively charged amino acid, X is any amino acid except proline, and n and m are independently an integer greater than or equal to 1. In some embodiments, n is an integer less than or equal to about 100, 200, 300, 400, or 500. In some embodiments, n is an integer greater than or equal to about 1, 10, 50, 100, 150, or 200. In some embodiments, n is an integer from about 10 to about 500, from about 10 to about 200, from about 10 to about 100, from about 10 to about 50, from about 1 to about 500, from about 1 to about 200, from about 1 to about 100, or from about 1 to about 50. In some embodiments, n is an integer equal to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or 500. In some embodiments, m is an integer less than or equal to about 100, 200, 300, 400, or 500. In some embodiments, m is an integer greater than or equal to about 1, 10, 50, 100, 150, or 200. In some embodiments, m is an integer from about 10 to about 500, from about 10 to about 200, from about 10 to about 100, from about 10 to about 50, from about 1 to about 500, from about 1 to about 200, from about 1 to about 100, or from about 1 to about 50. In some embodiments, m is an integer equal to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, 300, 305, 310, 315, 320, 325, 330, 335, 340, 345, 350, 355, 360, 365, 370, 375, 380, 385, 390, 395, 400, 405, 410, 415, 420, 425, 430, 435, 440, 445, 450, 455, 460, 465, 470, 475, 480, 485, 490, 495, or 500. In some embodiments, a zwitterionic polypeptide comprising the amino acid sequence of (VPGXG).sub.m(VPX.sub.1X.sub.2G).sub.n (SEQ ID NO:28), wherein X.sub.1 is a negatively or positively charged amino acid, X.sub.2 is the other of a negatively or positively charged amino acid, X is any amino acid except proline, and n and m are independently an integer greater than or equal to 1, may be referred to as a diblock polymer.
[0100] In some embodiments, the zwitterionic polypeptide comprises the amino acid sequence of {(VPX.sub.1X.sub.2G)(VPGXG)}.sub.b (SEQ ID NO:29), wherein X.sub.1 is a negatively or positively charged amino acid, X.sub.2 is the other of a negatively or positively charged amino acid, X is any amino acid except proline, and b is an integer greater than or equal to 1. In some embodiments, b is an integer less than or equal to about 100, 200, or 300. In some embodiments, b is an integer greater than or equal to about 1, 10, 50, 100, 150, or 200. In some embodiments, b is an integer from about 10 to about 300, from about 10 to about 200, from about 10 to about 100, from about 10 to about 50, from about 1 to about 300, from about 1 to about 200, from about 1 to about 100, or from about 1 to about 50. In some embodiments, b is an integer equal to about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, or 300. In some embodiments, a zwitterionic polypeptide comprising the amino acid sequence of {(VPX.sub.1X.sub.2G)(VPGXG)}.sub.b (SEQ ID NO:29), wherein X.sub.1 is a negatively or positively charged amino acid, X.sub.2 is the other of a negatively or positively charged amino acid, X is any amino acid except proline, and b is an integer greater than or equal to 1, may be referred to as a multiblock polymer.
[0101] In some embodiments, X.sub.1 is a negatively charged amino acid, and X.sub.2 is a positively charged amino acid. In some embodiments, X.sub.1 is a positively charged amino acid, and X.sub.2 is a negatively charged amino acid. In some embodiments, the negatively charged amino acid is independently selected from glutamatic acid and aspartic acid. In some embodiments, the positively charged amino acid is independently selected from lysine and arginine. In some embodiments, X is selected from arginine, histidine, lysine, aspartic acid, glutamic acid, serine, threonine, asparagine, glutamine, cysteine, selenocysteine, glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tyrosine, and tryptophan. In some embodiments, X is selected from glycine and valine.
[0102] iv) Linker
[0103] In some embodiments, the conjugate comprises a linker in between the self-assembly domain and the polypeptide. In some embodiments, the conjugate comprises a linker at the C-terminal end of the polypeptide. The linker may comprise a variety of amino acid sequences suitably known in the art. The linker may comprise, for example, an amino acid sequence selected from (GGC), ([GGC].sub.8) (SEQ ID NO:30), ([G.sub.4S].sub.3) (SEQ ID NO:31), and ([GGS].sub.n) (SEQ ID NO:32) wherein n is an integer from 1 to 10).
[0104] d. Phase Transition into Aggregates
[0105] Phase transition or transition may refer to the aggregation of the conjugate, which occurs sharply and in some instances reversibly at a specific temperature. Examples of specific temperatures include the T.sub.t and the T.sub.c of the conjugate. Below the T.sub.t, for example, the conjugate may be highly soluble. Upon heating above the transition temperature, for example, the conjugate may hydrophobically collapse and aggregate, forming a separate, phase. As mentioned above, the T.sub.t of the conjugate may be dependent on the T.sub.t of the unconjugated polypeptide. In some embodiments, the T.sub.t of the conjugate is about 15 C. to about 20 C. lower than the T.sub.t of the unconjugated polypeptide. The T.sub.t can be adjusted by varying the amino acid sequence of the polypeptide, by varying the length of the polypeptide, or a combination thereof.
[0106] The conjugate may have a T.sub.t from about 0 C. to about 100 C., such as from about 10 C. to about 50 C., or from about 20 C. to about 42 C. In some embodiments, the conjugate has a T.sub.t between room temperature (about 25 C.) and body temperature (about 37 C.). In some embodiments, the conjugate has its T.sub.t below body temperature or above body temperature at the concentration at which the conjugate is administered to a subject.
[0107] The T.sub.t may be a LCST. The T.sub.t may be a UCST. LCST is the temperature below which the conjugate is miscible. UCST is the temperature above which the conjugate is miscible. In some embodiments, the conjugate has only UCST behavior. In some embodiments, the conjugate has only LCST behavior. In some embodiments, the conjugate has both UCST and LCST behavior.
[0108] As mentioned above, the conjugate may also have a T.sub.c, which refers to a critical temperature at which the conjugate can undergo a second phase transition. The T.sub.c is a higher temperature than the T.sub.t of the conjugate. In some embodiments, the T.sub.c is a temperature that is above the T.sub.t and below the melting point of the unconjugated fatty acid. In some embodiments, the T.sub.c is about 10 C. to about 40 C. higher than the T.sub.t, such as about 15 C. to about 35 C. or about 20 C. to about 30 C. higher than the T.sub.t.
[0109] The phase of the conjugate may be described as, for example, soluble or an aggregate. The aggregate may be a variety of forms. The form and size of the aggregate may depend on the temperature, the sequence of the polypeptide, the sequence of the linker, or the fatty acid, or a combination thereof. The aggregate may be a micelle, a rod-like structure, a sheet, or a particle, or a combination thereof.
[0110] The aggregate may have a varying size depending on the phase or temperature. The aggregate may be, for example, nanoscale aggregates, micron-sized aggregates, or macroscale aggregates. In some embodiments, at a temperature below the T.sub.t the aggregate has a diameter or length of about 20 to about 100 nm. In some embodiments, at a temperature above the T.sub.t the aggregate has a diameter or length of about 1 m to about 1 cm. At the T.sub.t, the aggregate may change from soluble to an aggregate form, from an aggregate form to a soluble form, from a nanoscale aggregate to a micron-sized aggregate, from a nanoscale aggregate to a macroscale aggregate, from a micron-sized aggregate to a nanoscale aggregate, from a macroscale aggregate to a nanoscale aggregate, from a micron-sized aggregate to a macroscale aggregate, or from a macroscale aggregate to a micron-sized aggregate. In some embodiments, the conjugate is soluble below the T.sub.t. In some embodiments, the conjugate is soluble above the T.sub.t. In some embodiments, the conjugate is in the form of an aggregate below the T.sub.t. In some embodiments, the conjugate is in the form of an aggregate above the T.sub.t.
[0111] The conjugate can self-assemble into varying types of aggregates at different temperature phases dependent on the T.sub.t and the T.sub.c of the conjugate. The three phases may include a first phase, a second phase, and a third phase. The first phase may be at a temperature below the T.sub.t, wherein the conjugate is soluble and self-assembles into nanoscale aggregates. The second phase may be above the T.sub.t and below the T.sub.c, wherein the conjugate forms micron-sized aggregates. The third phase may be at a temperature greater than the T.sub.c, wherein the conjugate forms macroscale aggregates that are visible to the naked eye. In some embodiments, the conjugate can reversibly go from one phase to another phase (e.g., phase 1 to phase 2 to phase 1; or phase 1 to phase 2 to phase 3 to phase 2, etc.). In some embodiments, the conjugate upon entering phase 3 cannot reversibly transition to phase 1 or phase 2. In some embodiments, the conjugate can reversibly transition from phase 1 to phase 2 and vice versa, but upon entering phase 3 cannot reversibly transition to phase 1 or phase 2.
[0112] The conjugate can phase transition at varying temperatures. In some embodiments, the conjugate may comprise two individual phase transitions that occur from about 0 C. to about 100 C., such as from about 20 C. to about 65 C., from about 25 C. to about 60 C., or from about 30 C. to about 55 C. For example, the conjugate may phase transition from the first phase to the second phase at a temperature of about 30 C. to about 50 C. In addition, the conjugate may phase transition from the second phase to the third phase at a temperature of greater than 50 C.
[0113] In some embodiments, in a first phase, at a temperature below the T.sub.t, the hydrophobic collapse of the fatty acid drives the initial formation of nanoscale aggregates, such as spherical or cylindrical micelles. In some embodiments, in a second phase, at a temperature above the T.sub.t but below the T.sub.c, as the temperature is increased to just above the T.sub.t of the polypeptide, the interactions among portions of the polypeptide bring the structures into proximity to one another. In some embodiments, in a third phase, at a temperature above the T.sub.c, the desolvation of the polypeptide is intricately coupled to the final stages of self-assembly and morphogenesis of the final structure of the aggregate.
[0114] Phase transition behavior may be used to form drug depots within a tissue of a subject for controlled (slow) release of the conjugate. Phase transition behavior may also enable purification of the conjugate using inverse transition cycling, thereby eliminating the need for chromatography. Inverse transition cycling refers to a protein purification method for polypeptides having phase transition behavior, and the method may involve the use of the conjugate's reversible phase transition behavior to cycle the solution through soluble and insoluble phases, thereby removing contaminants and eliminating the need for chromatography.
[0115] In the above description of the phase transitions of the conjugate, the conjugate may have a varying concentration. For example, the conjugate may phase transition at a concentration of about 5 M to about 1 M, such as about 10 M to about 500 M, about 15 M to about 250 M, about 20 M to about 150 M, or about 25 M to about 100 M. In some embodiments, the conjugate may phase transition at a concentration that is suitable for administration to a subject.
[0116] e. Agent
[0117] In some embodiments, the conjugate may encapsulate an agent upon forming an aggregate. In some embodiments, the conjugate may release an agent upon resolubilizing out of the aggregate form. The agent may be a therapeutic. The agent may be a drug. In some embodiments, the agent is selected from a small molecule, nucleotide, polynucleotide, protein, polypeptide, lipid, carbohydrate, and a combination thereof. In some embodiments, the agent comprises a small molecule. In some embodiments, the agent comprises a protein. In some embodiments, the agent comprises a cancer therapeutic. In some embodiments, the agent comprises an antibody. In some embodiments, the agent is attached to a cysteine of the polypeptide of the conjugate. In some embodiments, the agent is hydrophobic.
[0118] In some embodiments, the conjugates detailed herein may form a drug delivery composition. The drug delivery composition may include a plurality of conjugates as detailed herein self-assembled into a micelle, with an agent encapsulated within the micelle. One or more agents may be encapsulated within the micelle.
[0119] f. Polynucleotides
[0120] Further provided are polynucleotides encoding the conjugates detailed herein. A vector may include the polynucleotide encoding the conjugates detailed herein. To obtain expression of a polypeptide, one may subclone the polynucleotide encoding the polypeptide into an expression vector that contains a promoter to direct transcription, a transcription/translation terminator, and if for a nucleic acid encoding a protein, a ribosome binding site for translational initiation. An example of a vector is pet24. Suitable bacterial promoters are well known in the art. Further provided is a host cell transformed or transfected with an expression vector comprising a polynucleotide encoding a conjugate as detailed herein. Bacterial expression systems for expressing the protein are available in, e.g., E. coli, Bacillus sp., and Salmonella (Paiva et al., Gene 1983, 22, 229-235; Mosbach et al., Nature 1983, 302, 543-545). Kits for such expression systems are commercially available. Eukaryotic expression systems for mammalian cells, yeast, and insect cells are well known in the art and are also commercially available. Retroviral expression systems can be used in the present invention.
