1,4-di-(4-methylthiophenyl)-3-phtaloylazetidine-2-one and the derivatives thereof
10457665 · 2019-10-29
Assignee
- Universite De Nantes (FR)
- Universite de Bourgogne (FR)
- Institut National De La Sante Et De La Recherche Medicale (Inserm) (FR)
Inventors
- Jean-Michel Robert (Nantes, FR)
- Stéphanie Troy-Fioramonti (Dijon, FR)
- Laurent Demizieux (Dijon, FR)
- Pascal DeGrace (Dijon, FR)
Cpc classification
C07D403/04
CHEMISTRY; METALLURGY
C07D205/085
CHEMISTRY; METALLURGY
International classification
C07D403/04
CHEMISTRY; METALLURGY
C07D205/085
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a compound with formula (I) or a salt and/or a pharmaceutically acceptable solvate thereof, the method for preparing same as well as the uses thereof, in particular the therapeutic use thereof, mainly in the treatment of diseases associated with a hyperactivity of the endocannabinoid system. ##STR00001##
Claims
1. A compound of following formula (I): ##STR00024## wherein: R.sub.1 and R.sub.2, which can be identical or different, represent a hydrogen atom or a COR.sub.3, SO.sub.2R.sub.4 or CONR.sub.5R.sub.6 group; or form together with the nitrogen atom that bears them a 5- or 6-member heterocycle comprising at least one additional heteroatom, CO group, aryl group or heteroaryl group; R.sub.3, R.sub.4, R.sub.5 and R.sub.6 independently represent a hydrogen atom, or an aryl or heteroaryl group, said group being optionally substituted by one or more groups selected from a halogen atom, OR.sub.7, NR.sub.8R.sub.9, SR.sub.10, S(O)R.sub.11, SO.sub.2R.sub.12, SO.sub.2NR.sub.13R.sub.14, OCOR.sub.15, NR.sub.16COR.sub.17, NR.sub.18C(O)OR.sub.19, CO.sub.2R.sub.20, CONR.sub.21R.sub.22, OCO.sub.2R.sub.23, OCONR.sub.24R.sub.25, COR.sub.26, nitro (NO.sub.2), cyano (CN), oxo (O) and CF.sub.3; and R.sub.7 to R.sub.26 independently represent a hydrogen atom or a (C.sub.1-C.sub.6)alkyl, aryl or aryl-(C.sub.1-.sub.6)alkyl group, or a pharmaceutically acceptable salt thereof.
2. The compound according to claim 1, wherein R.sub.1 and R.sub.2 form together with the nitrogen atom that bears them a heterocycle of following formula (II) or (III): ##STR00025## wherein R.sub.27 represents a hydrogen atom or a COR.sub.3 or SO.sub.2R.sub.4 group, R.sub.3 and R.sub.4 being as defined in claim 1, in particular R.sub.27 represents a hydrogen atom.
3. The compound according to claim 1, wherein: R.sub.1 and R.sub.2, which can be identical or different, represent a hydrogen atom or a COR.sub.3, SO.sub.2R.sub.4or CONR.sub.5R.sub.6 group; R.sub.3, R.sub.4 and R.sub.5 independently represent an aryl group, optionally substituted by a group selected from a halogen atom, CF.sub.3 and SO.sub.2R.sub.12, with R.sub.12 representing a (C.sub.1C.sub.6)alkyl group, preferably a methyl; and R.sub.6 represents a hydrogen atom.
4. The compound according to claim 1, wherein R.sub.1 is a hydrogen atom and R.sub.2 represents a COR.sub.3, SO.sub.2R.sub.4 or CONR.sub.5R.sub.6 group, with R.sub.3, R.sub.4, R.sub.5 and R.sub.6 being as defined in claim 1.
5. The compound according to claim 1, wherein it is selected from the following compounds: ##STR00026## ##STR00027## or a pharmaceutically acceptable salt thereof, wherein X represents a hydrogen atom, a halogen or CF.sub.3.
6. A process for preparing a compound of formula (I) as defined according to claim 1, comprising the following steps: (i) condensation of 4-methylthiobenzaldehyde with 4-methylthioaniline to obtain the composition of following formula (IV): ##STR00028## (ii) Staudinger cycloaddition between the composition of formula (IV) obtained and a ketene of following formula (V): ##STR00029## to obtain the composition of following formula (IA): ##STR00030## (iii) optionally, deprotection of the phthaloylated amine function of the compound of formula (IA), preferably by action of methylhydrazine, to obtain the composition of following formula (IF): ##STR00031## then, optionally, coupling of the compound of formula (IF) thus obtained with a compound of formula R.sub.1X and/or R.sub.2X, wherein R.sub.1X and R.sub.2X are activated forms, such as acyl chlorides, sulphonyl chlorides and aryl isocyanates, of groups R.sub.1 and R.sub.2 as defined in claim 1; and (iv) collection of the compound obtained in step (ii) or in step (iii).
7. A method comprising the in vitro use of at least one compound of formula (I) as defined in claim 1, as inverse agonist of the peripheral endocannabinoid CB1 receptors, said method comprising the step of contacting in vitro said peripheral endocannabinoid CB1 receptor with at least one compound of formula (I).
8. A pharmaceutical composition comprising as active ingredient at least one compound of formula (I) as defined in claim 1, and at least one pharmaceutically acceptable excipient.
9. A nontherapeutic composition, comprising at least one compound of formula (I) as defined in claim 1, and at least one acceptable excipient.
10. A method for treating diseases associated with hyperactivity of the endocannabinoid system comprising the administration of an effective amount of a compound as defined by the following formula (I): ##STR00032## wherein: R.sub.1 and R.sub.2, which can be identical or different, represent a hydrogen atom or a COR.sub.3, SO.sub.2R.sub.4 or CONR.sub.5R.sub.6 group; or form together with the nitrogen atom that bears them a 5- or 6-member heterocycle comprising at least one additional heteroatom, CO group, aryl group or heteroaryl group; R.sub.3, R.sub.4, R.sub.5 and R.sub.6 independently represent a hydrogen atom, or an aryl or heteroaryl group, said group being optionally substituted by one or more groups selected from a halogen atom, OR.sub.7, NR.sub.8R.sub.9, SR.sub.10, S(O)R.sub.11, SO.sub.2R.sub.12, SO.sub.2NR.sub.13R.sub.14, OCOR.sub.15, NR.sub.16COR.sub.17, NR.sub.18C(O)OR.sub.19, CO.sub.2R.sub.20, CONR.sub.21R.sub.22, OCO.sub.2R.sub.23, OCONR.sub.24R.sub.25, COR.sub.26, nitro (NO.sub.2), cyano (CN), oxo (O) and CF.sub.3; and R7 to R26 independently represent a hydrogen atom or a (C1-C6)alkyl, aryl or aryl-(C1-C.sub.6)alkyl group, or a pharmaceutically acceptable salt and/or solvate thereof, or the pharmaceutical composition as defined in claim 8, in a subject in need thereof.
