HDAC8 INHIBITORS FOR TREATING CANCER
20190322617 ยท 2019-10-24
Inventors
Cpc classification
C07D209/18
CHEMISTRY; METALLURGY
C07D333/24
CHEMISTRY; METALLURGY
C07D217/20
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
C07D213/74
CHEMISTRY; METALLURGY
C07C259/06
CHEMISTRY; METALLURGY
C07D209/08
CHEMISTRY; METALLURGY
C07D317/60
CHEMISTRY; METALLURGY
International classification
C07C259/06
CHEMISTRY; METALLURGY
C07D317/60
CHEMISTRY; METALLURGY
C07D213/74
CHEMISTRY; METALLURGY
C07D209/18
CHEMISTRY; METALLURGY
C07D209/08
CHEMISTRY; METALLURGY
C07D333/24
CHEMISTRY; METALLURGY
Abstract
Provided herein, inter alia, are compound and methods of treating cancer by inhibiting HDAC8.
Claims
1.-20. (canceled)
21. A method of treating cancer in a subject in need thereof, said method comprising administering an effective amount of an HDAC8 inhibitor to said subject.
22. The method of claim 21, wherein said cancer is a non-mutated p53 cancer.
23. The method of claim 22, wherein said non-mutated p53 cancer is acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), lymphoma, neuroblastoma, glioma, bladder cancer, lung cancer, non-small cell lung cancer, breast cancer, or triple-negative breast cancer.
24. The method of claim 23, wherein said non-mutated p53 cancer is AML.
25. The method of claim 24, wherein said non-mutated p53 cancer has increased HDAC8 activity or HDAC8 expression compared to a mutated p53 cancer.
26. The method of claim 21, wherein said method further comprises prior to said treating, determining whether said cancer in said subject is a non-mutated p53 cancer.
27. The method of claim 26, further comprising determining whether said non-mutated p53 cancer has increased HDAC8 activity or HDAC8 expression.
28. (canceled)
29. The method of claim 21, wherein said HDAC8 inhibitor is a compound of formula (I): ##STR00069## wherein: R.sup.1 is substituted or unsubstituted C.sub.1-C.sub.20 alkyl substituted or unsubstituted 2 to 20 membered heteroalkyl, substituted or unsubstituted C.sub.3-C.sub.7 cycloalkyl, substituted or unsubstituted 3 to 7 membered heterocycloalkyl, substituted or unsubstituted C.sub.3-C.sub.7 aryl, or substituted or unsubstituted 3 to 7 membered heteroaryl; and R.sup.2 is substituted or unsubstituted C.sub.1-C.sub.20 alkyl, substituted or unsubstituted 2 to 20 membered heteroalkyl, substituted or unsubstituted C.sub.3-C.sub.7 cycloalkyl, substituted or unsubstituted 3 to 7 membered heterocycloalkyl, substituted or unsubstituted C.sub.3-C.sub.7 aryl, or substituted or unsubstituted 3 to 7 membered heteroaryl.
30. The method of claim 29, wherein said HDAC8 inhibitor is an HDAC8 inhibitor antibody, a HDAC8 inhibitor siRNA, a HDAC8 inhibitor shRNA, or a HDAC8 inhibitor protein.
31. A method of inhibiting HDAC8 mediated deacetylation of p53, said method comprising contacting HDAC8 with a HDAC8 inhibitor in the presence of p53, thereby inhibiting HDAC8 deacetylation of p53.
32. The method of claim 31, wherein said contacting is performed in vitro.
33. The method of claim 31, wherein said contacting is performed in vivo.
34. The method of claim 31, wherein said contacting is performed in an organism.
35. The method of claim 31, wherein said HDAC8 inhibitor is a compound of formula (I): ##STR00070## wherein: R.sup.1 is substituted or unsubstituted C.sub.1-C.sub.20 alkyl substituted or unsubstituted 2 to 20 membered heteroalkyl, substituted or unsubstituted C.sub.3-C.sub.7 cycloalkyl, substituted or unsubstituted 3 to 7 membered heterocycloalkyl, substituted or unsubstituted C.sub.3-C.sub.7 aryl, or substituted or unsubstituted 3 to 7 membered heteroaryl; and R.sup.2 is substituted or unsubstituted C.sub.1-C.sub.20 alkyl, substituted or unsubstituted 2 to 20 membered heteroalkyl, substituted or unsubstituted C.sub.3-C.sub.7 cycloalkyl, substituted or unsubstituted 3 to 7 membered heterocycloalkyl, substituted or unsubstituted C.sub.3-C.sub.7 aryl, or substituted or unsubstituted 3 to 7 membered heteroaryl.
36. A method of activating p53 in vivo, said method comprising: (i) contacting a cell with a HDAC8 inhibitor in the presence of HDAC8, wherein the cell is an AML cell; and (ii) allowing said HDAC8 inhibitor to contact said HDAC8, thereby inhibiting said HDAC8 and activating p53.
37. The method of claim 36, wherein said contacting is performed in an organism.
38. The method of claim 36, wherein said HDAC8 inhibitor is a compound of formula (I): ##STR00071## wherein: R.sup.1 is substituted or unsubstituted C.sub.1-C.sub.20 alkyl substituted or unsubstituted 2 to 20 membered heteroalkyl, substituted or unsubstituted C.sub.3-C.sub.7 cycloalkyl, substituted or unsubstituted 3 to 7 membered heterocycloalkyl, substituted or unsubstituted C.sub.3-C.sub.7 aryl, or substituted or unsubstituted 3 to 7 membered heteroaryl; and R.sup.2 is substituted or unsubstituted C.sub.1-C.sub.20 alkyl, substituted or unsubstituted 2 to 20 membered heteroalkyl, substituted or unsubstituted C.sub.3-C.sub.7 cycloalkyl, substituted or unsubstituted 3 to 7 membered heterocycloalkyl, substituted or unsubstituted C.sub.3-C.sub.7 aryl, or substituted or unsubstituted 3 to 7 membered heteroaryl.
39. The method of claim 36, wherein the AML cell is an AML stem cell.
40. The method of claim 29, wherein R.sup.1 is substituted or unsubstituted C.sub.1-C.sub.4 alkoxy and R.sup.2 is a substituted or unsubstituted C.sub.4-C.sub.6 aryl.
41. The method of claim 40, wherein R.sup.1 is unsubstituted C.sub.1-C.sub.2 alkoxy and R.sup.2 is unsubstituted C.sub.6 aryl.
42. The method of claim 29, wherein the compound has formula (II): ##STR00072##
43. A method of treating cancer in a subject in need thereof, said method comprising administering an effective amount of an HDAC8 inhibitor compound selected from the group consisting of: ##STR00073## ##STR00074## ##STR00075##
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
DETAILED DESCRIPTION
[0036] The abbreviations used herein have their conventional meaning within the chemical and biological arts. The chemical structures and formulae set forth herein are constructed according to the standard rules of chemical valency known in the chemical arts.
[0037] Where substituent groups are specified by their conventional chemical formulae, written from left to right, they equally encompass the chemically identical substituents that would result from writing the structure from right to left, e.g., CH.sub.2O is equivalent to OCH.sub.2.
[0038] The term alkyl, by itself or as part of another substituent, means, unless otherwise stated, a straight (i.e., unbranched) or branched chain, or combination thereof, which may be fully saturated, mono- or polyunsaturated and can include di- and multivalent radicals, having the number of carbon atoms designated (i.e., C.sub.1-C.sub.10 means one to ten carbons). Alkyl is not cyclized. Examples of saturated hydrocarbon radicals include, but are not limited to, groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, t-butyl, isobutyl, sec-butyl, (cyclohexyl)methyl, homologs and isomers of, for example, n-pentyl, n-hexyl, n-heptyl, n-octyl, and the like. An unsaturated alkyl group is one having one or more double bonds or triple bonds. Examples of unsaturated alkyl groups include, but are not limited to, vinyl, 2-propenyl, crotyl, 2-isopentenyl, 2-(butadienyl), 2,4-pentadienyl, 3-(1,4-pentadienyl), ethynyl, 1- and 3-propynyl, 3-butynyl, and the higher homologs and isomers. An alkoxy is an alkyl attached to the remainder of the molecule via an oxygen linker (O).
[0039] The term alkylene, by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from an alkyl, as exemplified, but not limited by, CH.sub.2CH.sub.2CH.sub.2CH.sub.2. Typically, an alkyl (or alkylene) group will have from 1 to 24 carbon atoms. A lower alkyl or lower alkylene is a shorter chain alkyl or alkylene group, generally having eight or fewer carbon atoms.
[0040] The term heteroalkyl, by itself or in combination with another term, means, unless otherwise stated, a stable straight or branched chain, or combinations thereof, consisting of at least one carbon atom and at least one heteroatom selected from the group consisting of O, N, P, S, Se and Si, and wherein the nitrogen, selenium, and sulfur atoms may optionally be oxidized, and the nitrogen heteroatom may optionally be quaternized. Heteroalkyl is not cyclized. The heteroatom(s) O, N, P, S, Se, and Si may be placed at any interior position of the heteroalkyl group or at the position at which the alkyl group is attached to the remainder of the molecule. Examples include, but are not limited to: CH.sub.2CH.sub.2OCH.sub.3, CH.sub.2CH.sub.2NHCH.sub.3, CH.sub.2CH.sub.2N(CH.sub.3)CH.sub.3, CH.sub.2SCH.sub.2CH.sub.3, CH.sub.2CH.sub.2, S(O)CH.sub.3, CH.sub.2CH.sub.2S(O).sub.2CH.sub.3, CHCHOCH.sub.3, Si(CH.sub.3).sub.3, CH.sub.2CHNOCH.sub.3, CHCHN(CH.sub.3)CH.sub.3, OCH.sub.3, OCH.sub.2CH.sub.3, and CN. Up to two heteroatoms may be consecutive, such as, for example, CH.sub.2NHOCH.sub.3.
[0041] Similarly, the term heteroalkylene, by itself or as part of another substituent, means, unless otherwise stated, a divalent radical derived from heteroalkyl, as exemplified, but not limited by, CH.sub.2CH.sub.2SCH.sub.2CH.sub.2 and CH.sub.2SCH.sub.2CH.sub.2NHCH.sub.2. For heteroalkylene groups, heteroatoms can also occupy either or both of the chain termini (e.g., alkyleneoxy, alkylenedioxy, alkyleneamino, alkylenediamino, and the like). Still further, for alkylene and heteroalkylene linking groups, no orientation of the linking group is implied by the direction in which the formula of the linking group is written. For example, the formula C(O).sub.2R represents both C(O).sub.2R and RC(O).sub.2. As described above, heteroalkyl groups, as used herein, include those groups that are attached to the remainder of the molecule through a heteroatom, such as C(O)R, C(O)NR, NRR, OR, SeR, SR, and/or SO.sub.2R. Where heteroalkyl is recited, followed by recitations of specific heteroalkyl groups, such as NRR or the like, it will be understood that the terms heteroalkyl and NRR are not redundant or mutually exclusive. Rather, the specific heteroalkyl groups are recited to add clarity. Thus, the term heteroalkyl should not be interpreted herein as excluding specific heteroalkyl groups, such as NRR or the like.
[0042] The terms cycloalkyl and heterocycloalkyl, by themselves or in combination with other terms, mean, unless otherwise stated, cyclic versions of alkyl and heteroalkyl, respectively. Cycloalkyl and heterocycloalkyl are not aromatic. Additionally, for heterocycloalkyl, a heteroatom can occupy the position at which the heterocycle is attached to the remainder of the molecule. Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, 1-cyclohexenyl, 3-cyclohexenyl, cycloheptyl, and the like. Examples of heterocycloalkyl include, but are not limited to, 1-(1,2,5,6-tetrahydropyridyl), 1-piperidinyl, 2-piperidinyl, 3-piperidinyl, 4-morpholinyl, 3-morpholinyl, tetrahydrofuran-2-yl, tetrahydrofuran-3-yl, tetrahydrothien-2-yl, tetrahydrothien-3-yl, 1-piperazinyl, 2-piperazinyl, and the like. A cycloalkylene and a heterocycloalkylene, alone or as part of another substituent, means a divalent radical derived from a cycloalkyl and heterocycloalkyl, respectively.
[0043] The term aryl means, unless otherwise stated, a polyunsaturated, aromatic, hydrocarbon substituent, which can be a single ring or multiple rings (e.g. 1 to 3 rings) that are fused together (i.e., a fused ring aryl) or linked covalently. A fused ring aryl refers to multiple rings fused together wherein at least one of the fused rings is an aryl ring. The term heteroaryl refers to aryl groups (or rings) that contain at least one heteroatom (e.g. N, O, or S), wherein sulfur heteroatoms are optionally oxidized, and the nitrogen heteroatoms are optionally quaternized. Thus, the term heteroaryl includes fused ring heteroaryl groups (i.e., multiple rings fused together wherein at least one of the fused rings is a heteroaromatic ring). A 5,6-fused ring heteroarylene refers to two rings fused together, wherein one ring has 5 members and the other ring has 6 members, and wherein at least one ring is a heteroaryl ring. Likewise, a 6,6-fused ring heteroarylene refers to two rings fused together, wherein one ring has 6 members and the other ring has 6 members, and wherein at least one ring is a heteroaryl ring. And a 6,5-fused ring heteroarylene refers to two rings fused together, wherein one ring has 6 members and the other ring has 5 members, and wherein at least one ring is a heteroaryl ring. A heteroaryl group can be attached to the remainder of the molecule through a carbon or heteroatom. Non-limiting examples of aryl and heteroaryl groups include phenyl, 1-naphthyl, 2-naphthyl, 4-biphenyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 3-pyrazolyl, 2-imidazolyl, 4-imidazolyl, pyrazinyl, 2-oxazolyl, 4-oxazolyl, 2-phenyl-4-oxazolyl, 5-oxazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 2-furyl, 3-furyl, 2-thienyl, 3-thienyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-benzothiazolyl, purinyl, 2-benzimidazolyl, 5-indolyl, 1-isoquinolyl, 5-isoquinolyl, 2-quinoxalinyl, 5-quinoxalinyl, 3-quinolyl, and 6-quinolyl. Substituents for each of the above noted aryl and heteroaryl ring systems are selected from the group of acceptable substituents described below. An arylene and a heteroarylene, alone or as part of another substituent, mean a divalent radical derived from an aryl and heteroaryl, respectively.
[0044] A fused ring heterocycloalkyl-aryl is an aryl fused to a heterocycloalkyl. A fused ring heterocycloalkyl-heteroaryl is a heteroaryl fused to a heterocycloalkyl. A fused ring heterocycloalkyl-cycloalkyl is a heterocycloalkyl fused to a cycloalkyl. A fused ring heterocycloalkyl-heterocycloalkyl is a heterocycloalkyl fused to another heterocycloalkyl. Fused ring heterocycloalkyl-aryl, fused ring heterocycloalkyl-heteroaryl, fused ring heterocycloalkyl-cycloalkyl, or fused ring heterocycloalkyl-heterocycloalkyl may each independently be unsubstituted or substituted with one or more of the substituents described herein. Spirocyclic rings are two or more rings wherein adjacent rings are attached through a single atom. The individual rings within spirocyclic rings may be identical or different. Individual rings in spirocyclic rings may be substituted or unsubstituted and may have different substituents from other individual rings within a set of spirocyclic rings. Possible substituents for individual rings within spirocyclic rings are the possible substituents for the same ring when not part of spirocyclic rings (e.g. substituents for cycloalkyl or heterocycloalkyl rings). Spirocylic rings may be substituted or unsubstituted cycloalkyl, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkyl or substituted or unsubstituted heterocycloalkylene and individual rings within a spirocyclic ring group may be any of the immediately previous list, including having all rings of one type (e.g. all rings being substituted heterocycloalkylene wherein each ring may be the same or different substituted heterocycloalkylene). When referring to a spirocyclic ring system, heterocyclic spirocyclic rings means a spirocyclic rings wherein at least one ring is a heterocyclic ring and wherein each ring may be a different ring. When referring to a spirocyclic ring system, substituted spirocyclic rings means that at least one ring is substituted and each substituent may optionally be different.
[0045] The terms halo or halogen, by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom. Additionally, terms such as haloalkyl are meant to include monohaloalkyl and polyhaloalkyl. For example, the term halo(C.sub.1-C.sub.4)alkyl includes, but is not limited to, fluoromethyl, difluoromethyl, trifluoromethyl, 2,2,2-trifluoroethyl, 4-chlorobutyl, 3-bromopropyl, and the like.
[0046] The term acyl means, unless otherwise stated, C(O)R where R is a substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.
[0047] The term oxo, as used herein, means an oxygen that is double bonded to a carbon atom.
[0048] Each of the above terms (e.g., alkyl, heteroalkyl, aryl, and heteroaryl) includes both substituted and unsubstituted forms of the indicated radical. Preferred substituents for each type of radical are provided below.
[0049] Substituents for the alkyl and heteroalkyl radicals (including those groups often referred to as alkylene, alkenyl, heteroalkylene, heteroalkenyl, alkynyl, cycloalkyl, heterocycloalkyl, cycloalkenyl, and heterocycloalkenyl) can be one or more of a variety of groups selected from, but not limited to, OR, O, NR, NOR, NRR, SR, -halogen, SiRRR, OC(O)R, C(O)R, CO.sub.2R, CONRR, OC(O)NRR, NRC(O)R, NRC(O)NRR, NRC(O).sub.2R, NRC(NRRR)NR, NRC(NRR)NR, S(O)R, S(O).sub.2R, S(O).sub.2NRR, NRSO.sub.2R, CN, and NO.sub.2 in a number ranging from zero to (2m+1), where m is the total number of carbon atoms in such radical. R, R, R, and R each preferably independently refer to hydrogen, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl (e.g., aryl substituted with 1-3 halogens), substituted or unsubstituted alkyl, alkoxy, or thioalkoxy groups, or arylalkyl groups. When a compound described herein includes more than one R group, for example, each of the R groups is independently selected as are each R, R, R, and R group when more than one of these groups is present. When R and R are attached to the same nitrogen atom, they can be combined with the nitrogen atom to form a 4-, 5-, 6-, or 7-membered ring. For example, NRR includes, but is not limited to, 1-pyrrolidinyl and 4-morpholinyl. From the above discussion of substituents, one of skill in the art will understand that the term alkyl is meant to include groups including carbon atoms bound to groups other than hydrogen groups, such as haloalkyl (e.g., CF.sub.3 and CH.sub.2CF.sub.3) and acyl (e.g., C(O)CH.sub.3, C(O)CF.sub.3, C(O)CH.sub.2OCH.sub.3, and the like).
[0050] Similar to the substituents described for the alkyl radical, substituents for the aryl and heteroaryl groups are varied and are selected from, for example: OR, NRR, SR, -halogen, SiRRR, OC(O)R, C(O)R, CO.sub.2R, CONRR, OC(O)NRR, NRC(O)R, NRC(O)NRR, NRC(O).sub.2R, NRC(NRRR)NR, NRC(NRR)NR, S(O)R, S(O).sub.2R, S(O).sub.2NRR, NRSO.sub.2R, CN, NO.sub.2, R, N.sub.3, CH(Ph).sub.2, fluoro(C.sub.1-C.sub.4)alkoxy, and fluoro(C.sub.1-C.sub.4)alkyl, in a number ranging from zero to the total number of open valences on the aromatic ring system; and where R, R, R, and R are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl. When a compound described herein includes more than one R group, for example, each of the R groups is independently selected as are each R, R, R, and R groups when more than one of these groups is present.
[0051] Substituents for rings (e.g. cycloalkyl, heterocycloalkyl, aryl, heteroaryl, cycloalkylene, heterocycloalkylene, arylene, or heteroarylene) may be depicted as substituents on the ring rather than on a specific atom of a ring (commonly referred to as a floating substituent). In such a case, the substituent may be attached to any of the ring atoms (obeying the rules of chemical valency) and in the case of fused rings or spirocyclic rings, a substituent depicted as associated with one member of the fused rings or spirocyclic rings (a floating substituent on a single ring), may be a substituent on any of the fused rings or spirocyclic rings (a floating substituent on multiple rings). When a substituent is attached to a ring, but not a specific atom (a floating substituent), and a subscript for the substituent is an integer greater than one, the multiple substituents may be on the same atom, same ring, different atoms, different fused rings, different spirocyclic rings, and each substituent may optionally be different. Where a point of attachment of a ring to the remainder of a molecule is not limited to a single atom (a floating substituent), the attachment point may be any atom of the ring and in the case of a fused ring or spirocyclic ring, any atom of any of the fused rings or spirocyclic rings while obeying the rules of chemical valency. Where a ring, fused rings, or spirocyclic rings contain one or more ring heteroatoms and the ring, fused rings, or spirocyclic rings are shown with one more floating substituents (including, but not limited to, points of attachment to the remainder of the molecule), the floating substituents may be bonded to the heteroatoms. Where the ring heteroatoms are shown bound to one or more hydrogens (e.g. a ring nitrogen with two bonds to ring atoms and a third bond to a hydrogen) in the structure or formula with the floating substituent, when the heteroatom is bonded to the floating substituent, the substituent will be understood to replace the hydrogen, while obeying the rules of chemical valency.
[0052] Two or more substituents may optionally be joined to form aryl, heteroaryl, cycloalkyl, or heterocycloalkyl groups. Such so-called ring-forming substituents are typically, though not necessarily, found attached to a cyclic base structure. The ring-forming substituents may be attached to adjacent members of the base structure. For example, two ring-forming substituents attached to adjacent members of a cyclic base structure create a fused ring structure. The ring-forming substituents may be attached to a single member of the base structure. For example, two ring-forming substituents attached to a single member of a cyclic base structure create a spirocyclic structure. The ring-forming substituents may be attached to non-adjacent members of the base structure.
[0053] Two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally form a ring of the formula -T-C(O)(CRR).sub.q-U-, wherein T and U are independently NR, O, CRR, or a single bond, and q is an integer of from 0 to 3. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula -A-(CH.sub.2).sub.rB, wherein A and B are independently CRR, O, NR, S, S(O), S(O).sub.2, S(O).sub.2NR, or a single bond, and r is an integer of from 1 to 4. One of the single bonds of the new ring so formed may optionally be replaced with a double bond. Alternatively, two of the substituents on adjacent atoms of the aryl or heteroaryl ring may optionally be replaced with a substituent of the formula (CRR).sub.sX(CR).sub.d, where s and d are independently integers of from 0 to 3, and X is O, NR, S, S(O), S(O).sub.2, or S(O).sub.2NR. The substituents R, R, R, and R are preferably independently selected from hydrogen, substituted or unsubstituted alkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.
[0054] As used herein, the terms heteroatom or ring heteroatom are meant to include oxygen (O), nitrogen (N), sulfur (S), phosphorus (P), and silicon (Si).
[0055] A substituent group, as used herein, means a group selected from the following moieties: [0056] (A) OH, NH.sub.2, SH, CN, CF.sub.3, NO.sub.2, oxo, halogen, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and [0057] (B) alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, substituted with at least one substituent selected from: [0058] (i) oxo, OH, NH.sub.2, SH, CN, CF.sub.3, NO.sub.2, halogen, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and [0059] (ii) alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, and heteroaryl, substituted with at least one substituent selected from: [0060] (a) oxo, OH, NH.sub.2, SH, CN, CF.sub.3, NO.sub.2, halogen, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, unsubstituted heteroaryl, and [0061] (b) alkyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, or heteroaryl, substituted with at least one substituent selected from: oxo, OH, NH.sub.2, SH, CN, CF.sub.3, NO.sub.2, halogen, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted cycloalkyl, unsubstituted heterocycloalkyl, unsubstituted aryl, and unsubstituted heteroaryl.
[0062] A size-limited substituent or size-limited substituent group, as used herein, means a group selected from all of the substituents described above for a substituent group, wherein each substituted or unsubstituted alkyl is a substituted or unsubstituted C.sub.1-C.sub.20 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 20 membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C.sub.3-C.sub.8 cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3 to 8 membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted C.sub.3-C.sub.8 aryl, and each substituted or unsubstituted heteroaryl is a substituted or unsubstituted C.sub.3-C.sub.8 heteroaryl.
[0063] A lower substituent or lower substituent group, as used herein, means a group selected from all of the substituents described above for a substituent group, wherein each substituted or unsubstituted alkyl is a substituted or unsubstituted C.sub.1-C.sub.8 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 8 membered heteroalkyl, each substituted or unsubstituted cycloalkyl is a substituted or unsubstituted C.sub.3-C.sub.7 cycloalkyl, each substituted or unsubstituted heterocycloalkyl is a substituted or unsubstituted 3 to 7 membered heterocycloalkyl, each substituted or unsubstituted aryl is a substituted or unsubstituted C.sub.3-C.sub.7 aryl, and each substituted or unsubstituted heteroaryl is a substituted or unsubstituted C.sub.3-C.sub.7 heteroaryl.