[0121] The conjugate may be expressed recombinantly in a host cell according to one of skill in the art. The conjugate may be purified by any means known to one of skill in the art. For example, the conjugate may be purified using chromatography, such as liquid chromatography, size exclusion chromatography, or affinity chromatography, or a combination thereof. In some embodiments, the conjugate is purified without chromatography. In some embodiments, the conjugate is purified using inverse transition cycling.
[0122] g. Administration
[0123] A composition may comprise the conjugate. The conjugates as detailed herein can be formulated into a composition in accordance with standard techniques well known to those skilled in the pharmaceutical art. The composition may be prepared for administration to a subject. Such compositions comprising a conjugate can be administered in dosages and by techniques well known to those skilled in the medical arts taking into consideration such factors as the age, sex, weight, and condition of the particular subject, and the route of administration.
[0124] The conjugate can be administered prophylactically or therapeutically. In prophylactic administration, the conjugate can be administered in an amount sufficient to induce a response. In therapeutic applications, the conjugates are administered to a subject in need thereof in an amount sufficient to elicit a therapeutic effect. An amount adequate to accomplish this is defined as therapeutically effective dose. Amounts effective for this use will depend on, e.g., the particular composition of the conjugate regimen administered, the manner of administration, the stage and severity of the disease, the general state of health of the patient, and the judgment of the prescribing physician.
[0125] The conjugate can be administered by methods well known in the art as described in Donnelly et al. (Ann. Rev. Immunol. 1997, 15, 617-648); Feigner et al. (U.S. Pat. No. 5,580,859, issued Dec. 3, 1996); Feigner (U.S. Pat. No. 5,703,055, issued Dec. 30, 1997); and Carson et al. (U.S. Pat. No. 5,679,647, issued Oct. 21, 1997). The conjugate can be complexed to particles or beads that can be administered to an individual, for example, using a vaccine gun. One skilled in the art would know that the choice of a pharmaceutically acceptable carrier, including a physiologically acceptable compound, depends, for example, on the route of administration.
[0126] The conjugates can be delivered via a variety of routes. Typical delivery routes include parenteral administration, e.g., intradermal, intramuscular or subcutaneous delivery. Other routes include oral administration, intranasal, intravaginal, transdermal, intravenous, intraarterial, intratumoral, intraperitoneal, and epidermal routes. In some embodiments, the conjugate is administered intravenously, intraarterially, or intraperitoneally to the subject.
[0127] h. Methods
[0128] (1) Method of Preparing a Conjugate
[0129] The present invention is directed to a method of preparing a conjugate as detailed herein. The method may include (a) transforming a bacteria with a recombinant expression vector comprising a first polynucleotide encoding a first polypeptide and a second polynucleotide encoding a second polypeptide, wherein the first polypeptide comprises an N-myristoyl transferase (NMT), and wherein the second polypeptide comprises the self-assembly domain; and (b) culturing the transformed bacteria to express the first and second polypeptides and add myristic acid to the N-terminus of the self-assembly domain. In some embodiments, the method further includes (c) isolating the conjugate. In some embodiments, the bacteria comprise E. coli. In some embodiments, the bacteria is cultured in media comprising myristic acid. The myristic acid may be present in a concentration of about 0 to about 100 M, about 0 to about 200 M, about 1 M to about 100 M, or about 1 M to about 200 M. In some embodiments, the bacteria is cultured in media comprising the antibiotic. In some embodiments, the vector further comprises a single polynucleotide encoding a single antibiotic selection marker.
[0130] In some embodiments, the NMT comprises NMT from S. cerevisiae. In some embodiments, the NMT comprises an amino acid sequence consisting of residues 36-455 of NM_001182082.1 (S. cerevisiae NMT36-455).
[0131] Providing the disclosed conjugates by genetic methods (rather than chemical synthesis) may provide useful advantages, such as, but not limited to providing higher molecular weight conjugates. For example, the conjugate may have a molecular weight of about 12 kDa to about 30 kDa, such as about 15 kDa to about 25 kDa or about 15 kDa to about 20 kDa.
[0132] (2) Method of Treating a Disease
[0133] The present invention is directed to a method of treating a disease in a subject in need thereof. The method may include administering a drug delivery composition as detailed herein to the subject.
[0134] (3) Method of Delivering an Agent
[0135] The present invention is also directed to a method of delivering an agent to a subject. The method may include encapsulating the agent in a micelle, the micelle comprising a plurality of conjugates as detailed herein, and administering the micelle to the subject. In some embodiments, encapsulating comprises mixing the conjugates and agent and raising the temperature above the transition temperature (T.sub.t) of the conjugates.
[0136] (4) Method of Increasing the Maximum Tolerated Dose of an Agent
[0137] The present invention is directed to a method of increasing the maximum tolerated dose of an agent. The method may include encapsulating the agent in a micelle comprising a plurality of conjugates as detailed herein, and administering the agent-encapsulated micelle to a subject.
3. Examples
Example 1
Materials and Methods
Materials
[0138] The pETDuet-1 vector was purchased from EMD Millipore (Billerica, Mass.). All the restriction enzymes, ligase, and corresponding buffers were purchased from New England Biolabs (Ipswich, Mass.). Chemically competent Eb5alpha and BL21(DE3) cells were purchased from Edge Bio (Gaithersburg, Md.). DNA extraction and purification kits were purchased from Qiagen (Valencia, Calif.). Terrific broth medium (TB) was purchased from Amresco (Solon, Ohio). Isopropyl -D-1-thiogalactopyranoside (IPTG) was purchased from Bioline USA (Boston, Mass.). Myristic acid, N,N-diisopropylethylamine (DIPEA), 4-methylmorpholine, triisopropylsilane, alpha-cyano-4-hydroxycinnamic acid, and trifluoroacetic acid (TFA) were purchased from Sigma-Aldrich (St. Louis, Mo.). SnakeSkin Dialysis Tubing featuring 3.5K nominal molecular weight cut off (MWCO), mass spectroscopy grade Pierce trypsin protease, Alexa Fluor 488 NHS ester, and anhydrous dimethyl sulfoxide (DMSO) were purchased from Thermo Fisher Scientific (Waltham, Mass.). Rink amide resin (200-400 mesh, 0.6 meq/g), Fmoc-protected amino acids, O-benzotriazole-N,N,N,N-tetramethyluronium hexafluoro-phosphate (HBTU), and O-(6-Chlorobenzotriazol-1-yl)-N,N,N,N-tetramethyl-uronium hexafluoro-phosphate (HCTU) were purchased from Chem-Impex (Wood Dale, Ill.). Diethyl ether, dichloromethane (DCM), and high performance liquid chromatography-(HPLC) grade acetonitrile were purchased from VWR International (Radnor, Pa.) and were used as received without further purification. Anhydrous dimethylformamide (DMF) was purchased from EMD Millipore and was further dried over t.h.e. Desiccant (EMD Millipore) before use. Deionized water was obtained from a Milli-Q system (Thermo Scientific, CA).
[0139] ABIL EM 90 and TEGOSOFT DEC surfactants were purchased from Evonik Industries (Essen, Germany). Mineral oil was purchased from Sigma-Aldrich (St. Louis, Mo.). A single emulsion droplet chip was purchased from Dolomite Microfluidics (Royston, United Kingdom). Syringe pumps were purchased from Chemyx Inc. (Stafford, Tex.).
Recognition Sequence
[0140] In the design of our NMT recognition sequences, we checked the feasibility of myristoylation using an myristoylation predictor. The sequences and the predictor score are summarized in Table 1. We did not observe any myristoylation for the last recognition sequence, GVEVERGGSGGSGGS, consistent with the predictor score.
TABLE-US-00001 TABLE1 Myristoylationpredictorscoresforvarioussequencesinthis study Recognition NMT-The Sequence Query MYRPredictorScore B.sub.1 GAGASRGGSGGSGVGVPGVGVP 2.183 (SEQIDNO:30) (Reliablesite) B.sub.2 GAGAGAYRGGSGGSGGSGVG -1.045(Twilight VPGVGVP(SEQIDNO:31) zone,Likelysite) B.sub.3 GLSLSRGGSGGSGVGVPGVGVP 1.407 (SEQIDNO:32) (reliablesite) GVEVERGGSGGSGGSGVGVP -5.095(nositefor GVGVP(SEQIDNO:33) myristoylation)
[0141] As shown in Table 1, three out of four designed recognition sequences were myristoylated in our system. In our experiments, the MYR predictor appeared to be a reliable indicator of myristoylation for de novo designed sequences.
-Sheet Propensity of PA-Domain
[0142] We used two beta sheet propensity scales (Table 2). We are mindful that beta sheet propensities are context-dependent but in our system, we have used these relative propensities to score recognition sequences based on their propensity to form -sheets (B.sub.1<B.sub.2<B.sub.3) by comparing the first 8 amino acids, where the sequences are divergent. We have used this rough estimate also as an indirect surrogate for the stability of PA-domains. We point out that this treatment ignores secondary interactions such as the possible hydrogen bonds between the serine side chains.
TABLE-US-00002 TABLE 2 Experimentally observed thermodynamic scales for -sheet forming tendencies of amino acids in the FAME sequence Amino Acid G (kcal/mol) G (kcal/mol) Gly 1.2 1.21 Ala 0 0 Leu 0.51 0.45 Ser 0.70 0.87 Tyr 0.96 1.63 Arg 0.45 0.40 Val 0.82 0.94 Pro >3 Not determined
[0143] With alanine chosen as the reference, the more negative G values imply higher preference for -sheet formation.
ELP Domain
[0144] Our preliminary work demonstrated that myristoylation reduces the transition temperature (T.sub.t) of ELPs by 15 C. We have chosen the length of the ELP with the following two considerations: 1) we aimed to maintain the transition temperature of FAMEs approximately around 20-25 C. and thus aimed to choose ELP with original T.sub.t of 40 C., (GVGVP).sub.40 has a T.sub.t of 39 C. at the concentration of 100 M. 2) We also aimed to select an ELP segment as to avoid coacervation during the expression inside E. coli. Initially, we hypothesized that coacervation of the ELP may preclude the in situ enzymatic modification.
Gene Synthesis
[0145] Construction of the Expression Vector.