11. The method according to claim 10, wherein said diseases are selected from obesity and obesityrelated metabolic disorders, insulin resistance, diabetes and associated complications, hepatic steatosis, liver fibrosis, cirrhosis, renal fibrosis, nephropathy, cardiomyopathies, gastroparesis, bone and/or cartilage loss, muscle loss, and fertility problems.
12. The method according to claim 10, wherein subject is put on a balanced normocaloric diet.
13. The method according to claim 10, wherein compound or said composition is administered to said subject before and/or during the subject's meal(s).
14. A method for treating a disease associated with hyperactivity of the endocannabinoid system comprising the administration of an effective amount of the compound of formula (I) as defined in claim 1, and therapeutic agent, as combined preparation for simultaneous, separate, or sequential administration, in a subject in need thereof.
15. A nontherapeutic method for promoting and/or accelerating weight gain or for slowing and/or reducing weight gain in a subject, comprising administering an effective amount of a compound of formula (I) as defined by the following formula (I): ##STR00033## wherein: R1 and R2, which can be identical or different, represent a hydrogen atom or a COR3, SO2R4 or CONR5R6 group; or form together with the nitrogen atom that bears them a 5- or 6-member heterocycle comprising at least one additional heteroatom, CO group, aryl group or heteroaryl group; R3, R4, R5 and R6 independently represent a hydrogen atom, or an aryl or heteroaryl group, said group being optionally substituted by one or more groups selected from a halogen atom, OR7, NR8R9, SR10, S(O)R11, SO2R12, SO2NR13R14, OCOR15, NR16COR17, NR18C(O)OR19, CO2R20, CONR21R22, OCO2R23, OCONR24R25, COR26, nitro (NO2), cyano (CN), oxo (O) and CF3; and R7 to R26 independently represent a hydrogen atom or a (C1-C6)alkyl, aryl or aryl-(C1-C6)alkyl group, or a pharmaceutically acceptable salt and/or solvate thereof, or of a composition as defined according to claim 9.
16. The nontherapeutic method according to claim 15, wherein said subject is put on a balanced normocaloric diet.
17. The nontherapeutic method according to claim 15, wherein said compound or said composition is administered to said subject before and/or during the subject's meal(s).
Description
DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
EXAMPLES
(20) I. Synthesis of the Compounds According to the Invention
(21) 1. Materials
(22) Melting points were determined by means of an Electrothermal IA9300 apparatus, and are reported uncorrected.
(23) 1H and 13C NMR spectra were obtained with a Bruker Avance 400 spectrometer (400 MHz). Chemical shifts (6) are expressed in ppm with tetramethylsilane as internal control. The conventional representations (s=singlet, d=doublet, t=triplet, q=quadruplet, sext=sextuplet, m=multiplet and b=broad) are used for the description of the spectra. Coupling constants are expressed in hertz (Hz).
(24) Mass spectrometry (MS) analysis was carried out on a Waters Acquity UPLC System ZaQ 2000 single quadrupole spectrometer.
(25) Infrared spectra are obtained on a Perkin-Elmer Paragon FTIR 1000 PC apparatus. Only the characteristic absorption bands are shown; wave number values are expressed in cm-1.
(26) Monitoring of the reactions is carried out by thin-layer chromatography (TLC) on silica gel 60F-254 (5735 Merck), and the chromatographic purification columns on silica gel 60 (70-230 Mesh, ASTM, Merck).
(27) All the reagents and solvents used are commercial products.
(28) 2. Synthesis of 4-methylthiobenzyl-4-methylthiobenzaldimine (IV)
(29) ##STR00018##
(30) In 50 mL of toluene, dissolve 5.57 g (36.6 mM) of 4-methylthiobenzaldehyde and 5.0 g (35.92 mM) of 4-methylthioaniline. Add 3 g anhydrous sodium sulphate, and heat to reflux of the solvent, under stirring, for 4 hours. At the end of that time, the solvent is removed with the rotary evaporator under reduced pressure. The collected solid is triturated in 10 mL of isopropyl oxide and the suspension obtained filtered on sintered glass. Thus collect 7.66 g of imine (yield=78%).
(31) Chemical Features:
(32) MP C.=143-144 (Diisopropyl oxide).
(33) .sup.1H-NMR (CDCl.sub.3): 2.51, s, 3H, 4-SCH3; 2.54, s, 3H, 4-SCH3; 7.18, d, 2H, H.sup.3H.sup.5, J=6.7 Hz; 7.29, d, 2H, H.sup.2H.sup.6; 7.30, d, 2H, H.sup.3H.sup.5, J=8.4 Hz; 7.80, d, 2H, H.sup.2H.sup.6; 8.41, s, 1H, HCN.
(34) MS (ESI) m/z (%): 274[M+H].sup.+
(35) IR (KBr, cm.sup.1): 1552.53 ( CN).
(36) 3. Synthesis of the Acid Chloride of Phthaloylglycine
(37) ##STR00019##
(38) Dissolve 2 g (9.75 mM) of N-phthaloylglycine in 20 mL of thionyl chloride, and reflux for 3 hours. At the end of that time, the thionyl chloride is evaporated under reduced pressure with the rotary evaporator. The product obtained is taken up three times in 50 mL of toluene, and subjected each time to evaporation under reduced pressure. At the end of the third evaporation, the product obtained is kept under vacuum for 30 minutes, then is taken up again in 20 mL of dry dichloroethane and stored as such until use.
(39) 4. Synthesis of trans-1,4-di-(4-methylthiophenyl)-3-N-phthaloyl-azetidine-2-one (Compound IA=Also Called Hereinafter JM-00.266 or M6)
(40) ##STR00020##
(41) In a 250-mL round-bottom flask, dissolve 2.73 g (10.0 mM) of imine (IV) in 50 mL of dry dichloromethane. Add 5 mL of triethylamine and place the whole under stirring. Next, slowly introduce a solution of acid chloride of phthaloylglycine (9.75 mM) while keeping the mixture at a temperature below 10 C. Once the addition is finished, allow the mixture to return to room temperature, and keep it as such while monitoring the reaction's progress by TLC. At the end of 3 hours, the reaction progresses no further; pour the reaction mixture into 100 mL of water, and collect the organic phase with a separating funnel. Wash it again with an identical amount of water, then dry it over anhydrous sodium sulphate, filter and evaporate the solvent to dryness. The residue obtained is then chromatographed on silica column by eluting with dichloromethane, which makes it possible to obtain 2.39 g of compound (IA) (Y=53%).
(42) Chemical Features:
(43) MP C.=118-120 (Diethyl ether)
(44) .sup.1H-NMR (CDCl.sub.3): 2.44, s, 3H, CH.sub.3; 2.49, s, 3H, CH.sub.3; 5.26, d, 1H, H.sub.a; 5.33, d, 1H, H.sub.b (JH.sub.aH.sub.b=2.4 Hz); 7.18, d, 2 arom.H, (J=8.4 Hz); 7.25-7.30, m, 4 arom.H; 7.78, m, 2H, H4-H5; 7.88, m, 2H, H3-H6.
(45) .sup.13C-NMR (100.6 MHz, CDCl) 16.45(CH.sub.3); 16.50(CH.sub.3); 60.99(Cb); 62.77(Ca); 118.15(2C); 123.85(C3-C6); 126.63(2C); 127.00(2C); 127.91(2C); 131.65(C2-C7); 132.10(C1); 134.14(C4-C1); 134.61(C4-C5); 140.11(C4); 161.75(C1-C8); 166.65(Cc).