[0064] Each substituted group described in the compounds herein may be substituted with at least one substituent group. More specifically, each substituted alkyl, substituted heteroalkyl, substituted cycloalkyl, substituted heterocycloalkyl, substituted aryl, substituted heteroaryl, substituted alkylene, substituted heteroalkylene, substituted cycloalkylene, substituted heterocycloalkylene, substituted arylene, and/or substituted heteroarylene described in the compounds herein may be substituted with at least one substituent group. At least one or all of these groups may be substituted with at least one size-limited substituent group. At least one or all of these groups may be substituted with at least one lower substituent group.
[0065] Each substituted or unsubstituted alkyl may be a substituted or unsubstituted C.sub.1-C.sub.20 alkyl, each substituted or unsubstituted heteroalkyl is a substituted or unsubstituted 2 to 20 membered heteroalkyl, each substituted or unsubstituted cycloalkyl may be a substituted or unsubstituted C.sub.3-C.sub.8 cycloalkyl, and/or each substituted or unsubstituted heterocycloalkyl may be a substituted or unsubstituted 3 to 8 membered heterocycloalkyl. Each substituted or unsubstituted alkylene may be a substituted or unsubstituted C.sub.1-C.sub.20 alkylene, each substituted or unsubstituted heteroalkylene may be a substituted or unsubstituted 2 to 20 membered heteroalkylene, each substituted or unsubstituted cycloalkylene may be a substituted or unsubstituted C.sub.3-C.sub.8 cycloalkylene, each substituted or unsubstituted heterocycloalkylene may be a substituted or unsubstituted 3 to 8 membered heterocycloalkylene, each substituted or unsubstituted arylene may be a substituted or unsubstituted C.sub.3-C.sub.8 arylene, and/or each substituted or unsubstituted heteroaryl may be a substituted or unsubstituted C.sub.3-C.sub.8 heteroarylene.
[0066] Each substituted or unsubstituted alkyl may be a substituted or unsubstituted C.sub.1-C.sub.8 alkyl, each substituted or unsubstituted heteroalkyl may be a substituted or unsubstituted 2 to 8 membered heteroalkyl, each substituted or unsubstituted cycloalkyl may be a substituted or unsubstituted C.sub.3-C.sub.7 cycloalkyl, each substituted or unsubstituted heterocycloalkyl may be a substituted or unsubstituted 3 to 7 membered heterocycloalkyl, each substituted or unsubstituted aryl may be a substituted or unsubstituted C.sub.3-C.sub.7 aryl, and/or each substituted or unsubstituted heteroaryl may be a substituted or unsubstituted C.sub.3-C.sub.7 heteroaryl. Each substituted or unsubstituted alkylene may be a substituted or unsubstituted C.sub.1-C.sub.5 alkylene, each substituted or unsubstituted heteroalkylene may be a substituted or unsubstituted 2 to 8 membered heteroalkylene, each substituted or unsubstituted cycloalkylene may be a substituted or unsubstituted C.sub.3-C.sub.7 cycloalkylene, each substituted or unsubstituted heterocycloalkylene may be a substituted or unsubstituted 3 to 7 membered heterocycloalkylene, each substituted or unsubstituted arylene may be a substituted or unsubstituted C.sub.3-C.sub.7 arylene, and/or each substituted or unsubstituted heteroarylene may be a substituted or unsubstituted C.sub.3-C.sub.7 heteroarylene.
[0067] Certain compounds described herein possess asymmetric carbon atoms (optical or chiral centers) or double bonds; the enantiomers, racemates, diastereomers, tautomers, geometric isomers, stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)- or, as (D)- or (L)- for amino acids, and individual isomers are encompassed within the scope of the compounds described herein. The compounds described herein do not include those that are known in art to be too unstable to synthesize and/or isolate. Compounds described herein include compounds in racemic and optically pure forms. Optically active (R)- and (S)-, or (D)- and (L)-isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. When the compounds described herein contain olefinic bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers.
[0068] As used herein, the term isomers refers to compounds having the same number and kind of atoms, and hence the same molecular weight, but differing in respect to the structural arrangement or configuration of the atoms.
[0069] The term tautomer, as used herein, refers to one of two or more structural isomers which exist in equilibrium and which are readily converted from one isomeric form to another.
[0070] It will be apparent to one skilled in the art that certain compounds described herein may exist in tautomeric forms, all such tautomeric forms of the compounds being within the scope described herein.
[0071] Unless otherwise stated, structures depicted herein are also meant to include all stereochemical forms of the structure; i.e., the R and S configurations for each asymmetric center. Therefore, single stereochemical isomers as well as enantiomeric and diastereomeric mixtures of the present compounds are within the scope described herein.
[0072] Unless otherwise stated, structures depicted herein are also meant to include compounds which differ only in the presence of one or more isotopically enriched atoms. For example, compounds described herein include the present structures except for the replacement of a hydrogen by a deuterium or tritium, or the replacement of a carbon by .sup.13C- or .sup.14C-enriched carbon.
[0073] The compounds described herein may also contain unnatural proportions of atomic isotopes at one or more of the atoms that constitute such compounds. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium (.sup.3H), iodine-125 (.sup.125I), or carbon-14 (.sup.14C). Compounds described herein further include all isotopic variations thereof, whether radioactive or not.
[0074] The symbol denotes the point of attachment of a chemical moiety to the remainder of a molecule or chemical formula.
[0075] Analog or analogue is used in accordance with its plain ordinary meaning within Chemistry and Biology and refers to a chemical compound that is structurally similar to another compound (i.e., a so-called reference compound) but differs in composition, e.g., in the replacement of one atom by an atom of a different element, or in the presence of a particular functional group, or the replacement of one functional group by another functional group, or the absolute stereochemistry of one or more chiral centers of the reference compound. Accordingly, an analog is a compound that is similar or comparable in function and appearance but not in structure or origin to a reference compound.
[0076] The terms a or an, as used in herein means one or more. In addition, the phrase substituted with a[n], as used herein, means the specified group may be substituted with one or more of any or all of the named substituents. For example, where a group, such as an alkyl or heteroaryl group, is substituted with an unsubstituted C.sub.1-C.sub.20 alkyl, or unsubstituted 2 to 20 membered heteroalkyl, the group may contain one or more unsubstituted C.sub.1-C.sub.20 alkyls, and/or one or more unsubstituted 2 to 20 membered heteroalkyls.
[0077] Moreover, where a moiety is substituted with an R substituent, the group may be referred to as R-substituted. Where a moiety is R-substituted, the moiety is substituted with at least one R substituent and each R substituent is optionally different. Where a particular R group is present in the description of a chemical genus (such as Formula (I)), a decimal symbol may be used to distinguish each appearance of that particular R group. For example, where multiple R.sup.13 substituents are present, each R.sup.13 substituent may be distinguished as R.sup.13.1, R.sup.13.2, R.sup.13.3, R.sup.13.4, etc., wherein each of R.sup.13.1, R.sup.13.2, R.sup.13.3, R.sup.13.4, etc. is defined within the scope of the definition of R.sup.13 and optionally differently.
[0078] Description of compounds described herein are limited by principles of chemical bonding known to those skilled in the art. Accordingly, where a group may be substituted by one or more of a number of substituents, such substitutions are selected so as to comply with principles of chemical bonding and to give compounds which are not inherently unstable and/or would be known to one of ordinary skill in the art as likely to be unstable under ambient conditions, such as aqueous, neutral, and several known physiological conditions. For example, a heterocycloalkyl or heteroaryl is attached to the remainder of the molecule via a ring heteroatom in compliance with principles of chemical bonding known to those skilled in the art thereby avoiding inherently unstable compounds.
[0079] The terms DNA and RNA refer to deoxyribonucleic acid and ribonucleic acid, respectively.
[0080] Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, and complements thereof. The term polynucleotide refers to a linear sequence of nucleotides. The term nucleotide typically refers to a single unit of a polynucleotide, i.e., a monomer. Nucleotides can be ribonucleotides, deoxyribonucleotides, or modified versions thereof. Examples of polynucleotides contemplated herein include single and double stranded DNA, single and double stranded RNA (including siRNA), and hybrid molecules having mixtures of single and double stranded DNA and RNA. Nucleic acid as used herein also refers nucleic acids that have the same basic chemical structure as naturally occurring nucleic acids. Such analogues have modified sugars and/or modified ring substituents, but retain the same basic chemical structure as the naturally occurring nucleic acid. A nucleic acid mimetic refers to chemical compounds that have a structure that is different the general chemical structure of a nucleic acid, but functions in a manner similar to a naturally occurring nucleic acid. Examples of such analogues include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, and peptide-nucleic acids (PNAs).
[0081] Synthetic mRNA as used herein refers to any mRNA derived through non-natural means such as standard oligonucleotide synthesis techniques or cloning techniques. Such mRNA may also include non-proteinogenic derivatives of naturally occurring nucleotides. Additionally, synthetic mRNA herein also includes mRNA that has been expressed through recombinant techniques or exogenously, using any expression vehicle, including but not limited to prokaryotic cells, eukaryotic cell lines, and viral methods. Synthetic mRNA includes such mRNA that has been purified or otherwise obtained from an expression vehicle or system.
[0082] The terms polypeptide, peptide and protein are used interchangeably herein to refer to a polymer of amino acid residues, wherein the polymer may optionally be conjugated to a moiety that does not consist of amino acids. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
[0083] The term peptidyl and peptidyl moiety means a monovalent peptide.
[0084] The term amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, -carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an a carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
[0085] Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
[0086] Conservatively modified variants applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are silent variations, which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid, which encodes a polypeptide, is implicit in each described sequence with respect to the expression product, but not with respect to actual probe sequences.
[0087] As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a conservatively modified variant where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles described herein.
[0088] The following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
[0089] The term pharmaceutically acceptable salts is meant to include salts of the active compounds that are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein. When compounds described herein contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt. When compounds described herein contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include those derived from inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from relatively nontoxic organic acids like acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, lactic, mandelic, phthalic, benzenesulfonic, p-tolylsulfonic, citric, tartaric, oxalic, methanesulfonic, and the like. Also included are salts of amino acids such as arginate and the like, and salts of organic acids like glucuronic or galactunoric acids and the like (see, for example, Berge et al., Pharmaceutical Salts, Journal of Pharmaceutical Science, 1977, 66, 1-19). Certain specific compounds described herein contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts.
[0090] Thus, the compounds described herein may exist as salts, such as with pharmaceutically acceptable acids. The compounds described herein include such salts. Non-limiting examples of such salts include hydrochlorides, hydrobromides, phosphates, sulfates, methanesulfonates, nitrates, maleates, acetates, citrates, fumarates, proprionates, tartrates (e.g., (+)-tartrates, ()-tartrates, or mixtures thereof including racemic mixtures), succinates, benzoates, and salts with amino acids such as glutamic acid, and quaternary ammonium salts (e.g. methyl iodide, ethyl iodide, and the like). These salts may be prepared by methods known to those skilled in the art.
[0091] The neutral forms of the compounds are preferably regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner. The parent form of the compound may differ from the various salt forms in certain physical properties, such as solubility in polar solvents.
[0092] In addition to salt forms, the compounds described herein may be provided in a prodrug form. Prodrugs of the compounds described herein are those compounds that readily undergo chemical changes under physiological conditions to provide their respective active forms. Prodrugs of the compounds described herein may be converted in vivo after administration. Additionally, prodrugs can be converted to the compounds described herein by chemical or biochemical methods in an ex vivo environment, such as, for example, when contacted with a suitable enzyme or chemical reagent.
[0093] Certain compounds described herein can exist in unsolvated forms as well as solvated forms, including hydrated forms. In general, the solvated forms compounds described herein are equivalent to unsolvated forms. Certain compounds described herein may exist in multiple crystalline or amorphous forms. In general, all physical forms compounds described herein are equivalent for their uses described herein.
[0094] Pharmaceutically acceptable excipient and pharmaceutically acceptable carrier refer to a substance that aids the administration of an active agent to and absorption by a subject and can be included in the compositions described herein without causing a significant adverse toxicological effect on the patient. Non-limiting examples of pharmaceutically acceptable excipients include water, NaCl, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavors, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethylcellulose, polyvinyl pyrrolidine, and colors, and the like. Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, and/or aromatic substances and the like that do not deleteriously react with the compounds described herein. One of skill in the art will recognize that other pharmaceutical excipients are useful in the compositions described herein.
[0095] The term preparation is intended to include the formulation of the active compound with encapsulating material as a carrier providing a capsule in which the active component with or without other carriers, is surrounded by a carrier, which is thus in association with it. Similarly, cachets and lozenges are included. Tablets, powders, capsules, pills, cachets, and lozenges can be used as solid dosage forms suitable for oral administration.
[0096] As used herein, the term administering means oral administration, administration as a suppository, topical contact, intravenous, parenteral, intraperitoneal, intramuscular, intralesional, intrathecal, intranasal or subcutaneous administration, or the implantation of a slow-release device, e.g., a mini-osmotic pump, to a subject. Administration is by any route, including parenteral and transmucosal (e.g., buccal, sublingual, palatal, gingival, nasal, vaginal, rectal, or transdermal). Parenteral administration includes, e.g., intravenous, intramuscular, intra-arteriole, intradermal, subcutaneous, intraperitoneal, intraventricular, and intracranial. Other modes of delivery include, but are not limited to, the use of liposomal formulations, intravenous infusion, transdermal patches, etc.
[0097] The compositions disclosed herein can be delivered by transdermally, by a topical route, formulated as applicator sticks, solutions, suspensions, emulsions, gels, creams, ointments, pastes, jellies, paints, powders, and aerosols. Oral preparations include tablets, pills, powder, dragees, capsules, liquids, lozenges, cachets, gels, syrups, slurries, suspensions, etc., suitable for ingestion by the patient. Solid form preparations include powders, tablets, pills, capsules, cachets, suppositories, and dispersible granules. Liquid form preparations include solutions, suspensions, and emulsions, for example, water or water/propylene glycol solutions. The compositions of the present invention may additionally include components to provide sustained release and/or comfort. Such components include high molecular weight, anionic mucomimetic polymers, gelling polysaccharides and finely-divided drug carrier substrates. These components are discussed in greater detail in U.S. Pat. Nos. 4,911,920; 5,403,841; 5,212,162; and 4,861,760. The entire contents of these patents are incorporated herein by reference in their entirety for all purposes. The compositions disclosed herein can also be delivered as microspheres for slow release in the body. For example, microspheres can be administered via intradermal injection of drug-containing microspheres, which slowly release subcutaneously (see Rao, J. Biomater Sci. Polym. Ed. 7:623-645, 1995; as biodegradable and injectable gel formulations (see, e.g., Gao Pharm. Res. 12:857-863, 1995); or, as microspheres for oral administration (see, e.g., Eyles, J. Pharm. Pharmacol. 49:669-674, 1997). In another embodiment, the formulations of the compositions of the present invention can be delivered by the use of liposomes which fuse with the cellular membrane or are endocytosed, i.e., by employing receptor ligands attached to the liposome, that bind to surface membrane protein receptors of the cell resulting in endocytosis. By using liposomes, particularly where the liposome surface carries receptor ligands specific for target cells, or are otherwise preferentially directed to a specific organ, one can focus the delivery of the compositions of the present invention into the target cells in vivo. (See, e.g., Al-Muhammed, J. Microencapsul. 13:293-306, 1996; Chonn, Curr. Opin. Biotechnol. 6:698-708, 1995; Ostro, Am. J. Hosp. Pharm. 46:1576-1587, 1989). The compositions can also be delivered as nanoparticles.
[0098] Pharmaceutical compositions may include compositions wherein the active ingredient (e.g. compounds described herein, including embodiments or examples) is contained in a therapeutically effective amount, i.e., in an amount effective to achieve its intended purpose. The actual amount effective for a particular application will depend, inter alia, on the condition being treated. When administered in methods to treat a disease, such compositions will contain an amount of active ingredient effective to achieve the desired result, e.g., modulating the activity of a target molecule, and/or reducing, eliminating, or slowing the progression of disease symptoms.
[0099] The dosage and frequency (single or multiple doses) administered to a mammal can vary depending upon a variety of factors, for example, whether the mammal suffers from another disease, and its route of administration; size, age, sex, health, body weight, body mass index, and diet of the recipient; nature and extent of symptoms of the disease being treated, kind of concurrent treatment, complications from the disease being treated or other health-related problems. Other therapeutic regimens or agents can be used in conjunction with the methods and compounds of Applicants' invention. Adjustment and manipulation of established dosages (e.g., frequency and duration) are well within the ability of those skilled in the art.
[0100] The compounds and complexes described herein can be used in combination with one another, with other active drugs known to be useful in treating a disease (e.g. anti-cancer drugs) or with adjunctive agents that may not be effective alone, but may contribute to the efficacy of the active agent.
[0101] By co-administer it is meant that a composition described herein is administered at the same time, just prior to, or just after the administration of one or more additional therapies, for example an anticancer agent as described herein. The compound of the invention can be administered alone or can be co-administered to the patient. Co-administration is meant to include simultaneous or sequential administration of the compound individually or in combination (more than one compound or agent). Thus, the preparations can also be combined, when desired, with other active substances (e.g. anticancer agents).
[0102] Co-administration includes administering one active agent (e.g. a complex described herein) within 0.5, 1, 2, 4, 6, 8, 10, 12, 16, 20, or 24 hours of a second active agent (e.g. anti-cancer agents). Also contemplated herein, are embodiments, where co-administration includes administering one active agent within 0.5, 1, 2, 4, 6, 8, 10, 12, 16, 20, or 24 hours of a second active agent. Co-administration includes administering two active agents simultaneously, approximately simultaneously (e.g., within about 1, 5, 10, 15, 20, or 30 minutes of each other), or sequentially in any order. In embodiments, co-administration can be accomplished by co-formulation, i.e., preparing a single pharmaceutical composition including both active agents. In other embodiments, the active agents can be formulated separately. In embodiments, the active and/or adjunctive agents may be linked or conjugated to one another. In embodiments, the compounds and complexes described herein may be combined with treatments for cancer such as chemotherapy or radiation therapy.
[0103] The terms HDAC8 inhibitor and HDAC8i are used interchangeably herein and refer a composition (e.g. compound, peptide, protein, nucleic acid, or antibody) which reduces the activity of HDAC8 (Histone Deacetylase 8) relative to the activity of HDAC8 in the absence of the inhibitor. HDAC8 inhibitors may be selective for HDAC8 as described herein. The HDAC8 inhibitor may be a HDAC8 inhibitor compound (e.g. a compound having a molecular weight (MW) of less than about 1000 Da). The HDAC8 inhibitor compound may be a compound described herein. HDAC8 inhibitor compounds further include compounds known to selectively inhibit HDAC8 expression or activity including one or more of those exemplified in, for example, U.S. Pat. No. 7,820,711; PCT/JP2011/050647; and/or PCT/US2014/012968.
[0104] HDAC8 inhibitor compounds include one or more of the compounds described herein, and further includes, for example, one or more of the compounds described by K. Krennhrubec, et al., Bioorg. Med. Chem. Lett. 2007, 17, 2874-2878; P. Galletti, et al., ChemMedChem. 2009, 4, 1991-2001; E. Hu, et al., J. Pharmacol. Exp. Ther. 2003, 307, 720-728; W. Tang, et al., Bioorg. Med. Chem. Lett. 2011, 21, 2601-2605; S. Balasubramanian, et al., Leukemia 2008, 22, 1026-1034; L. Whitehead, et al., Bioorg. Med. Chem. 2011, 19, 4626-4634; and T. Suzuki, et al., ChemMedChem. 2014, 9, 657-664.
[0105] The HDAC8 inhibitor may be a HDAC8 inhibitor antibody (e.g. those described by PCT/US2000/033622). The HDAC8 inhibitor may be a HDAC8 inhibitor polynucleotide. The HDAC8 inhibitor polynucleotide may be a mdRNA as described by, for example, PCT/US2008/055612. The HDAC8 inhibitor polynucleotide may be RNA (e.g. a HDAC8 inhibitor RNA), siRNA (e.g. a HDAC8 inhibitor siRNA), shRNA (e.g. a HDAC8 inhibitor shRNA) or a miRNA (e.g. a HDAC8 inhibitor miRNA). The HDAC8 inhibitor may be a HDAC8 inhibitor protein.
[0106] Selective, selectivity or the like of a compound refers to the compound's ability to discriminate between molecular targets. A selective HDAC8 inhibitor described herein may have an IC.sub.50 for HDAC8 activity that is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 fold lower than the IC.sub.50 for one or more of HDAC1, HDAC2, HDAC3, HDAC6, HDAC10, and/or HDAC 11. A selective HDAC8 inhibitor may have an IC.sub.50 for HDAC8 acetyltransferase activity that is about 5, 10, 50, 150, 200, 250, 300, 350, 400, 450 or more than about 500 fold lower than the IC.sub.50 for acetyltransferase activity of another HDAC (e.g. HDAC1, HDAC2, HDAC3, HDAC6, HDAC10, or HDAC 11).
[0107] Specific, specifically, specificity, or the like of a compound refers to the compound's ability to cause a particular action, such as inhibition, to a particular molecular target with minimal or no action to other proteins in the cell.
[0108] HDAC8 is used herein and according to its common, ordinary meaning and refers to proteins of the same or similar names and functional fragments and homologs thereof. The term includes any recombinant or naturally occurring form of HDAC8 (e.g. Histone deacetylase 8; GI No: 8132878), or variants or fragments thereof that maintain HDAC8 activity (e.g. within at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% activity compared to HDAC8).
[0109] p53 is used herein and according to its common, ordinary meaning and refers to proteins of the same or similar names and functional fragments and homologs thereof. The term includes any recombinant or naturally occurring form of p53 (e.g. GI No: 23491729), or variants or fragments thereof that maintain p53 activity (e.g. within at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% activity compared to p53). A mutated p53 is a p53 variant that is aberrantly acetylated or deacetylated resulting from a mutation to the wildtype p53 amino acid sequence. The phrase non-mutated p53 refers to p53 variants which are correctly acetylated or deacetylated. A non-mutated p53 may include mutations so long as those mutations impart no effect on p53 acetylation or deacetylation. Thus, a non-mutated p53 cancer refers to a cancer characterized by correctly acetylated or deacetylated p53. Likewise, a mutated p53 cancer refers to a cancer characterized by incorrectly acetylated or deacetylated p53.
[0110] The terms treating, or treatment refers to any indicia of success in the treatment or amelioration of an injury, disease, pathology or condition, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the injury, pathology or condition more tolerable to the patient; slowing in the rate of degeneration or decline; making the final point of degeneration less debilitating; improving a patient's physical or mental well-being. The treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of a physical examination, neuropsychiatric exams, and/or a psychiatric evaluation. The term treating and conjugations thereof, include prevention of an injury, pathology, condition, or disease.
[0111] An effective amount is an amount sufficient to accomplish a stated purpose (e.g. achieve the effect for which it is administered, treat a disease, reduce enzyme activity, increase enzyme activity, reduce one or more symptoms of a disease or condition). An example of an effective amount is an amount sufficient to contribute to the treatment, prevention, or reduction of a symptom or symptoms of a disease, which could also be referred to as a therapeutically effective amount. A reduction of a symptom or symptoms (and grammatical equivalents of this phrase) means decreasing of the severity or frequency of the symptom(s), or elimination of the symptom(s). A prophylactically effective amount of a drug is an amount of a drug that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing or delaying the onset (or reoccurrence) of an injury, disease, pathology or condition, or reducing the likelihood of the onset (or reoccurrence) of an injury, disease, pathology, or condition, or their symptoms. The full prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a prophylactically effective amount may be administered in one or more administrations. The exact amounts will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); Pickar, Dosage Calculations (1999); and Remington: The Science and Practice of Pharmacy, 20th Edition, 2003, Gennaro, Ed., Lippincott, Williams & Wilkins).
[0112] For any compound described herein, the therapeutically effective amount can be initially determined from cell culture assays. Target concentrations will be those concentrations of active compound(s) that are capable of achieving the methods described herein, as measured using the methods described herein or known in the art.
[0113] As is well known in the art, therapeutically effective amounts for use in humans can also be determined from animal models. For example, a dose for humans can be formulated to achieve a concentration that has been found to be effective in animals. The dosage in humans can be adjusted by monitoring compounds effectiveness and adjusting the dosage upwards or downwards, as described above. Adjusting the dose to achieve maximal efficacy in humans based on the methods described above and other methods is well within the capabilities of the ordinarily skilled artisan.