[0146]
TABLE-US-00003 (SEQIDNO:34) 5-CAATGGTATATCTTCCGGGCGCTATCATGCCATACCTTTTTATACCA TGGGCAGCAGCCATCACCATCATCACCACAAAGACCACAAATTTTGGCGT ACCCAGCCGGTTAAAGATTTTGATGAAAAAGTTCTTGAAGAAGGTCCGAT CGACAAACCGAAAACACCGGAAGATATTAGCGATAAACCGCTGCCGCTGC TGAGCAGCTTTGAATGGTGTAGCATTGATGTGGACAACAAAAAACAGCTG GAAGATGTTTTTGTGCTGCTGAACGAAAACTATGTGGAAGATCGTGATGC AGGTTTTCGGTTCAATTATACCAAAGAGTTTTTCAACTGGGCACTGAAAA GTCCGGGTTGGAAAAAAGATTGGCATATTGGTGTTCGTGTGAAAGAAACC CAGAAACTGGTTGCATTTATTAGCGCAATTCCGGTTACCCTGGGTGTGCG TGGTAAACAGGTTCCGAGCGTTGAAATTAACTTTCTGTGTGTTCATAAAC AGCTGCGTAGCAAACGTCTGACACCGGTTCTGATTAAAGAAATCACCCGT CGTGTGAACAAATGCGATATTTGGCATGCACTGTATACCGCAGGTATTGT TCTGCCTGCACCGGTTAGCACCTGTCGTTATACCCATCGTCCGCTGAACT GGAAAAAACTGTATGAAGTTGATTTCACCGGTCTGCCGGATGGTCATACC GAAGAAGATATGATTGCAGAAAATGCACTGCCTGCAAAAACCAAAACCGC AGGTCTGCGTAAACTGAAAAAAGAGGACATCGATCAGGTCTTTGAGCTGT TTAAACGTTATCAGAGCCGCTTTGAACTGATCCAGATTTTTACCAAAGAA GAGTTCGAGCACAACTTTATTGGTGAAGAAAGCCTGCCGCTGGATAAACA GGTCATTTTTAGCTATGTTGTTGAACAGCCGGATGGCAAAATTACCGATT TTTTCAGCTTTTATAGCCTGGCGTTTACCATTCTGAACAACACCAAATAC AAAGACCTGGGCATTGGCTATCTGTATTATTACGCAACCGATGCCGATTT CCAGTTTAAAGATCGTTTTGATCCGAAAGCAACCAAAGCCCTGAAAACCC GTCTGTGCGAACTGATTTATGATGCATGTATTCTGGCCAAAAACGCCAAC ATGGATGTTTTTAATGCACTGACCAGCCAGGATAATACCCTGTTTCTGGA TGATCTGAAATTTGGTCCGGGTGATGGTTTTCTGAATTTCTACCTGTTTA ACTATCGTGCCAAACCGATTACCGGTGGTCTGAATCCGGATAATAGCAAT GATATTAAACGTCGCAGCAATGTTGGTGTGGTTATGCTGTGATAATGATA ATGATCTTCTGAATTCCCGTCATATCCGCTGAGCAATAACTAGCATAACC CCTTATACGTTACAT-3'
[0147] This NMT(+) vector was then modified with the cDNA (see below) of each of the three de novo designed NMT signal sequences (B.sub.1-3) using the same Gibson Assembly method. The following genes (Integrated DNA Technologies) were ligated into MCS 2 after digesting the NMT(+) pETDuet-1 vector with NdeI and XhoI and purification of linearized vector. Importantly, these cDNA for NMT signal (recognition) sequence were designed to contain a BseRI recognition sequence which was engineered to cut directly after the peptide substrate gene. BseRI is a type IIS restriction enzyme that enables seamless cloning with our available in-house ELPs, many of which have been designed using the cloning system developed by McDaniel et al. (McDaniel, et al. Biomacromolecules 2010, 11, 944). After Gibson Assembly, these new ligated vectors were transformed into competent cells and we identified positive clones with T7 Terminator sequencing. The recognition sequences for NdeI and XhoI enzymes are underlined in the sequences below.
TABLE-US-00004 NMTRecognitionSequenceB.sub.1:(GAGASRGGSGGS) (SEQIDNO:35) (SEQIDNO:36) ATCTTAGTATATTAGTTAAGTATAAGAAGGAGATATACATATGGGGGCGG GCGCATCTCGTGGTGGCAGTGGTGGGAGCGGcTAATGATCTCCTCTATGA GGATCCGCTCGAGTCTGGTAAAGAAACCGCTGCTGCGAAATTTGAA NMTRecogntionSequenceB.sub.2:(GAGAGAYRGGSGGSGGS) (SEQIDNO:37) (SEQIDNO:38) CATCTTAGTATATTAGTTAAGTATAAGAAGGAGATATACATATGGGAGCG GGTGCAGGTGCCTATAGAGGTGGGTCGGGAGGCAGTGGAGGCTCAGGCTA ATGATCTCCTCAATGAGCTCGAGTCTGGTAAAGAAACCGCTGCTGCGAAA TTTGAACG NMTRecognitionSequenceB.sub.3:(GLSLSRGGSGGS) (SEQIDNO:39) (SEQIDNO:40) ATCTTAGTATATTAGTTAAGTATAAGAAGGAGATATACATATGGGGCTGA GCCTGTCTCGTGGTGGCAGTGGTGGGAGCGGCTAATGATCTCCTCAATGA GCTCGAGTCTGGTAAAGAAACCGGTGCTGCGAAATTTGAA
[0148] The final plasmid was constructed by digesting a plasmid containing the ELP gene and each NMT (+) vector (now containing NMT in MCS 1 and one of the three recognition sequences in MCS 2) with BseRI and XhoI. After gel purification, the ELP was ligated into each vector and transformed into EB5alpha cells. After confirming positive clones with T7 Terminator sequencing, the DNA was transformed into BL21(DE3) competent cells for expression.
[0149] Construction of Control Plasmids.
[0150]
[0151] Amino Acid Sequence of Proteins.
[0152] The amino acid sequences of the proteins used in this study are reported below. N-terminal methionine is shown in italics and was removed co-translationally by methionine aminopeptidase before modification with the myristoyl group. A lysine residue was included for fluorophore conjugation as shown (underlined). A single tryrosine residue was encoded at the C-terminal to assist with UV-Vis detection of the proteins.
TABLE-US-00005 ELP (SEQIDNO:41) MGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGV PGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGV PGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGV PGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGV PGY B.sub.1-ELP (SEQIDNO:42) MGAGASRGGSGGSGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGY B.sub.2-ELP (SEQIDNO:43) MGAGAGAYRGGSGGSGGSGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGY B.sub.3-ELP (SEQIDNO:44) MGLSLSRGGSGGSGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGY B.sub.1-ELP-GKG (SEQIDNO:45) MGAGASRGGSGGSGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGGKGY B.sub.2-ELP-GKG (SEQIDNO:46) MGAGAGAYRGGSGGSGGSGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGGKGY B.sub.3-ELP-GKG (SEQIDNO:47) MGLSLSRGGSGGSGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGGKGY
Expression Protocol
[0153] A single bacterial colony was selected to inoculate 50 mL of autoclaved TB medium containing 100 g/mL ampicillin at 37 C. on an orbital shaker at 200 rpm. After 12 h, the seed culture was centrifuged at 3500 rpm and 4 C. for 15 min to harvest the cells. The E. coli pellet was re-suspended in 6 mL of phosphate buffer saline (PBS) solution. 1 mL of this suspension was used to inoculate 1 L of autoclaved TB media containing 100 g/mL ampicillin. The bacteria were cultivated in an orbital shaker incubator at 37 C. at 180 rpm. After 6 h, the temperature of the incubator was reduced to 28 C. Myristic acid was added to each flask to a final concentration of 100 M (i.e., 1 mL of 100 mM myristic acid that had been dissolved in molecular biology grade DMSO was added to each flask). After 15 min, expression was induced by the addition of IPTG to a final concentration of 0.5 mM.
Protein Purification Protocol
[0154] After 18 h post-induction, the cells were harvested by centrifugation at 3500 rpm and 4 C. for 15 min. The bacterial pellet was re-suspended in PBS (5 mL PBS for each 1 L of expression culture). The cells were then lysed by two cycles of sonication at 4 C. using sequential pulses of 10 s at 85 W followed by 40 s resting-time for a total sonication period of 90 s. The lysed bacterial solution was transferred to polycarbonate centrifuge tubes and 10% w/v polyethylenimine (2 mL per every 1 L of expression culture) was added to remove the nucleic acid fragments. Each tube was vortexed several times to ensure complete mixing until a white homogenous precipitate appeared in the entire volume of the solution. After which, the solution was centrifuged at 14 krpm and 4 C. for 15 min to separate the protein from insoluble cell debris. The clear supernatant layer was transferred to clear polycarbonate tubes and was then subjected to two rounds of inverse transition cycling (ITC). First, we triggered the phase-transition of the Fatty Acid Modified ELPs (FAMEs) or ELPs isothermally by the addition of solid NaCl. The polymer coacervates were then collected by a hot spin centrifugation step at 15 krpm and 35 C. for 15 min, after which the supernatant was discarded. The pellet was then re-suspended in 4 mL of deionized H.sub.2O, and the tubes were placed in a tube rotisserie within a 4 C. refrigerator. After 1 h, the pellets were scraped with a metallic spatula to help the solubilization process. After 6 h, the mixture was centrifuged at 15 krpm and 4 C. for 15 min for a cold spin step, and then the pellet was discarded. The supernatant was delivered to a clean tube and was subjected to another round of ITC. For the second round of ITC, a 5 M NaCl aqueous solution was used to trigger the phase-transition of FAMEs or ELPs isothermally. After the second cold spin cycle, the supernatant was collected and purified by preparative HPLC as described below to ensure purity (>95%) for the self-assembly studies.
[0155] Reverse phase HPLC (RP-HPLC) was performed on a Waters 600 HPLC system (Phenomenex Jupiter 10 m C18 300 , LC Column 25021.2 mm, solvent A: H.sub.2O+0.1% TFA, solvent B: acetonitrile+0.1% TFA). A sample of the protein (0.5 mL, 5 mg/mL) was injected into the HPLC system using these conditions (TABLE 3) and the absorbance was monitored at 230 nm.
TABLE-US-00006 TABLE 3 Gradient program used for preparative RP-HPLC Time (min) Solvent B % 0 30% 5 30% 25 90%
[0156] Fractions corresponding to each peak were collected and analyzed using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) using an Applied Biosystems Voyager-DE PRO instrument according to the procedure below.
[0157] Fractions containing the desired proteins were combined and dialyzed extensively against deionized water at 4 C. using a snake skin dialysis tube with a MWCO of 3.5 kDa for 12 h. After dialysis, each sample was lyophilized and kept at 20 C. for long-term storage. The purity and identity of the constructs were assessed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), analytical HPLC, and MALDI-TOF. The N-terminal myristoylation was further confirmed by digesting the FAME constructs with trypsin and analyzing the N-terminal peptide fragment using MALDI-TOF-MS.
Synthesis of Control Peptide Amphiphiles
[0158] Control peptide amphiphiles (PAs) were synthesized using standard Fmoc (9-fluorenylmethoxy-carbonyl)-based chemistry on rink amide resin using Protein Technologies PS3 automated peptide synthesizer (Coin, et al., Nat. Protoc. 2007, 2, 3247). We coupled standard Fmoc-protected amino acids using 4 equivalents of HBTU-activated amino acids in the presence of N-methylmorpholine in DMF for 20 min. Fmoc deprotection was achieved using 20% piperidine in DMF. Myristic acid was coupled as the last residue using a similar protocol used for coupling the canonical amino acids. After the last coupling reaction, the resin was washed twice with DMF, twice with dichloromethane, and then air-dried.
[0159] Peptide cleavage and deprotection was accomplished by re-suspending the resin in 5 mL of a cleavage cocktail (95% TFA, 2.5% H.sub.2O, and 2.5% triisopropylsilane) for 3 h. The resin was filtered and the cleavage cocktail was concentrated in vacuo. Peptides were precipitated in cold diethyl ether and were collected by centrifugation at 3500 rpm and 4 C. for 15 min. The pellet was washed with cold diethyl ether and air dried before storage at 20 C. The purity and the identity of each peptide was confirmed by liquid chromatography-mass spectrometry and MALDI-TOF-MS.
[0160] Alternatively, the control PAs could be synthesized by trypsin digestion of the corresponding FAME, similar to a method described below (see Trypsin Digestion of Proteins). Briefly, to biosynthetically produce the PAs, 10 mg of the corresponding FAME (dissolved in 1 mL of digest buffer) and 1 g of trypsin were incubated at 37 C. overnight. The PAs were collected by centrifugation and further purified by utilizing the thermally-triggered phase transition of the ELP domains and the low-solubility of PAs in water.