(46) MS (ESI) m/z (%): 461.6 [M+H].sup.+
(47) IR (KBr, cm.sup.1): 3064, CH.sub.ar; 2974, 2922, 2835, CH.sub.aliph; 1759, 1714, CO.
(48) 5. Other Compounds Tested
(49) ##STR00021##
6. Alternative Synthetic Pathway for trans-1,4-di-(4-methylthiophenyl)-3-N-phthaloyl-azetidine-2-one (Compound IA=Also Called Hereinafter JM-00.266 or M6)
(50) Another synthetic pathway for compound JM-00.266 was developed. It consists in contacting the imine (compound IV) with N-phthaloylglycine, and generating the ketene in situ by means of a coupling agent, phenyl dichlorophosphate, in the presence of triethylamine as proton acceptor. The advantage of this method is to avoid the use of thionyl chloride, the handling and removal of which can be tricky.
(51) According to one procedure, 1.38 g of imine (compound IV) (5 mM) is dissolved in 20 mL of dichloromethane, under stirring; 3 mL of triethylamine then 1.128 g of N-phthaloylglycine are added. 1.5 mL (2.11 g, i.e. 10 mM) of phenyl dichlorophosphate is then introduced dropwise into the mixture, and the reaction is left at room temperature for 3 h. At the end of that time, the reaction mixture is washed with water, the organic phase is collected, dried and concentrated under reduced pressure. The residue obtained is chromatographed on silica gel column by eluting with dichloromethane. 1.51 g of compound IA (JM-00.266 trans; the cis isomer is not present in the reaction mixture) is thus collected with a 66% yield.
(52) 7. Deprotection of the Amine Function Starting with trans-1,4-di-(4-methylthiophenyl)-3-N-phthaloyl-azetidine-2-one (Compound IA=Also Called Hereinafter JM-00.266 or M6)
(53) In addition, deprotection of the phthaloylated amine function on compound JM-00.266 was carried out. Release of the amine function was concluded successfully by action of methylhydrazine in methylene chloride.
(54) According to one procedure, 0.1 mL (2.18 mM) of methylhydrazine is added to 0.44 g of compound IA JM-00.266 (0.955 mM) in solution in 20 mL of dichloromethane (DCM); the mixture is left under stirring first at room temperature then while slowly raising the temperature to reflux of DCM and while monitoring the reaction's progress by TLC. When the reaction is completed (4 h), the reaction mixture is washed with water then dried and concentrated by evaporation to dryness. The residue obtained is chromatographed on silica gel by means of a short column (diameter=30 mm; length=70 mm) and by eluting with ethyl acetate. 221 mg of the desired amine is thus collected (compound IF, also called hereinafter HR-0131 trans) with a yield ranging from 70 to 81% with an optimized synthesis and purification process.
(55) ##STR00022##
Structures of the Two Enantiomers of Compound HR-0131 Trans
(56) Physicochemical Features of Compound HR-0131:
(57) Empirical formula: C.sub.17H.sub.18N.sub.2S.sub.2O; molecular mass: 330.47; M=134 C. (AcOEt).
(58) IR (KBr, cm.sup.1): 3350-3061 (CH.sub.ar); 2981-2835 (CH.sub.aliph); 1728 (CO).
(59) .sup.1H-NMR, (ppm), DMSO-d6: 2.43, s, 3H, SCH.sub.3(benzald); 2.49, s, 3H, SCH.sub.3(anil); 3.66, 2H, NH.sub.2; 3.92, d, 1H, (NCHlact); 4.73, d, 1H, (COCHlact), J=2.0 Hz; 7.18-7.34, m, 8 Har.
(60) .sup.13C-NMR, (ppm), DMSO-d6: 14.73; 15.54; 65.41; 70.82; 117.75; 124.31; 126.41; 126.91; 127.52; 128.91; 132.41; 132.51; 133.08; 134.30; 135.01; 138.14; 168.80.
(61) MS (ESI) m/z (%): 331 [M+H].sup.+
(62) 8. Synthesis of Derivatives Starting with Amine HR-0131
(63) Starting with the amine prepared previously, it was envisaged to synthesize a superior homologous derivative (HR-0133) of compound JM-00266. This derivative results from the condensation of phthaloylglycine on HR-0131 and represents a structure into which a space has been introduced between the lactam ring and the phthaloyl substituent.
(64) ##STR00023##
Structure of Compound HR-0133 Trans
(65) According to one procedure, 144 mg (0.7 mM) of N-phthaloylglycine and 1 mL of triethylamine are added to a solution of 183 mg (0.55 mM) of HR-0131 in 15 mL of dichloromethane. 169 mg (0.8 mM) of phenyl dichlorophosphate is then added dropwise and the mixture is left under stirring for 3 h. At the end of that time, the solvent is evaporated and the residue obtained is chromatographed on silica column by eluting with ethyl ether. 61 mg of the desired product (HR-0133 trans) is obtained (Y=21%, a yield which can be improved by optimizing the synthesis and purification process).
(66) Physicochemical Features of Compound HR-0133:
(67) Empirical formula: C.sub.27H.sub.23N.sub.3S.sub.2O.sub.4; molecular mass: 517.63; M=190-192 C. (iPrOiPr).
(68) IR (KBr, cm.sup.1): 3348 (CH.sub.ar); 2998-2918 (CH.sub.aliph); 1728, 1693 (CO).
(69) .sup.1H-NMR, (ppm), DMSO-d6: 2.43, s, 3H, SCH.sub.3(benzald); 2.49, s, 3H,S CH.sub.3(anil); 4.37, s, 2H, CH.sub.2; 4.72, dd, 1H, (COCHlact), J=2.4 Hz, J=7.6 Hz; 5.05, d, 1H, (NCHlact), J=2.4 Hz; 7.18, d, 2H, H.sub.2H.sub.6benzald, J=8.8 Hz; 7.23, d, 2H, H.sub.3H.sub.5benzald, J=8.8 Hz; 7.29, d, 2H, H.sub.3H.sub.5anil, J=8.4 Hz; 7.40, d, 2H, H.sub.2H.sub.6anil, J=8.4 Hz; 7.90-7.98, m, 4H, Ft.sub.arH, 9.20, d, 1H, NH, J=7.6 Hz.
(70) .sup.13C-NMR, (ppm), DMSO-d6: 14.62; 15.39; 40.33; 61.49; 65.08; 117.86(2C); 123.44(2C); 126.34(2C); 127.35(2C); 127.39; 131.88; 133.09(2C); 133.19(2C); 134.40; 134.80(2C); 141.00; 163.98; 166.98; 167.59(2C).
(71) MS (ESI) m/z (%): 518 [M+H].sup.+.