[0114] Dosages may be varied depending upon the requirements of the patient and the compound being employed. The dose administered to a patient, in the context of the present invention should be sufficient to effect a beneficial therapeutic response in the patient over time. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects. Determination of the proper dosage for a particular situation is within the skill of the practitioner. Generally, treatment is initiated with smaller dosages which are less than the optimum dose of the compound. Thereafter, the dosage is increased by small increments until the optimum effect under circumstances is reached.
[0115] Dosage amounts and intervals can be adjusted individually to provide levels of the administered compound effective for the particular clinical indication being treated. This will provide a therapeutic regimen that is commensurate with the severity of the individual's disease state.
[0116] Utilizing the teachings provided herein, an effective prophylactic or therapeutic treatment regimen can be planned that does not cause substantial toxicity and yet is effective to treat the clinical symptoms demonstrated by the particular patient. This planning should involve the careful choice of active compound by considering factors such as compound potency, relative bioavailability, patient body weight, presence and severity of adverse side effects, preferred mode of administration and the toxicity profile of the selected agent.
[0117] Control or control experiment is used in accordance with its plain ordinary meaning and refers to an experiment in which the subjects or reagents of the experiment are treated as in a parallel experiment except for omission of a procedure, reagent, or variable of the experiment. In some instances, the control is used as a standard of comparison in evaluating experimental effects. A control may be the measurement of the activity of a protein in the absence of a compound as described herein.
[0118] A test compound as used herein refers to an experimental compound used in a screening process to identify activity, non-activity, or other modulation of a particularized biological target or pathway.
[0119] The term modulation, modulate, or modulator are used in accordance with their plain ordinary meaning and refer to the act of changing or varying one or more properties. Modulator refers to a composition that increases or decreases the level of a target molecule or the function of a target molecule or the physical state of the target of the molecule. Modulation refers to the process of changing or varying one or more properties. For example, as applied to the effects of a modulator on a biological target, to modulate means to change by increasing or decreasing a property or function of the biological target or the amount of the biological target.
[0120] As defined herein, the term inhibition, inhibit, inhibiting and the like in reference to a protein-inhibitor interaction means negatively affecting (e.g. decreasing) the activity or function of the protein relative to the activity or function of the protein in the absence of the inhibitor. Inhibition may refer to reduction of a disease or symptoms of disease. Inhibition may refer to a reduction in the activity of a particular protein or nucleic acid target. Thus, inhibition includes, at least in part, partially or totally blocking stimulation, decreasing, preventing, or delaying activation, or inactivating, desensitizing, or down-regulating signal transduction or enzymatic activity or the amount of a protein.
[0121] Contacting is used in accordance with its plain ordinary meaning and refers to the process of allowing at least two distinct species (e.g. chemical compounds including biomolecules or cells) to become sufficiently proximal to react, interact or physically touch. It should be appreciated; however, the resulting reaction product can be produced directly from a reaction between the added reagents or from an intermediate from one or more of the added reagents that can be produced in the reaction mixture.
[0122] The term contacting may include allowing two species to react, interact, or physically touch, wherein the two species may be a compound as described herein and a protein or enzyme. Contacting may include allowing a compound described herein to interact with a protein or enzyme that is involved in a signaling pathway.
[0123] Patient, subject, patient in need thereof, and subject in need thereof are herein used interchangeably and refer to a living organism suffering from or prone to a disease or condition that can be treated by administration of a pharmaceutical composition as provided herein. Non-limiting examples include humans, other mammals, bovines, rats, mice, dogs, monkeys, goat, sheep, cows, deer, and other non-mammalian animals. A patient may be human.
[0124] Disease or condition or disorder refers to a state of being or health status of a patient or subject capable of being treated with the compounds, drugs, pharmaceutical compositions, or methods provided herein. The disease may be a disease related to (e.g. caused by) an abnormal cell growth or abnormal protein activity (e.g. cancer).
[0125] As used herein, the term cancer refers to all types of cancer, neoplasm, or malignant or benign tumors found in mammals, including leukemia, carcinomas and sarcomas. Exemplary cancers include acute myeloid leukemia (AML), chronic myelogenous leukemia (CML), and cancer of the brain, breast, pancreas, colon, liver, kidney, lung, non-small cell lung, melanoma, ovary, sarcoma, and prostate. Additional examples include, cervix cancers, stomach cancers, head & neck cancers, uterus cancers, mesothelioma, metastatic bone cancer, Medulloblastoma, Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, cancer, malignant pancreatic insulinoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical cancer, and neoplasms of the endocrine and exocrine pancreas.
[0126] The term leukemia refers broadly to progressive, malignant diseases of the blood-forming organs and is generally characterized by a distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow. Leukemia is generally clinically classified on the basis of (1) the duration and character of the disease-acute or chronic; (2) the type of cell involved; myeloid (myelogenous), lymphoid (lymphogenous), or monocytic; and (3) the increase or non-increase in the number abnormal cells in the blood-leukemic or aleukemic (subleukemic). The murine leukemia model is widely accepted as being predictive of in vivo anti-leukemic activity. It is believed that a compound that tests positive in the P388 cell assay will generally exhibit some level of anti-leukemic activity regardless of the type of leukemia being treated. Accordingly, the present invention includes a method of treating leukemia, including treating acute myeloid leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute promyelocytic leukemia, adult T-cell leukemia, aleukemic leukemia, a leukocythemic leukemia, basophylic leukemia, blast cell leukemia, bovine leukemia, chronic myelocytic leukemia, leukemia cutis, embryonal leukemia, eosinophilic leukemia, Gross' leukemia, hairy-cell leukemia, hemoblastic leukemia, hemocytoblastic leukemia, histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, lymphatic leukemia, lymphoblastic leukemia, lymphocytic leukemia, lymphogenous leukemia, lymphoid leukemia, lymphosarcoma cell leukemia, mast cell leukemia, megakaryocytic leukemia, micromyeloblastic leukemia, monocytic leukemia, myeloblastic leukemia, myelocytic leukemia, myeloid granulocytic leukemia, myelomonocytic leukemia, Naegeli leukemia, plasma cell leukemia, multiple myeloma, plasmacytic leukemia, promyelocytic leukemia, Rieder cell leukemia, Schilling's leukemia, stem cell leukemia, subleukemic leukemia, and undifferentiated cell leukemia.
[0127] The term sarcoma generally refers to a tumor which is made up of a substance like the embryonic connective tissue and is generally composed of closely packed cells embedded in a fibrillar or homogeneous substance. Sarcomas which can be treated with a combination of antineoplastic thiol-binding mitochondrial oxidant and an anticancer agent include a chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abemethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, chorio carcinoma, embryonal sarcoma, Wilms' tumor sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fibroblastic sarcoma, giant cell sarcoma, granulocytic sarcoma, Hodgkin's sarcoma, idiopathic multiple pigmented hemorrhagic sarcoma, immunoblastic sarcoma of B cells, lymphoma, immunoblastic sarcoma of T-cells, Jensen's sarcoma, Kaposi's sarcoma, Kupffer cell sarcoma, angiosarcoma, leukosarcoma, malignant mesenchymoma sarcoma, parosteal sarcoma, reticulocytic sarcoma, Rous sarcoma, serocystic sarcoma, synovial sarcoma, and telangiectaltic sarcoma.
[0128] The term melanoma is taken to mean a tumor arising from the melanocytic system of the skin and other organs. Melanomas which can be treated with a combination of antineoplastic thiol-binding mitochondrial oxidant and an anticancer agent include, for example, acral-lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, lentigo maligna melanoma, malignant melanoma, nodular melanoma, subungal melanoma, and superficial spreading melanoma.
[0129] The term carcinoma refers to a malignant new growth made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases. Exemplary carcinomas which can be treated with a combination of antineoplastic thiol-binding mitochondrial oxidant and an anticancer agent include, for example, acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, carcinoma adenomatosum, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma basocellulare, basaloid carcinoma, basosquamous cell carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma, chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epiermoid carcinoma, carcinoma epitheliale adenoides, exophytic carcinoma, carcinoma ex ulcere, carcinoma fibrosum, gelatiniforni carcinoma, gelatinous carcinoma, giant cell carcinoma, carcinoma gigantocellulare, glandular carcinoma, granulosa cell carcinoma, hair-matrix carcinoma, hematoid carcinoma, hepatocellular carcinoma, Hurthle cell carcinoma, hyaline carcinoma, hypemephroid carcinoma, infantile embryonal carcinoma, carcinoma in situ, intraepidermal carcinoma, intraepithelial carcinoma, Krompecher's carcinoma, Kulchitzky-cell carcinoma, large-cell carcinoma, lenticular carcinoma, carcinoma lenticulare, lipomatous carcinoma, lymphoepithelial carcinoma, carcinoma medullare, medullary carcinoma, melanotic carcinoma, carcinoma molle, mucinous carcinoma, carcinoma muciparum, carcinoma mucocellulare, mucoepidermoid carcinoma, carcinoma mucosum, mucous carcinoma, carcinoma myxomatodes, nasopharyngeal carcinoma, oat cell carcinoma, carcinoma ossificans, osteoid carcinoma, papillary carcinoma, periportal carcinoma, preinvasive carcinoma, prickle cell carcinoma, pultaceous carcinoma, renal cell carcinoma of kidney, reserve cell carcinoma, carcinoma sarcomatodes, schneiderian carcinoma, scirrhous carcinoma, carcinoma scroti, signet-ring cell carcinoma, carcinoma simplex, small-cell carcinoma, solanoid carcinoma, spheroidal cell carcinoma, spindle cell carcinoma, carcinoma spongiosum, squamous carcinoma, squamous cell carcinoma, string carcinoma, carcinoma telangiectaticum, carcinoma telangiectodes, transitional cell carcinoma, carcinoma tuberosum, tuberous carcinoma, verrucous carcinoma, and carcinoma villosum.
[0130] Anti-cancer agent is used in accordance with its plain and ordinary meaning and refers to a composition (e.g. compound, drug, antagonist, inhibitor, modulator) having antineoplastic properties or the ability to inhibit the growth or proliferation of cells. In some embodiments, an anti-cancer agent is a chemotherapeutic. An anti-cancer agent may be an agent approved by the FDA or similar regulatory agency of a country other than the USA, for treating cancer.
[0131] Examples of anti-cancer agents include, but are not limited to, MEK (e.g. MEK1, MEK2, or MEK1 and MEK2) inhibitors (e.g. XL518, CI-1040, PD035901, selumetinib/AZD6244, GSK1120212/trametinib, GDC-0973, ARRY-162, ARRY-300, AZD8330, PD0325901, U0126, PD98059, TAK-733, PD318088, AS703026, BAY 869766), alkylating agents (e.g., cyclophosphamide, ifosfamide, chlorambucil, busulfan, melphalan, mechlorethamine, uramustine, thiotepa, nitrosoureas, nitrogen mustards (e.g., mechloroethamine, cyclophosphamide, chlorambucil, meiphalan), ethylenimine and methylmelamines (e.g., hexamethlymelamine, thiotepa), alkyl sulfonates (e.g., busulfan), nitrosoureas (e.g., carmustine, lomusitne, semustine, streptozocin), triazenes (decarbazine)), anti-metabolites (e.g., 5-azathioprine, leucovorin, capecitabine, fludarabine, gemcitabine, pemetrexed, raltitrexed, folic acid analog (e.g., methotrexate), or pyrimidine analogs (e.g., fluorouracil, floxouridine, Cytarabine), purine analogs (e.g., mercaptopurine, thioguanine, pentostatin), etc.), plant alkaloids (e.g., vincristine, vinblastine, vinorelbine, vindesine, podophyllotoxin, paclitaxel, docetaxel, etc.), topoisomerase inhibitors (e.g., irinotecan, topotecan, amsacrine, etoposide (VP16), etoposide phosphate, teniposide, etc.), antitumor antibiotics (e.g., doxorubicin, adriamycin, daunorubicin, epirubicin, actinomycin, bleomycin, mitomycin, mitoxantrone, plicamycin, etc.), platinum-based compounds (e.g. cisplatin, oxaloplatin, carboplatin), anthracenedione (e.g., mitoxantrone), substituted urea (e.g., hydroxyurea), methyl hydrazine derivative (e.g., procarbazine), adrenocortical suppressant (e.g., mitotane, aminoglutethimide), epipodophyllotoxins (e.g., etoposide), antibiotics (e.g., daunorubicin, doxorubicin, bleomycin), enzymes (e.g., L-asparaginase), inhibitors of mitogen-activated protein kinase signaling (e.g. U0126, PD98059, PD184352, PD0325901, ARRY-142886, SB239063, SP600125, BAY 43-9006, wortmannin, or LY294002, Syk inhibitors, mTOR inhibitors, antibodies (e.g., rituxan), gossyphol, genasense, polyphenol E, Chlorofusin, all trans-retinoic acid (ATRA), bryostatin, tumor necrosis factor-related apoptosis-inducing ligand (TRAIL), 5-aza-2-deoxycytidine, all trans retinoic acid, doxorubicin, vincristine, etoposide, gemcitabine, imatinib (Gleevec), geldanamycin, 17-N-Allylamino-17-Demethoxygeldanamycin (17-AAG), flavopiridol, LY294002, bortezomib, trastuzumab, BAY 11-7082, PKC412, PD184352, 20-epi-1, 25 dihydroxyvitamin D3; 5-ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin; ALL-TK antagonists; altretamine; ambamustine; amidox; amifostine; aminolevulinic acid; amrubicin; amsacrine; anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D; antagonist G; antarelix; anti-dorsalizing morphogenetic protein-1; antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston; antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase; asulacrine; atamestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin III derivatives; balanol; batimastat; BCR/ABL antagonists; benzochlorins; benzoylstaurosporine; beta lactam derivatives; beta-alethine; betaclamycin B; betulinic acid; bFGF inhibitor; bicalutamide; bisantrene; bisaziridinylspermine; bisnafide; bistratene A; bizelesin; breflate; bropirimine; budotitane; buthionine sulfoximine; calcipotriol; calphostin C; camptothecin derivatives; canarypox IL-2; capecitabine; carboxamide-amino-triazole; carboxyamidotriazole; CaRest M3; CARN 700; cartilage derived inhibitor; carzelesin; casein kinase inhibitors (ICOS); castanospermine; cecropin B; cetrorelix; chlorins; chloroquinoxaline sulfonamide; cicaprost; cis-porphyrin; cladribine; clomifene analogues; clotrimazole; collismycin A; collismycin B; combretastatin A4; combretastatin analogue; conagenin; crambescidin 816; crisnatol; cryptophycin 8; cryptophycin A derivatives; curacin A; cyclopentanthraquinones; cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor; cytostatin; dacliximab; decitabine; dehydrodidemnin B; deslorelin; dexamethasone; dexifosfamide; dexrazoxane; dexverapamil; diaziquone; didemnin B; didox; diethylnorspermine; dihydro-5-azacytidine; 9-dioxamycin; diphenyl spiromustine; docosanol; dolasetron; doxifluridine; droloxifene; dronabinol; duocarmycin SA; ebselen; ecomustine; edelfosine; edrecolomab; eflornithine; elemene; emitefur; epirubicin; epristeride; estramustine analogue; estrogen agonists; estrogen antagonists; etanidazole; etoposide phosphate; exemestane; fadrozole; fazarabine; fenretinide; filgrastim; finasteride; flavopiridol; flezelastine; fluasterone; fludarabine; fluorodaunorunicin hydrochloride; forfenimex; formestane; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; heregulin; hexamethylene bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene; idramantone; ilmofosine; ilomastat; imidazoacridones; imiquimod; immunostimulant peptides; insulin-like growth factor-1 receptor inhibitor; interferon agonists; interferons; interleukins; iobenguane; iododoxorubicin; ipomeanol, 4-; iroplact; irsogladine; isobengazole; isohomohalicondrin B; itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin; lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia inhibiting factor; leukocyte alpha interferon; leuprolide+estrogen+progesterone; leuprorelin; levamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide; lipophilic platinum compounds; lissoclinamide 7; lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone; lovastatin; loxoribine; lurtotecan; lutetium texaphyrin; lysofylline; lytic peptides; maitansine; mannostatin A; marimastat; masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase inhibitors; menogaril; merbarone; meterelin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltefosine; mirimostim; mismatched double stranded RNA; mitoguazone; mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast growth factor-saporin; mitoxantrone; mofarotene; molgramostim; monoclonal antibody, human chorionic gonadotrophin; monophosphoryl lipid A+myobacterium cell wall sk; mopidamol; multiple drug resistance gene inhibitor; multiple tumor suppressor 1-based therapy; mustard anticancer agent; mycaperoxide B; mycobacterial cell wall extract; myriaporone; N-acetyldinaline; N-substituted benzamides; nafarelin; nagrestip; naloxone+pentazocine; napavin; naphterpin; nartograstim; nedaplatin; nemorubicin; neridronic acid; neutral endopeptidase; nilutamide; nisamycin; nitric oxide modulators; nitroxide antioxidant; nitrullyn; O6-benzylguanine; octreotide; okicenone; oligonucleotides; onapristone; ondansetron; ondansetron; oracin; oral cytokine inducer; ormaplatin; osaterone; oxaliplatin; oxaunomycin; palauamine; palmitoylrhizoxin; pamidronic acid; panaxytriol; panomifene; parabactin; pazelliptine; pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin; pentrozole; perflubron; perfosfamide; perillyl alcohol; phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocarpine hydrochloride; pirarubicin; piritrexim; placetin A; placetin B; plasminogen activator inhibitor; platinum complex; platinum compounds; platinum-triamine complex; porfimer sodium; porfiromycin; prednisone; propyl bis-acridone; prostaglandin J2; proteasome inhibitors; protein A-based immune modulator; protein kinase C inhibitor; protein kinase C inhibitors, microalgal; protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; purpurins; pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylerie conjugate; raf antagonists; raltitrexed; ramosetron; ras farnesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitor; retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin; ribozymes; RII retinamide; rogletimide; rohitukine; romurtide; roquinimex; rubiginone B1; ruboxyl; safingol; saintopin; SarCNU; sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence derived inhibitor 1; sense oligonucleotides; signal transduction inhibitors; signal transduction modulators; single chain antigen-binding protein; sizofuran; sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; somatomedin binding protein; sonermin; sparfosic acid; spicamycin D; spiromustine; splenopentin; spongistatin 1; squalamine; stem cell inhibitor; stem-cell division inhibitors; stipiamide; stromelysin inhibitors; sulfinosine; superactive vasoactive intestinal peptide antagonist; suradista; suramin; swainsonine; synthetic glycosaminoglycans; tallimustine; tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium; tegafur; tellurapyrylium; telomerase inhibitors; temoporfin; temozolomide; teniposide; tetrachlorodecaoxide; tetrazomine; thaliblastine; thiocoraline; thrombopoietin; thrombopoietin mimetic; thymalfasin; thymopoietin receptor agonist; thymotrinan; thyroid stimulating hormone; tin ethyl etiopurpurin; tirapazamine; titanocene bichloride; topsentin; toremifene; totipotent stem cell factor; translation inhibitors; tretinoin; triacetyluridine; triciribine; trimetrexate; triptorelin; tropisetron; turosteride; tyrosine kinase inhibitors; tyrphostins; UBC inhibitors; ubenimex; urogenital sinus-derived growth inhibitory factor; urokinase receptor antagonists; vapreotide; variolin B; vector system, erythrocyte gene therapy; velaresol; veramine; verdins; verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole; zanoterone; zeniplatin; zilascorb; zinostatin stimalamer, Adriamycin, Dactinomycin, Bleomycin, Vinblastine, Cisplatin, acivicin; aclarubicin; acodazole hydrochloride; acronine; adozelesin; aldesleukin; altretamine; ambomycin; ametantrone acetate; aminoglutethimide; amsacrine; anastrozole; anthramycin; asparaginase; asperlin; azacitidine; azetepa; azotomycin; batimastat; benzodepa; bicalutamide; bisantrene hydrochloride; bisnafide dimesylate; bizelesin; bleomycin sulfate; brequinar sodium; bropirimine; busulfan; cactinomycin; calusterone; caracemide; carbetimer; carboplatin; carmustine; carubicin hydrochloride; carzelesin; cedefingol; chlorambucil; cirolemycin; cladribine; crisnatol mesylate; cyclophosphamide; cytarabine; dacarbazine; daunorubicin hydrochloride; decitabine; dexormaplatin; dezaguanine; dezaguanine mesylate; diaziquone; doxorubicin; doxorubicin hydrochloride; droloxifene; droloxifene citrate; dromostanolone propionate; duazomycin; edatrexate; eflornithine hydrochloride; elsamitrucin; enloplatin; enpromate; epipropidine; epirubicin hydrochloride; erbulozole; esorubicin hydrochloride; estramustine; estramustine phosphate sodium; etanidazole; etoposide; etoposide phosphate; etoprine; fadrozole hydrochloride; fazarabine; fenretinide; floxuridine; fludarabine phosphate; fluorouracil; fluorocitabine; fosquidone; fostriecin sodium; gemcitabine; gemcitabine hydrochloride; hydroxyurea; idarubicin hydrochloride; ifosfamide; iimofosine; interleukin I1 (including recombinant interleukin IL, or rlL.sub.2), interferon alfa-2a; interferon alfa-2b; interferon alfa-n1; interferon alfa-n3; interferon beta-1a; interferon gamma-1b; iproplatin; irinotecan hydrochloride; lanreotide acetate; letrozole; leuprolide acetate; liarozole hydrochloride; lometrexol sodium; lomustine; losoxantrone hydrochloride; masoprocol; maytansine; mechlorethamine hydrochloride; megestrol acetate; melengestrol acetate; melphalan; menogaril; mercaptopurine; methotrexate; methotrexate sodium; metoprine; meturedepa; mitindomide; mitocarcin; mitocromin; mitogillin; mitomalcin; mitomycin; mitosper; mitotane; mitoxantrone hydrochloride; mycophenolic acid; nocodazoie; nogalamycin; ormaplatin; oxisuran; pegaspargase; peliomycin; pentamustine; peplomycin sulfate; perfosfamide; pipobroman; piposulfan; piroxantrone hydrochloride; plicamycin; plomestane; porfimer sodium; porfiromycin; prednimustine; procarbazine hydrochloride; puromycin; puromycin hydrochloride; pyrazofurin; riboprine; rogletimide; safingol; safingol hydrochloride; semustine; simtrazene; sparfosate sodium; sparsomycin; spirogermanium hydrochloride; spiromustine; spiroplatin; streptonigrin; streptozocin; sulofenur; talisomycin; tecogalan sodium; tegafur; teloxantrone hydrochloride; temoporfin; teniposide; teroxirone; testolactone; thiamiprine; thioguanine; thiotepa; tiazofurin; tirapazamine; toremifene citrate; trestolone acetate; triciribine phosphate; trimetrexate; trimetrexate glucuronate; triptorelin; tubulozole hydrochloride; uracil mustard; uredepa; vapreotide; verteporfin; vinblastine sulfate; vincristine sulfate; vindesine; vindesine sulfate; vinepidine sulfate; vinglycinate sulfate; vinleurosine sulfate; vinorelbine tartrate; vinrosidine sulfate; vinzolidine sulfate; vorozole; zeniplatin; zinostatin; zorubicin hydrochloride, agents that arrest cells in the G2-M phases and/or modulate the formation or stability of microtubules, (e.g. Taxol (i.e. paclitaxel), Taxotere, compounds comprising the taxane skeleton, Erbulozole (i.e. R-55104), Dolastatin 10 (i.e. DLS-10 and NSC-376128), Mivobulin isethionate (i.e. as CI-980), Vincristine, NSC-639829, Discodermolide (i.e. as NVP-XX-A-296), ABT-751 (Abbott, i.e. E-7010), Altorhyrtins (e.g. Altorhyrtin A and Altorhyrtin C), Spongistatins (e.g. Spongistatin 1, Spongistatin 2, Spongistatin 3, Spongistatin 4, Spongistatin 5, Spongistatin 6, Spongistatin 7, Spongistatin 8, and Spongistatin 9), Cemadotin hydrochloride (i.e. LU-103793 and NSC-D-669356), Epothilones (e.g. Epothilone A, Epothilone B, Epothilone C (i.e. desoxyepothilone A or dEpoA), Epothilone D (i.e. KOS-862, dEpoB, and desoxyepothilone B), Epothilone E, Epothilone F, Epothilone B N-oxide, Epothilone A N-oxide, 16-aza-epothilone B, 21-aminoepothilone B (i.e. BMS-310705), 21-hydroxyepothilone D (i.e. Desoxyepothilone F and dEpoF), 26-fluoroepothilone, Auristatin PE (i.e. NSC-654663), Soblidotin (i.e. TZT-1027), LS-4559-P (Pharmacia, i.e. LS-4577), LS-4578 (Pharmacia, i.e. LS-477-P), LS-4477 (Pharmacia), LS-4559 (Pharmacia), RPR-112378 (Aventis), Vincristine sulfate, DZ-3358 (Daiichi), FR-182877 (Fujisawa, i.e. WS-9885B), GS-164 (Takeda), GS-198 (Takeda), KAR-2 (Hungarian Academy of Sciences), BSF-223651 (BASF, i.e. ILX-651 and LU-223651), SAH-49960 (Lilly/Novartis), SDZ-268970 (Lilly/Novartis), AM-97 (Armad/Kyowa Hakko), AM-132 (Armad), AM-138 (Armad/Kyowa Hakko), IDN-5005 (Indena), Cryptophycin 52 (i.e. LY-355703), AC-7739 (Ajinomoto, i.e. AVE-8063A and CS-39.HCl), AC-7700 (Ajinomoto, i.e. AVE-8062, AVE-8062A, CS-39-L-Ser.HCl, and RPR-258062A), Vitilevuamide, Tubulysin A, Canadensol, Centaureidin (i.e. NSC-106969), T-138067 (Tularik, i.e. T-67, TL-138067 and TI-138067), COBRA-1 (Parker Hughes Institute, i.e. DDE-261 and WHI-261), H10 (Kansas State University), H16 (Kansas State University), Oncocidin A1 (i.e. BTO-956 and DIME), DDE-313 (Parker Hughes Institute), Fijianolide B, Laulimalide, SPA-2 (Parker Hughes Institute), SPA-1 (Parker Hughes Institute, i.e. SPIKET-P), 3-IAABU (Cytoskeleton/Mt. Sinai School of Medicine, i.e. MF-569), Narcosine (also known as NSC-5366), Nascapine, D-24851 (Asta Medica), A-105972 (Abbott), Hemiasterlin, 3-BAABU (Cytoskeleton/Mt. Sinai School of Medicine, i.e. MF-191), TMPN (Arizona State University), Vanadocene acetylacetonate, T-138026 (Tularik), Monsatrol, lnanocine (i.e. NSC-698666), 3-IAABE (Cytoskeleton/Mt. Sinai School of Medicine), A-204197 (Abbott), T-607 (Tuiarik, i.e. T-900607), RPR-115781 (Aventis), Eleutherobins (such as Desmethyleleutherobin, Desaetyleleutherobin, Isoeleutherobin A, and Z-Eleutherobin), Caribaeoside, Caribaeolin, Halichondrin B, D-64131 (Asta Medica), D-68144 (Asta Medica), Diazonamide A, A-293620 (Abbott), NPI-2350 (Nereus), Taccalonolide A, TUB-245 (Aventis), A-259754 (Abbott), Diozostatin, ()-Phenylahistin (i.e. NSCL-96F037), D-68838 (Asta Medica), D-68836 (Asta Medica), Myoseverin B, D-43411 (Zentaris, i.e. D-81862), A-289099 (Abbott), A-318315 (Abbott), HTI-286 (i.e. SPA-10, trifluoroacetate salt) (Wyeth), D-82317 (Zentaris), D-82318 (Zentaris), SC-12983 (NCI), Resverastatin phosphate sodium, BPR-OY-007 (National Health Research Institutes), and SSR-250411 (Sanofi)), steroids (e.g., dexamethasone), finasteride, aromatase inhibitors, gonadotropin-releasing hormone agonists (GnRH) such as goserelin or leuprolide, adrenocorticosteroids (e.g., prednisone), progestins (e.g., hydroxyprogesterone caproate, megestrol acetate, medroxyprogesterone acetate), estrogens (e.g., diethlystilbestrol, ethinyl estradiol), antiestrogen (e.g., tamoxifen), androgens (e.g., testosterone propionate, fluoxymesterone), antiandrogen (e.g., flutamide), immunostimulants (e.g., Bacillus Calmette-Gurin (BCG), levamisole, interleukin-2, alpha-interferon, etc.), monoclonal antibodies (e.g., anti-CD20, anti-HER2, anti-CD52, anti-HLA-DR, and anti-VEGF monoclonal antibodies), immunotoxins (e.g., anti-CD33 monoclonal antibody-calicheamicin conjugate, anti-CD22 monoclonal antibody-pseudomonas exotoxin conjugate, etc.), radioimmunotherapy (e.g., anti-CD20 monoclonal antibody conjugated to .sup.111In, .sup.90Y, or .sup.131I, etc.), triptolide, homoharringtonine, dactinomycin, doxorubicin, epirubicin, topotecan, itraconazole, vindesine, cerivastatin, vincristine, deoxyadenosine, sertraline, pitavastatin, irinotecan, clofazimine, 5-nonyloxytryptamine, vemurafenib, dabrafenib, erlotinib, gefitinib, EGFR inhibitors, epidermal growth factor receptor (EGFR)-targeted therapy or therapeutic (e.g. gefitinib (Iressa), erlotinib (Tarceva), cetuximab (Erbitux), lapatinib (Tykerb), panitumumab (Vectibix), vandetanib (Caprelsa), afatinib/BIBW2992, CI-1033/canertinib, neratinib/HKI-272, CP-724714, TAK-285, AST-1306, ARRY334543, ARRY-380, AG-1478, dacomitinib/PF299804, OSI-420/desmethyl erlotinib, AZD8931, AEE788, pelitinib/EKB-569, CUDC-101, WZ8040, WZ4002, WZ3146, AG-490, XL647, PD153035, BMS-599626), sorafenib, imatinib, sunitinib, dasatinib, or the like.