Chemical Synthesis of M-ELP
[0161] M-ELP was prepared as a control to investigate the contribution of PA-like domains to the self-assembly and phase-transition of FAMEs. Due to the lack of a recognition sequence in this construct, it was not possible to prepare M-ELP through co-expression with NMT. Instead, we devised an alternative semisynthetic method to prepare this construct as shown in
[0162]
Fluorescent Labelling of Proteins
[0163] A lysine residue was encoded near the C-terminal of the protein to ensure that the fluorophore conjugation site was distant from the PA-like domain. Labelling genetically encoded lysine was achieved using NHS-activated Alexa Fluor 488 dye. The M-B.sub.1-3ELP-GKG construct (25 mg, 1.4 mol) was dissolved in anhydrous DMF (1 mL), and the labelling dye (1 mg, 1.6 mol, 1.1 equiv) was dissolved in anhydrous DMSO (1 mL) before use. The dye and the protein solution were mixed, followed by the addition of DIPEA (3 L, 18 mol, 16 equiv). After 12 h, the reaction was quenched by the addition of water (8 mL), and water soluble impurities were subsequently removed by dialysis against 4 L of deionized water. The fluorescently labeled protein was separated from the unreacted dye using RP-HPLC by monitoring the absorbance at 230 nm and 350 nm. The labelling efficiency was determined by dissolving a known amount of labeled protein in water and measuring the absorbance at 494 nm (according to the manufacturer protocol, the .sub.494 of Alexa Fluor 488 dye is 71000 cm.sup.1 M.sup.1). Based on this measurement, we determined that the labelling efficiency was 42% for M-B.sub.1-ELP-GKG, 37% for M-B.sub.2-ELP-GKS, and 32% for M-B.sub.3-ELP-GKG. For the encapsulation experiments, the molar ratio of the fluorescently-labeled to unlabeled FAMEs was kept at 25% by adding unlabeled FAME constructs as needed. The N-terminal amine of control ELP was labeled using a similar procedure.
Characterization
[0164] SDS-PAGE.
[0165] The purity and molecular weight of the purified proteins was characterized using a 10-20% gradient Tris-glycerol SDS-PAGE gel (Thermo Scientific, CA). The gels were negatively stained by incubation with 0.5 M CuCl.sub.2 for 20 min before imaging using a BioRad Universal imager.
[0166] Analytical HPLC.
[0167] Analytical RP-HPLC was performed on a Shimadzu instrument using a Phenomenex Jupiter 5 m C18 300 , LC Column 2504.6 mm, solvent A: H.sub.2O+0.1% TFA, solvent B: acetonitrile+0.1% TFA), as shown in TABLE 4.
TABLE-US-00007 TABLE 4 Gradient program used for analytical RP-HPLC Time (min) Solvent B (%) 0 30 3 30 30 90
[0168] Constructs were dissolved in deionized water at a concentration of 70 M. 35 L of this solution was injected and analyzed using a photo-diode array detector to measure the absorbance at wavelengths between 190 nm and 800 nm. Representative chromatograms (at 230 nm) for each protein is displayed in
[0169] Trypsin Digestion of Proteins.
[0170] Trypsin digestion was conducted according to the manufacturer's protocol. Briefly, 10 L of 50 mM ammonium bicarbonate buffer (pH=7.8) was added to an Eppendorf tube. 9 L of each construct was added to this reaction tube for a final concentration of 100 M. To this mixture, 1 L trypsin (reconstituted as 1 g/L trypsin in 50 mM acetic acid) was added and the reaction mixture was incubated at 37 C. After 2 h, the N-terminal fragment peptide was analyzed by MALDI-TOF-MS.
[0171] MALDI-TOF-MS.
[0172] Samples for MALDI-TOF-MS analysis were prepared by mixing 10 L of each HPLC fraction with 10 L of the sinapinic acid (SA) matrix (a saturated solution was prepared by suspending 10 mg of SA in 700 L H.sub.2O+0.1% TFA and 300 L acetonitrile+0.1% TFA). Afterward, 3 L of this mixture was deposited onto a sample plate and dried in air at room temperature. All spectra with an acceptable signal-to-noise (S/N) ratio (>10) were calibrated against an aldolase standard (Sigma Aldrich, M.sub.w=39,211.28 Da). The following instrument parameters were optimized empirically to maximize the S/N ratio: accelerating voltage=25 kv; grid voltage=90%; guide wire=0.15%; extraction delay time=750 ns; acquisition range: 10,000-60,000 Da; low mass gate=5000 Da; number of laser shots=75/spectrum; laser intensity=3000; bin size=4 ns.
[0173] We used -cyano-4-hydroxycinnamic acid as a matrix for analysis of the N-terminal peptide fragments and canonical peptide amphiphiles. All spectra were calibrated against adrenocorticotropic hormone fragment 18-39 (Sigma Aldrich, M.sub.w=2,464.1989). The following instrument parameters were optimized empirically to maximize the S/N ratio: accelerating voltage=20 kv; grid voltage=73.5%; guide wire=0.005%; extraction delay time=90 ns; acquisition range: 500-400 Da; low mass gate=500 Da; number of laser shots=40/spectrum; laser intensity=2000; bin size=0.5 ns. Results are shown in TABLE 5 and
TABLE-US-00008 TABLE 5 Summary of MALDI-TOF-MS experiments M.sub.W m/z Construct (Da, calculated) [M + H].sup.+ (observed) Proteins ELP 16617.7 16616.2 M-ELP 16828.0 16822.9 B.sub.1-ELP 17519.6 17476.3 M-B.sub.1-ELP 17729.9 17702.6 B.sub.2-ELP 17924.9 17948.1 M-B.sub.2-ELP 18135.3 18147.2 B.sub.3-ELP 17633.7 17674.4 M-B.sub.3-ELP 17844.1 17849.0 Peptides M-B.sub.1 727.4 728.7 M-B.sub.2 931.6 931.6 M-B.sub.3 841.6 842.6
UV-Visible Spectroscopy
[0174] We investigated the temperature-triggered phase-transition of each construct by recording the optical density of the protein solution at 350 nm as a function of temperature, from 15 C. to 50 C. (ramping at a rate of 1 C./min) on a temperature controlled UV-Vis spectrophotometer (Cary 300 Bio, Varian Instruments, Palo Alto, Calif.). The transition temperature (T.sub.t) is defined as the inflection point of the turbidity profile. Turbidity profiles for each sample were measured in PBS at three different solution concentrations between 25-100 M. See
Dynamic Light Scattering
[0175] Dynamic light scattering (DLS) studies were conducted to investigate the self-assembly of various constructs in solution. Prior to analysis, samples were freshly prepared in PBS to a concentration of 50 M and filtered through a 0.22 m polyvinylidene fluoride membrane (Durapore) directly into the quartz cell. DLS experiments were conducted in a temperature-controlled DynaPro Microsampler (Wyatt Technologies). Measurements were obtained over a temperature range of 4 C. to 10 C. using 0.5 C. steps and 18 acquisitions of 5 s each for every temperature point. Autocorrelation intensities across the range of temperatures were averaged and plotted as a function of decay time with error bars representing the standard deviation of measurements (shown as a shaded band around the line). See
[0176] We note that it is not possible to extract reliable size data (Rh) from the DLS autocorrelation function of myristoylated constructs, as most DLS models are developed by assuming a spherical object as the source of scattering. The electron microscopy (
Circular Dichroism
[0177] We probed the secondary structure of all the constructs using circular dichroism (CD) to study whether the incorporation of the short recognition sequences or myristoylation significantly altered the secondary structure of the constructs. CD spectroscopy was performed using an Aviv Model 202 instrument and a 1 mm quartz cell (Hellma). Each sample was freshly prepared by dissolving the lyophilized product in a salt-free phosphate buffer solution (pH 7.2, Sigma Aldrich) to a concentration of 10 M. This solution was stored on ice prior to analysis. The CD spectra were obtained at 15 C. from 350 nm to 180 nm in 1 nm steps and 0.5 s averaging time. The CD spectra were corrected for the buffer signal at 15 C. Each experiment was repeated in triplicate, and the average of the three measurements was represented as a mean residue ellipticity ([], deg cm.sup.2 dmol.sup.1). Data featuring dynode voltages above 500 V was not considered for analysis. The CD data for different constructs were then normalized at 220 nm for comparison. See
[0178] We investigated the effect of myristoylation on the secondary structure of the ELPs using CD. In accordance with the turbidity profile, non-myristoylated ELPs exhibited CD signatures characteristic of canonical ELPs (
[0179] Due to the limited solubility of synthetic PAs in water and PBS, it was not possible to compare their CD spectra with ELPs as a control. However, based on previous reports of PAs, it is likely that the first 4-6 amino acids in the recognition sequence adopts a -sheet conformation after the conjugation of the myristoyl group, characterized by two peaks at 195 nm and 220 nm (Paramonov, et al. J. Am. Chem. Soc. 2006, 128, 7291). The positive peak at 195 nm, indicative of -sheet structures, overlaps with the much stronger negative peak from the ELPs. Due to similarities between the CD signature of ELPs and FAMEs, we can conclude that myristoylation did not significantly increase the beta-turn population, nor did it result in a global change in the conformational preference of the ELPs. We also point out that the CD signature of FAMEs (particularly M-B.sub.3-ELP) may be less reliable due to the self-assembly and aggregation of these constructs in solution (Kelly, et al. Biochim. Biophys. ActaProteins Proteomics 2005, 1751, 119).
FT-IR
[0180] We collected Fourier transform infrared spectroscopy (FT-IR) spectra on a Nicolet 8700 FT-IR spectrometer that was equipped with an attenuated total reflectance attachment. A Ge crystal was used for collecting spectra of the proteins and peptides. In bench mode operation, the lyophilized powder was clamped tightly over the Ge crystal, and the spectra were collected from 4000 to 400 cm.sup.1 with 1 cm.sup.1 resolution. There were 128 scans accumulated per spectrum.
[0181] We utilized FT-IR spectroscopy to probe the effects of myristoylation on the conformation and hydrogen bonding of the amide carbonyls (
Variable Temperature ATR-IR
[0182] Each sample was prepared to the final concentration of 100 M solution by dissolving lyophilized powder in cold (4 C.) Dulbecco's Phosphate Buffered Saline (PBS, Thermo Fisher Scientific). After the addition of cold PBS, the solution was immediately mixed by vortex and left in a thermomixer (Eppendorf) at 4 C. while shaking for 30 min. From this point onward, the prepared solutions were kept in an ice bath between the ATR-IR measurements.
[0183] Experiment: ATR-IR measurements samples were performed with FT-IR Bruker TENSOR II spectroscopy (Bruker, Germany) with a diamond crystal. The samples were loaded into a metallic sample holder with an inner volume of 0.5 mL, which was pressed on the top of the ATR crystal. A refrigerated/heated circulator (Julabo, Seelbach, Germany) combined with a custom-built copper tube was used to heat or cool the metallic sample holder by fitting the copper tube around the metallic holder. As the solution was in contact with the metallic holder, this device cooled or heated the sample solution on the ATR crystal. The metallic holder design allowed us to measure the temperature of the solution during measurement with a thermocouple and digital multimeter (Voltcraft VC 140). Before each ATR measurement of protein samples, a solution of PBS was used to verify the temperature settings on the circulator. After verification, the proper temperature was set in the circulator, the neat PBS was taken out from the sample holder, and the container was filled with the measured samplewhile still monitoring the temperature. ATR-IR spectra were collected at 10 C., 30 C., and 50 C. from 400-4000 cm.sup.1 with an accumulation of 128 scans and using a spectral resolution of 4 cm.sup.1.
[0184] Data Processing: At least three different ATR-IR spectra from each sample were collected at each temperature. Data analysis of the ATR-IR spectra was done by using IgorPro (Wavemetrics, Lake Oswego, Oreg.). First, the baseline of spectra was corrected by subtracting the average absorbance value which was calculated from the absorbance values between 3877 cm.sup.1 and 3997 cm.sup.1 from each ATR-IR spectrum. All spectra of each sample at a certain temperature were averaged and the ATR-IR spectra of PBS at the same temperature was subtracted to produce difference spectra. Exemplary peaks assignments are shown in Table 6.
[0185] Little, if any, signal was seen at 10 C. for any of the proteins at this concentration. Notably, M-ELP showed an almost identical spectrum at 30 C. and 50 C. (
TABLE-US-00009 TABLE 6 ATR-IR peak assignments peak assignment wavenumber CH.sub.3 asymmetric 1450 20 cm.sup.1 Amide II band 1500 cm.sup.1-1600 cm.sup.1 (Max absorbance at 1540 cm.sup.1) -spiral signature in Amide 1615 cm.sup.1 and 1656 cm.sup.1 I band
Thioflavin T (ThT) Assay
[0186] Single Time-Point Static ThT Assay.