(72) II. Biological Activity of the Synthesized Compounds
(73) 1. Materials and Methods
(74) 1.1. In Vitro Studies
(75) 1.1.1. Liver Explant Culture
(76) The liver of the mice was perfused in situ, under sodium pentobarbital anaesthesia (50 mg/kg), with Hank's medium (pH 7.4) saturated with oxygen. Next, the liver was sectioned using a Brendel/Vitron slicer (Tucson, Ariz., USA) in the same medium. The liver sections (about 200 m) were then incubated 21 h in William's medium E (WME) oxygenated and supplemented with deactivated foetal calf serum (10%) and antibiotic/antifungal cocktail (1%) under controlled atmosphere (5% CO2), to which is added either the antagonist to be tested or vehicle.
(77) 1.1.2. Gene Expression
(78) Total messenger RNA (mRNA) extraction was carried out with Tri Reagent (Euromedex, France) and consecutive synthesis of complementary DNA (cDNA) was carried out from 1 g of mRNA with the Bio-Rad iScripttm Reverse Transcription super mix kit (Bio-Rad, France).
(79) Gene expression was evaluated by semi-quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR). The primers used were designed using the Primer3Plus software (http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi) and were synthesized by MWG-Biotech (TATA box-binding protein: Sense acggcacaggacttactcca, antisense gctgtctttgttgctcttccaa; CB1R: Sense ccgcaaagatagtcccaatg, antisense aaccccacccagtttgaac). Semi-quantification of gene expression was obtained by taking into account the efficacy of each PCR and after standardization with the reporter gene, TATA box-binding protein.
(80) 1.1.3. GloSensor cAMP Assay
(81) HEK293T/17 (ATCC) cells were cultured in DMEM 10% FCS, then seeded at 30000 cells/well in 96-well plates. After 24 h, the cells were subjected to transient transfection by FuGENE HD (Promega) by pcDNA3.1-mCB1 (50 ng) and pGlo (100 ng) plasmids with or without pertussis toxin (PTX). For the control assays, the cells were transfected with empty pcDNA3 (EV) and pGlo vectors with or without PTX. At 48 h (24 h post-transfection), the cells were loaded for 2 h with 2% GloReagent in CO2-independent medium with 10% FCS (80 L/well).
(82) The cells were then treated by adding, at t=0, 10 L/well of Forskolin (FSK) 1 M final, in order to increase the basal cAMP concentration. The kinetics of appearance of cAMP was monitored for 10 minutes. At t=10, the molecules to be tested were added and the cAMP variations measured for 20 minutes. The light signal was measured in RLU and is expressed as % response relative to the signal read at t=10 min (FSK1 M). Sigmoidal curves were obtained by measurement at t=10 min after addition of the molecule to be tested (thus t=20 min total) of the percentage of light signal as a function of molecule concentration. The 4PL regression was carried out using the Sigma Plot software and made it possible to obtain an EC50 (1 experiment, n=3).
(83) 1.2. Short-term In Vivo Studies: Acute Tests.
(84) 1.2.1. Gastrointestinal Transit
(85) Transit through the stomach and the intestine was measured via oral administration of vegetable charcoal suspended in gum arabic used herein as nonabsorbable marker. Briefly, following a short fast, C57BL/6 mice were injected intraperitoneally (i.p.) with anandamide (10 mg/kg) in the presence or absence of the molecule of interest JM-00.266 (i.e., compound IA) (10 mg/kg) before oral charcoal administration. 25 minutes later, the animals were sacrificed by cervical dislocation in order to entirely remove the intestine. The distance between the beginning of the pylorus and the location of the charcoal bolus was measured.
(86) 1.2.2. Oral Glucose Tolerance Test (OGTT)
(87) In order to evaluate the short-term effects of the rimonabant-like molecules, as well as their selectivity for CB1R, wild-type C57BL/6 mice and CB1R / mice underwent an oral glucose tolerance test (OGTT at 2 g/kg) 10 min after i.p. injection of vehicle or of JM-02.003 or JM-00.266 (i.e., compound IA) (10 mg/kg). Blood glucose was measured at times t=0, t=15 min, t=30 min, t=45 min, t=60 min, t=90 min, and t=120 min post-oral. glucose administration using a ContourTS blood glucose monitor (ref. 81574201, Bayer HealthCare) and reactive strips (ref. 81574274, Bayer HealthCare).
(88) 1.2.3. Insulin Tolerance Test (ITT)
(89) The short-term effect of molecule JM-00.266 (i.e., compound IA) on insulin sensitivity was measured during an insulin tolerance test. To that end, wild-type C57BL/6 mice were injected intraperitoneally with fast-acting insulin (0.5 IU/kg; ref. YT60088, Actrapid) 10 min after i.p. injection of vehicle or of JM-00.266 (i.e., compound IA) (10 mg/kg). Blood glucose was measured at times t=0, t=15 min, t=30 min, t=45 min, t=60 min, t=90 min, and t=120 min post-i.p. insulin injection using a blood glucose monitor.
(90) 1.2.4. Plasma Insulin
(91) Assay of plasma insulin was carried out using the ALPCO Mouse Insulin ELISA Kit (ref. AKRIN-011T, ALPCO Diagnostics) according to the supplier's instructions. Blood samples were collected during an OGTT at t=0, t=30, t=60, t=120 min post-administration of the oral bolus of glucose (2 g/kg).
(92) 1.3. Long-term In Vivo Studies: Chronic Administration
(93) 1.3.1. Diet, Food Intake and Body Composition of the Animals
(94) In order to determine the long-term effects of the molecules of interest, C57BL/6 mice made obese by means of a high-sucrose, high-fat diet (HSHF: 30% crude fat, 33.5% carbohydrates; ref. E15126-34; ref. E15126-34, SSNIFF, Soest, Germany) for 20 weeks. These mice then received daily an i.p. injection of rimonabant, JM-00.266 (i.e., compound IA) or vehicle for a period of 30 days. In parallel, weight and food intake were monitored every two days following the beginning of the treatment.
(95) The long-term effect of the treatment on body composition was measured using an EchoMRI scanner allowing non-invasive analysis of fat mass, lean mass and body fluid composition by nuclear magnetic resonance (NMR) on the live animal without anaesthesia.
(96) 1.3.2. Behavioural Study: Open-field Test
(97) Locomotor activity of the mice was measured at the conclusion of the chronic treatment with rimonabant or molecule JM-00.266 (i.e., compound IA) by an infrared monitoring system. To that end, the animals were placed individually in 4343 cm plexiglass boxes (MED associates) for 20 min. Two series of 16 pulsed infrared beams were spaced 2.5 cm apart on opposite walls to record ambulatory X-Y movements at 100 ms resolution. The centre was defined as a central 3232 cm square. In addition to locomotor activity information, this test makes it possible to predict anxiolytic activity in response to novelty or to an anxiogenic environment. The variables measured in the open field are total ambulatory activity (in cm), the number of entries and the time spent in the central area as well as the distance traversed in the centre divided by the total distance traversed.
(98) 1.3.3. Plasma Assays
(99) Total cholesterol, triglycerides and hepatic markers were assayed by a Dimension Vista Intelligent Lab System (Siemens, Saint-Denis, France) using suitable reagents.