[0132] Chemotherapeutic or chemotherapeutic agent is used in accordance with its plain ordinary meaning and refers to a chemical composition or compound having antineoplastic properties or the ability to inhibit the growth or proliferation of cells.
[0133] Cancer model organism, as used herein, is an organism exhibiting a phenotype indicative of cancer, or the activity of cancer causing elements, within the organism. The term cancer is defined above. A wide variety of organisms may serve as cancer model organisms, and include for example, cancer cells and mammalian organisms such as rodents (e.g. mouse or rat) and primates (such as humans). Cancer cell lines are widely understood by those skilled in the art as cells exhibiting phenotypes or genotypes similar to in vivo cancers. Cancer cell lines as used herein includes cell lines from animals (e.g. mice) and from humans.
I. COMPOSITIONS
[0134] Provided herein are compounds for treating cancer. The compound has formula (I):
##STR00002##
[0135] In the compound of formula (I), A is cycloalkyl, heterocycloalkyl, aryl, or heteroaryl. X is C(R.sup.4) or N. Y is a bond, N(R.sup.5), O, or S. L.sup.1 is a bond, C(O), C(O)O, O, S, N(R.sup.6), C(O)N(R.sup.6), S(O).sub.n6, S(O)N(R.sup.6), substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene. R.sup.1 is halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.1A, C(O)R.sup.1A, NR.sup.1AR.sup.1B, C(O)OR.sup.1A, C(O)NR.sup.1AR.sup.1B, NO.sub.2, SR.sup.1A, S(O).sub.n1R.sup.1A, S(O).sub.n1OR.sup.1A, S(O).sub.n1NR.sup.1AR.sup.1B, NHNR.sup.1AR.sup.1B, ONR.sup.1AR.sup.1B, NHC(O)NHNR.sup.1AR.sup.1B, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. R.sup.2 is halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.2A, C(O)R.sup.2A, NR.sup.2AR.sup.2B, C(O)OR.sup.2A, C(O)NR.sup.2AR.sup.2B, NO.sub.2, SR.sup.2A, S(O).sub.n2R.sup.2A, S(O).sub.n2OR.sup.2A, S(O).sub.n2NR.sup.2AR.sup.2B, NHNR.sup.2AR.sup.2B, ONR.sup.2AR.sup.2B, NHC(O)NHNR.sup.2AR.sup.2B, substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.3 is independently hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.4 is hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.4A, C(O)R.sup.4A, NR.sup.4AR.sup.4B, C(O)OR.sup.4A, C(O)NR.sup.4AR.sup.4B, NO.sub.2, SR.sup.4A, S(O).sub.n4R.sup.4A, S(O).sub.n4OR.sup.4A, S(O).sub.n4NR.sup.4AR.sup.4B, NHNR.sup.4AR.sup.4B, ONR.sup.4AR.sup.4B, NHC(O)NHNR.sup.4AR.sup.4B, substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.5 is hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.5A, C(O)R.sup.5A, NR.sup.5AR.sup.5B, C(O)OR.sup.5A, C(O)NR.sup.5AR.sup.5B, NO.sub.2, SR.sup.5A, S(O).sub.n5R.sup.5A, S(O).sub.n5OR.sup.5A, S(O).sub.n5NR.sup.5AR.sup.5B, NHNR.sup.5AR.sup.5B, ONR.sup.5AR.sup.5B, NHC(O)NHNR.sup.5AR.sup.5B, substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.6 is hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.6A, C(O)R.sup.6A, NR.sup.6AR.sup.6B, C(O)OR.sup.6A, C(O)NR.sup.6AR.sup.6B, NO.sub.2, SR.sup.6A, S(O).sub.n6R.sup.6A, S(O).sub.n6OR.sup.6A, S(O).sub.n6NR.sup.6AR.sup.6B, NHNR.sup.6AR.sup.6B, ONR.sup.6AR.sup.6B, NHC(O)NHNR.sup.6AR.sup.6B, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. R.sup.1A, R.sup.1B, R.sup.2A, R.sup.2B, R.sup.4A, R.sup.4B, R.sup.5A, R.sup.5B, R.sup.6A, and R.sup.6B are independently hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2Cl, S(O).sub.3H, S(O).sub.4H, S(O).sub.2NH.sub.2, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, NHC(O)NH.sub.2, NHS(O).sub.2H, NHC(O)H, NHC(O)OH, NHOH, OCF.sub.3, OCHF.sub.2, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. The symbols n1, n2, n4, n5, and n6 are independently 1, 2, or 3. The symbol m1 is 0, 1, 2, 3, or 4. The symbol m2 is 0, 1, 2, 3, 4, 5, or 6. The symbol m3 is 0, 1, or 2.
[0136] Ring A may be heterocycloalkyl, aryl, or heteroaryl. Ring A may be heterocycloalkyl or aryl. Ring A may be aryl or heteroaryl. Ring A may be heterocycloalkyl or heteroaryl.
[0137] Ring A may be cycloalkyl. Ring A may be a 3 to 10 membered cycloalkyl. Ring A may be 3 to 8 membered cycloalkyl. Ring A may be 3 to 6 membered cycloalkyl. Ring A may be cyclopropanyl. Ring A may be cyclopropenyl. Ring A may be cyclobutanyl. Ring A may be cyclobutenyl. Ring A may be cyclopentanyl. Ring A may be cyclopentenyl. Ring A may be cyclohexanyl. Ring A may be cyclohexenyl. Ring A may be cyclopentanyl, cyclopentenyl, cyclohexanyl, or cyclohexenyl.
[0138] Ring A may be heterocycloalkyl or heteroaryl. Ring A may be heterocycloalkyl. Ring A may be 3 to 10 membered heterocycloalkyl. Ring A may be 3 to 8 membered heterocycloalkyl. Ring A may be 3 to 6 membered heterocycloalkyl. Ring A may be 3 membered heterocycloalkyl. Ring A may be 4 membered heterocycloalkyl. Ring A may be aziridinyl, azirinyl, oxiranyl, oxirenyl, thiiranyl, thiirenyl, azetidinyl, azetyl, oxetanyl, oxetyl, thietanyl, or thietyl.
[0139] Ring A may be 5 membered heterocycloalkyl. Ring A may be 6 membered heterocycloalkyl. Ring A may be tetrahydrofuranyl, tetrahydropyranyl, tetrahydrothiopyranyl, pyranyl, thianyl, dioxanyl, piperidinyl, piperazinyl, oxathianyl, morpholinyl, trioxanyl, pyrrolinyl, pyrrolidinyl, pyrrolidonyl, pyrrolidionyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, isoxazolinyl, isoxazolidinyl, oxazolinyl, oxazolidinyl, oxazolidinonyl, or thiazolidinyl
[0140] Ring A may be aryl. Ring A may be 5 to 10 membered aryl. Ring A may be 5 or 6 membered aryl. Ring A may be 5 membered aryl. Ring A may be 6 membered aryl. Ring A may be phenylene. Ring A may be heteroaryl. Ring A may be 5 to 10 membered heteroaryl. Ring A may be 5 or 6 membered heteroaryl. Ring A may be 5 membered heteroaryl. Ring A may be 6 membered heteroaryl. Ring A may be pyrroyl, furanyl, thiophenyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, pyrazoyl, furyl, thienyl, triazolyl, tetrazolyl, pyridinyl, pyrimidinyl, pyrazinyl, or pyridazinyl.
[0141] Ring A may be a 5,6-, 6,5-, or 6,6-fused ring aryl or 5,6-, 6,5-, or 6,6-fused ring heteroaryl as described herein. Ring A may be a 5,6-fused ring aryl. Ring A may be a 5,6-fused ring heteroaryl. Ring A may be a 6,5-fused ring aryl. Ring A may be a 6,5-fused ring heteroaryl. Ring A may be 6,6-fused ring aryl. Ring A may be a 6,6-fused ring heteroaryl. Ring A may indenyl, indolyl, isoindolyl, indolizinyl, purinyl, benzothiazolyl, benzoxazoyl, benzoimidazoyl, benzofuranyl, isobenzofuranyl indazolyl, pyrrollopyridinyl, pyrrollopyrimidinyl, pyrazolopyridinyl, imidazopyridinyl, benzotriazolyl, benzothiophenyl, quinolyl, quinolinyl, isoquinolyl, naphthalenyl, cinnolinyl, phthalazinyl, isoquinolinyl, quinoxalinyl, or quinazolinyl.
[0142] The symbol m2 may be 0. The symbol m2 may be 1. The symbol m2 may be 1, 2, 3, 4, 5, or 6. The symbol m2 may be 1, 2, or 3. The symbols n1, n2, n4, n5, and n6 may independently be 1. The symbols n1, n2, n4, n5, and n6 may independently be 2. The symbols n1, n2, n4, n5, and n6 may independently be 3.
[0143] R.sup.1 may be halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.1A, C(O)R.sup.1A, NR.sup.1AR.sup.1B, C(O)OR.sup.1A, C(O)NR.sup.1AR.sup.1B, NO.sub.2, SR.sup.1A, S(O).sub.n1R.sup.1A, S(O).sub.n1OR.sup.1A, S(O).sub.n1NR.sup.1AR.sup.1B, NHNR.sup.1AR.sup.1B, ONR.sup.1AR.sup.1B, NHC(O)NHNR.sup.1AR.sup.1B. R.sup.1 may be halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.1A, C(O)R.sup.1A, NR.sup.1AR.sup.1B, C(O)OR.sup.1A, C(O)NR.sup.1AR.sup.1B, NO.sub.2, SR.sup.1A. R.sup.1 may be halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.1A, NH.sub.2, C(O)OH, C(O)NH.sub.2, NO.sub.2, or SH. R.sup.1 may be halogen, CF.sub.3, NO.sub.2, NH.sub.2, OR.sup.1A. R.sup.1 may be halogen. R.sup.1 may be F. R.sup.1 may be Cl. R.sup.1 may be Br. R.sup.1 may be I. R.sup.1 may be CF.sub.3. R.sup.1 may be NH.sub.2. R.sup.1 may be OR.sup.1A, where R.sup.1A is as defined herein. R.sup.1 may be OR.sup.1A where R.sup.1A is substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, or substituted or unsubstituted aryl. R.sup.1 may be OR.sup.1A where R.sup.1A is substituted or unsubstituted alkyl. R.sup.1 may be OR.sup.1A where R.sup.1A is unsubstituted alkyl. R.sup.1 may be OR.sup.1A where R.sup.1A is unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.1 may be OR.sup.1A where R.sup.1A is unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.1 may be OR.sup.1A where R.sup.1A is methyl (e.g. OCH.sub.3). R.sup.1 may be halogen, CF.sub.3, NO.sub.2, NH.sub.2, OR.sup.1A, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.
[0144] R.sup.1 may be substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.
[0145] R.sup.1 may be substituted or unsubstituted alkyl. R.sup.1 may be substituted alkyl. R.sup.1 may be unsubstituted alkyl. R.sup.1 may be substituted or unsubstituted C.sub.1-C.sub.20 alkyl. R.sup.1 may be substituted C.sub.1-C.sub.20 alkyl. R.sup.1 may be unsubstituted C.sub.1-C.sub.20 alkyl. R.sup.1 may be substituted or unsubstituted C.sub.1-C.sub.10 alkyl. R.sup.1 may be substituted C.sub.1-C.sub.10 alkyl. R.sup.1 may be unsubstituted C.sub.1-C.sub.10 alkyl. R.sup.1 may be substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.1 may be substituted C.sub.1-C.sub.5 alkyl. R.sup.1 may be unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.1 may be substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.1 may be substituted C.sub.1-C.sub.3 alkyl. R.sup.1 may be unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.1 may be methyl. R.sup.1 may be ethyl. R.sup.1 may be propyl.
[0146] R.sup.1 may be R.sup.10-substituted or unsubstituted alkyl. R.sup.1 may be R.sup.10-substituted alkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted C.sub.1-C.sub.20 alkyl. R.sup.1 may be substituted C.sub.1-C.sub.20 alkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted C.sub.1-C.sub.10 alkyl. R.sup.1 may be R.sup.10-substituted C.sub.1-C.sub.10 alkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.1 may be R.sup.10-substituted C.sub.1-C.sub.5 alkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.1 may be R.sup.10-substituted C.sub.1-C.sub.3 alkyl.
[0147] R.sup.1 may be substituted or unsubstituted 2 to 20 membered heteroalkyl. R.sup.1 may be substituted 2 to 20 membered heteroalkyl. R.sup.1 may be unsubstituted 2 to 20 membered heteroalkyl. R.sup.1 may be substituted or unsubstituted 2 to 10 membered heteroalkyl. R.sup.1 may be substituted 2 to 10 membered heteroalkyl. R.sup.1 may be unsubstituted 2 to 10 membered heteroalkyl. R.sup.1 may be substituted or unsubstituted 2 to 6 membered heteroalkyl. R.sup.1 may be substituted 2 to 6 membered heteroalkyl. R.sup.1 may be unsubstituted 2 to 6 membered heteroalkyl. R.sup.1 may be substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.1 may be substituted 2 to 5 membered heteroalkyl. R.sup.1 may be unsubstituted 2 to 5 membered heteroalkyl.
[0148] R.sup.1 may be R.sup.10-substituted or unsubstituted 2 to 20 membered heteroalkyl. R.sup.1 may be R.sup.10-substituted 2 to 20 membered heteroalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 2 to 10 membered heteroalkyl. R.sup.1 may be R.sup.10-substituted 2 to 10 membered heteroalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 2 to 6 membered heteroalkyl. R.sup.1 may be R.sup.10-substituted 2 to 6 membered heteroalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.1 may be R.sup.10-substituted 2 to 5 membered heteroalkyl.
[0149] R.sup.1 may be substituted or unsubstituted 3 to 10 membered cycloalkyl. R.sup.1 may be substituted 3 to 10 membered cycloalkyl. R.sup.1 may be unsubstituted 3 to 10 membered cycloalkyl. R.sup.1 may be substituted or unsubstituted 3 to 6 membered cycloalkyl. R.sup.1 may be substituted 3 to 6 membered cycloalkyl. R.sup.1 may be unsubstituted 3 to 6 membered cycloalkyl. R.sup.1 may be substituted or unsubstituted 3 to 5 membered cycloalkyl. R.sup.1 may be substituted 3 to 5 membered cycloalkyl. R.sup.1 may be unsubstituted 3 to 5 membered cycloalkyl. R.sup.1 may be substituted or unsubstituted 3 membered cycloalkyl. R.sup.1 may be substituted 3 membered cycloalkyl. R.sup.1 may be unsubstituted 3 membered cycloalkyl. R.sup.1 may be substituted or unsubstituted 4 membered cycloalkyl. R.sup.1 may be substituted 4 membered cycloalkyl. R.sup.1 may be unsubstituted 4 membered cycloalkyl. R.sup.1 may be substituted or unsubstituted 5 membered cycloalkyl. R.sup.1 may be substituted 5 membered cycloalkyl. R.sup.1 may be unsubstituted 5 membered cycloalkyl. R.sup.1 may be substituted or unsubstituted 6 membered cycloalkyl. R.sup.1 may be substituted 6 membered cycloalkyl. R.sup.1 may be unsubstituted 6 membered cycloalkyl.
[0150] R.sup.1 may be R.sup.10-substituted or unsubstituted 3 to 10 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted 3 to 10 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 3 to 6 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted 3 to 6 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 3 to 5 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted 3 to 5 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 3 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted 3 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 4 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted 4 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 5 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted 5 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 6 membered cycloalkyl. R.sup.1 may be R.sup.10-substituted 6 membered cycloalkyl.
[0151] R.sup.1 may be substituted or unsubstituted 3 to 10 membered heterocycloalkyl. R.sup.1 may be substituted 3 to 10 membered heterocycloalkyl. R.sup.1 may be unsubstituted 3 to 10 membered heterocycloalkyl. R.sup.1 may be substituted or unsubstituted 3 to 6 membered heterocycloalkyl. R.sup.1 may be substituted 3 to 6 membered heterocycloalkyl. R.sup.1 may be unsubstituted 3 to 6 membered heterocycloalkyl. R.sup.1 may be substituted or unsubstituted 3 to 5 membered heterocycloalkyl. R.sup.1 may be substituted 3 to 5 membered heterocycloalkyl. R.sup.1 may be unsubstituted 3 to 5 membered heterocycloalkyl. R.sup.1 may be substituted or unsubstituted 3 membered heterocycloalkyl. R.sup.1 may be substituted 3 membered heterocycloalkyl. R.sup.1 may be unsubstituted 3 membered heterocycloalkyl. R.sup.1 may be substituted or unsubstituted 4 membered heterocycloalkyl. R.sup.1 may be substituted 4 membered heterocycloalkyl. R.sup.1 may be unsubstituted 4 membered heterocycloalkyl. R.sup.1 may be substituted or unsubstituted 5 membered heterocycloalkyl. R.sup.1 may be substituted 5 membered heterocycloalkyl. R.sup.1 may be unsubstituted 5 membered heterocycloalkyl. R.sup.1 may be substituted or unsubstituted 6 membered heterocycloalkyl. R.sup.1 may be substituted 6 membered heterocycloalkyl. R.sup.1 may be unsubstituted 6 membered heterocycloalkyl.
[0152] R.sup.1 may be R.sup.10-substituted or unsubstituted 3 to 10 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted 3 to 10 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 3 to 6 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted 3 to 6 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 3 to 5 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted 3 to 5 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 3 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted 3 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 4 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted 4 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 5 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted 5 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted or unsubstituted 6 membered heterocycloalkyl. R.sup.1 may be R.sup.10-substituted 6 membered heterocycloalkyl.
[0153] R.sup.1 may be substituted or unsubstituted aryl. R.sup.1 may be substituted aryl. R.sup.1 may be unsubstituted aryl. R.sup.1 may be substituted or unsubstituted 5 to 10 membered aryl. R.sup.1 may be substituted 5 to 10 membered aryl. R.sup.1 may be unsubstituted 5 to 10 membered aryl. R.sup.1 may be substituted or unsubstituted 5 or 6 membered aryl. R.sup.1 may be substituted 5 or 6 membered aryl. R.sup.1 may be unsubstituted 5 or 6 membered aryl. R.sup.1 may be substituted or unsubstituted 5 membered aryl. R.sup.1 may be substituted 5 membered aryl. R.sup.1 may be unsubstituted 5 membered aryl. R.sup.1 may be substituted or unsubstituted 6 membered aryl. R.sup.1 may be substituted 6 membered aryl. R.sup.1 may be unsubstituted 6 membered aryl.
[0154] R.sup.1 may be R.sup.10-substituted or unsubstituted aryl. R.sup.1 may be R.sup.10-substituted aryl. R.sup.1 may be R.sup.10-substituted or unsubstituted 5 to 10 membered aryl. R.sup.1 may be R.sup.10-substituted 5 to 10 membered aryl. R.sup.1 may be R.sup.10-substituted or unsubstituted 5 or 6 membered aryl. R.sup.1 may be R.sup.10-substituted 5 or 6 membered aryl. R.sup.1 may be R.sup.10-substituted or unsubstituted 5 membered aryl. R.sup.1 may be R.sup.10-substituted 5 membered aryl. R.sup.1 may be R.sup.10-substituted or unsubstituted 6 membered aryl. R.sup.1 may be R.sup.10-substituted 6 membered aryl.