[0187] The static ThT assay was conducted on a SpectraMax M series microplate reader. ThT stock solution (50) was freshly prepared by dissolving 8 mg of ThT in 10 mL of PBS, which was then kept in the dark. This solution was furthered diluted by a factor of 5 to obtain the working stock solution (10). A freshly prepared sample of each construct (144 L) was mixed with the ThT (16 L). Each sample contained 100 M of protein in addition to 50 M of ThT and was kept on ice prior to the experiment. The mixture (130 L) was then transferred to a black Corning 96 well half area plate with a clear flat bottom and was incubated for 5 minutes at 20 C. The ThT fluoresce (excitation wavelength=440 nm, emission wavelength=482 nm) for each sample was recorded. See
[0188] Dynamic ThT Assay.
[0189] We conducted a ThT assay on a StepOnePlus Real-Time PCR System by adapting a procedure commonly used for protein thermal shift assays. ThT stock solution (50) was freshly prepared by dissolving 8 mg of ThT in 10 mL of PBS, which was then kept in the dark. This solution was furthered diluted by a factor of 5 to obtain the working stock solution (10). A freshly prepared sample of each construct (18 L) was mixed with the ThT (2 L). Each sample contained 100 M of protein in addition to 50 M of ThT and was kept on ice prior to the experiment. We used the FAM filter in the instrument for measuring the ThT signal. Control experiments without protein and/or ThT were conducted in tandem to ensure that the fluorescent signal was due to the interaction of the proteins with the ThT. Samples were incubated at 4 C. for 10 min before the start of the experiment. Fluorescence was measured as the temperature was increased to 60 C. at a rate of 1% according to the instrument setting (i.e., approximately 1 C./min). A baseline correction was conducted using the TN020 procedure package in Igor Pro 6.37 software. See
[0190] We suggest that the differences in ThT fluorescence between M-ELP and ELP in static assay can be explained by considering the peptide sequences after myristoyl group. The M-ELP sequence consists of Myristoyl-GVGVP and valine residues have a relatively high -sheet propensity. It is likely that this short peptide sequence adopts an amyloid cross-section and thus interacts strongly with the ThT dye at low temperature.
[0191] However, presence of proline as the fifth residue in the M-ELP sequence (Myr-GVGVP) is likely to break the formation of secondary content after this position. Thus, despite having two residues with high -sheet propensity, an extended -sheet cannot be formed with this sequence. This hypothesis can explain the lower interaction of M-ELP with ThT at higher temperature.
[0192] We are also mindful that ThT fluorescence depends on parameters such as the solvent viscosity (which is expected to change at least in the ELP coacervates). Considering these factors, we suggest that the interaction of FAMEs with ThT can be enhanced through any of the following pathways at higher temperatures. 1) It is possible that a segment of the ELP domain, close to the PA-domain, is restricted to a conformation with favorable interactions with the ThT dye. Our variable temperature ATR-IR experiments provides a support for this hypothesis as the broad amide peaks in the ELP and M-ELP are replaced with more well-defined sharper peaks. 2) Above T.sub.t, the core of the FAME aggregates (PA-domain) can grow as the aggregates are no longer stabilized by the dehydrated ELP corona. This extended core can interact with more ThT molecules. In particular, this pathway is consistent with microscopy results obtained for M-B.sub.2-ELP. 3) The increased viscosity of the ELP coacervates can also increase the ThT fluorescence above T.sub.t.
[0193] Our current mechanism does not explain the small decrease in ThT fluorescent signals for ELP and M-ELP at high temperatures (with an inflection point 50 C.). It may be that presence of charged amino acid (in this case, Arg which is found in all recognition sequences but not in ELP or M-ELP) can also affect the kinetics of coacervate coalescence.
Spinning Disk Confocal Laser Microscopy (SDCLM)
[0194] SDCLM was conducted on an Olympus SD-OSR System based on a IX83 inverted microscope equipped with Yokogowa W1 Spinning disk confocal with 50 nm disk and Tokai Hit WSKM environmental control module. The spatial distribution of the fluorophore-labeled FAMEs was characterized via fluorescence microscopy using a 100X Si oil objective with correction collar and the appropriate filter set (excitation BP 470/40, emission BP 525/50). Fluorescence intensities of the acquired images were analyzed using Metamorph acquisition software.
[0195] SDCLM has the sensitivity and the resolution of traditional confocal microscopy but offers the advantage of faster data acquisition over a larger area of the sample. We leveraged these capabilities to visualize the fine details of the self-assembly process. SDCLM was conducted by depositing 20 L of the fluorescently labelled protein samples below T.sub.t onto a glass bottom MatTek dish (Ashland, Mass.) and transferring the slide to microscope stage and heating it to 30 C. We monitored the assembly by taking consecutive images from a focal plane above the cover slips to avoid surface induced artifacts. The temperature was then raised to 50 C. to monitor the final stage of the self-assembly. Following the stabilization of the network, we also used the super resolution mode of the microscope and recorded multiple images at different focal planes and collapsed these z-stack images using ImageJ to visualize finer details of the final entangled network.
Encapsulation and Imaging
[0196] We also visualized the phase transition of FAMEs and ELPs in monodisperse, well-defined droplets at micron-level resolution during the second and third stages of self-assembly. We chose this system because it prevents the coalescence of aggregates beyond the well-defined boundaries of each micron-scale droplet, which is ideal for studying the morphogenesis of structures at the micro-scale. To visualize the self-assembled structures, we genetically encoded a Lys residue at the C-terminus of the M-B.sub.1-3-ELP constructs to enable labeling with Alexa Fluor 488 dye. The turbidity profile of these labeled FAMEs was identical to their parent sequences, indicating that the addition of a Lys and a fluorophore at a position distant from the PA domain does not perturb the self-assembly process. We then used a microfluidic device to form water-in-oil emulsions containing each FAME at 100 M. The structural evolution of each construct was then visualized using wide-field fluorescence microscopy while increasing the temperature from 10 C. to 50 C. at a rate of 1 C./min.
[0197] Droplet Formation.
[0198] Microfluidic water-in-oil droplet generators were purchased from Dolomite Microfluidics. To create aqueous droplets, we injected two liquid phasesa dispersed aqueous phase of the FAME sample, and an organic continuous phase comprised of TEGOSOFT DEC/ABIL EM 90/mineral oil (75/5/20 v/v %)into the drop generators at constant flow rates using precision syringe pumps. We tuned the flow rates of the dispersed and continuous fluids to ensure droplet formation in the dripping regime and used a constant flow rate of 250 L.Math.hr.sup.1 for the organic continuous phase and 75-100 L.Math.hr.sup.1 for the aqueous, dispersed phase. We monitored the production of droplets within the microfluidic device using a 5 objective on an inverted microscope (Leica) equipped with a digital microscopy camera (Lumenera Infinity 3-1 CCD).
[0199] The organic phase contains commercially available surfactants to stabilize aqueous droplets. It was noticed that this mixture does not affect the cloud point (T.sub.t) of ELPs. However, we performed the following control experiment to ensure that the surfactants do not perturb the self-assembly of FAMEs. We have mixed PBS (1 mL) with the organic phase (containing the same three components described above) by vigorous agitation on a vortex. After waiting for 1 hour, the cloudy mixture separated into three layers, oil phase at top, narrow emulsion layer at the middle, and a PBS phase at the bottom. We carefully removed the top layer and dissolved the M-B.sub.2-ELP in this mixture to the final concentration of 50 M. As a control, M-B.sub.2-ELP was dissolved in PBS to the similar concentration. The phase behavior and self-assembly of both samples were analyzed by a turbidimetry assay. Both samples exhibited almost identical T.sub.t, T.sub.c, and overall macroscopic morphology.
[0200] Visualization of the FAME Constructs' Thermally Triggered Phase-Transition.
[0201] The FAME emulsion samples were collected on a glass microscope slide and heated using a precision Peltier heating and cooling stage (Linkam LTS120) equipped with a Linkam PE95 digital temperature control unit. The spatial distribution of the fluorophore-labeled FAMEs was characterized via fluorescence microscopy using an upright Zeiss Axio Imager A2 microscope with a 20 objective and the appropriate filter set (excitation BP 470/40, emission BP 525/50). Fluorescence intensities of the acquired images were analyzed using Zeiss ZEN imaging software. M-B.sub.2-ELP and M-B.sub.3-ELP fluorophores were artificially colored blue and red in the images in
Cryo-TEM
[0202] Cryo-transmission electron microscopy (TEM) experiments were performed at Duke University's Shared Materials Instrumentation Facility. Lacey holey carbon grids (Ted Pella, Redding, Calif.) were glow discharged in a PELCO EasiGlow Cleaning System (Ted Pella, Redding, Calif.). A 3 L drop of the sample (100 M of each construct) at 25 C. or 30 C. (above the T.sub.t for FAME constructs) was deposited onto the grid, blotted for 3 s with an offset of 3 mm, and vitrified in liquid ethane using the Vitrobot Mark III (FEI, Eindhoven, Netherlands). The sample chamber was maintained at 100% relative humidity to prevent sample evaporation. Grids were transferred to a Gatan 626 cryoholder (Gatan, Pleasanton, Calif.) and imaged with an FEI Tecnai G.sup.2 Twin TEM (FEI, Eindhoven, Netherlands), which was operated at 80 keV (Mcdaniel, et al. Nano Left. 2014, 14, 6590). Control PA (M-B.sub.1-3) were resuspended in 20% aqueous acetic acid solution (v/v %) due to their low solubility in PBS or water. See
Scanning Force Microscopy
[0203] We prepared a 100 M solution of FAMEs in cold PBS buffer. Then 1.5 l of the solution was put in an Eppendorf tube and heated to 30 C. for typically 1-2 min in a water bath. Then the entire solution was pipetted onto a freshly cleaved mica substrate and then carefully dried in an air stream. Subsequently the surface was rinsed with pure water provided by a Sartorius Arium 611 VF purification system (Milli-Q, specific resistivity of 18.2 M.Math.cm). Then the sample was dried again in an air stream and installed on the xy-stage of a Dimension ICON SFM instrument (Bruker, Karlsruhe, Germany). For the SFM investigation we used Olympus AC240TS-R3 cantilevers having a nominal spring constant of 2 N/m. The SFM was operated in the peak force tapping mode at 1 kHz. For all studies, we recorded the surface topography, the adhesion and the DMT modulus map simultaneously.
Cryo-Scanning Electron Microscopy (SEM)
[0204] Cryo-SEM analyses were conducted using a JEOL JSM-7600 FE SEM (JEOL USA, Peabody, Mass.) outfitted with an Alto-2500 preparation chamber Gatan, Warrendale, Pa.). The macroscopic object formed by M-B.sub.2-ELP was carefully placed on the SEM stage using a tweezer and was plunge frozen in liquid nitrogen slush, then transferred under vacuum to the preparation chamber and cryo-fractured. The fractured sample was etched for 5 min at 95 C. and 410.sup.6 mbar to reveal the underlying microstructure. Subsequently, the samples were allowed to cool down to 120 C. An in situ cold magnetron coater was used to make a 5 nm thick Au/Pd coating on the etched samples. The SEM images were then taken using 15 keV accelerating voltage energy and a working distance of 5 mm under cryo-temperature. The observed microstructure is consistent with the morphology observed by SEM following fixation and dehydration. M-B.sub.3-ELP structure did not survive the direct freezing and cryo-fracturing and were instead analyzed by regular SEM as described below.
SEM
[0205] SEM was performed using a FEI XL30 SEM-FEG instrument with an accelerating voltage of 5 kv. We used the FAMEs with a genetically encoded lysine at the C-terminal to include a chemical handle for fixation with gluteraldehyde. The assembly of M-B.sub.2-ELP-GKG and M-B.sub.3-ELP-GKG was triggered by heating the 750 L of the solution of each one of the protein at the concentration of 100 M in a UV cuvette. The solution temperature was increased at the rate of 1 C./min from 15 C. to 50 C. while monitoring the turbidity of the solution by measuring the absorbance at 350 nm. Once the temperature reached 50 C., which coincided with the sudden decrease in turbidity, the cuvettes were removed from the instrument and the solution and the white solid structure was transferred by inversion to a 20-mL scintillation vial containing 750 L of 8% glutaraldehyde aqueous solution (Electron Microscopy Sciences, Hatfield, Pa.) to achieve final glutaraldehyde concentration of 4%). After fixing the structures at room temperature for 4 hours, the structures were washed 2 with PBS before being dehydrated using increasing concentration of ethanol (30, 50, 70, 90, and 100). We prepared two replicas of each sample and dried them either using a critical point drier (CPD, Ladd Research Industries, Williston, Vt.) or washed twice with hexamethyldisilazane (HMDS, Electron Microscopy Sciences). The method of drying did not seem to affect the overall morphology of the fibers for M-B.sub.2-ELP-GKG. M-B.sub.3-ELP-GKG did not survive CPD treatment and the SEM images were taken from the HDMS dried sample. Each sample was then fixed on the SEM stage with carbon tape and sputter coated with gold before imagining.