(100) 1.3.4. Oral Glucose Tolerance Test and Insulin Tolerance Test
(101) In order to evaluate the long-term effects of the treatment on blood glucose control, glucose tolerance (OGTT) and insulin sensitivity (ITT) were evaluated pre- and post-treatment. Thus, for the OGTT the mice were force-fed glucose (2 g/kg), and for the ITT the mice received an i.p. injection of insulin (0.5 IU/kg). In both cases, blood glucose was measured at times t=0, t=15 min, t=30 min, t=45 min, t=60 min, t=90 min, and t=120 min post-glucose ingestion using a ContourTS blood glucose monitor (ref. 81574201, Bayer HealthCare) and reactive strips (ref. 81574274, Bayer HealthCare).
(102) 1.4 Long-term In Vivo Study: Administration of Compound IA in Combination with a Reduced Energy Supply in Obese Mice
(103) 1.4.1 High-fat Diet, Food Intake Associated with a Low-fat Diet and Body Mass of the Animals
(104) In order to determine the long-term effects of compound of interest JM-00.266 (i.e., compound IA), C57BL/6 mice were made obese by means of a high-fat diet (30% crude fat, 33.5% carbohydrates; ref. E15126-34, SSNIFF, Soest, Germany) for 15 weeks. The mice were then subjected to a low-fat diet (5% lipids; Standard Diet AO4; UAR, Epinay-sur-Orge, France) and received daily, in the middle of the day, an oral dose of JM-00.266 (i.e., compound IA) or of vehicle over a period of 43 days. The weight of the animals was measured every two days from the beginning of the treatment.
(105) 1.4.2 Glucose Tolerance Test
(106) In order to evaluate the long-term effects of the treatment on blood glucose control, glucose tolerance was evaluated at the end of the treatment period. The mice received an intraperitoneal injection of glucose (2 g/kg) then blood glucose was measured at times t=0, t=15 min, t=30 min, t=45 min, t=60 min, t=90 min, and t=120 min post-glucose injection using a My Life Pura blood glucose monitor (Ypsomed, Paris, France).
(107) 1.5 Long-term In Vivo Study: Administration of Compound IA Simultaneously with Food Intake in Obese Mice Maintained on a High-fat Diet
(108) The choice of this approach is justified by the fact that previous results show that when the administration of M6 precedes a glucose load, sugar tolerance is very clearly improved.
(109) 1.5.1 High-fat Diet, Administration of the Compound Simultaneously with Food Intake and Body Mass of the Animals
(110) C57BL/6 mice were made obese by means of a high-fat diet (35% crude fat, 25.3% carbohydrates; ref. E15742-34, SSNIFF, Soest, Germany) for 15 weeks. The mice maintained on the same diet then received daily an oral dose of JM-00.266 (i.e., compound IA) or of vehicle incorporated in the feed over a period of 43 days. The weight of the animals was measured every two days from the beginning of the treatment.
(111) 1.5.2 Glucose Tolerance Test
(112) In order to evaluate the long-term effects of the treatment on blood glucose control, glucose tolerance was evaluated at the end of the treatment period. The mice received an intraperitoneal injection of glucose (2 g/kg) then blood glucose was measured at times t=0, t=15 min, t=30 min, t=45 min, t=60 min, t=90 min, and t=120 min post-glucose injection using a My Life Pura blood glucose monitor (Ypsomed, Paris, France).
(113) 1.5.3 Gene Expression
(114) Total messenger RNA (mRNA) extraction was carried out with Tri-Reagent (Euromedex, France) and consecutive synthesis of complementary DNA (cDNA) was carried out from 1 g of mRNA with the Bio-Rad iScripttm Reverse Transcription super mix kit (Bio-Rad, France). Gene expression was evaluated by semi-quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR). The primers used, described below, were selected using the Primer3Plus software (http://www.bioinformatics.nl/cgi-25 bin/primer3plus/primer3plus.cgi) and synthesized by MWG-Biotech. Semi-quantification of gene expression was obtained by taking into account the efficacy of each PCR and standardization with the reporter gene TATA box-binding protein (TBP).
(115) Primers Used:
(116) TABLE-US-00001 SEQ SEQ ID ID Gene NO 5-senseprimer-3 NO 5-antisenseprimer-3 TPB 1 acggcacaggacttactcca 2 gctgtctttgttgctcttccaa CB1R 3 ccgcaaagatagtcccaatg 4 aaccccacccagtttgaac CB2R 5 caaaggaggaagtgcttggt 6 tggagagatcggcttatgttg F4/80 7 tgacaaccagacggcttgtg 8 gcaggcgaggaaaagatagtgt FAAH 9 ggaccttgctcccctttct 10 cctgctgggctgtcacata FAS 11 ggctgcagtgaatgaatttg 12 ttcgtacctccttggcaaac G6P 13 tggcctggcttattgtacct 14 gtgctaagaggaagacccga GLUT2 15 ctcttcaccaactggccct 16 cagcagataggccaagtagga GLUT4 17 gatgccgtcgggtttccagca 18 tgttccagtcactcgctgccg DGAT2 19 agccctccaagacatcttctct 20 tgcagctgtttttccacct NAPE-PLD 21 ctcgatatctgcgtggaaca 22 ctgaattctggcgctttctc SCD1 23 ccggagaccccttagatcga 24 tagcctgtaaaagatttctgcaaacc TNF-a 25 cggggtgatcggtccccaaag 26 tggtttgctacgacgtgggct
(117) The impact of the treatment on endocannabinoid system activity is evaluated by measuring the gene expression 1) of receptors CB1R and CB2R 2) of the endocannabinoid synthesis enzyme, N-acyl phosphatidylethanolamine phospholipase D (NAPE-PLD) and 3) of the endocannabinoid degradation enzyme, fatty acid amide hydrolase (FAAH).
(118) Fatty acid synthase (FAS), stearoyl-CoA desaturase 1 (SCD-1) and glycerol-phosphate acyl-transferase (GPAT2) are enzymes whose expression variations reflect lipogenic activity.
(119) Glucose-6-phosphatase (G6P) and the glucose transporters GLUT2 and GLUT4 in the liver are used herein as neoglucogenesis markers.
(120) F4/80 is a mature macrophage marker.
(121) Tumour necrosis factor-alpha (TNF-a) is a proinflammatory cytokine affecting the regulation of numerous biological processes such as immune functions, cell differentiation and energy metabolism.
(122) 2. Results
(123) 2.1. Short-term In Vitro and In Vivo Experiments (Acute Injections) on Compounds JM-00.246, JM-02.003, JM-01.1006, JM-00.242 and JM-00.266 (i.e., Compound IA).
(124) 2.1.1. Effects of Candidate Molecules JM-00.246, JM-02.003, JM-01.006, JM-00.266 (i.e., Compound IA) and JM-00.242 on Hepatic Expression of CB1R in Ob/Ob Mice
(125) Studies previously carried out in the laboratory indicated that it was possible to modulate CB1R expression in liver explants cultured in the presence of agonists or of antagonists (Jourdan et al. 2012). For example, CB1R expression in liver explants is reduced following treatment with SR141716 (i.e., rimonabant). Consequently, this in vitro model was used herein to preselect candidate molecules on the basis of their capacity to modify CB1R expression.
(126) Based on these previous results obtained with SR141716 (i.e., rimonabant), the capacity of each compound to decrease CB1R expression was tested in the same liver explant model.