[0155] R.sup.1 may be substituted or unsubstituted heteroaryl. R.sup.1 may be substituted heteroaryl. R.sup.1 may be unsubstituted heteroaryl. R.sup.1 may be substituted or unsubstituted 5 to 10 membered heteroaryl. R.sup.1 may be substituted 5 to 10 membered heteroaryl. R.sup.1 may be unsubstituted 5 to 10 membered heteroaryl. R.sup.1 may be substituted or unsubstituted 5 or 6 membered heteroaryl. R.sup.1 may be substituted 5 or 6 membered heteroaryl. R.sup.1 may be unsubstituted 5 or 6 membered heteroaryl. R.sup.1 may be substituted or unsubstituted 5 membered heteroaryl. R.sup.1 may be substituted 5 membered heteroaryl. R.sup.1 may be unsubstituted 5 membered heteroaryl. R.sup.1 may be substituted or unsubstituted 6 membered heteroaryl. R.sup.1 may be substituted 6 membered heteroaryl. R.sup.1 may be unsubstituted 6 membered heteroaryl.
[0156] R.sup.1 may be R.sup.10-substituted or unsubstituted heteroaryl. R.sup.1 may be R.sup.10-substituted heteroaryl. R.sup.1 may be R.sup.10-substituted or unsubstituted 5 to 10 membered heteroaryl. R.sup.1 may be R.sup.10-substituted 5 to 10 membered heteroaryl. R.sup.1 may be R.sup.10-substituted or unsubstituted 5 or 6 membered heteroaryl. R.sup.1 may be R.sup.10-substituted 5 or 6 membered heteroaryl. R.sup.1 may be R.sup.10-substituted or unsubstituted 5 membered heteroaryl. R.sup.1 may be R.sup.10-substituted 5 membered heteroaryl. R.sup.1 may be R.sup.10-substituted or unsubstituted 6 membered heteroaryl. R.sup.1 may be R.sup.10-substituted 6 membered heteroaryl.
[0157] R.sup.10 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.11-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.11-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.11-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.11-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.11-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.11-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl. R.sup.10 may be hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl. R.sup.10 may be hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0158] R.sup.11 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.12-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.12-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.12-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.12-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.12-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.12-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0159] R.sup.12 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.13-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.13-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.13-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.13-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.13-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.13-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0160] R.sup.13 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0161] The symbol m1 may be 0, 1, 2, or 3. The symbol m1 may be 0. The symbol m1 may be 1. The symbol m may be 2. The symbol m may be 3. The symbol m may be 1, 2, or 3. When R.sup.1 is halogen, the symbol m1 may be 1. When R.sup.1 is CF.sub.3 the symbol m1 may be 1, 2, or 3. R.sup.1 may independently be halogen or CF.sub.3 and the symbol m1 is 2 or 3. When R.sup.1 is OR.sup.1A, the symbol m1 may be 1, 2, or 3. When R.sup.1 is OCH.sub.3 the symbol m1 may be 1, 2, or 3. When R.sup.1 is OCH.sub.3 the symbol m1 may be 1. When R.sup.1 is OCH.sub.3 the symbol m1 may be 2. When R.sup.1 is OCH.sub.3 the symbol m1 may be 3.
[0162] R.sup.1A and R.sup.1B may independently be hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.3H, ONH.sub.2, NHC(O)NHNH.sub.2, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. R.sup.1A and R.sup.1B may independently be hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.3H, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.10-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.10-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.10-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.10-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.10-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.10-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0163] R.sup.1A and R.sup.1B may independently be hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.3H, or ONH.sub.2. R.sup.1A and R.sup.1B may independently be substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. R.sup.1A and R.sup.1B may independently be R.sup.1C-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.1C-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.1C-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.1C-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.1C-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.1C-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0164] R.sup.1C is hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2Cl, S(O).sub.3H, S(O).sub.4H, S(O).sub.2NH.sub.2, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, NHC(O)NH.sub.2, NHS(O).sub.2H, NHC(O)H, NHC(O)OH, NHOH, OCF.sub.3, OCHF.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0165] R.sup.2 may be halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.2A, C(O)R.sup.2A, NR.sup.2AR.sup.2B, C(O)OR.sup.2A, C(O)NR.sup.2AR.sup.2B, NO.sub.2, SR.sup.2A, S(O).sub.n2R.sup.2A, S(O).sub.n2OR.sup.2A, S(O).sub.n2NR.sup.2AR.sup.2B, NHNR.sup.2AR.sup.2B, ONR.sup.2AR.sup.2B, or NHC(O)NHNR.sup.2AR.sup.2B. R.sup.2 may be halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.2A, NR.sup.2AR.sup.2B, NO.sub.2, or SR.sup.2A. R.sup.2 may be halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.2A, C(O)R.sup.2A, NR.sup.2AR.sup.2B, C(O)OH, NO.sub.2, or SH. R.sup.2 may be halogen, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, OR.sup.2, NH.sub.2, N(CH.sub.3).sub.2NO.sub.2. R.sup.2 may be halogen, CF.sub.3, OR.sup.2A, or NO.sub.2. R.sup.2 may be halogen. R.sup.2 may be CF.sub.3. R.sup.2 may be OR.sup.2A. R.sup.2 may be NO.sub.2. R.sup.2 may be OR.sup.2A, where R.sup.2A is substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, or substituted or unsubstituted aryl. R.sup.2 may be OR.sup.2A, where R.sup.2A is substituted or unsubstituted alkyl. R.sup.2 may be OR.sup.2A, where R.sup.2A is substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.2 may be OR.sup.2A, where R.sup.2A is substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.2 may be OR.sup.2A, where R.sup.2A is methyl. R.sup.2 may be halogen, CF.sub.3, OR.sup.2A, NO.sub.2, substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl.
[0166] R.sup.2 may be substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.2 may be substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.2 may be substituted C.sub.1-C.sub.5 alkyl. R.sup.2 may be unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.2 may be substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.2 may be substituted C.sub.1-C.sub.3 alkyl. R.sup.2 may be unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.2 may be methyl. R.sup.2 may be ethyl. R.sup.2 may be propyl.
[0167] R.sup.2 may be R.sup.20-substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.2 may be R.sup.20-substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.2 may be R.sup.20-substituted C.sub.1-C.sub.5 alkyl. R.sup.2 may be R.sup.20-substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.2 may be R.sup.20-substituted C.sub.1-C.sub.3 alkyl.
[0168] R.sup.2 may be substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.2 may be substituted 2 to 5 membered heteroalkyl. R.sup.2 may be unsubstituted 2 to 5 membered heteroalkyl. R.sup.2 may be R.sup.20-substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.2 may be R.sup.20-substituted 2 to 5 membered heteroalkyl.
[0169] R.sup.20 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0170] R.sup.2A and R.sup.2B may independently be hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.3H, ONH.sub.2, NHC(O)NHNH.sub.2, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. R.sup.2A and R.sup.2B may independently be hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.3H, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.20-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.20-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.20-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.20-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.20-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.20-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0171] R.sup.2A and R.sup.2B may independently be hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.3H, or ONH.sub.2. R.sup.2A and R.sup.2B may independently be substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. R.sup.2A and R.sup.2B may independently be R.sup.2C-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.2C-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.2C-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.2C-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.2C-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.2C-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0172] R.sup.2C is hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2Cl, S(O).sub.3H, S(O).sub.4H, S(O).sub.2NH.sub.2, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, NHC(O)NH.sub.2, NHS(O).sub.2H, NHC(O)H, NHC(O)OH, NHOH, OCF.sub.3, OCHF.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0173] R.sup.3 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, or NHC(O)NHNH.sub.2. R.sup.3 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, or ONH.sub.2. R.sup.3 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, or SH. R.sup.3 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, or NO.sub.2. R.sup.3 may be hydrogen, halogen, or OR.sup.3A. R.sup.3 may be hydrogen, halogen, CF.sub.3, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, or NO.sub.2. R.sup.3 may be halogen. R.sup.3 may be hydrogen. R.sup.3 may be CF.sub.3. R.sup.3 may be OCH.sub.3. R.sup.3 may be OCH.sub.2CH.sub.3. R.sup.3 may be NH.sub.2. R.sup.3 may be NO.sub.2.
[0174] R.sup.3 may be substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.3 may be substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.3 may be substituted C.sub.1-C.sub.5 alkyl. R.sup.3 may be unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.3 may be substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.3 may be substituted C.sub.1-C.sub.3 alkyl. R.sup.3 may be unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.3 may be methyl. R.sup.3 may be ethyl. R.sup.3 may be propyl.
[0175] R.sup.3 may be R.sup.30-substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.3 may be R.sup.30-substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.3 may be R.sup.30-substituted C.sub.1-C.sub.5 alkyl. R.sup.3 may be R.sup.30-substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.3 may be R.sup.30-substituted C.sub.1-C.sub.3 alkyl.
[0176] R.sup.3 may be substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.3 may be substituted 2 to 5 membered heteroalkyl. R.sup.3 may be unsubstituted 2 to 5 membered heteroalkyl. R.sup.3 may be R.sup.30-substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.3 may be R.sup.30-substituted 2 to 5 membered heteroalkyl.
[0177] R.sup.30 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0178] The symbol m3 may be 1. The symbol m3 may be 2. When R.sup.3 is halogen, the symbol m3 may be 1. When R.sup.3 is CF.sub.3, the symbol m3 may be 1. When R.sup.3 is OCH.sub.3 or OCH.sub.2CH.sub.3, the symbol m3 may be 1. When R.sup.3 is OCH.sub.3 or OCH.sub.2CH.sub.3, the symbol m3 may be 2. R.sup.3 may independently be halogen and OCH.sub.3 and the symbol m3 is 2.
[0179] X may be C(R.sup.4). X may be N.
[0180] When X is C(R.sup.4), R.sup.4 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.4A, C(O)R.sup.4A, NR.sup.4AR.sup.4B, C(O)OR.sup.4A, C(O)NR.sup.4AR.sup.4B, NO.sub.2, SR.sup.4A, S(O).sub.4R.sup.4A, S(O).sub.4OR.sup.4A, S(O).sub.n4NR.sup.4AR.sup.4B, NHNR.sup.4AR.sup.4B, ONR.sup.4AR.sup.4B, or NHC(O)NHNR.sup.4AR.sup.4B. R.sup.4 may be hydrogen, halogen, OR.sup.4A, or C(O)R.sup.4A. R.sup.4 may be hydrogen or halogen. R.sup.4 may be hydrogen. R.sup.4 may be halogen.
[0181] R.sup.4 may be substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.4 may be substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.4 may be substituted C.sub.1-C.sub.5 alkyl. R.sup.4 may be unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.4 may be substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.4 may be substituted C.sub.1-C.sub.3 alkyl. R.sup.4 may be unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.4 may be methyl. R.sup.4 may be ethyl. R.sup.4 may be propyl.
[0182] R.sup.4 may be R.sup.40-substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.4 may be R.sup.40-substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.4 may be R.sup.40-substituted C.sub.1-C.sub.5 alkyl. R.sup.4 may be R.sup.40-substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.4 may be R.sup.40-substituted C.sub.1-C.sub.3 alkyl.
[0183] R.sup.4 may be substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.4 may be substituted 2 to 5 membered heteroalkyl. R.sup.4 may be unsubstituted 2 to 5 membered heteroalkyl. R.sup.4 may be R.sup.40-substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.4 may be R.sup.40-substituted 2 to 5 membered heteroalkyl.
[0184] R.sup.40 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl. R.sup.4A and R.sup.4B may independently be hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.3H, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.40-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.40-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.40-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.40-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.40-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.40-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0185] R.sup.4A and R.sup.4B may independently be hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.3H, or ONH.sub.2. R.sup.4A and R.sup.4B may independently be substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. R.sup.4A and R.sup.4B may independently be R.sup.4C-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.4C-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.4C-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.4C-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.4C-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.4C-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0186] R.sup.4C is hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2Cl, S(O).sub.3H, S(O).sub.4H, S(O).sub.2NH.sub.2, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, NHC(O)NH.sub.2, NHS(O).sub.2H, NHC(O)H, NHC(O)OH, NHOH, OCF.sub.3, OCHF.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0187] Y may be a bond or N(R.sup.5). Y may be a bond or O. Y may be a bond or S. Y may be a bond, N(R.sup.5), or S. Y may be a bond. Y may be O. Y may be S. Y may be N(R.sup.5).
[0188] When Y is N(R.sup.5), R.sup.5 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.5A, C(O)R.sup.5A, NR.sup.5AR.sup.5B, C(O)OR.sup.5A, C(O)NR.sup.5AR.sup.5B, NO.sub.2, SR.sup.5A, S(O).sub.n5R.sup.5A, S(O).sub.n5OR.sup.5A, S(O).sub.n5NR.sup.5AR.sup.5B, NHNR.sup.5AR.sup.5B, ONR.sup.5AR.sup.5B, or NHC(O)NHNR.sup.5AR.sup.5B. R.sup.5 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.5A, NR.sup.5AR.sup.5B, C(O)OR.sup.5A, C(O)NR.sup.5AR.sup.5B, NO.sub.2, or SR.sup.5A. R.sup.5 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.5A, NR.sup.5AR.sup.5B, C(O)OR.sup.5A, NO.sub.2, or SR.sup.5A. R.sup.5 may be hydrogen, halogen, CF.sub.3, CN, OR.sup.5A, NR.sup.5AR.sup.5B, NO.sub.2, or SR.sup.5A. R.sup.5 may be hydrogen, halogen, CF.sub.3, CN, OR.sup.5A, NH.sub.2, NO.sub.2, or SH. R.sup.5 may be hydrogen. R.sup.5 may be halogen. R.sup.5 may be CF.sub.3. R.sup.5 may be CN. R.sup.5 may be OR.sup.5A. R.sup.5 may be NR.sup.5AR.sup.5B. R.sup.5 may be, NO.sub.2. R.sup.5 may be SR.sup.5A.
[0189] R.sup.5 may be substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.5 may be substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.5 may be substituted C.sub.1-C.sub.5 alkyl. R.sup.5 may be unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.5 may be substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.5 may be substituted C.sub.1-C.sub.3 alkyl. R.sup.5 may be unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.5 may be methyl. R.sup.5 may be ethyl. R.sup.5 may be propyl.
[0190] R.sup.5 may be R.sup.50-substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.5 may be R.sup.50-substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.5 may be R.sup.50-substituted C.sub.1-C.sub.5 alkyl. R.sup.5 may be R.sup.50-substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.5 may be R.sup.50-substituted C.sub.1-C.sub.3 alkyl.
[0191] R.sup.5 may be substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.5 may be substituted 2 to 5 membered heteroalkyl. R.sup.5 may be unsubstituted 2 to 5 membered heteroalkyl. R.sup.5 may be R.sup.50-substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.5 may be R.sup.50-substituted 2 to 5 membered heteroalkyl.
[0192] R.sup.50 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0193] R.sup.5A and R.sup.5B may independently be hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.3H, or ONH.sub.2. R.sup.5A and R.sup.5B may independently be substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. R.sup.5A and R.sup.5B may independently be hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.3H, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.50-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.50-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.50-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.50-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.50-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.50-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0194] R.sup.5A and R.sup.5B may independently be R.sup.5C-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.5C-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.5C-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.5C-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.5C-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.5C-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0195] R.sup.5C is hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2Cl, S(O).sub.3H, S(O).sub.4H, S(O).sub.2NH.sub.2, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, NHC(O)NH.sub.2, NHS(O).sub.2H, NHC(O)H, NHC(O)OH, NHOH, OCF.sub.3, OCHF.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0196] L.sup.1 may be a bond, C(O), O, S, N(R.sup.6), C(O)N(R.sup.6), S(O).sub.n6, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene. L.sup.1 may be a bond, C(O), O, S, NH, C(O)NH, S(O).sub.2, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene. L.sup.1 may be a bond, C(O), O, NH, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene.
[0197] L.sup.1 may be a bond, C(O), O, S, N(R.sup.6), C(O)N(R.sup.6), or S(O).sub.n6. L.sup.1 may be a bond, C(O), O, S, NH, C(O)NH, -or S(O).sub.2. L.sup.1 may be a bond. L.sup.1 may be C(O). L.sup.1 may be O. L.sup.1 may be S. L.sup.1 may N(R.sup.6). L.sup.1 may be C(O)N(R.sup.6). L.sup.1 may be S(O).sub.n6.
[0198] L.sup.1 may be substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene.
[0199] L.sup.1 may be substituted or unsubstituted alkylene. L.sup.1 may be substituted alkylene. L.sup.1 may be unsubstituted alkylene. L.sup.1 may be substituted or unsubstituted C.sub.1-C.sub.20 alkylene. L.sup.1 may be substituted C.sub.1-C.sub.20 alkylene. L.sup.1 may be substituted or unsubstituted C.sub.1-C.sub.10 alkylene. L.sup.1 may be substituted C.sub.1-C.sub.10 alkylene. L.sup.1 may be unsubstituted C.sub.1-C.sub.10 alkylene. L.sup.1 may be substituted or unsubstituted C.sub.1-C.sub.5 alkylene. L.sup.1 may be substituted C.sub.1-C.sub.5 alkylene. L.sup.1 may be unsubstituted C.sub.1-C.sub.5 alkylene.
[0200] L.sup.1 may be R.sup.14-substituted or unsubstituted alkylene. L.sup.1 may be R.sup.14-substituted alkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted C.sub.1-C.sub.20 alkylene. L.sup.1 may be R.sup.14-substituted C.sub.1-C.sub.20 alkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted C.sub.1-C.sub.10 alkylene. L.sup.1 may be R.sup.14-substituted C.sub.1-C.sub.10 alkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted C.sub.1-C.sub.5 alkylene. L.sup.1 may be R.sup.14-substituted C.sub.1-C.sub.5 alkylene.
[0201] L.sup.1 may be substituted or unsubstituted heteroalkylene. L.sup.1 may be substituted heteroalkylene. L.sup.1 may be unsubstituted heteroalkylene. L.sup.1 may be substituted or unsubstituted 2 to 20 membered heteroalkylene. L.sup.1 may be substituted 2 to 20 membered heteroalkylene. L.sup.1 may be unsubstituted 2 to 20 membered heteroalkylene. L.sup.1 may be substituted or unsubstituted 2 to 10 membered heteroalkylene. L.sup.1 may be substituted 2 to 10 membered heteroalkylene. L.sup.1 may be unsubstituted 2 to 10 membered heteroalkylene. L.sup.1 may be substituted or unsubstituted 2 to 5 membered heteroalkylene. L.sup.1 may be substituted 2 to 5 membered heteroalkylene. L.sup.1 may be unsubstituted 2 to 5 membered heteroalkylene.
[0202] L.sup.1 may be R.sup.14-substituted or unsubstituted heteroalkylene. L.sup.1 may be R.sup.14-substituted heteroalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 2 to 20 membered heteroalkylene. L may be R.sup.14-substituted 2 to 20 membered heteroalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 2 to 10 membered heteroalkylene. L.sup.1 may be R.sup.14-substituted 2 to 10 membered heteroalkylene. L may be R.sup.14-substituted or unsubstituted 2 to 5 membered heteroalkylene. L.sup.1 may be R.sup.14-substituted 2 to 5 membered heteroalkylene.
[0203] L.sup.1 may be substituted or unsubstituted cycloalkylene. L.sup.1 may be substituted cycloalkylene. L.sup.1 may be unsubstituted cycloalkylene. L.sup.1 may be substituted or unsubstituted 3 to 10 membered cycloalkylene. L.sup.1 may be substituted 3 to 10 membered cycloalkylene. L.sup.1 may be unsubstituted 3 to 10 membered cycloalkylene. L.sup.1 may be substituted or unsubstituted 3 to 6 membered cycloalkylene. L.sup.1 may be substituted 3 to 6 membered cycloalkylene. L.sup.1 may be unsubstituted 3 to 6 membered cycloalkylene. L.sup.1 may be substituted or unsubstituted 3 membered cycloalkylene. L.sup.1 may be substituted or unsubstituted 4 membered cycloalkylene. L.sup.1 may be substituted or unsubstituted 5 membered cycloalkylene. L.sup.1 may be substituted or unsubstituted 6 membered cycloalkylene.
[0204] L.sup.1 may be R.sup.14-substituted or unsubstituted cycloalkylene. L.sup.1 may be R.sup.14-substituted cycloalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 3 to 10 membered cycloalkylene. L.sup.1 may be R.sup.14-substituted 3 to 10 membered cycloalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 3 to 6 membered cycloalkylene. L.sup.1 may be R.sup.14-substituted 3 to 6 membered cycloalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 3 membered cycloalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 4 membered cycloalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 5 membered cycloalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 6 membered cycloalkylene.
[0205] L.sup.1 may be substituted or unsubstituted heterocycloalkylene. L.sup.1 may be substituted heterocycloalkylene. L.sup.1 may be unsubstituted heterocycloalkylene. L.sup.1 may be substituted or unsubstituted 3 to 10 membered heterocycloalkylene. L.sup.1 may be substituted 3 to 10 membered heterocycloalkylene. L.sup.1 may be unsubstituted 3 to 10 membered heterocycloalkylene. L.sup.1 may be substituted or unsubstituted 3 to 6 membered heterocycloalkylene. L.sup.1 may be substituted 3 to 6 membered heterocycloalkylene. L.sup.1 may be unsubstituted 3 to 6 membered heterocycloalkylene. L may be substituted or unsubstituted 3 membered heterocycloalkylene. L.sup.1 may be substituted or unsubstituted 4 membered heterocycloalkylene. L.sup.1 may be substituted or unsubstituted 5 membered heterocycloalkylene. L.sup.1 may be substituted or unsubstituted 6 membered heterocycloalkylene.
[0206] L.sup.1 may be R.sup.14-substituted or unsubstituted heterocycloalkylene. L.sup.1 may be R.sup.14-substituted heterocycloalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 3 to 10 membered heterocycloalkylene. L.sup.1 may be R.sup.14-substituted 3 to 10 membered heterocycloalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 3 to 6 membered heterocycloalkylene. L.sup.1 may be R.sup.14-substituted 3 to 6 membered heterocycloalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 3 membered heterocycloalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 4 membered heterocycloalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 5 membered heterocycloalkylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 6 membered heterocycloalkylene.
[0207] L.sup.1 may be substituted or unsubstituted arylene. L.sup.1 may be substituted arylene. L.sup.1 may be unsubstituted arylene. L.sup.1 may be substituted or unsubstituted 5 to 10 membered arylene. L.sup.1 may be substituted 5 to 10 membered arylene. L.sup.1 may be unsubstituted 5 to 10 membered arylene. L.sup.1 may be substituted or unsubstituted 5 membered arylene. L.sup.1 may be substituted 5 membered arylene. L.sup.1 may be unsubstituted 5 membered arylene. L.sup.1 may be substituted or unsubstituted 6 membered arylene. L.sup.1 may be substituted 6 membered arylene. L.sup.1 may be unsubstituted 6 membered arylene (e.g. phenylene).
[0208] L.sup.1 may be R.sup.14-substituted or unsubstituted arylene. L.sup.1 may be R.sup.14-substituted arylene. L may be R.sup.14-substituted or unsubstituted 5 to 10 membered arylene. L.sup.1 may be R.sup.14-substituted 5 to 10 membered arylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 5 membered arylene. L.sup.1 may be R.sup.14-substituted 5 membered arylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 6 membered arylene. L.sup.1 may be R.sup.14-substituted 6 membered arylene.
[0209] L.sup.1 may be substituted or unsubstituted heteroarylene. L.sup.1 may be substituted heteroarylene. L.sup.1 may be unsubstituted heteroarylene. L.sup.1 may be substituted or unsubstituted 5 to 10 membered heteroarylene. L.sup.1 may be substituted 5 to 10 membered heteroarylene. L.sup.1 may be unsubstituted 5 to 10 membered heteroarylene. L.sup.1 may be substituted or unsubstituted 5 membered heteroarylene. L.sup.1 may be substituted 5 membered heteroarylene. L.sup.1 may be unsubstituted 5 membered heteroarylene. L.sup.1 may be substituted or unsubstituted 6 membered heteroarylene. L.sup.1 may be substituted 6 membered heteroarylene. L.sup.1 may be unsubstituted 6 membered heteroarylene.