Aggregation above T.sub.c
[0206] For M-B.sub.2-ELP, the onset of T.sub.c (defined as the critical temperature corresponding to sudden decrease in the turbidity) depends on the nominal concentration of the protein in solution. For example, at 100 M, T.sub.c is approximately 45 C.; at 50 M, T.sub.c is approximately 50 C. We do not observe T.sub.c in solution containing 25 M below 50 C. (The upper limit in our experiments). In the case of M-B.sub.3-ELP, T.sub.c does not show the same dependence on the initial concentration (i.e. at all concentrations T.sub.c appears to be 50 C.).
[0207] We hypothesize that ELP chains are responsible for the stabilization of aggregates during stage 1 and to some extent in stage 2. The last stage of self-assembly manifested at higher temperatures (T>T.sub.c), where the repulsion between the ELP coronas is reduced due to further dehydration, which results in a decrease in the core-core (PA-domain) distances inside the coacervates. At some point, it is possible that the cores are connected (non-covalently cross-linked) through a dynamic rearrangement (e.g., the formation of bundle fibers in M-Br ELP). If the cores are held together by very strong forces, as appears to be the case in M-B.sub.3-ELP, this dynamic rearrangement may not occur in the window of opportunity before non-specific aggregation of the ELP chains, resulting in the formation of ill-defined aggregates.
[0208] Dynamic of core-core supramolecular cross-linking can depend on the strength of interactions holding these cores together, and the concentration of self-assembly intermediates. In the case of M-B.sub.2-ELP with weaker core interaction (lower propensity to form -sheets), increasing the concentration of aggregates in solution may be expected to decrease T.sub.c.
[0209] Additionally, increasing the size of the ELP length (e.g., protective corona) may increase T.sub.c. We have conducted this simple experiment, using M-B.sub.2-ELP.sub.20 and M-B.sub.2-ELP.sub.60 (subscript denotes the number of pentapeptide repeats). T.sub.c for M-B.sub.2-ELP.sub.20 at 100 M is lowered to 40 C. and no critical aggregation is observed for M-B.sub.2ELP.sub.60 at the same concentration up to 50 C. M-B.sub.2-ELP.sub.20 aggregates remained stable below T.sub.t while M-B.sub.2-ELP.sub.60 solution turned clear below T.sub.t.
Statistics
[0210] Characterization techniques were used to collect data with technical replicates. The error bars (shown as shaded band) in
Example 2
[0211] As a proof-of-concept to demonstrate the feasibility of creating a genetically encoded biohybrid material via PTM, we chose to create a recombinant lipid-modified polypeptide that we call Fatty Acid-Modified Elastin-like polypeptide (FAME). FAME includes three components. The first component is myristic acid (C14:0), chosen because it can be genetically incorporated at the N-terminus of proteins in a single reaction catalyzed by the enzyme N-myristoyl transferase (NMT). The second component of FAME is a short, structure-directing peptide sequence of 5-10 amino acids that, when conjugated to an alkyl tail such as the myristoyl group, creates a peptide amphiphile (PA) that introduces a pre-programmed secondary structure (e.g., beta sheet,
[0212] The third segment of the FAME is an elastin-like polypeptide (ELP), which is incorporated at the C-terminus of the FAME at the gene level. ELPs are a class of peptide polymers that includes repeat units of the tropoelastin-derived pentapeptide, [Val-Pro-Gly-Xaa-Gly].sub.n, in which Xaa can be any amino acid, except Pro (Urry. J. Phys. Chem. B 1997, 101, 11007-11028; Roberts, et al. FEBS Lett. 2015, 589, 2477-2486). We chose ELPs as the third segment of FAME for several reasons. First, they can be conveniently synthesized with high yield by recombinant expression in E. coli. Second, they exhibit a lower critical solution temperature (LCST) phase transition, which enables them to transition from a soluble state to an insoluble coacervate by: 1) increasing the solution temperature or, 2) isothermally depressing their T.sub.t below the operating temperature by the addition of kosmotropic salts in the Hofmeister series (Cho, et al. J. Phys. Chem. B. 2008, 112, 13765-13771). The T.sub.t can be precisely tuned to within a narrow temperature range at the molecular level by manipulating two genetically encoded and orthogonal variablesthe composition of Xaa and the chain length (McDaniel, et al. Biomacromolecules 2013, 14, 2866-2872). Their stimulus-responsive behavior, we hypothesized, could be used as a convenient trigger to control the hierarchical self-assembly embedded in the PA, as well as to purify the FAME. Third, because ELPs are genetically encoded, they are monodisperse, non-toxic, and biodegradable, and may be used for many biomedical applications, including injectable controlled release depots, tissue-engineering scaffolds, and thermally triggered targeting of tumors.
[0213] To create a recombinant expression system that is capable of lipidation in E. coli, we used a bicistronic expression vector (pETDuet-1) that simultaneously expresses two proteins of interest: (1) an ELP containing a substrate peptide at its N-terminus that is recognized by NMT; and (2) NMT from S. cerevisiae, the enzyme that catalyzes the covalent attachment of a myristoyl group to the N-terminus of the peptide substrate. In principle, NMT should covalently append a single copy of myristic acid to the N-terminal residue of the ELP through the formation of an amide bond. We hypothesized that the simultaneous expression of NMT and the substrate-containing ELP in E. coli should enable the in vivo, one-pot synthesis of FAME (
[0214] The first major challenge that we had to address was the identification of structure-directing peptides that could also function as an in vivo myristoylation substrate. Previous studies have shown that it is possible to modify heterologous proteins in E. coli lysate by fusing an 11-amino acid signal peptide from the natively myristoylated yeast protein, ADP-ribosylation factor, in the presence of co-expressed NMT, but, to date, the ability of NMT to myristoylate other sequences, and in particular structure-directing peptides has not been investigated.
[0215] Analysis of the N-terminal sequence of myristoylated proteins reveals no universal consensus sequence except the presence of an N-terminal Gly residue (Eisenhaber, et al. Nucleic Acids Res. 2003, 31, 3631-3634). This lack of consensus, we speculated, should enable diverse sequences to serve as suitable substrates without the need for site-directed mutagenesis or evolution of NMT. We hence used software predictors of the myristoylation recognition sequence to guide the de novo design of PAs that have a dual functionalitythey function as a signal sequence for recognition and myristoylation by NMT and they also act as a structure-directing self-assembly domain. To satisfy the first requirement, we utilized an online predictor (Maurer-Stroh, et al. J. Mol Biol. 2002, 317, 523-540; Maurer-Stroh, et al. J. Mol. Biol. 2002, 317, 541-557), which employs a machine learning algorithm from verified NMT substrates, to predict the possibility of N-terminal myristoylation.
[0216] Our de novo design was also informed by previous studies on PAs that have established the critical role of interactions among the first 4-6 residues after the alkyl tail in controlling self-assembly through the formation of -sheets. PAs that could also serve as NMT substrates (TABLE 7) were designed based on the following considerations. First, we ensured that all sequences had a Gly residue at the N-terminus because an N-terminal Gly is critical for myristoylation. Next, we designed three sequences that, upon myristoylation, could function as PAs. (i) Sequence B.sub.1 consists of Gly-Ala-Gly-Ala-Ser, whose alternating repeats of Gly/Ala residues were inspired by a repeat unit commonly found in spider silk and represent the minimum structural motif necessary for the formation of a -sheet. (ii) The second sequence, B.sub.2, with the sequence Gly-Ala-Gly-Ala-Gly-Ala-Tyr, was designed to enhance inter-strand interactions by increasing the number of Gly-Ala repeat units to three, as well as introducing an aromatic residue, Tyr. (iii) Sequence B.sub.3 consisting of Gly-Leu-Ser-Leu-Ser, combines the bulky hydrophobic amino acid, Leu, with the hydrogen-bonding residue, Ser, which increases the peptide's overall propensity to form -sheets. In order to characterize these materials and verify recombinant myristoylation by mass spectrometry, we also included an Arg residue to enable selective cleavage of the N-terminal peptide by trypsin. Finally, a short and flexible (Gly-Gly-Ser).sub.n linker was included between the self-assembly domain and the ELP to ensure that access to the enzyme's active site was not sterically hindered by the ELP. The software predictor categorized our de novo designed recognition sequences as reliable potential sites for modification.
TABLE-US-00010 TABLE7 AsummaryoftheELPs,FAMES,andcontrolPAsusedinthisstudy. N-terminal Sequence Identifier Modification NMTRecognitionsequences.sup.a) ELP ELPs B.sub.1-ELP N/A GAGASRGGSGGS(SEQID (GVGVP).sub.40GY NO:38) (SEQIDNO:54) B.sub.2-ELF N/A GAGAGAYRGGSGGSGGS (SEQIDNO:40) B.sub.3-ELP N/A GLSLSRGGSGGS(SEQID NO:42) FAMEs M-B.sub.1-ELP Myristoyl GAGASRGGSGGS(SEQID NO:38) M-B.sub.2-ELP Myristoyl GAGAGAYRGGSGGSGGS (SEQIDNO:40) M-B.sub.3-ELP Myristoyl GLSLSRGGSGGS(SEQID NO:42) N-terminal Identifier Modification Sequence Control M-B.sub.1 Myristoyl GAGASR(SEQID N/A PAs NO:48) M-B.sub.2 Myristoyl GAGAGAYR(SEQ IDNO:49) M-B.sub.3 Myristoyl GLSLSR(SEQID NO:50) .sup.a)De novo designed recognition sequences have three components: self-assembly domain (bold), trypsin cleavage site (Arg, underlined), and a flexible linker (italics).
[0217] We chose an ELP with the sequence [Gly-Val-Gly-Val-Pro].sub.40 (SEQ ID NO:52) and call it ELP for simplicity. It should be noted, however, that this design framework can be easily applied to other ELPs, featuring different lengths and guest residue compositions to tune the LCST of the desired FAME. In principle, this approach is also applicable to a wide range of protein polymers that could be substituted for the ELP, such as resilin-like polypeptides (RLP; Quiroz, et al. Nat. Mater. 2015, 14, 1164-1171) and collagens.
[0218] The NMT and the polypeptide gene were cloned into tandem expression cassettes of the pETDuet-1 vector. The pETDuet-1 plasmidcontaining the NMT gene and the ELP substratewas transformed into E. coli BL21(DE3) cells, cultured in the presence of myristic acid, and then chemically induced to express both genes by the addition of isopropyl-J-D-thiogalactopyranoside. The FAMEs were purified by taking advantage of their temperature-triggered phase transition using inverse transition cycling, a non-chromatographic method for purification of ELPs and ELP fusion proteins (ITC; Hassouneh, et al. Curr. Protoc. Protein Sci. 2010, 6.11.1-6.11.16).