(127) Only molecules JM-02.003, JM-01.006 and JM-00.266 (i.e., compound IA) caused a significant decrease in hepatic CB1R expression, i.e., an effect comparable to that observed in the previous study with SR141716 (i.e., rimonabant) (
(128) 2.1.2. Effects of Preselected Molecules JM-02.003, JM-01.1006 and JM-00.266 on CB1 Receptor Activity
(129) The capacities of JM-02.003, JM-01.006 and JM-00.266 (i.e., compound IA) to antagonize CB1R were tested in a CB1R-transfected cell model by measuring cAMP variations (GloSensor cAMP assay).
(130) First, it was verified by using this in vitro model that activation of the receptors by an agonist, in this case AEA, lead indeed to a reduction in the intracellular cAMP concentration (data not shown). The results indicate that cAMP concentrations are increased in the absence of agonist (AEA) in cells treated with JM-02.003 and JM-00.266 (i.e., compound IA) whereas JM-01.006 has no effect (
(131) 2.1.3. Effects of Acute Treatment with Molecules JM-02.003 and JM-00.266 (i.e., Compound IA) on Glucose Tolerance in Wild-type C57Bl/6J Mice.
(132) In order to evaluate the in vivo effects of the selected molecules, the Inventors sought to determine if a single i.p. injection could modulate carbohydrate metabolism in mice. Indeed, recent work showed that CB1R activation in response to a single i.p. injection of AEA (CB1R agonist) alters glucose tolerance and insulin resistance (Liu et al., 2012).
(133) To that end, wild-type C57Bl/6J mice received a 10 mg/kg i.p. injection of antagonist JM-02.003 or JM-00.266 (i.e., compound IA) 10 min before a 2 g/kg oral glucose load. These results show that i.p. injection of these two molecules improves glucose tolerance compared with mice having received vehicle (
(134) When these experiments are repeated in CB1R KO mice, it is observed that the improvement in glucose tolerance is abolished in mice treated with JM-00.266 (i.e., compound IA) whereas it persists with JM-02.003 (
(135) 2.1.4. Effects of Acute Treatment with JM-00.266 (i.e., Compound IA) on Insulin Sensitivity and Production in Wild-type C57Bl/6J Mice.
(136) In order to know if the improvement in blood glucose control observed in response to i.p. injection of JM-00.266 (i.e., compound IA) is potentially due to an increase in insulin secretion and/or to a better insulin sensitivity, a plasma insulin assay was carried out following oral administration of the glucose bolus as well as an insulin tolerance test (ITT).
(137) The results show that insulin production induced by glucose administration is not stimulated by JM-00.266 (
(138) These data suggest that molecule JM-00.266 (i.e., compound IA) improves glucose tolerance by increasing insulin sensitivity.
(139) 2.1.5. Effects of Acute Treatment with JM-00.266 (i.e., Compound IA) on Gastrointestinal Transit in Wild-type C57Bl/6J Mice.
(140) It is clearly shown in the literature that CB1R activation strongly inhibits gastrointestinal motility (Di Marzo et al., 2008). On this basis, the Inventors sought to know if molecule JM-00.266 (i.e., compound IA) was capable of improving gastroparesis induced by a CB1R agonist (AEA) by measuring in vivo progression along the digestive tract of a bolus of nonabsorbable charcoal administered by force-feeding. In the experimental model tested, transit is, as expected, strongly inhibited by AEA. Interestingly, injection of JM-00.266 (i.e., compound IA) beforehand completely abolishes the effect of the agonist and normalizes gastrointestinal transit (
(141) 2.2. Long-term In Vivo Experiments (Chronic Injections) in Obese Mice with Compound JM-00.266.
(142) In order to determine the long-term effects of compound JM-00.266 (i.e., compound IA), C57BL/6 mice were made obese by means of a high-sucrose, high-fat diet administered for 20 weeks. These mice then received daily an i.p. injection of SR141716 (i.e., rimonabant) (10 mg/kg), JM-00.266 (i.e., compound IA) (10 mg/kg) or of vehicle for a period of 30 days.
(143) 2.2.1. Effects of Chronic Treatment with Compound JM-00.266 (i.e., Compound IA) on Markers of Liver Damage
(144) The liver enzymes alanine aminotransferase (ALT), aspartate aminotransferase (AST), intestinal alkaline phosphatase (ALPI), gamma GT and total bilirubin are markers of cell damage. These markers were measured in the plasma in order to detect possible liver toxicity of compound JM-00.266 (i.e., compound IA).
(145) TABLE-US-00002 TABLE 1 Plasma concentration of liver markers at the conclusion of 30-day chronic treatment with SR141716 (rimonabant) or compound JM-00.266 (compound IA, also called M6) in comparison with vehicle (Control). Control SR141716 JM-00.266 Gamma GT (U/L) <3 <3 <3 ALT (U/L) 62.0 24.9 21.6 2.3* 34.3 10.5 AST (U/L) 131.2 47.0 46.4 3.1* 60.8 13.4 ALPI 52.7 7.8 37.4 2.4 47.3 3.6 Total bilirubin (mol/L) <2 <2 <2 ALT: alanine aminotransferase; AST: aspartate aminotransferase, ALPI: intestinal alkaline phosphatase.
(146) The results presented in Table 1 show that a 30-day chronic treatment with SR141716 (i.e., rimonabant) or JM-00.266 (i.e., compound IA) does not cause an increase in liver damage markers compared with the control. On the contrary, the ALT and AST concentrations detected in the plasma of obese mice are significantly decreased by SR141716 (i.e., rimonabant) while the same trend is observed with JM-00.266 (i.e., compound IA).
(147) In conclusion, the results suggest not only that chronic administration of compound JM-00.266 (i.e., compound IA) causes no liver toxicity but also that it reduces the cell damage caused by obesity.
(148) 2.2.2. Effects of Chronic Treatment with Compound JM-00.266 (i.e., Compound IA) on Certain Behavioural Parameters Related to Activation of Central CB1R.
(149) The open-field test consists in measuring, by a system of infrared beams, the animal's movements in a lighted enclosure representing a stressful environment. The variables measured in the open field are total ambulatory activity and number of entries and time spent in the central area. This test makes it possible, in addition to measuring locomotor activity, to learn about the animal's anxiety state.
(150) The test results indicate, on the one hand, that neither administration of SR141716 (i.e., rimonabant) nor that of JM-00.266 (i.e., compound IA) has a significant effect on time spent in the centre of the arena (the most anxiogenic area), suggesting that the anxiety state of obese mice was not altered at the end of the 30-day treatment (
(151) 2.2.3. Effects of Chronic Treatment with Compound JM-00.266 (i.e., Compound IA) on Food Intake, Weight and Body Composition.
(152) Throughout the treatment, food intake and body weight were measured every two days.
(153) Parallel to food intake, change in body weight in response to the treatments was monitored every two days (
(154) At the end of the treatment, the body composition (fat mass, lean mass) of the mice was analysed by NMR.