[0210] L.sup.1 may be R.sup.14-substituted or unsubstituted heteroarylene. L.sup.1 may be R.sup.14-substituted heteroarylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 5 to 10 membered heteroarylene. L.sup.1 may be R.sup.14-substituted 5 to 10 membered heteroarylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 5 membered heteroarylene. L.sup.1 may be R.sup.14-substituted 5 membered heteroarylene. L.sup.1 may be R.sup.14-substituted or unsubstituted 6 membered heteroarylene. L.sup.1 may be R.sup.14-substituted 6 membered heteroarylene.
[0211] R.sup.14 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.15-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.15-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.15-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.15-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.15-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.15-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl. R.sup.14 may be hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl. R.sup.14 may be hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0212] R.sup.15 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.16-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.16-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.16-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.16-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.16-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.16-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0213] R.sup.16 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.17-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.17-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.17-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.17-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.17-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.17-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0214] R.sup.17 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0215] When L.sup.1 is N(R.sup.6), C(O)N(R.sup.6), or S(O)N(R.sup.6), R.sup.6 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.6A, C(O)R.sup.6A, NR.sup.6AR.sup.6B, C(O)OR.sup.6A, C(O)NR.sup.6AR.sup.6B, NO.sub.2, SR.sup.6A, S(O).sub.n6R.sup.6A, S(O).sub.n6OR.sup.6A, S(O).sub.n6NR.sup.6AR.sup.6B, NHNR.sup.6AR.sup.6B, ONR.sup.6AR.sup.6B, or NHC(O)NHNR.sup.6AR.sup.6B. R.sup.6 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.6A, C(O)R.sup.6A, NR.sup.6AR.sup.6B, C(O)OR.sup.6A, C(O)NR.sup.6AR.sup.6B, NO.sub.2, SR.sup.6A, or S(O).sub.n6R.sup.6A. R.sup.6 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.6A, NR.sup.6AR.sup.6B, C(O)OR.sup.6A, C(O)NR.sup.6AR.sup.6B, NO.sub.2, or SR.sup.6A. R.sup.6 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.6A, NR.sup.6AR.sup.6B, C(O)OR.sup.6A, NO.sub.2, or SR.sup.6A. R.sup.6 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.6A, NR.sup.6AR.sup.6B, or NO.sub.2. R.sup.6 may be hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.6A, or NH.sub.2. R.sup.6 may be hydrogen. R.sup.6 may be halogen. R.sup.6 may be N.sub.3. R.sup.6 may be CF.sub.3. R.sup.6 may be CN. R.sup.6 may be OR.sup.6A. R.sup.6 may be NH.sub.2. R.sup.6 may be NO.sub.2.
[0216] R.sup.6 may be substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.
[0217] R.sup.6 may be substituted or unsubstituted alkyl. R.sup.6 may be substituted alkyl. R.sup.6 may be unsubstituted alkyl. R.sup.6 may be substituted or unsubstituted C.sub.1-C.sub.20 alkyl. R.sup.6 may be substituted C.sub.1-C.sub.20 alkyl. R.sup.6 may be unsubstituted C.sub.1-C.sub.20 alkyl. R.sup.6 may be substituted or unsubstituted C.sub.1-C.sub.10 alkyl. R.sup.6 may be substituted C.sub.1-C.sub.10 alkyl. R.sup.6 may be unsubstituted C.sub.1-C.sub.10 alkyl. R.sup.6 may be substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.6 may be substituted C.sub.1-C.sub.5 alkyl. R.sup.6 may be unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.6 may be substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.6 may be substituted C.sub.1-C.sub.3 alkyl. R.sup.6 may be unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.6 may be methyl. R.sup.6 may be ethyl. R.sup.6 may be propyl.
[0218] R.sup.6 may be R.sup.60-substituted or unsubstituted alkyl. R.sup.6 may be R.sup.60-substituted alkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted C.sub.1-C.sub.20 alkyl. R.sup.6 may be R.sup.60-substituted C.sub.1-C.sub.20 alkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted C.sub.1-C.sub.10 alkyl. R.sup.6 may be R.sup.60-substituted C.sub.1-C.sub.10 alkyl R.sup.6 may be R.sup.60-substituted or unsubstituted C.sub.1-C.sub.5 alkyl. R.sup.6 may be R.sup.60-substituted C.sub.1-C.sub.5 alkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted C.sub.1-C.sub.3 alkyl. R.sup.6 may be R.sup.60-substituted C.sub.1-C.sub.3 alkyl.
[0219] R.sup.6 may be substituted or unsubstituted 2 to 20 membered heteroalkyl. R.sup.6 may be substituted 2 to 20 membered heteroalkyl. R.sup.6 may be unsubstituted 2 to 20 membered heteroalkyl. R.sup.6 may be substituted or unsubstituted 2 to 10 membered heteroalkyl. R.sup.6 may be substituted 2 to 10 membered heteroalkyl. R.sup.6 may be unsubstituted 2 to 10 membered heteroalkyl. R.sup.6 may be substituted or unsubstituted 2 to 6 membered heteroalkyl. R.sup.6 may be substituted 2 to 6 membered heteroalkyl. R.sup.6 may be unsubstituted 2 to 6 membered heteroalkyl. R.sup.6 may be substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.6 may be substituted 2 to 5 membered heteroalkyl. R.sup.6 may be unsubstituted 2 to 5 membered heteroalkyl.
[0220] R.sup.6 may be R.sup.60-substituted or unsubstituted 2 to 20 membered heteroalkyl. R.sup.6 may be R.sup.60-substituted 2 to 20 membered heteroalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 2 to 10 membered heteroalkyl. R.sup.6 may be R.sup.60-substituted 2 to 10 membered heteroalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 2 to 6 membered heteroalkyl. R.sup.6 may be R.sup.60-substituted 2 to 6 membered heteroalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.6 may be R.sup.60-substituted 2 to 5 membered heteroalkyl.
[0221] R.sup.6 may be substituted or unsubstituted 3 to 10 membered cycloalkyl. R.sup.6 may be substituted 3 to 10 membered cycloalkyl. R.sup.6 may be unsubstituted 3 to 10 membered cycloalkyl. R.sup.6 may be substituted or unsubstituted 3 to 6 membered cycloalkyl. R.sup.6 may be substituted 3 to 6 membered cycloalkyl. R.sup.6 may be unsubstituted 3 to 6 membered cycloalkyl. R.sup.6 may be substituted or unsubstituted 3 to 5 membered cycloalkyl. R.sup.6 may be substituted 3 to 5 membered cycloalkyl. R.sup.6 may be unsubstituted 3 to 5 membered cycloalkyl. R.sup.6 may be substituted or unsubstituted 3 membered cycloalkyl. R.sup.6 may be substituted 3 membered cycloalkyl. R.sup.6 may be unsubstituted 3 membered cycloalkyl. R.sup.6 may be substituted or unsubstituted 4 membered cycloalkyl. R.sup.6 may be substituted 4 membered cycloalkyl. R.sup.6 may be unsubstituted 4 membered cycloalkyl. R.sup.6 may be substituted or unsubstituted 5 membered cycloalkyl. R.sup.6 may be substituted 5 membered cycloalkyl. R.sup.6 may be unsubstituted 5 membered cycloalkyl. R.sup.6 may be substituted or unsubstituted 6 membered cycloalkyl. R.sup.6 may be substituted 6 membered cycloalkyl. R.sup.6 may be unsubstituted 6 membered cycloalkyl.
[0222] R.sup.6 may be R.sup.60-substituted or unsubstituted 3 to 10 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted 3 to 10 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 3 to 6 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted 3 to 6 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 3 to 5 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted 3 to 5 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 3 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted 3 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 4 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted 4 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 5 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted 5 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 6 membered cycloalkyl. R.sup.6 may be R.sup.60-substituted 6 membered cycloalkyl.
[0223] R.sup.6 may be substituted or unsubstituted 3 to 10 membered heterocycloalkyl. R.sup.6 may be substituted 3 to 10 membered heterocycloalkyl. R.sup.6 may be unsubstituted 3 to 10 membered heterocycloalkyl. R.sup.6 may be substituted or unsubstituted 3 to 6 membered heterocycloalkyl. R.sup.6 may be substituted 3 to 6 membered heterocycloalkyl. R.sup.6 may be unsubstituted 3 to 6 membered heterocycloalkyl. R.sup.6 may be substituted or unsubstituted 3 to 5 membered heterocycloalkyl. R.sup.6 may be substituted 3 to 5 membered heterocycloalkyl. R.sup.6 may be unsubstituted 3 to 5 membered heterocycloalkyl. R.sup.6 may be substituted or unsubstituted 3 membered heterocycloalkyl. R.sup.6 may be substituted 3 membered heterocycloalkyl. R.sup.6 may be unsubstituted 3 membered heterocycloalkyl. R.sup.6 may be substituted or unsubstituted 4 membered heterocycloalkyl. R.sup.6 may be substituted 4 membered heterocycloalkyl. R.sup.6 may be unsubstituted 4 membered heterocycloalkyl. R.sup.6 may be substituted or unsubstituted 5 membered heterocycloalkyl. R.sup.6 may be substituted 5 membered heterocycloalkyl. R.sup.6 may be unsubstituted 5 membered heterocycloalkyl. R.sup.6 may be substituted or unsubstituted 6 membered heterocycloalkyl. R.sup.6 may be substituted 6 membered heterocycloalkyl. R.sup.6 may be unsubstituted 6 membered heterocycloalkyl.
[0224] R.sup.6 may be R.sup.60-substituted or unsubstituted 3 to 10 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted 3 to 10 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 3 to 6 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted 3 to 6 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 3 to 5 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted 3 to 5 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 3 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted 3 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 4 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted 4 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 5 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted 5 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted or unsubstituted 6 membered heterocycloalkyl. R.sup.6 may be R.sup.60-substituted 6 membered heterocycloalkyl.
[0225] R.sup.6 may be substituted or unsubstituted aryl. R.sup.6 may be substituted aryl. R.sup.6 may be unsubstituted aryl. R.sup.6 may be substituted or unsubstituted 5 to 10 membered aryl. R.sup.6 may be substituted 5 to 10 membered aryl. R.sup.6 may be unsubstituted 5 to 10 membered aryl. R.sup.6 may be substituted or unsubstituted 5 or 6 membered aryl. R.sup.6 may be substituted 5 or 6 membered aryl. R.sup.6 may be unsubstituted 5 or 6 membered aryl. R.sup.6 may be substituted or unsubstituted 5 membered aryl. R.sup.6 may be substituted 5 membered aryl. R.sup.6 may be unsubstituted 5 membered aryl. R.sup.6 may be substituted or unsubstituted 6 membered aryl. R.sup.6 may be substituted 6 membered aryl. R.sup.6 may be unsubstituted 6 membered aryl.
[0226] R.sup.6 may be R.sup.60-substituted or unsubstituted aryl. R.sup.6 may be R.sup.60-substituted aryl. R.sup.6 may be R.sup.60-substituted or unsubstituted 5 to 10 membered aryl. R.sup.6 may be R.sup.60-substituted 5 to 10 membered aryl. R.sup.6 may be R.sup.60-substituted or unsubstituted 5 or 6 membered aryl. R.sup.6 may be R.sup.60-substituted 5 or 6 membered aryl. R.sup.6 may be R.sup.60-substituted or unsubstituted 5 membered aryl. R.sup.6 may be R.sup.60-substituted 5 membered aryl. R.sup.6 may be R.sup.60-substituted or unsubstituted 6 membered aryl. R.sup.6 may be R.sup.60-substituted 6 membered aryl.
[0227] R.sup.6 may be substituted or unsubstituted heteroaryl. R.sup.6 may be substituted heteroaryl. R.sup.6 may be unsubstituted heteroaryl. R.sup.6 may be substituted or unsubstituted 5 to 10 membered heteroaryl. R.sup.6 may be substituted 5 to 10 membered heteroaryl. R.sup.6 may be unsubstituted 5 to 10 membered heteroaryl. R.sup.6 may be substituted or unsubstituted 5 or 6 membered heteroaryl. R.sup.6 may be substituted 5 or 6 membered heteroaryl. R.sup.6 may be unsubstituted 5 or 6 membered heteroaryl. R.sup.6 may be substituted or unsubstituted 5 membered heteroaryl. R.sup.6 may be substituted 5 membered heteroaryl. R.sup.6 may be unsubstituted 5 membered heteroaryl. R.sup.6 may be substituted or unsubstituted 6 membered heteroaryl. R.sup.6 may be substituted 6 membered heteroaryl. R.sup.6 may be unsubstituted 6 membered heteroaryl.
[0228] R.sup.6 may be R.sup.60-substituted or unsubstituted heteroaryl. R.sup.6 may be R.sup.60-substituted heteroaryl. R.sup.6 may be R.sup.60-substituted or unsubstituted 5 to 10 membered heteroaryl. R.sup.6 may be R.sup.60-substituted 5 to 10 membered heteroaryl. R.sup.6 may be R.sup.60-substituted or unsubstituted 5 or 6 membered heteroaryl. R.sup.6 may be R.sup.60-substituted 5 or 6 membered heteroaryl. R.sup.6 may be R.sup.60-substituted or unsubstituted 5 membered heteroaryl. R.sup.6 may be R.sup.60-substituted 5 membered heteroaryl. R.sup.6 may be R.sup.60-substituted or unsubstituted 6 membered heteroaryl. R.sup.6 may be R.sup.60-substituted 6 membered heteroaryl.
[0229] R.sup.60 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.61-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.61-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.61-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.61-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.61-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.61-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl. R.sup.60 may be hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl. R.sup.60 may be hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0230] R.sup.61 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.62-substituted or unsubstituted alkyl, R.sup.62-substituted or unsubstituted heteroalkyl, R.sup.62-substituted or unsubstituted cycloalkyl, R.sup.62-substituted or unsubstituted heterocycloalkyl, R.sup.62-substituted or unsubstituted aryl, or R.sup.62-substituted or unsubstituted heteroaryl.
[0231] R.sup.62 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.63-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.63-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.63-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.63-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.63-substituted or unsubstituted e.g. phenyl or naphthyl), or R.sup.63-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0232] R.sup.63 is hydrogen, halogen, oxo, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0233] R.sup.6A and R.sup.6B may independently be hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.3H, or ONH.sub.2. R.sup.6A and R.sup.6B may independently be substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. R.sup.6A and R.sup.6B may independently be hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.3H, ONH.sub.2, NHC(O)NHNH.sub.2, R.sup.60-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.60-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.60-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.60-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.60-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.60-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0234] R.sup.6A and R.sup.6B may independently be R.sup.6C-substituted or unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, R.sup.6C-substituted or unsubstituted (e.g. 2 to 5 membered) heteroalkyl, R.sup.6C-substituted or unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, R.sup.6C-substituted or unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, R.sup.6C-substituted or unsubstituted aryl (e.g. phenyl or naphthyl), or R.sup.6C-substituted or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0235] R.sup.6C is hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2Cl, S(O).sub.3H, S(O).sub.4H, S(O).sub.2NH.sub.2, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, NHC(O)NH.sub.2, NHS(O).sub.2H, NHC(O)H, NHC(O)OH, NHOH, OCF.sub.3, OCHF.sub.2, unsubstituted (e.g. C.sub.1-C.sub.5) alkyl, unsubstituted (e.g. 2 to 5 membered) heteroalkyl, unsubstituted (e.g. C.sub.3-C.sub.8) cycloalkyl, unsubstituted (e.g. 3 to 8 membered) heterocycloalkyl, unsubstituted aryl (e.g. phenyl or naphthyl), or unsubstituted (e.g. 5 or 6 membered or fused ring) heteroaryl.
[0236] The compound of formula (I) may have the formula:
##STR00003##
[0237] L.sup.1, R.sup.1, R.sup.2, X, Y, and m1 are as described herein. R.sup.2 of the compounds of formula (II) or (III) may be halogen or OR.sup.2A, where R.sup.2A is hydrogen or unsubstituted C.sub.1-C.sub.5 alkyl compounds. X of formula (II) or (III) may be CH.sub.2 or N. Y of formula (II) or (III) may be NH or O. L.sup.1 of formula (II) or (III) may be a bond. R.sup.1 of formula (II) or (III) may be halogen, NO.sub.2, NH.sub.2, OR.sup.1A, where R.sup.1A is hydrogen or unsubstituted C.sub.1-C.sub.5 alkyl, where the symbol m1 is 1, 2, or 3.
[0238] The compound of formula (I) may have the formula:
##STR00004##
where R.sup.1, m1, R.sup.2, and X are as described herein. R.sup.1 may be OR.sup.1A, where R.sup.1A is as described herein (e.g. substituted or unsubstituted alkyl) and m1 is 1, 2, or 3. R.sup.1 may be halogen. R.sup.1 may be CF.sub.3. R.sup.1 may be NO.sub.2. R.sup.1 may be NH.sub.2. R.sup.1 may be substituted at the 2, 3, or 4 positions with one or more of be OR.sup.1A, where R.sup.1A is as described herein (e.g. substituted or unsubstituted alkyl), halogen, CF.sub.3, NO.sub.2, or NH.sub.2. The symbol m may be 1, 2, or 3.
[0239] The compound of formula (I) may have the formula:
##STR00005##
where L, R.sup.1, m1, R.sup.2 and X are as described herein. L.sup.1 may be a bond and R.sup.1 may be OR.sup.1A, where R.sup.1A is as defined herein (e.g. substituted or unsubstituted alkyl) and m1 is 1, 2, or 3. R.sup.1 may be halogen. R.sup.1 may be CF.sub.3. R.sup.1 may be NO.sub.2. R.sup.1 may be NH.sub.2. R.sup.1 may be substituted at the 2, 3, or 4 positions with one or more of be OR.sup.1A, where R.sup.1A is as described herein (e.g. substituted or unsubstituted alkyl), halogen, CF.sub.3, NO.sub.2, or NH.sub.2. The symbol m1 may be 1, 2, or 3.
[0240] The compound of formula (I) may have formula:
##STR00006##
where A is 5,6-fused ring heteroaryl, 6,5-fused ring heteroaryl, or 6,6-fused ring heteroaryl. L.sup.1, R.sup.1, m1, R.sup.2, X and Y are as described herein. R.sup.2 of the compounds of formula (IV) or formula (V) may be halogen or OR.sup.2A, where R.sup.2A is hydrogen or unsubstituted C.sub.1-C.sub.5 alkyl. X of the compounds of formula (IV) or formula (V) may be CH.sub.2 or N. Y of the compounds of formula (IV) or formula (V) may be NH or O. L.sup.1 of the compounds of formula (IV) or formula (V) may be a bond. R.sup.1 of the compounds of formula (IV) or formula (V) may be halogen, NO.sub.2, NH.sub.2, OR.sup.1A, where R.sup.1A is hydrogen or unsubstituted C.sub.1-C.sub.5 alkyl where the symbol m1 is 1, 2, or 3.
[0241] The compound of formula (I) may be a compound having the structure set forth in Table 1, 2, or 3, or in the examples provided herein.
TABLE-US-00001 TABLE 1 Compounds and inhibition of HDAC8 (relative potency) and HeLa nuclear HDACs (IC.sub.50, nM)
TABLE-US-00002 TABLE 2 Compounds and inhibition of HDAC8 (relative potency) and HeLa nuclear HDACs (IC.sub.50, nM) and cytotoxicity (IC.sub.50, M)
TABLE-US-00003 TABLE 3 Compounds and inhibition of HDAC 8 (relative potency) and HeLa nuclear HDACs (IC.sub.50, nM)
[0242] In embodiments, R.sup.1 and R.sup.2 of the compound of formula (I) are not unsubstituted aryl. In embodiments R.sup.1 and R.sup.2 of the compound of formula (I) are not unsubstituted phenyl. In embodiments, when L.sup.1 is a bond, R.sup.1 is not unsubstituted aryl or unsubstituted heteroaryl. In embodiments, when L.sup.1 is a bond, R.sup.1 is not substituted or unsubstituted aryl (e.g. phenyl). In embodiments, when L.sup.1 is a bond, R.sup.1 is not OR.sup.1A, where R.sup.1A is methyl or substituted or unsubstituted benzyl. In embodiments, when L.sup.1 is a bond, R.sup.1 is not OR.sup.1A, where R.sup.1A is methyl or substituted or unsubstituted benzyl and R.sup.2 is not OCH.sub.3. In embodiments, when L.sup.1 is substituted or unsubstituted arylene, R.sup.1 is not substituted or unsubstituted aryl. In embodiments, when L.sup.1 is unsubstituted arylene (e.g. phenyl), R.sup.1 is not substituted or unsubstituted aryl. In embodiments when L.sup.1 is unsubstituted arylene, R.sup.1 is not unsubstituted aryl (e.g. phenyl). In embodiments the compound is not a compound as set forth in Scheme 1. In embodiments the compound is not a compound as set forth in Scheme 2. In embodiments the compound is not a compound as set forth in Scheme 3. In embodiments the compound is not a compound as set forth in Scheme 4. In embodiments the compound is not a compound as set forth in Scheme 5. In embodiments the compound is not a compound as set forth in Scheme 6. In embodiments the compound is not a compound as set forth in Table 1. In embodiments the compound is not a compound as set forth in Table 4. In embodiments the compound is not a compound as set forth in Table 5. In embodiments the compound is not a compound as set forth in Table 6.
[0243] In embodiments, the compound is not a compound having formula:
##STR00025## [0244] where R.sup.1H, 4-Cl, 4-Br, 4-OCH.sub.3, 3,4-C.sub.6H.sub.4, 4-OCF.sub.3.
[0245] In embodiments, the compound is not a compound having formula:
##STR00026## [0246] where RH, 4-Cl, 4-Br, 4-OCH.sub.3, 3,4-C.sub.6H.sub.4.
[0247] In embodiments, the compound is not a compound having formula:
##STR00027## [0248] where n is 2-5.
[0249] In embodiments, the compound is not a compound having formula:
##STR00028##
[0250] where R is:
##STR00029##
[0251] In embodiments, the compound is not a compound having formula:
##STR00030##
II. METHODS OF TREATING
[0252] Provided herein are methods of treating cancer with a HDAC8 inhibitor. In one aspect, the method is a method of treating cancer by administering to a subject in need thereof an effective amount of a HDAC8 inhibitor as described herein. The HDAC8 inhibitor is as described herein. The HDAC8 inhibitor may be a compound of formula (I) as described herein including one or more compounds set forth in Tables 1-3 and/or one or more of those set forth in the Examples. The HDAC8 inhibitor may be an HDAC8 inhibitor antibody. The HDAC8 inhibitor may be a HDAC8 inhibitor polynucleotide. The HDAC8 inhibitor may be a HDAC8 inhibitor protein. The inhibitor may block the active site of HDAC8.
[0253] The cancer may be a non-mutated p53 cancer. The non-mutated p53 cancer may be a blood cancer (e.g. a non-mutated p53 blood cancer) or a solid tumor cancer (e.g. a non-mutated p53 solid tumor cancer). The non-mutated p53 cancer may be acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), lymphoma, neuroblastoma, glioma, bladder cancer, lung cancer, non-small cell lung cancer, or breast cancer (including triple-negative breast cancer).
[0254] The non-mutated p53 cancer may be acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), lymphoma, neuroblastoma, glioma, bladder cancer, or lung cancer. The non-mutated p53 cancer may be acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), lymphoma, neuroblastoma, or glioma. The non-mutated p53 cancer may be acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), or lymphoma. The non-mutated p53 cancer may be acute myeloid leukemia (AML) or acute lymphoblastic leukemia (ALL).
[0255] The non-mutated p53 cancer may be acute myeloid leukemia (AML). The non-mutated p53 cancer may be acute lymphoblastic leukemia (ALL). The non-mutated p53 cancer may be lymphoma. The non-mutated p53 cancer may be neuroblastoma. The non-mutated p53 cancer may be glioma. The non-mutated p53 cancer may be bladder cancer. The non-mutated p53 cancer may be lung cancer. The non-mutated p53 cancer may be non-small cell lung cancer. The non-mutated p53 cancer may be breast cancer (including triple-negative breast cancer).
[0256] The cancer may have increased HDAC8 activity or expression when compared to a non-cancerous cell. The cancer may have increased HDAC8 activity and expression when compared to a non-cancerous cell. The cancer may have increased HDAC8 activity when compared to a non-cancerous cell. The cancer may have increased HDAC8 expression when compared to a non-cancerous cell.