Example 3
[0219] We first sought to investigate whether FAMEs exhibited temperature-triggered LCST phase behavior, which is an important feature, as it would enable extrinsic control of their hierarchical self-assembly. The LCST phase transition of ELPs and their fusions can be conveniently monitored by measuring the turbidity of the solution at different temperatures. The phase transition of unmodified ELPs and FAMEs was quantified for each polypeptide by measuring the optical density at 350 nm while gradually increasing the temperature from 10 C. to 50 C. for solutions with varying concentrations of polypeptide (
[0220] In contrast, all three FAMEs exhibited a lower T.sub.t compared to their non-myristoylated counterparts (i.e., ELPs). For example, the T.sub.t of all FAMEs was 20-25 C. at 100 M (
[0221] While M-B.sub.1-ELP resolubilized completely upon cooling (
Example 4
[0222] To understand the self-assembly mechanism at the molecular level, we utilized various spectroscopic techniques to study the effect of myristoylation on the structure and self-assembly of FAMEs below their T.sub.t. We used dynamic light scattering (DLS) to probe the self-assembly of each construct below its ELP-driven phase transition. As shown in
Example 5
[0223] We next investigated the effect of myristoylation on the secondary structure of the ELPs using circular dichroism (CD). Non-myristoylated ELPs exhibited CD signatures (
[0224] Consistent with the CD spectra, both FAMEs and their non-myristoylated controls exhibited similar FT-IR spectra, consistent with previous reports for ELPs (
[0225] Because the FT-IR spectroscopy of the PAs suggests that they have a propensity to adopt a -sheet secondary structure, we reasoned that a thioflavin T (ThT) fluorescence assay could be used to investigate the role of the PA in directing hierarchical self-assembly of the FAMEs. ThT is a benzothioazole salt that is commonly used to visualize and quantify the presence of fibrillar- or amyloid-like aggregates. The fluorescence of free ThT in solution is strongly quenched by water but, upon binding to aggregates rich in -sheets, the fluorescence is significantly enhanced by up to a 1000-fold. We began with a single time-point static ThT assay at 15 C., a temperature below the T.sub.t of each FAME (
Example 6
[0226] Next, to understand the hierarchical self-assembly of the nanoscale structures into larger macroscopic objects that is directed by the LCST phase transition of the ELP component of each FAME, we carried out a dynamic ThT assay by monitoring the evolution of ThT fluorescence as a function of temperature by a temperature ramp experiment. As shown in
[0227] Based on these results, we conclude that the self-assembly of FAMEs is initially triggered below the T.sub.t and is driven by the hydrophobic collapse of the myristoyl group. DLS and the static ThT assay confirm that the higher order self-assembly of these nanoaggregates below the T.sub.t is influenced by the programmed secondary interactions (propensity to form -sheets) encoded in the myristoylation sequence. Above the T.sub.t, we propose that the phase transition and the desolvation of ELP chains drive a second stage in the self-assembly of all FAMEs, and raising the temperature further drives a third stage for M-B.sub.2-ELP and M-B.sub.ZELP that is marked by the appearance of macroscopic self-assembled objects.
Example 7
[0228] We next turned our attention to structural characterization of these self-assembled FAMEs at increasing levels of spatial resolution to elucidate their morphology. We began with fluorescence microscopy to visualize the phase transition and self-assembly of the FAMEs in monodisperse, well-defined droplets at micron-level resolution. We chose this system because it prevents the coalescence of aggregates beyond the well-defined boundaries of each micron-scale droplet, which is ideal for studying the morphogenesis of structures at the micro-scale. To visualize the self-assembled structures, we genetically encoded a Lys residue at the C-terminus of the M-B.sub.1-3-ELP constructs to enable labeling with Alexa Fluor 488 dye. The turbidity profile of each labeled FAME was identical to their parent sequences, indicating that the addition of a Lys and a fluorophore at a position distant from the recognition sequence does not perturb the self-assembly process (
[0229] At lower temperatures (10 C.), a homogenous fluorescent signal was detected across each droplet (
Example 8
[0230] To dissect the morphology of these hierarchical self-assembled structures on a smaller length scale than fluorescence microscopy, we next turned to cryogenic transmission electron microscopy (cryo-TEM). Cryo-TEM enables imaging of these materials in their near-native hydrated state with nanometer spatial resolution (
[0231] Cryo-TEM imaging confirmed that control PAs (M-B.sub.1-3) primarily formed thin fibers (diameters equal to 11.82.9 nm, 9.72.7 nm, and 13.90.89 nm, means.e.m., respectively) with large aspect ratios, (
[0232] ELPs are difficult to visualize in cryo-TEM due to poor electron contrast resulting from their high water content. Therefore, the observed structures are likely reflective of the dehydrated core of the FAME assemblies, which consists of the PA-domain. The hydrated ELP corona (not seen in cryo-TEM) surrounds the M-B.sub.1-3 core and prevents further assembly at lower temperatures (T<T.sub.t). We did not observe major differences in the nanoscale morphology of the aggregates below versus above the T using cryo-TEM (structures with similar widths were observed at T.sub.c>T>T.sub.t), although the cross-section of larger scale M-B.sub.2-ELP and M-B.sub.3-ELP assemblies was visible as a shadow of dehydrated PA-domains on the TEM grid.
Example 9
[0233] Next, scanning force microscopy (SFM) was used to visualize the nanoscale morphology of the aggregates at 30 C. (T.sub.c>T>T.sub.t, stage 2). The topography showed rod-like structures for M-B.sub.2-ELP and M-B.sub.3-ELP that consist of a PA-core and an ELP-corona (
[0234] The temperature-triggered assembly process of FAMEs in the hydrated state was visualized in real time at longer length scale by spinning disk confocal laser microscopy (SDCLM). We genetically encoded a Lys residue at the C-terminus of the M-B.sub.1-3-ELP constructs to enable labeling with Alexa Fluor 488 dye. While heating fluorescently labeled protein samples from 4 C. (T<T.sub.t) to 30 C. (T.sub.c>T>T.sub.t), we monitored the second stage of self-assembly by taking consecutive images from a focal plane distant from the cover slip to avoid surface-induced artifacts (
[0235] Before reaching thermal equilibrium a homogeneous fluorescent signal was observed across the viewing field, suggesting that at stage 1 (T<T.sub.t) each population of the FAMEs exists as a nanoscale assembly below the diffraction limit, consistent with DLS and cryo-TEM data. However, the PA domain significantly altered the morphogenesis of aggregates at higher temperatures. During stage 2, at 30 C. (T.sub.c>T>T.sub.t), M-B.sub.1-ELP, whose PA domain has the lowest propensity to form -sheets, transitioned into liquid-like droplets similar to canonical ELPs. These droplets moved quickly in and out of the focal plane, which rendered the accurate measurement of their diameter difficult. However, as expected, these liquid-like smaller coacervates coalesced with each other over time and equilibrated to a larger coacervate 4-5 m in diameter (
[0236] In the case of M-B.sub.ZELP at 30 C., we did not observe liquid droplets but instead observed the anisotropic growth of small fibers with a width of 0.1-0.2 m (
[0237] Interestingly, M-B.sub.3-ELP initially transitioned into liquid-like droplets at 30 C. (
[0238] We are mindful that slight differences in the heating profile used in the spectroscopic characterization and SDCLM may impact the final structure of the aggregates. Nevertheless, these results confirm the hierarchical self-assembly process of M-B.sub.2ELP and M-B.sub.3-ELP that drives the formation of macroscopic objects through three distinct stages, consistent with the results of the turbidimetry and spectroscopic characterization. These experiments confirm the influence of the PA domain on the interactions between the coacervates and the dynamics of their coalescence.
[0239] In our system, we propose that the nanoscale structure of the PA domain drives the morphological differences observed in the later stages of FAME coacervation, since the spectroscopic data suggest that temperature has very little effect on the protein secondary structure in all constructs.
Example 10
[0240] To gain a better understanding of the third stage of the self-assembly process, we fixed the macroscopic objects formed by M-B.sub.2-ELP and M-B.sub.3-ELP above their T.sub.c and investigated their structure with scanning electron microscopy (SEM). M-Br-ELP showed a network of narrow interwoven fibers (50 nm) that extended in the fiber axis direction to form long bundles with much larger overall diameters (1 m,
[0241] As discussed above, unlike canonical ELP coacervates, structures formed by M-Br ELP and M-B.sub.3-ELP above T.sub.c do not dissolve upon re-cooling, and in the case of M-B.sub.2-ELP they were able to withstand moderate mechanical agitation (inversion and brief mixing by vortex). These observations, coupled with SEM, point to the PA domains undergoing an irreversible transition during the self-assembly process, perhaps forming a network of connected PA domains that is further reinforced by the interaction among the ELP chains. This hypothesis may explain the observed thermal hysteresis, as structures held together by just the ELP chains are expected to dissolve back into solution once the temperature is lowered below the T.sub.t.
[0242] Combining the insights gained from the spectroscopic and structural studies, we propose the following three-stage self-assembly mechanism (
[0243] In stage 2 (T.sub.c>T>T.sub.t), the ELP domain in the nanostructure dehydrates and undergoes an LCST phase-transition into a liquid-like coacervate with a preference to form spherical droplets to minimize the surface tension of the polymer-rich colloidal particle suspended in the solvent. This dehydration step has several consequences. (1) Above their T.sub.t, the ELP domains are more desolvated, rendering the corona more hydrophobic and thus increasing the interactions between the FAME nanostructures. (2) The self-assembly of the ELP chains into polymer-rich coacervates concentrates the PA domain in a polymer rich medium, thereby reducing the water content and increasing the strength of the core-core interactions. (3) The nano-aggregation of the cores inside the coacervates consequently controls the kinetics of coacervate maturation and coalescence. If the cores are held together by weak interactions, as in the case of M-B.sub.1-ELP, the overall assembly behavior is similar to canonical ELPs. For FAMEs with stronger core interactions, the equilibrium size and coalescence of the coacervates is significantly affected by the PA-domain self-assembly at stage 1 as seen by the anisotropic growth of M-B.sub.2-ELP fibers and the disrupted coalescence of M-B.sub.3-ELP stemming from a large coacervate size and slow coalescence dynamics.
[0244] The third and final stage of self-assembly occurs at temperatures T>T.sub.c, where the repulsion between the ELP coronas is reduced due to further dehydration, which results in a decrease in the core-core distances inside the coacervates. In M-B.sub.2-ELP, we hypothesize that the cores are connected (non-covalently cross-linked) in this stage through a thermally-driven dynamic rearrangement leading to the formation of bundled fibers. In contrast, if the cores are held together by very strong forces as for M-B.sub.3-ELP, this dynamic rearrangement may not be competitive with non-specific aggregation of the ELP chains, resulting in the formation of ill-defined macroscopic aggregates.
[0245] The foregoing description of the specific aspects will so fully reveal the general nature of the invention that others can, by applying knowledge within the skill of the art, readily modify and/or adapt for various applications such specific aspects, without undue experimentation, without departing from the general concept of the present disclosure. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed aspects, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance.
[0246] The breadth and scope of the present disclosure should not be limited by any of the above-described exemplary aspects, but should be defined only in accordance with the following claims and their equivalents.
[0247] All publications, patents, patent applications, and/or other documents cited in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication, patent, patent application, and/or other document were individually indicated to be incorporated by reference for all purposes.
[0248] For reasons of completeness, various aspects of the invention are set out in the following numbered clauses:
[0249] Clause 1. A conjugate comprising: a fatty acid; a self-assembly domain comprising a sequence of 5 to 10 amino acids that is a substrate of a lipid enzyme transferase and that adopts a secondary structure at about 25 C., a pH of about 7, and a salt concentration of about 150 mM; and a polypeptide, wherein the fatty acid is N-terminal to the self-assembly domain, the polypeptide is C-terminal to the self-assembly domain, and the conjugate has a first phase transition at a transition temperature (T.sub.t) and a second phase transition at a critical temperature (T.sub.c), the T.sub.c being higher than the T.sub.t.
[0250] Clause 2. The conjugate of clause 1, wherein the fatty acid is selected from myristic acid, palmitic acid, lauric acid, arachidic acid, strearic acid, erucic acid, oleic acid, arachidonic acid, linoleic acid, and linolenic acid.
[0251] Clause 3. The conjugate of clause 2, wherein the fatty acid is myristic acid.
[0252] Clause 4. The conjugate of any one of the preceding clauses, wherein the self-assembly domain comprises a glycine at the N-terminus.
[0253] Clause 5. The conjugate of any one of the preceding clauses, wherein the self-assembly domain comprises an amino acid sequence of (G[XZ].sub.n) (SEQ ID NO:1) wherein X is an amino acid, Z is an amino acid more polar than X, and n is an integer from 2 to 5.
[0254] Clause 6. The conjugate of any one of clauses 1-4, wherein the self-assembly domain comprises an amino acid sequence of (GAGA), (GAGAS) (SEQ ID NO:2), (GAGAGAY) (SEQ ID NO:3), or (GLSLS) (SEQ ID NO:4).
[0255] Clause 7. The conjugate of any one of the preceding clauses, wherein the self-assembly domain adopts a beta-sheet secondary structure at about 25 C., a pH of about 7, and a salt concentration of about 150 mM.