(155) The effect of SR141716 (i.e., rimonabant) observed in this study has already been described in the literature and is explained by the central action of SR141716 on CB1R leading to a rapid (but transient) reduction in food intake followed by a loss of body mass (Ravinet Trillou et al., 2003). The fact that compound JM-00.266 (i.e., compound IA) has no effect on food intake or on weight, on the timescale tested, confirms that the action of the compound is indeed limited to the peripheral CB1 receptors.
(156) 2.2.4. Effects of Chronic Treatment with Compound JM-00.266 (i.e., Compound IA) on Blood Glucose and Glucose Tolerance
(157) To evaluate the long-term effects of compound JM-00.266 (i.e., compound IA) on carbohydrate metabolism, glucose tolerance tests (OGTT 2 g/kg) were carried out before and at the end of the treatments. The results indicate a significant improvement in basal blood glucose (
(158) 2.2.5. Effects of Chronic Treatment with Compound JM-00.266 (i.e., Compound IA) on Blood Insulin and Insulin Sensitivity
(159) In order to know if the improvement in blood glucose control induced by chronic administration of compound JM-00.266 (i.e., compound IA) can be associated with an improvement in insulin resistance, ITTs were used to measure the effect of the treatment on insulin sensitivity. This test shows that the insulin resistance of obese mice detected before the beginning of the treatment is improved after administration of SR141716 (i.e., rimonabant) and JM-00.266 (i.e., compound IA) for 30 days (
(160) 2.3. In Vivo Effect of Long-term Administration of Compound IA (Also Called M6 or JM-00.266) in Combination with a Reduced Energy Supply in Obese Mice
(161) 2.3.1. Effect on Body Mass
(162) As the results presented in the graph in
(163) Consequently, it was observed that administration of compound M6 as an adjunct to a low-fat diet enhances the weight loss induced by caloric restriction in mice first made obese by a high-fat diet.
(164) 2.3.2. Effect on Glucose Tolerance
(165) As the results presented on the graph in
(166) 2.4. In Vivo Effect of Long-term Administration of Compound IA (Also Called M6 or JM-00.266) Simultaneously with Food in Obese Mice
(167) 2.4.1 Effect on Body Mass
(168) As the results presented on the graph in
(169) Consequently, administration of compound M6 during the meal promotes weight loss in mice made obese by a high-fat diet and subjected to this same diet during the treatment. Similar results are expected with administration of compound M6 right before the meal, taking into account the effects of compound M6 observed on blood glucose control when it is administered acutely 10 minutes before administration of glucose (see section 2.1.3 above).
(170) 2.4.2 Effect on Glucose Tolerance
(171) As the results presented on the graph in
(172) 2.4.3 Effect on Gene Expression of Markers
(173) Treatment with M6 led to a reduction in the expression of NAPE-PLD in the tissues tested, suggesting a reduction in endocannabinoid tone.
(174) Expression of CB R and of the endocannabinoid degradation enzyme (fatty acid amide hydrolase, FAAH) is not modified by the treatment in any of the tissues tested. CB2R expression is also lower in tissues of animals treated with M6. CB2R being expressed mainly in immune cells, it is possible that this result reflects a lower macrophage infiltration.
(175) Fatty acid synthase (FAS), stearoyl-CoA desaturase 1 (SCD-1) and glycerol-phosphate acyl-transferase (GPAT2) are enzymes whose expression variations reflect lipogenic activity. Thus, the reduction in expression of SCD-1 and GPAT in the liver and of FAS in the adipose tissue of animals treated with M6 suggests lower lipid synthesis in these tissues.
(176) Glucose-6-phosphatase (G6P) and the glucose transporters GLUT2 and GLUT4 in the liver are used herein as neoglucogenesis markers. The results suggest that treatment with M6 may be associated with lower glucose production by the liver.
(177) The reduction in G6P and GLUT4 expression in the adipose tissue of mice treated with M6 may reflect a reduction in the use of the glucose engaged in the lipogenesis pathway.
(178) F4/80 is a mature macrophage marker. F4/80 expression appears clearly decreased in the liver and the adipose tissues, suggesting a lower macrophage infiltration.
(179) Tumour necrosis factor-alpha (TNF-a) is a proinflammatory cytokine affecting the regulation of numerous biological processes such as immune functions, cell differentiation and energy metabolism. It is accepted that the macrophages having infiltrated the adipose tissue of obese mice are responsible for an increase in TNF-a production. In the present study, a trend towards the reduction of TNF-a expression in adipose tissue is observed, in combination with the reduction in F4/80 expression by M6. These results seem consistent with the reduction in CB2R expression which is located essentially on the immune cells.
(180) III. Conclusion
(181) Obesity is associated with endocannabinoid 1 receptor (CB1R)-dependant hyperactivation of the endocannabinoid system (ECS). Thus, CB1R inactivation constitutes a treatment strategy for fighting obesity-related metabolic disorders. SR141716 (rimonabant), CB1R inverse agonist, was the first anti-obesity agent marketed but nevertheless was quickly withdrawn from the market because of neuropsychiatric side effects resulting from the blocking of central CB1R. However, an action targeting the peripheral CB1R may constitute a therapeutic solution in its own right for treating obesity and certain obesity-related diseases. Indeed, even if the reduction in food intake seems to be the principal cause of weight loss and of improvement in metabolic parameters, several studies in animals and in man indicate that the peripheral CB1R may also be involved in the regulation of lipid and glucose metabolism (Nogueiras et al., 2008; Osei-Hyiaman et al., 2008). Consequently, it has been suggested that the long-term beneficial effects of endocannabinoid system inactivation are due to both the central effects on food intake and the peripheral effects on adipose tissue, liver, skeletal muscle and pancreas. The role of peripheral CB1R has been clearly shown by the work of Tam et al. in 2010 indicating that the blocking of these receptors by a peripheral antagonist decreases cardiometabolic risk in obese mice. Two recent studies are also in agreement with this notion. The first suggests that a reduction in endocannabinoid system activity in visceral adipose tissue is associated with normalization of adipocyte metabolism favourable to reversal of hepatic steatosis observed in obese mice (Jourdan et al., 2010). The second shows by an in vitro approach that inactivation of hepatic CB1R leads to a stimulation of fatty acid beta-oxidation (Jourdan et al., 2012). The use of compounds acting as endocannabinoid CB1 receptor (CB1R) antagonists is thus of unquestionable interest in controlling regulation of food intake and of carbohydrate and lipid metabolism in diseases such as metabolic syndrome having a significant public health impact. Furthermore, the development of compounds retaining activity on peripheral CB1R, but not crossing the blood-brain barrier, would make it possible to circumvent the difficulties of clinical use of rimonabant-generation molecules.
(182) These results, based on three approaches, in vitro, short-term in vivo and long-term in vivo, show that, among five novel molecules tested, only compound JM-00.266 has:
(183) (1) inverse agonist properties with respect to CB1 receptors,
(184) (2) limited peripheral action and is thus unlikely to produce deleterious psychotropic side effects as was the case with compounds arising from past attempts at development,
(185) (3) beneficial effects on carbohydrate-lipid metabolism, within the context of obesity, by improving in particular glucose tolerance and insulin sensitivity, and by decreasing blood triglycerides, and
(186) (4) a capacity to prevent the inhibitory action of anandamide (natural CB1R agonist) on gastrointestinal motility, which shows a powerful antagonistic effect of the compound in vivo, as well as its utility in the treatment of gastroparesis.