[0257] The non-mutated p53 cancer may have increased HDAC8 activity or expression when compared to a mutated p53 cancer. The non-mutated p53 cancer may have increased HDAC8 activity and expression when compared to a mutated p53 cancer. The non-mutated p53 cancer may have increased HDAC8 activity when compared to a mutated p53 cancer. The non-mutated p53 cancer may have increased HDAC8 expression when compared to a mutated p53 cancer. p53 may be deacetylated in the non-mutated cancer. p53 may be deacetylated in a non-mutated cancer having increased HDAC8 activity or expression. The non-mutated p53 cancer may have deacetylated p53 and may be characterized by increased resistance to treatment with an anti-cancer agent when compared to a cancer having mutated p53. The non-mutated p53 cancer may have increased HDAC8 expression and may be characterized by increased resistance to treatment with an anti-cancer agent when compared to a cancer having mutated p53.
[0258] The methods described herein may further include determining whether the non-mutated cancer has increased HDAC8 activity or HDAC8 expression. Increased HDAC8 activity or HDAC8 expression may be determined using techniques known in the art. Thus the level of HDAC8 activity may be measured from a sample taken from the subject and compared to the level of HDAC8 activity in a control sample (e.g. a healthy or non-cancerous cell). The level of HDAC8 expression may be determined using methods of quantifying a polypeptide (e.g. fluorometric or colorimetric assays, IHC, ELISA, or western blots). The level of HDAC8 expression may be determined using methods of quantifying a polynucleotide (e.g. fluorometric or colorimetric assays, PCR, or northern blots).
[0259] Also provided herein are methods of determining whether a subject has a non-mutated p53 cancer. Determining the presence or absence of non-mutated p53 in a cancer may allow for more effective treatment in the subject. The method may further include determining the expression or activity levels of HDAC8 in the non-mutated p53 cancer. When a non-mutated p53 cancer in the subject is determined to also have increased activity or expression of HDAC8, the cancer may be resistant to anti-cancer agents. When the non-mutated cancer in the subject is determined to also have increased activity or expression of HDAC8, p53 in the non-mutated cancer may be deacetylated.
[0260] The non-mutated p53 cancer may be leukemia where the cancer also has increased HDAC expression or activity. The non-mutated p53 cancer may be leukemia where the cancer also has increased HDAC expression. The non-mutated p53 cancer may be leukemia where the cancer also has increased HDAC activity.
[0261] In another aspect, the method is a method of treating cancer stem cells by administering to a subject in need thereof an effective amount of a HDAC8 inhibitor as described herein. The HDAC inhibitor is as described herein. The HDAC8 inhibitor may inhibit the leukemia-initiating capacity (e.g. population of cancer stem cells causing relapse). The cancer stem cells may be resistant to treatment with anti-cancer agents listed herein. Thus, treatments with an HDAC8 inhibitor described herein may target cancer stem cells resistant to such treatments and allow efficacy of previously resistant anti-cancer agents.
[0262] The HDAC8 inhibitor may be selective for HDAC8 over other HDAC isoforms (e.g. HDAC1, HDAC2, HDAC3, HDAC6, HDAC10, or HDAC 11). The HDAC8 inhibitor may be at least 1, 2, 5, 10, 15, 25, 50, 100, 200, 300, 400, or 500 more selective (e.g. by determining K.sub.i or IC.sub.50 values for the compound for HDAC8 and other HDAC isoforms described herein).
[0263] Also provided herein are methods of treating cancer by modulating p53 activity. In one aspect, is a method of treating cancer by modulating p53 activity by administering to a subject in need thereof a HDAC8 inhibitor as described herein. The HDAC8 inhibitor may be a compound described herein. The cancer is as described herein. The cancer may overexpress HDAC8.
III. METHODS OF INHIBITING
[0264] Further provided herein are methods of inhibiting HDAC8 mediated deacetylation of p53. In one aspect, the method includes contacting HDAC8 with a HDAC8 inhibitor as described herein, thereby inhibiting HDAC8 mediated deacetylation of p53. The inhibition of HDAC8 may allow for acetylation and activation of p53, thereby mediating cell apoptosis.
[0265] The contacting may be performed in vitro or in vivo. The contacting may be performed in vitro. The contacting may be performed in vivo. The contacting may be performed in an organism.
[0266] The inhibition of HDAC8 mediated deacetylation of p53 may be monitored by techniques known in the art, including for example, fluorescent and colorimetric assays.
IV. METHODS OF ACTIVATING
[0267] Further provided herein are methods of activating p53. The method may be a method of activating p53 in vivo by contacting a cell with a HDAC8 inhibitor in the presence of HDAC8 and allowing the HDAC8 inhibitor to contact the HDAC8, thereby inhibiting the HDAC8 and activating p53. The contacting is performed as described herein. The HDAC8 inhibitor is as described herein. The HDAC8 inhibitor may be a compound described herein.
V. EXAMPLES
Example 1. Chemical Design
[0268] The synthesis of N-hydroxycinnamides 8a-f is illustrated in Scheme 1 following. 7-Hydroxycoumarin 3 reacted with the appropriate benzyl bromides gave corresponding coumarins 4a-f. Ethanolysis of compounds 4a-f using sodium ethoxide under anhydrous conditions provided (E)-ethyl cinnamates 5a-f,[26] respectively. Methylation of compounds 5a-f reacted with DMS gave corresponding cinnamic esters 6a-f. Saponification of compounds 6a-f in the presence of LiOH gave corresponding cinnamic acids 7a-f in quantitative yields. Compounds 7a-f reacted with ethyl chlorformate to produce the corresponding activated mixed anhydride in situ, and subsequent treatment of the prepared hydroxylamine gave N-hydroxycinnamides 8a-f, respectively. The synthesis of N-hydroxycinnamides 13a-e is described in Scheme 2. Ethanolysis of 7-methoxycoumarin 9 gave (E)-ethyl cinnamate 10. Reaction of (E)-ethyl cinnamate 10 with the appropriate benzyl bromides provided cinnamic esters 11 a-e, respectively. N-Hydroxycinnamides 13a-e were achieved starting from compounds 11 a-e through saponification followed by reaction with ethyl chloroformate and hydroxylamine according to the synthetic approach for 8a-f. The synthesis of N-hydroxycinnamides 18a-d is shown in Scheme 3.
##STR00031##
##STR00032##
##STR00033##
[0269] Reaction of 4-methoxyphenol 14 with the appropriate chlorosubstituted alkyl bromides with chain lengths of two to five carbons yielded corresponding compounds 15a-d. Coupling of ethyl cinnamate 10 with 15a-d gave compounds 16a-d, respectively. Saponification of compounds 16a-d and subsequent reaction with ethyl chloroformate and hydroxylamine gave corresponding N-hydroxycinnamides 18a-d. The synthesis of ortho-aryl N-hydroxycinnamides 22a-g is described in Scheme 4. Reaction of ethyl cinnamate 10 with trifluoromethanesulfonyl (triflic) anhydride in the presence of pyridine gave compound 19. Suzuki coupling[27] of 19 with the appropriate aryl borates using catalytic tetrakis(triphenylphosphine) palladium yielded compounds 20a-g, respectively. Using compound 20a-g as the starting material, saponification followed by reaction with ethyl chloroformate and hydroxylamine gave corresponding the N-hydroxycinnamides 22a-g. The synthesis of ortho-phenyl N-hydroxycinnamides 27a-c with various chain lengths at the para position is achieved as described in Scheme 5. Reaction of 7-hydroxycoumarin 3 with the appropriate alkyl bromides with a three- to five-carbon chain length gave 23a-c, respectively. Ethanolysis of compounds 23a-c yielded corresponding (E)-ethyl cinnamates 24a-c. Reaction of compounds 24a-c with triflic anhydride provided 25a-c, respectively. Suzuki coupling of compounds 25a-c with phenyl borate gave corresponding compounds 26a-c. Ethyl cinnamates 26a-c was reacted directly with hydroxylamine in the presence of NaOH to yield N-hydroxycinnamides 27a-c, respectively. The synthesis of N-hydroxycinnamide 27d with a phenyl group at the ortho and para position was achieved as illustrated in Scheme 6. Reaction of 7-hydroxycoumarin 3 with triflic anhydride gave 28. Suzuki coupling of compound 28 with phenyl borate yielded phenyl coumarin 29. Methanolysis of compound 29 provided (E)-methyl cinnamate 30. Trifluoromethanesulfonylation of compound 30 and subsequent Suzuki coupling was repeated to give 32. Compound 32 was converted into N-hydroxycinnamide 27d using hydroxylamine and NaOH. Details on the synthesis, isolation, and characterization of reaction intermediates can be found in the Supporting Information.
##STR00034##
##STR00035##
##STR00036##
Example 2. Compound Synthesis
[0270] General.
[0271] .sup.1H NMR spectrum was obtained on a Bruker AV400 or AV500 spectrometer using standard pulse programs. Melting point was recorded on a Fisher-Johns apparatus (uncorrected). MS data were measured on a JEOL JMX-HX110 mass spectrometer (HREIMS and HRFABMS), a JMS-SX102A mass spectrometer (EIMS and FABMS), or a Finnigan Mat 95S mass spectrometer (HRESIMS and ESIMS). TLC analyses were carried out on silica gel plates (KG60-F254, Merck). The microplate spectrophotometer Victor 2 (PerkinElmer, Fremont, Calif., USA) was used for fluorometric analysis. Unless otherwise mentioned, all chemicals and materials were used as received from commercial suppliers without further purification. CH.sub.2Cl.sub.2 was distilled from CaH under N.sub.2. THF was distilled from sodium and benzophenone under N.sub.2. All test compounds were estimated to be at least 98% pure as judged by HPLC analysis, which was performed on an Ascentis C18 column (1504.6 mm) using an L-2130 pump (Hitachi) and a UV/Vis L-2420 detector (Hitachi) with UV detection at 250 nm.
7-Benzyloxycoumarin (4a)
[0272] To a solution of 7-hydroxy-2H-chromen-2-one (4.86 g, 30.00 mmol) and K.sub.2CO.sub.3 (10.35 g, 75.00 mmol) in acetone (200 mL) was added benzyl chloride (6.90 mL, 60.00 mmol). The resulting was heated to 56 C under N.sub.2 overnight. After filtration to remove K.sub.2CO.sub.3, the filtrate was concentrated in vacuo. The residue was diluted with distd H.sub.2O (100 mL) and then extracted with EtOAc (50 mL3). The organic layer was dried (Na.sub.2SO.sub.4), filtered and the solvent removed in vacuo. The residue was purified by silica gel chromatography (EtOAc:n-Hexane=1:4) to give 4a (6.43 g, 85%) as a white solid: mp: 135-140 C.; .sup.1H NMR (500 MHz, CDCl.sub.3): =7.62 (d, J=9.5 Hz, 1H), 7.42 (m, 3H), 7.37 (d, J=8.7 Hz, 1H), 7.34 (m, 2H), 6.91 (d, J=8.7 Hz, 1H), 6.89 (s, 1H), 6.25 (d, J=9.5 Hz, 1H), 5.13 ppm (s, 2H); MS (EI, 70 ev) m/z: 252 [M]+.
7-(4-Chlorobenzyloxy)coumarin (4b)
[0273] To a solution of 7-hydroxy-2H-chromen-2-one (5.16 g, 31.85 mmol) and K.sub.2CO.sub.3 (10.99 g, 79.63 mmol) in acetone (200 mL) was added 4-chlorobenzyl chloride (10.29 g, 63.70 mmol). Following the procedure as described for 4a gave 4b (7.47 g, 82%) as a white solid: mp: 120-125 C.; .sup.1H NMR (500 MHz, CDCl.sub.3): =7.63 (d, J=9.5 Hz, 1H), 7.37 (m, 5H), 6.90 (dd, J=2.4, 8.6 Hz, 1H), 6.86 (d, J=2.4 Hz, 1H), 6.26 (d, J=9.5 Hz, 1H), 5.09 ppm (s, 2H); MS (EL, 70 ev) m/z: 286 [M]+.
7-[(Naphthalen-4-yl)methoxy]coumarin (4e)
[0274] To a solution of 7-hydroxy-2H-chromen-2-one (4.45 g, 27.47 mmol) and K.sub.2CO.sub.3 (9.48 g, 68.67 mmol) in acetone (220 mL) was added 1-(chloromethyl)naphthalene (8.30 mL, 54.94 mmol). Following the procedure as described for 4a gave 4e (6.22 g, 75%) as a white solid: mp: 135-150 C.; .sup.1H NMR (500 MHz, CDCl.sub.3): =8.03 (d, J=8.1 Hz, 1H), 7.91 (d, J=7.8 Hz, 1H), 7.88 (d, J=8.1 Hz, 1H), 7.63 (d, J=9.5 Hz, 1H), 7.60 (m, 1H), 7.56 (m, 2H), 7.48 (t, J=7.8 Hz, 1H), 7.39 (d, J=8.6 Hz, 1H), 7.00 (d, J=2.2 Hz, 1H), 6.96 (dd, J=2.2, 8.6 Hz, 1H), 6.26 (d, J=9.5 Hz, 1H), 5.56 ppm (s, 2H); MS (EI, 70 ev) m/z: 302 [M]+.
(E)-Ethyl 4-benzyloxy-2-hydroxycinnamate (5a)
[0275] To a solution of 4a (5.54 g, 22.00 mmol) in anhydrous EtOH (50 mL) was added NaOEt (3.12 g, 44.00 mmol) in anhydrous EtOH (50 mL) dropwise during 1 h. The resulting solution was heated to 78 C. under N.sub.2 at for 6 h. The reaction was diluted with distd H2O (200 mL), acidified with 1N HCl(aq) to pH 4-5 and extracted with EtOAc (100 mL3). The organic layer was dried (Na.sub.2SO.sub.4), filtered and the solvent removed in vacuo. The residue was purified by silica gel chromatography (EtOAc:n-Hexane=1:4) to give 5a (4.92 g, 75%) as a white solid: mp: 120-130 C.; .sup.1H NMR (500 MHz, [D6] DMSO): 10.33 (s, 1H), 7.77 (d, J=16.2 Hz, 1H), 7.52 (d, J=9.3 Hz, 1H), 7.40 (m, 5H), 7.33 (d, J=9.3 Hz, 1H), 6.51 (s, 1H), 6.44 (d, =16.2 Hz, 1H), 5.08 (s, 2H), 4.14 (q, =7.1 Hz, 2H), 1.22 ppm (t, =7.2 Hz, 3H); MS (EI, 70 ev) m/z: 298 [M]+.
(E)-Ethyl 4-(4-chlorobenzyloxy)-2-hydroxycinnamate (5b)
[0276] To a solution of 4b (6.26 g, 21.89 mmol) in anhydrous EtOH (60 mL) was added NaOEt (3.10 g, 43.78 mmol) in anhydrous EtOH (50 mL) dropwise during 1 h. Following the procedure as described for 5a gave 5b (5.23 g, 72%) as a white solid: mp: 133-140 C.; .sup.1H NMR (500 MHz, CDCl3): 7.95 (d, 1=16.2 Hz, 1H), 7.39 (d, J=8.7 Hz, 1H), 7.35 (dd, J=2.3, 9.0 Hz, 4H), 6.66 (s, 1H), 6.53 (dd, J=2.3, 8.7 Hz, 1H), 6.52 (d, J=16.2 Hz, 1H), 6.44 (d, J=2.3 Hz, 1H), 5.01 (s, 2H), 4.27 (q, J=7.1 Hz, 2H), 1.34 ppm (t, J=7.1 Hz, 3H); MS (EI, 70 ev) m/z: 332 [M]+.
(E)-Ethyl 2-hydroxy-4-[(naphthalen-4-yl)methoxy]cinnamate (5e)
[0277] To a solution of 4e (6.00 g, 19.87 mmol) in anhydrous EtOH (60 mL) was added NaOEt (2.81 g, 39.74 mmol) in anhydrous EtOH (50 mL) dropwise during 1 h. Following the procedure as described for 5a gave 5e (5.12 g, 74%) as a white solid: mp: 139-144 C.; .sup.1H NMR (500 MHz, [D6]DMSO): =10.34 (s, 1H), 8.05 (d, J=8.0 Hz, 1H), 7.97 (d, J=7.6 Hz, 1H), 7.93 (d, J=8.7 Hz, 1H), 7.79 (d, J=16.1 Hz, 1H), 7.64 (t, J=6.9 Hz, 1H), 7.57 (m, 3H), 7.51 (t, J=7.6 Hz, 1H), 6.61 (dd, J=2.1, 8.7 Hz, 1H), 6.57 (d, J=2.1 Hz, 1H), 6.46 (d, J=16.1 Hz, 1H), 5.53 (s, 2H), 4.14 (q, J=7.1 Hz, 2H), 1.23 ppm (t. J=7.1 Hz, 3H); MS (EI, 70 ev) m/z: 348 [M]+.
(E)-N-Hydroxy-4-benzyloxy-2-methxycinnamide (8a)
[0278] KOH (1.23 g, 22.00 mmol) was added to a solution of NH.sub.2OH (1.53 g, 22.00 mmol) in MeOH (20 mL). The resulting solution was stirred in an ice bath for 1 h. Filtration to remove the white salt gave a solution of NH.sub.2OH in MeOH. A solution of 7a (3.12 g, 11.00 mmol) in freshly distilled THF (30 mL) was treated with ethyl chloroformate (1.58 mL, 16.50 mmol) and Et.sub.3N (3.06 mL, 22.00 mmol) and was stirred at room temperature for 1 h. The prepared free NH.sub.2OH solution was then added to the reaction, and stirring was continued for 3 h. The reaction was diluted with distilled water (100 mL), acidified with 1n HCl(aq) to pH 2-3, and extracted with EtOAc (350 mL). The organic layer was dried (Na.sub.2SO.sub.4) and filtered, and the solvent was removed in vacuo. The residue was purified by silica gel chromatography (EtOAc/n-hexane, 1:2-1:1) to give 8a (1.81 g, 55%) as a white solid: mp: 128-135 C.; .sup.1H NMR (500 MHz, [D6]DMSO): d=10.60 (s, 1H), 8.89 (s, 1H), 7.58 (d, J=15.9 Hz, 1H), 7.45 (t, J=7.4 Hz, 2H), 7.42 (d, J=8.5 Hz, 1H), 7.38 (t, J=7.4 Hz, 2H), 7.33 (d, J=7.4 Hz, 1H), 6.70 (d, J=1.9 Hz, 1H), 6.64 (dd, J=1.9, 8.5 Hz, 1H), 6.37 (d, J=15.9 Hz, 1H), 5.14 (s, 2H), 3.83 ppm (s, 3H); .sup.13C NMR (125 MHZ, [D6]DMSO): d=161.6, 160.0, 137.2, 134.9, 129.6, 128.4, 127.9, 127.7, 116.9, 106.6, 99.2, 69.8, 55.2 ppm; HRMS-EI: m/z [M]+ calcd for C.sub.17H.sub.17NO.sub.4: 299.1157, found: 299.1160.
(E)-N-Hydroxy-4-(4-chlorobenzyloxy)-2-methoxycinnamide (8b)
[0279] Following the procedure as described for 8a, reaction of 7b (3.50 g, 11.00 mmol) in THF (40 mL) with ethyl chloroformate (1.54 mL, 16.50 mmol) and Et.sub.3N (2.31 mL, 16.50 mmol) gave 8b (1.94 g, 53%) as a white solid: mp: 167-172 C.; .sup.1H NMR (500 MHz, [D6]DMSO): d=7.57 (d, J=15.8 Hz, 1H), 7.47 (d, J=8.6 Hz, 2H), 7.44 (d, J=8.6 Hz, 2H), 7.42 (d, J=8.8 Hz, 1H), 6.68 (s, 1H), 6.62 (d, J=8.8 Hz, 1H), 6.36 (d, J=15.8 Hz, 1H), 5.14 (s, 2H), 3.82 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=164.1, 161.0, 159.4, 136.3, 133.0, 130.1, 129.7, 128.9, 117.4, 116.9, 107.1, 99.9, 69.1, 56.2 ppm; HRMS-ESI: m/z [M.sub.H].sub. calcd for C.sub.17H.sub.15NO.sub.4Cl: 332.0690, found: 332.0693.
(E)-N-Hydroxy-4-(4-bromobenzyloxy)-2-methoxycinnamide (8c)
[0280] Following the procedure as described for 8a, reaction of 7c (3.80 g, 10.50 mmol) in THF (40 mL) with ethyl chloroformate (1.47 mL, 15.75 mmol) and Et.sub.3N (2.21 mL, 15.75 mmol) gave 8c (2.26 g, 57%) as a white solid: mp: 165-170 C.; .sup.1H NMR (500 MHz, [D6]DMSO): d=10.60 (s, 1H), 8.89 (s, 1H), 7.59 (d, J=8.2 Hz, 2H), 7.56 (d, J=16.0 Hz, 1H), 7.42 (d, J=8.2 Hz, 3H), 6.69 (d, J=2.1 Hz, 1H), 6.63 (dd, J=2.1, 8.6 Hz, 1H), 6.37 (d, J=16.0 Hz, 1H), 5.13 (s, 2H), 3.84 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=164.1, 161.0, 159.4, 136.7, 133.7, 131.9, 130.4, 129.7, 121.5, 117.4, 116.9, 107.1, 99.9, 69.1, 56.2 ppm; HRMS-EI: m/z [M]+ calcd for C.sub.17H.sub.16BrNO.sub.4: 377.0263, found: 377.0259.
(E)-N-Hydroxy-4-(4-methoxybenzyloxy)-2-methoxycinnamide (8d)
[0281] Following the procedure as described for 8a, reaction of 7d (3.50 g, 11.15 mmol) in THF (35 mL) with ethyl chloroformate (1.56 mL, 16.73 mmol) and Et.sub.3N (2.35 mL, 16.73 mmol) gave 8d (2.02 g, 55%) as a white solid: mp: 140-150 C.; .sup.1H NMR (500 MHz, [D6]DMSO): d=10.60 (s, 1H), 8.89 (s, 1H), 7.58 (d, J=15.9 Hz, 1H), 7.41 (d, J=8.5 Hz, 1H), 7.38 (d, J=8.3 Hz, 2H), 6.94 (d, J=8.3 Hz, 2H), 6.67 (s, 1H), 6.63 (d, J=8.5 Hz, 1H), 6.37 (d, J=15.9 Hz, 1H), 5.05 (s, 2H), 3.83 (s, 3H), 3.75 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=164.2, 161.3, 159.6, 159.4, 133.8, 130.1, 129.6, 129.1, 117.2, 116.7, 114.3, 107.2, 99.8, 69.7, 56.1, 55.6 ppm; HRMS-EI: m/z [M]+ calcd for C.sub.18H.sub.19NO.sub.5: 329.1263, found: 329.1259.
(E)-N-Hydroxy-4-[(naphthalen-4-yl)methoxy]-2-methoxycinnamide (8e)
[0282] Following the procedure as described for 8a, reaction of 7e (3.15 g, 9.43 mmol) in THF (35 mL) with ethyl chloroformate (1.32 mL, 14.15 mmol) and Et.sub.3N (1.99 mL, 14.15 mmol) gave 8e (1.67 g, 51%) as a white solid: mp: 150-158 C.; .sup.1H NMR (500 MHz, [D6]DMSO): d=10.61 (s, 1H), 8.91 (s, 1H), 8.09 (d, J=8.2 Hz, 1H), 7.97 (d, J=7.7 Hz, 1H), 7.94 (d, J=8.2 Hz, 1H), 7.69 (d, J=7.7 Hz, 1H), 7.61 (d, J=9.1 Hz, 1H), 7.56 (m, 3H), 7.52 (t, J=7.7 Hz, 1H), 7.46 (d, J=15.9 Hz, 1H), 6.78 (s, 1H), 6.75 (d, J=8.6 Hz, 1H), 6.39 (d, J=15.9 Hz, 1H), 5.59 (s, 2H), 3.84 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=164.2, 161.4, 159.4, 133.8, 132.7, 131.6, 129.7, 129.3, 129.0, 127.4, 127.0, 126.5, 125.9, 124.4, 117.3, 116.9, 107.3, 99.8, 68.5, 56.2 ppm; HRMS-ESI m/z [M.sub.H].sub. calcd for C.sub.21H.sub.18NO.sub.4Cl: 348.1236, found: 348.1235.
(E)-N-Hydroxy-4-(trifluoromethoxy)-2-methoxycinnamide (8f)
[0283] Following the procedure as described for 8a, reaction of 7 f (4.50 g, 12.23 mmol) in THF (45 mL) with ethyl chloroformate (1.71 mL, 18.35 mmol) and Et.sub.3N (2.58 mL, 18.35 mmol) gave 8 f (2.72 g, 58%) as a white solid: mp: 155-160 C.; .sup.1H NMR (500 MHz, [D6]DMSO): d=7.58 (d, J=8.5 Hz, 2H), 7.57 (d, J=16.6 Hz, 1H), 7.43 (d, J=8.5 Hz, 1H), 7.38 (d, J=8.5 Hz, 2H), 6.69 (d, J=1.9 Hz, 1H), 6.64 (d, J=8.5 Hz, 1H), 6.37 (d, J=16.6 Hz, 1H), 5.17 (s, 2H), 3.82 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=161.0, 159.4, 148.4, 136.8, 133.7, 130.1, 129.7, 121.5, 117.4, 117.0, 107.1, 99.9, 69.0, 56.2 ppm; HRMS-EI: m/z [M]+ calcd for C.sub.18H.sub.16F.sub.3NO.sub.5: 383.0980, found: 383.0981.