[0256] Clause 8. The conjugate of any one of the preceding clauses, wherein the conjugate further comprises a linker in between the self-assembly domain and the polypeptide.
[0257] Clause 9. The conjugate of clause 8, wherein the linker comprises an amino acid sequence selected from (GGC), ([GGC].sub.8) (SEQ ID NO:5), ([G.sub.4S].sub.3) (SEQ ID NO:6), and [GGS].sub.n (SEQ ID NO:7), wherein n is an integer from 1 to 10.
[0258] Clause 10. The conjugate of any one of clauses 1-9, wherein the polypeptide comprises a repeated unstructured polypeptide or a non-repeated unstructured polypeptide.
[0259] Clause 11. The conjugate of any one of clauses 1-9, wherein the polypeptide comprises a zwitterionic polypeptide.
[0260] Clause 12. The conjugate of any one of clauses 1-9, wherein the polypeptide comprises an amino acid sequence of [GVGVP].sub.n (SEQ ID NO:8), wherein n is an integer from 10 to 120.
[0261] Clause 13. The conjugate of any one of the preceding clauses, wherein the conjugate self-assembles into aggregates above the T.sub.t of the conjugate.
[0262] Clause 14. The conjugate of clause 13, wherein the conjugate self-assembles into aggregates in three phases relative to the T.sub.t and the T.sub.c of the conjugate, wherein the three phases comprise: (1) a first phase at a temperature below the T.sub.t, wherein the conjugate is soluble and self-assembles into nanoscale aggregates; (2) a second phase at a temperature above the T.sub.t and below the T.sub.c, wherein the conjugate forms micron-sized aggregates; and (3) a third phase at a temperature greater than the T.sub.c, wherein the conjugate forms macroscale aggregates that are visible to the naked eye.
[0263] Clause 15. The conjugate of clause 14, wherein the aggregate comprises a micelle.
[0264] Clause 16. The conjugate of clause 14 or 15, wherein the aggregate comprises a rod-like structure.
[0265] Clause 17. The conjugate of clause 14 or 15, wherein the aggregate comprises a sheet.
[0266] Clause 18. A drug delivery composition comprising: a plurality of conjugates as detailed in any of clauses 1-17 self-assembled into a micelle; and an agent encapsulated within the micelle.
[0267] Clause 19. A method of treating a disease in a subject in need thereof, the method comprising administering the drug delivery composition of clause 18 to the subject.
[0268] Clause 20. A method of delivering an agent to a subject, the method comprising: encapsulating the agent in a micelle, the micelle comprising a plurality of conjugates as detailed in any of clauses 1-17; and administering the micelle to the subject.
[0269] Clause 21. The method of clause 20, wherein encapsulating comprises mixing the conjugates and agent and raising the temperature above the T.sub.t of the conjugates.
[0270] Clause 22. A method of increasing the maximum tolerated dose of an agent, the method comprising: encapsulating the agent in a micelle comprising a plurality of conjugates as detailed in any of clauses 1-17; and administering the agent-encapsulated micelle to a subject.
[0271] Clause 23. The method of any one of clauses 19-22, wherein the agent is hydrophobic.
[0272] Clause 24. The method of any one of clauses 19-22, wherein the agent comprises a small molecule, a polypeptide, a polynucleotide, a lipid, a carbohydrate, or a combination thereof.
[0273] Clause 25. A method of preparing a conjugate as detailed in any of clauses 1-17, the method comprising: (a) transforming a bacteria with a recombinant expression vector comprising a first polynucleotide encoding a first polypeptide and a second polynucleotide encoding a second polypeptide, wherein the first polypeptide comprises an N-myristoyl transferase (NMT), and wherein the second polypeptide comprises the self-assembly domain; and (b) culturing the transformed bacteria to express the first and second polypeptides and adding myristic acid to the N-terminus of the self-assembly domain.
[0274] Clause 26. The method of clause 25, wherein the bacteria comprise E. coli.
[0275] Clause 27. The method of any one of clauses 25-26, wherein the bacteria is cultured in media comprising myristic acid.
[0276] Clause 28. The method of any one of clauses 25-27, wherein the vector further comprises a single polynucleotide encoding a single antibiotic selection marker.
[0277] Clause 29. The method of clause 28, wherein the bacteria is cultured in media comprising the antibiotic.
[0278] Clause 30. The method of any one of clauses 25-29, wherein the NMT comprises NMT from S. cerevisiae.
[0279] Clause 31. The method of any one of clauses 25-30, wherein the NMT comprises an amino acid sequence consisting of residues 36-455 of NM_001182082.1 (S. cerevisiae NMT36-455).
[0280] Clause 32. The method of any one of clauses 25-31, further comprising (c) isolating the conjugate.
TABLE-US-00011 Sequences G[XZ].sub.n)(SEQIDNO:1) (GAGAS)(SEQIDNO:2) (GAGAGAY)(SEQIDNO:3) (GLSLS)(SEQIDNO:4) ([GGC].sub.8)(SEQIDNO:5) ([G.sub.4S].sub.3)(SEQIDNO:6) ([GGS].sub.n)(SEQIDNO:7) [GVGVP].sub.n(SEQIDNO:8) P(X).sub.nG(SEQIDNO:9) (U).sub.mP(X).sub.nG(Z).sub.p(SEQIDNO:10) PXXXG(SEQIDNO:11) PXXXXG(SEQIDNO:12) PXXXXXG(SEQIDNO:13) PXXXXXXG(SEQIDNO:14) PXXXXXXXG(SEQIDNO:15) PXXXXXXXXG(SEQIDNO:16) PXXXXXXXXXG(SEQIDNO:17) PXXXXXXXXXXG(SEQIDNO:18) PXXXXXXXXXXXG(SEQIDNO:19) PXXXXXXXXXXXXG(SEQIDNO:20) PXXXXXXXXXXXXXG(SEQIDNO:21) PXXXXXXXXXXXXXXG(SEQIDNO:22) PXXXXXXXXXXXXXXXG(SEQIDNO:23) (VPGXG).sub.n(SEQIDNO:24) VPX.sub.1X.sub.2G(SEQIDNO:25) VPGXG(SEQIDNO:26) (VPX.sub.1X.sub.2G).sub.n(VPGXG).sub.m(SEQIDNO:27) (VPGXG).sub.m(VPX.sub.1X.sub.2G).sub.n(SEQIDNO:28) {(VPX.sub.1X.sub.2G)(VPGXG)}.sub.b(SEQIDNO:29) GAGASRGGSGGSGVGVPGVGVP(SEQIDNO:30) GAGAGAYRGGSGGSGGSGVGVPGVGVP(SEQIDNO:31) GLSLSRGGSGGSGVGVPGVGVP(SEQIDNO:32) GVEVERGGSGGSGGSGVGVPGVGVP(SEQIDNO:33) 5-CAATGGTATATCTTCCGGGCGCTATCATGCCATACCTTTTTATACCATGGGCAGCA GCCATCACCATCATCACCACAAAGACCACAAATTTTGGCGTACCCAGCCGGTTAAAGATTT TGATGAAAAAGTTGTTGAAGAAGGTCCGATCGACAAACCGAAAACACCGGAAGATATTAGC GATAAACCGCTGCCGCTGCTGAGCAGCTTTGAATGGTGTAGCATTGATGTGGACAACAAAA AACAGCTGGAAGATGTTTTTGTGCTGCTGAACGAAAACTATGTGGAAGATCGTGATGCAGG TTTTCGCTTGAATTATAGCAAAGAGTTTTTCAACTGGGCACTGAAAAGTCCGGGTTGGAAAA AAGATTGGCATATTGGTGTTCGTGTGAAAGAAACCCAGAAACTGGTTGCATTTATTAGCGC AATTCCGGTTACCCTGGGTGTGCGTGGTAAACAGGTTCCGAGCGTTGAAATTAAGTTTCTG TGTGTTCATAAACAGCTGCGTAGCAAACGTCTGACACCGGTTCTGATTAAAGAAATCACCC GTCGTGTGAACAAATGCGATATTTGGCATGCACTGTATACCGCAGGTATTGTTGTGCCTGC ACCGGTTAGCACCTGTCGTTATACCCATCGTCCGCTGAACTGGAAAAAACTGTATGAAGTT GATTTCACCGGTCTGCCGGATGGTCATACCGAAGAAGATATGATTGCAGAAAATGCACTGC CTGCAAAAACCAAAACCGCAGGTCTGCGTAAACTGAAAAAAGAGGACATCGATCAGGTCTT TGAGCTGTTTAAACGTTATCAGAGCCGCTTTGAACTGATCCAGATTTTTACCAAAGAAGAGT TCGAGCACAACTTTATTGGTGAAGAAAGCCTGCCGCTGGATAAACAGGTGATTTTTAGCTA TGTTGTTGAACAGCCGGATGGCAAAATTACCGATTTTTTCAGCTTTTATAGCCTGCCGTTTA CCATTCTGAACAACACCAAATACAAAGACCTGGGCATTGGCTATCTGTATTATTACGCAACC GATGCCGATTTCCAGTTTAAAGATCGTTTTGATCCGAAAGCAACCAAAGCCCTGAAAACCC GTCTGTGCGAACTGATTTATGATGCATGTATTCTGGCCAAAAACGCCAACATGGATGTTTTT AATGCACTGACCAGCCAGGATAATACCCTGTTTCTGGATGATCTGAAATTTGGTCCGGGTG ATGGTTTTCTGAATTTCTACCTGTTTAACTATCGTGCCAAACCGATTACCGGTGGTCTGAAT CCGGATAATAGCAATGATATTAAACGTCGCAGCAATGTTGGTGTGGTTATGGTGTGATAAT GATAATGATCTTCTGAATTCCGTCATATCCGCTGAGCAATAACTAGCATAACCCCTTATAC GTTACAT-3 (SEQIDNO:34) (GAGASRGGSGGS)(SEQIDNO:35) ATCTTAGTATATTAGTTAAGTATAAGAAGGAGATATACATATGGGGGCGGGCGCATCTCGT GGTGGCAGTGGTGGGAGCGGcTAATGATCTCCTCTATGAGGATCCGCTCGAGTCTGGTAA AGAAACCGCTGCTGCGAAATTTGAA(SEQIDNO:36) (GAGAGAYRGGSGGSGGS)(SEQIDNO:37) CATCTTAGTATATTAGTTAAGTATAAGAAGGAGATATACATATGGGAGCGGGTGCAGGTGC CTATAGAGGTGGGTCGGGAGGCAGTGGAGGCTCAGGCTAATGATCTCCTCAATGAGCTCG AGTCTGGTAAAGAAACCGCTGCTGCGAAATTTGAACG(SEQIDNO:38) (GLSLSRGGSGGS)(SEQIDNO:39) ATCTTAGTATATTAGTTAAGTATAAGAAGGAGATATACATATGGGGCTGAGCCTGTCTCGTG GTGGCAGTGGTGGGAGCGGCTAATGATCTCCTCAATGAGCTCGAGTCTGGTAAAGAAACC GCTGCTGCGAAATTTGAA(SEQIDNO:40) MGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVG VPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGV GVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPG VGVPGVGVPGVGVPGVGVPGVGVPGY(SEQIDNO:41) MGAGASRGGSGGSGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPG VGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVP GVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGV PGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGY(SEQIDNO:42) MGAGAGAYRGGSGGSGGSGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPG VGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVP GVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGV PGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGY(SEQIDNO:43) MGLSLSRGGSGGSGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPG VGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVP GVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGV PGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGY(SEQIDNO:44) MGAGASRGGSGGSGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPG VGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVP GVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGV PGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGGKGY(SEQIDNO:45) MGAGAGAYRGGSGGSGGSGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPG VGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVP GVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGV PGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGGKGY(SEQIDNO:46) MGLSLSRGGSGGSGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPG VGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVP GVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGV PGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGVGVPGGKGY(SEQIDNO:47) GAGASR(SEQIDNO:48) GAGAGAYR(SEQIDNO:49) GLSLSR(SEQIDNO:50) (GVGVP).sub.40GY(SEQIDNO:51) [Gly-Val-Gly-Val-Pro].sub.40(SEQIDNO:52)