(187) The effect of compound JM-00.266 in vivo on body mass and certain biological parameters in obese mice as a function of the mode of administration also made it possible to bring to light the following: this compound, administered as an adjunct to a low-fat diet, enhances the weight loss induced by caloric restriction in mice first made obese by a high-fat diet and improves glucose tolerance. These results make it possible to envisage treatments combining this type of compound with normocaloric diets and/or with compounds known to negatively regulate food intake; this compound, administered during the meal, promotes weight loss in mice made obese by a high-fat diet and subjected to this same diet during the treatment, and improves glucose tolerance. These results make it possible to envisage protocols for administering the compound of interest preferably right before and/or during the meal(s); the in vivo effect of this compound on various markers of endocannabinoid system activity, of lipogenic activity, and of macrophage infiltration, especially suggests a reduction in endocannabonoid tone, lower lipid synthesis in tissues, a reduction in the use of the glucose engaged in the lipogenesis pathway and a lower macrophage inflitration.
(188) Furthermore, the structure of this novel compound and the possibilities of pharmacomodulation thereof thus make it possible to access molecules diffusing little or not at all in the central nervous system, which are represented by the compounds of formula (I) described above.
(189) Taking into account the properties observed within the context of this work, the compound of formula (I) according to the invention is without question of therapeutic interest not only with respect to obesity-related diseases, but also for diseases for which CB1R involvement in various peripheral tissues has been shown. Thus, peripheral CB1R inactivation by the compound according to the invention can make it possible to treat insulin resistance (Song et al., 2011; Eckardt et al., 2009), type II diabetes (Matias et al. 2006; Jensen, 2006), non-alcoholic hepatic steatosis (Osei-Hyiamann et al., 2005; Osei-Hyiaman et al. 2008; Jeong et al. 2008), liver fibrosis (Teixeira-Clerc et al. 2006), nephropathy (Jourdan et al., 2012), renal fibrosis (Lecru et al., 2015), cardiomyopathies (Montecucco and Di Marzo, 2012; Rajesh et al., 2012; Slavic et al., 2013; Schaich et al., 2014; Pacher and Kunos, 2013), gastroparesis (Izzo and Sharkey, 2010), bone growth and cartilage development (Tam et al., 2008; Wasserman et al., 2015), muscle development (Iannotti et al., 2014), fertility, especially sperm motility and viability in men (Amoako et al., 2014) and oocyte implantation in women (Wang et al., 2006).
REFERENCES
(190) Amoako A A et al. (2014). Fertil. Steril.; 102:1260-1267.
(191) Beaumont H, Jensen J et al. (2009). Br J Pharmacol; 156(1):153-62.
(192) Blher M, Engeli et al. (2006). Diabetes; 55(11):3053-60.
(193) Buckley N E, Hansson S et al. (1998). Neuroscience; 82(4):1131-1149.
(194) Cota D, Marsicano G et al. (2003). J clin Invest; 112(3):423-431.
(195) Ct M, Matias I, et al. (2007). Int J Obes (Lond); 31(4):692-9.
(196) Das S K, Paria B C et al. (1995). Proc Natl Acad Sci USA; 92(10):4332-4336.
(197) Despres J P and Lemieux I (2006). Nature; 444(7121):881-887.
(198) Di Carlo G and Izzo A A (2003). Expert Opin Investig Drugs; 12(1):39-49.
(199) Di Marzo V and Matias I (2005). Nat Neurosci; 8(5):585-9.
(200) Di Marzo V (2008). Nature Reviews Drug Discovery; 7:438-455.
(201) Di Marzo V et al. (2008). British Journal of Pharmacology; 153:1272-1280.
(202) Eckardt K et al. (2009). Diabetologia; 52:664-674.
(203) Gye M C, Kim C et al. (2001). Arch Androl; 46(1): 51-55.
(204) Hoehe M R, Carnazzo L et al. (2001). Novel biol; 3(9): 880-885.
(205) Iannotti F A et al. (2014). Proc. Natl. Acad. Sci. U.S.A; 117:2472-2481.
(206) Izzo A A, Mascolo N et al. (1999). Arch Pharmacol.; 360(2):221-3.
(207) Izzo A A, Fezza F et al. (2001). Br J Pharmacol; 134(3):563-70.
(208) Izzo A A and Sharkey K A (2010). Pharmacol Ther; 126(1):21-38.
(209) Jensen M. (2006). The American Journal of Medicine (2007); Vol 120 (9A), S25-S32.
(210) Jeong W I et al. (2008). Cell Metab.; 7:227-235.
(211) Jourdan T. et al. (2010). Diabetes; 59:926-934.
(212) Jourdan T. et al. (2012). Hepatology; 55:790-799.
(213) Jourdan T, Szanda G et al. (2014). Proc Natl Acad Sci USA; 111(50):E5420-E5428.
(214) Lehmann A, Blackshaw L A et al. (2002). Gastroenterology; 123(4):1129-34.
(215) Lecru L. et al. (2015). Kidney Int.; 88(1):72-84
(216) Liu J, Batkai S et al. (2003). J Biol Chem; 278(45):45034-45039.
(217) Liu J. et al. (2012). Gastroenterolog; 142(5):1218-1228.
(218) Matias I et al. (2006). J. Clin. Endocrinol. Metab; 91:3171-3180.
(219) Maccarrone M, Bab I et al. (2015). Trends Pharmacol Sci.; 36(5):277-296.
(220) Massa F, Marsicano G et al. (2004). J Clin Invest; 113(8):1202-9.
(221) Nogueiras R et al. (2008). Diabetes; 57, 2977-2991.
(222) Osei-Hyiaman D et al. (2005). J. Clin. Invest; 115(5): 1298-1305.
(223) Osei-Hyiaman D et al. (2008). J. Clin. Invest; 118:3160-3169.
(224) Pacher P and Kunos G (2013). FEBS J; 280(9):1918-43.
(225) Pertwee R G (2001). Prog. Neurobiol; 63(5):569-611.
(226) Rajesh M et al. (2012). Diabetes; 61:716-727.
(227) Rinaldi-Carmona M et al. (1996). J Pharmacol Exp Ther; 278(2):871-8.
(228) Ravinet Trillou C et al. (2003). Am J Physiol Regul Integr Comp Physiol; 284(2): R345-R353.
(229) Schaich C L et al. (2014). Physiol. Rep; 2(8):e12108.
(230) Tam J et al. (2008). FASEB J.; 22:285-294.
(231) Tam J, Vemuri V K et al. (2010). J Clin Invest; 120(8):2953-66.
(232) Tam J, Cinar R et al. (2012). Cell Metab; 16(2):167-79.
(233) Teixeira-Clere F et al. (2006). Nature Medicine; 12(6):671-676.
(234) Slavic S. et al. (2013). J. Mol. Med.; 91:811-823.
(235) Song D. et al. (2011). Diabetologia; 54:1181-1189.
(236) Wang H. et al. (2006). Endocr. Rev. 27:427-448