(E)-N-Hydroxy-2-benzyloxy-4-methoxycinnamide (13a)
[0284] KOH (1.46 g, 26.00 mmol) to a solution of NH.sub.2OHHCl (1.81 g, 26.00 mmol) in MeOH (20 mL). The resulting mixture was stirred in an ice bath for 1 h. Filtration to remove the white salt gave a solution of NH.sub.2OH in MeOH. A solution of 12a (3.69 g, 13.00 mmol) in freshly distilled THF (45 mL) was treated with ethyl chloroformate (1.29 mL, 20.97 mmol), Et.sub.3N (3.61 mL, 26.00 mmol) and the resulting solution was stirred at room temperature for 1 h. The prepared free NH.sub.2OH solution was then added to the reaction and stirring was continued for 3 h. The reaction was diluted with distilled water (100 mL), acidified with 1n HCl(aq) to pH 2-3, and extracted with EtOAc (3_50 mL). The combined organic layer was dried (Na.sub.2SO.sub.4) and filtered, and the solvent was removed in vacuo. The residue was purified by silica gel chromatography (EtOAc/n-hexane, 1:1) to give 13a (1.55 g, 40%) as a white solid: mp: 134-140 C.; .sup.1H NMR (500 MHz, [D6]acetone): d=8.02 (d, J=15.8 Hz, 1H), 7.62 (d, J=7.5 Hz, 3H) 7.52 (t, J=7.2 Hz, 2H), 7.45 (t, J=7.3 Hz, 1H), 6.80 (d, J=2.2 Hz, 1H), 6.68 (dd, J=8.6, 2.3 Hz, 1H), 6.66 (d, J=8.6 Hz, 1H), 6.52 (d, J=15.8 Hz, 1H), 5.36 (s, 2H), 3.92 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=164.1, 162.1, 158.1, 137.3, 133.5, 129.1, 129.0, 128.4, 128.0, 117.2, 117.0, 106.7, 100.4, 70.1, 55.9 ppm; HRMS-FAB: m/z [M+H]+ calcd for C.sub.17H.sub.18NO.sub.4: 300.1235, found: 300.1234.
(E)-N-Hydroxy-2-(4-chlorobenzyloxy)-4-methoxycinnamide (13b)
[0285] Following the procedure as described for 13a, reaction of 12b (2.53 g, 7.86 mmol) in THF (40 mL) with ethyl chloroformate (1.10 mL, 11.79 mmol) and Et.sub.3N (1.65 mL, 11.79 mmol) gave 13b (1.10 g, 42%) as a white solid: mp: 160-170 C.; .sup.1H NMR (500 MHz, [D4]MeOH): d=11.04 (s, 1H), 9.69 (s, 1H), 8.44 (d, J=15.9 Hz, 1H), 8.27 (d, J=8.8 Hz, 1H), 8.25 (br s, 4H), 7.48 (d, J=1.9 Hz, 1H), 7.39 (dd, J=8.8, 1.9 Hz, 1H), 7.16 (d, J=15.9 Hz, 1H), 6.01 (s, 2H), 4.57 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=164.1, 162.0, 157.9, 136.3, 133.5, 133.0, 129.9, 129.3, 129.1, 117.3, 117.0, 106.8, 100.4, 69.3, 55.9 ppm; HRMS-ESI: m/z [M+H]+ calcd for C.sub.17H.sub.17ClNO.sub.4: 334.0846, found: 334.0843.
(E)-N-Hydroxy-2-(4-bromobenzyloxy)-4-methoxycinnamide (13c)
[0286] Following the procedure as described for 13a, reaction of 12c (3.50 g, 9.67 mmol) in THF (40 mL) with ethyl chloroformate (1.35 mL, 14.51 mmol) and Et.sub.3N (2.03 mL, 14.51 mmol) gave 13c (1.46 g, 40%) as a white solid: mp: 148-155 C.; .sup.1H NMR (500 MHz, [D6]acetone): d=10.17 (s, 1H), 7.18 (d, J=16.1 Hz, 1H), 7.14 (d, J=8.3 Hz, 2H), 7.00 (d, J=8.6 Hz, 1H), 6.96 (d, J=8.3 Hz, 2H), 6.21 (s, 1H), 6.13 (d, J=8.6 Hz, 1H), 5.90 (d, J=16.1 Hz, 1H), 4.73 (s, 2H), 3.32 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=164.1, 162.0, 157.9, 136.7, 133.5, 132.0, 130.2, 129.3, 121.6, 117.3, 117.0, 106.8, 100.4, 69.3, 55.9 ppm; HRMS-ESI: m/z [M+H]+ calcd for C.sub.17H.sub.17BrNO.sub.4: 378.0341, found: 378.0340.
(E)-N-Hydroxy-2-(4-methoxybenzyloxy)-4-methoxycinnamide (13d)
[0287] Following the procedure as described for 13a, reaction of 12d (2.20 g, 7.00 mmol) in THF (40 mL) with ethyl chloroformate (1.86 mL, 10.51 mmol) and Et.sub.3N (2.80 mL, 10.51 mmol) gave 13d (1.04 g, 45%) as a white solid: mp: 145-150 C.; .sup.1H NMR (500 MHz, [D6]acetone): d=7.98 (d, J=15.8 Hz, 1H), 7.61 (d, J=8.4 Hz, 1H), 7.55 (d, J=8.6 Hz, 2H), 7.07 (d, J=8.6 Hz, 2H), 6.81 (d, J=2.2 Hz, 1H), 6.67 (dd, J=8.6, 2.2 Hz, 1H), 6.64 (d, J=15.8 Hz, 1H), 5.27 (s, 2H), 3.93 (s, 3H), 3.92 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=162.5, 159.7, 158.6, 135.6, 129.0, 128.8, 116.8, 114.4, 113.6, 105.8, 99.5, 69.9, 54.5, 54.3 ppm; HRMS-ESI: m/z [M+H]+ calcd for C.sub.18H.sub.20NO.sub.5: 330.1341, found: 330.1341.
(E)-N-Hydroxy-2-[(naphthalen-4-yl)methoxy]-4-methoxycinnamide (13e)
[0288] Following the procedure as described for 13a, reaction of 12e (2.82 g, 8.44 mmol) in THF (40 mL) with ethyl chloroformate (2.24 mL, 12.67 mmol) and Et.sub.3N (3.38 mL, 12.67 mmol) gave 13e (1.38 g, 47%) as a white solid: mp: 152-165 C.; .sup.1H NMR (500 MHz, [D6]DMSO): d=10.55 (s, 1H), 8.84 (s, 1H), 8.13 (d, J=8.2 Hz, 1H), 7.98 (m, 2H), 7.94 (d, J=8.2 Hz, 1H), 7.69 (d, J=6.7 Hz, 1H), 7.61 (d, J=16.1 Hz, 1H), 7.55 (m, 2H), 7.45 (d, J=8.5 Hz, 1H), 6.90 (s, 1H), 6.60 (d, J=8.5 Hz, 1H), 6.30 (d, J=16.1 Hz, 1H), 5.65 (s, 2H), 3.80 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=163.9, 162.2, 158.1, 133.8, 133.2, 132.7, 131.6, 129.3, 129.0, 128.7, 127.1, 127.0, 126.5, 125.9, 124.3, 117.0, 106.9, 100.4, 68.7, 55.9 ppm; HRMS-ESI: m/z [M+H]+ calcd for C.sub.21H.sub.20NO.sub.4: 350.1392, found: 350.1390.
(E)-N-Hydroxy-2-(2-(4-methoxyphenoxyoxy)ethoxy)-4-methoxycinnamide (18a)
[0289] Following the procedure described for 8a, reaction of 17a (900 mg, 2.61 mmol) in THF (10 mL) with ethyl chloroformate (424 mg, 3.92 mmol) and Et3N (0.73 mL, 5.22 mmol) gave 18a (497 mg, 53%) as a white solid: mp: 110-115 C.; .sup.1H NMR (500 MHz, [D6]acetone): d=10.12 (s, 1H), 8.63 (s, 1H), 7.85 (d, J=15.8 Hz, 1H), 7.49 (d, J=8.5 Hz, 1H), 6.95 (d, J=8.1 Hz, 2H), 6.86 (d, J=8.1 Hz, 2H), 6.68 (d, J=2.4 Hz, 1H), 6.57 (dd, J=2.4, 8.5 Hz, 1H), 6.54 (d, J=15.8 Hz, 1H), 4.42 (m, 2H), 4.38 (m, 2H), 3.83 (s, 3H), 3.73 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=162.1, 158.4, 158.3, 154.1, 152.8, 133.7, 129.4, 117.2, 116.9, 116.2, 115.1, 113.2, 107.0, 100.0, 67.7, 67.3, 60.4, 55.9, 55.8 ppm; HRMS-EI: m/z [M]+ calcd for C.sub.19H.sub.21NO.sub.6: 359.1369, found: 359.1364.
(E)-N-Hydroxy-2-(2-(4-methoxyphenoxyoxy)propoxy)-4-methoxycinnamide (18b)
[0290] Following the procedure described for 8a, reaction of 17b (300 mg, 0.84 mmol) in THF (10 mL) with ethyl chloroformate (136 mg, 1.26 mmol) and Et.sub.3N (0.23 mL, 1.68 mmol) gave 18b (191 mg, 61%) as a white solid: mp: 115-120 C.; .sup.1H NMR (500 MHz, [D6]acetone): d=10.60 (s, 1H), 8.86 (s, 1H), 7.57 (d, J=15.9 Hz, 1H), 7.41 (d, J=8.6 Hz, 1H), 6.86 (d, J=9.2 Hz, 2H), 6.82 (d, J=9.2 Hz, 2H), 6.60 (d, J=2.3 Hz, 1H), 6.54 (dd, J=2.3, 8.6 Hz, 1H), 6.38 (d, J=15.9 Hz, 1H), 4.18 (t, J=6.2 Hz, 2H), 4.07 (t, J=6.2 Hz, 2H), 3.75 (s, 3H), 3.66 (s, 3H), 2.19 ppm (q, J=6.2 Hz, 2H); .sup.13C NMR (125 MHz, [D6]DMSO): d=164.2, 162.1, 158.7, 153.9, 152.9, 134.0, 130.1, 117.3, 116.7, 115.9, 115.1, 106.6, 99.6, 65.5, 65.2, 55.9, 55.8, 29.1 ppm; HRMS-ESI: m/z [M+Na]+ calcd for C.sub.20H.sub.23NNaO.sub.6: 396.1408, found: 396.1418.
(E)-N-Hydroxy-2-(2-(4-methoxyphenoxyoxy)butoxy)-4-methoxycinnamide (18c)
[0291] Following the procedure described for 8a, reaction of 17c (250 mg, 0.67 mmol) in THF (10 mL) was treated with ethyl chloroformate (109 mg, 1.00 mmol) and Et3N (0.19 mL, 1.34 mmol) gave 18c (166 mg, 64%) as a white solid: mp: 82-88 OC; .sup.1H NMR (500 MHz, [D6]DMSO): d=10.62 (s, 1H), 9.46 (s, 1H), 7.57 (d, J=15.9 Hz, 1H), 7.40 (d, J=8.4 Hz, 1H), 6.83 (d, J=9.4 Hz, 2H), 6.79 (d, J=9.4 Hz, 2H), 6.56 (s, 1H), 6.52 (d, J=8.4 Hz, 1H), 6.35 (d, J=15.9 Hz, 1H), 4.06 (t, J=5.7 Hz, 2H), 3.93 (t, J=5.7 Hz, 2H), 3.74 (s, 3H), 3.64 (s, 3H), 1.86 ppm (m, 4H); .sup.13C NMR (125 MHz, [D6]DMSO): d=164.2, 162.1, 158.8, 153.8, 153.1, 134.0, 129.9, 117.2, 116.7, 115.8, 115.1, 106.5, 99.6, 68.3, 68.0, 55.9, 55.8, 26.1, 25.8 ppm; HRMS-ESI: m/z [M.sub.H].sub. calcd for C.sub.21H.sub.24NO.sub.6: 386.1604, found: 386.1609.
(E)-N-Hydroxy-2-(2-(4-methoxyphenoxyoxy)pentyloxy)-4-methoxycinnamide (18d)
[0292] Following the procedure described for 8a, reaction of 17d (200 mg, 0.52 mmol) in THF (10 mL) with ethyl chloroformate (85 mg, 0.78 mmol) and Et.sub.3N (0.15 mL, 1.04 mmol) gave 18d (118 mg, 57%) as a colorless liquid: .sup.1H NMR (500 MHz, [D6]acetone): d=7.82 (d, J=15.7 Hz, 1H), 7.47 (d, J=8.4 Hz, 1H), 6.86 (d, J=9.4 Hz, 2H), 6.84 (d, J=15.7 Hz, 1H), 6.82 (d, J=9.4 Hz, 2H), 6.60 (d, J=2.2 Hz, 1H), 6.54 (dd, J=2.2, 8.4 Hz, 1H), 4.12 (t, J=6.4 Hz, 2H), 3.97 (t, J=6.4 Hz, 2H), 3.82 (s, 3H), 3.71 (s, 3H), 1.93 (m, 2H), 1.84 (m, 2H), 1.69 ppm (m, 2H); .sup.13C NMR (125 MHz, [D6]DMSO): d=162.4, 159.1, 153.9, 153.3, 135.1, 129.8, 116.8, 115.4, 114.5, 105.7, 99.0, 68.2, 68.1, 54.9, 28.9, 28.7, 22.6 ppm; HRMS-ESI: m/z [M.sub.H].sub. calcd for C.sub.22H.sub.26NO.sub.6: 400.1760, found: 400.1766.
(E)-N-Hydroxy-4-methoxy-2-phenylcinnamide (22a)
[0293] Following the procedure described for 8a, reaction of 21a (800 mg, 3.15 mmol) in THF (10 mL) with ethyl chloroformate (512 mg, 4.73 mmol) and Et.sub.3N (0.88 mL, 6.30 mmol) gave 22a (355 mg, 42%) as a white solid: mp: 100-102 OC; .sup.1H NMR (500 MHz, [D6]acetone): d=8.67 (br s, 1H), 7.66 (d, J=8.2 Hz, 1H), 7.55 (d, J=15.5 Hz, 1H), 7.47 (m, 2H), 7.39 (m, 1H), 7.33 (d, J=8.4 Hz, 2H), 6.98 (dd, J=2.5, 8.7 Hz, 1H), 6.88 (d, J=2.5 Hz, 1H), 6.41 (d, J=15.5 Hz, 1H), 3.89 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]acetone): d=164.7, 161.3, 145.1, 141.1, 138.6, 130.5, 129.1, 128.8, 128.4, 128.1, 126.4, 117.3, 115.9, 114.9, 114.7, 55.8 ppm; HRMS-ESI: m/z [M+Na]+ calcd for C.sub.16H.sub.15NNaO.sub.3: 292.0950, found: 292.0944.
(E)-N-Hydroxy-4-methoxy-2-(4-bromophenyl)cinnamide (22b)
[0294] Following the procedure described for 8a, reaction of 21b (500 mg, 1.51 mmol) in THF (10 mL) with ethyl chloroformate (245 mg, 2.27 mmol) and Et.sub.3N (0.42 mL, 3.02 mmol) gave 22b (204 mg, 39%) as a white solid: mp: 141-144 OC; .sup.1H NMR (500 MHz, [D6]DMSO): d=10.64 (s, 1H), 8.90 (s, 1H), 7.65 (d, J=8.2 Hz, 2H), 7.63 (d, J=8.7 Hz, 1H), 7.25 (d, J=8.2 Hz, 2H), 7.22 (d, J=15.6 Hz, 1H), 7.02 (dd, J=2.1, 8.7 Hz, 1H), 6.84 (d, J=2.1 Hz, 1H), 6.28 (d, J=15.6 Hz, 1H), 3.80 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=163.4, 160.3, 142.6, 139.4, 136.4, 132.1, 131.8, 128.3, 125.6, 121.7, 118.6, 115.4, 115.1, 55.9 ppm. HRMS-ESI: m/z [M+Na]+ calcd for C.sub.16H.sub.14BrNNaO.sub.3: 370.0055, found: 370.0049.
(E)-N-Hydroxy-4-methoxy-2-(naphthalen-1-yl)cinnamide (22 c)
[0295] Following the procedure described for 8a, reaction of 21c (1.00 g, 3.29 mmol) in THF (15 mL) with ethyl chloroformate (533 mg, 4.93 mmol) and Et.sub.3N (0.92 mL, 6.58 mmol) gave 22c (619 mg, 59%) as a white solid: mp: 125-127 OC; .sup.1H NMR (500 MHz, [D6]DMSO): d=8.00 (d, J=8.2 Hz, 2H), 7.74 (d, J=8.8 Hz, 1H), 7.59 (t, J=7.9 Hz, 1H), 7.52 (t, J=7.2 Hz, 1H), 7.42 (t, J=7.9 Hz, 1H), 7.33 (d, J=6.8 Hz, 1H), 7.30 (d, J=8.4 Hz, 1H), 7.11 (dd, J=2.6, 8.8 Hz, 1H), 6.83 (d, J=15.6 Hz, 1H), 6.82 (d, J=2.5 Hz, 1H), 6.25 (d, J=15.6 Hz, 1H), 3.79 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=163.3, 160.3, 142.4, 137.9, 136.2, 133.6, 132.0, 128.8, 128.6, 127.7, 127.5, 127.0, 126.9, 126.6, 125.9, 118.0, 116.3, 115.1, 55.9 ppm; HRMS-ESI: m/z [M+Na]+ calcd for C.sub.20H.sub.17NNaO.sub.3: 342.1106, found: 342.1101.
(E)-N-Hydroxy-4-methoxy-2-(biphenyl-4-yl)cinnamide (22d)
[0296] Following the procedure described for 8a, reaction of 21d (800 mg, 2.42 mmol) in THF (15 mL) with ethyl chloroformate (393 mg, 3.64 mmol) and Et.sub.3N (0.68 mL, 4.84 mmol) gave 22d (326 mg, 39%) as a white solid: mp: 76-79 OC; .sup.1H NMR (500 MHz, [D6]DMSO): d=7.76 (d, J=8.1 Hz, 1H), 7.73 (d, J=7.7 Hz, 2H), 7.65 (d, J=8.7 Hz, 1H), 7.48 (t, J=7.7 Hz, 2H), 7.39 (d, J=8.1 Hz, 3H), 7.35 (d, J=15.0 Hz, 1H), 7.02 (dd, J=2.6, 8.7 Hz, 1H), 6.90 (d, J=2.6 Hz, 1H), 6.32 (d, J=15.0 Hz, 1H), 3.82 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=163.5, 160.4, 143.5, 140.0, 139.9, 139.3, 136.9, 130.6, 129.5, 128.3, 128.1, 127.2, 127.1, 125.6, 118.3, 115.4, 114.9, 55.9 ppm; HRMS-ESI: m/z [M+Na]+ calcd for C.sub.22H.sub.19NNaO.sub.3: 368.1263, found: 368.1257.
(E)-N-Hydroxy-4-methoxy-2-(4-phenoxyphenyl)cinnamide (22e)
[0297] Following the procedure described for 8a, reaction of 21e (800 mg, 2.31 mmol) in THF (15 mL) with ethyl chloroformate (374 mg, 3.47 mmol) and Et.sub.3N (0.65 mL, 4.62 mmol) gave 22e (417 mg, 50%) as a white solid: mp: 75-78 OC; .sup.1H NMR (500 MHz, [D6]DMSO): d=7.61 (d, J=8.7 Hz, 1H), 7.42 (t, J=8.1 Hz, 1H), 7.42 (d, J=15.8 Hz, 1H), 7.30 (d, J=8.5 Hz, 3H), 7.18 (t, J=7.4 Hz, 1H), 7.10 (d, J=8.0 Hz, 2H), 7.05 (d, J=8.5 Hz, 2H), 6.99 (dd, J=2.6, 8.7 Hz, 1H), 6.85 (d, J=2.6 Hz, 1H), 6.28 (d, J=15.8 Hz, 1H), 3.80 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=163.5, 160.3, 157.1, 156.5, 143.3, 136.9, 135.0, 131.6, 130.7, 128.3, 125.7, 124.5, 119.8, 118.3, 118.2, 115.5, 114.7, 55.8 ppm; HRMS-ESI: m/z [M+Na]+ calcd for C.sub.22H.sub.19NNaO.sub.4: 384.1212, found: 384.1206.
(E)-N-Hydroxy-4-methoxy-2-(4-benzoylphenyl)cinnamide (22f)
[0298] Following the procedure described for 8a, reaction of 21 f (900 mg, 2.51 mmol) in THF (20 mL) with ethyl chloroformate (406 mg, 3.77 mmol) and Et.sub.3N (0.71 mL, 5.02 mmol) gave 22 f (487 mg, 52%) as a white solid: mp: 71-73 OC; .sup.1H NMR (500 MHz, [D6]DMSO): d=7.83 (d, J=8.0 Hz, 2H), 7.78 (d, J=7.6 Hz, 2H), 7.68 (d, J=7.3 Hz, 1H), 7.67 (d, J=7.6 Hz, 1H), 7.58 (t, J=7.6 Hz, 2H), 7.50 (d, J=8.0 Hz, 2H), 7.29 (d, J=15.6 Hz, 1H), 7.06 (dd, J=2.3, 8.6 Hz, 1H), 6.92 (d, J=2.3 Hz, 1H), 6.31 (d, J=15.6 Hz, 1H), 3.82 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=195.8, 163.4, 160.4, 144.5, 142.8, 137.5, 136.5, 136.4, 133.2, 130.3, 130.2, 130.1, 129.1, 128.5, 125.6, 118.8, 115.4, 55.9 ppm; HRMS-ESI: m/z [M+Na]+ calcd for C.sub.23H.sub.19NNaO.sub.4: 396.1212, found: 396.1206.
(E)-N-Hydroxy-4-methoxy-2-(dibenzofuran-4-yl)cinnamide (22g)
[0299] Following the procedure described for 8a, reaction of 21g (1.00 g, 2.91 mmol) in THF (20 mL) with ethyl chloroformate (470 mg, 4.36 mmol) and Et.sub.3N (0.82 mL, 5.82 mmol) gave 22g (532 mg, 51%) as a white solid: mp: 158-161 OC; .sup.1H NMR (500 MHz, [D6]DMSO): d=8.21 (d, J=7.7 Hz, 1H), 8.19 (d, J=7.7 Hz, 1H), 7.74 (d, J=8.5 Hz, 1H), 7.60 (d, J=8.2 Hz, 1H), 7.49 (q, J=7.5 Hz, 2H), 7.41 (d, J=7.5 Hz, 1H), 7.38 (d, J=7.2 Hz, 1H), 7.11 (dd, J=2.5, 8.5 Hz, 1H), 7.10 (d, J=15.6 Hz, 1H), 7.01 (d, J=2.5 Hz, 1H), 6.30 (d, J=15.6 Hz, 1H), 3.82 ppm (s, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=163.3, 160.4, 156.0, 153.4, 138.5, 136.2, 129.2, 128.3, 127.9, 126.5, 124.5, 124.3, 124.0, 123.7, 121.8, 121.4, 118.3, 116.3, 115.4, 112.3, 55.9 ppm; HRMS-ESI: m/z [M+Na]+ calcd for C.sub.22H.sub.17NNaO.sub.4: 382.1055, found: 382.1050.
(E)-N-Hydroxy-4-propoxy-2-phenylcinnamide (27a)
[0300] NaOH (120 mg, 3.01 mmol) in 50% NH.sub.2OH(aq) (2 mL) in an ice bath was added to a solution of 26a (170 mg, 0.60 mmol) in MeOH/THF (1 mL: 1 mL). The resulting solution was then warmed to room temperature and stirred for an additional 3 h. The reaction was diluted with distilled water (50 mL), acidified with 1n HCl(aq) to pH 6-7, and extracted with EtOAc (25 mL3). The organic layer was dried (Na.sub.2SO.sub.4) and filtered, and the solvent was removed in vacuo. The residue was purified by silica gel chromatography (MeOH/CH.sub.2Cl.sub.2, 3:97) to give 27a (90 mg, 51%) as a white solid: mp: 147-150 C.; .sup.1H NMR (500 MHz, [D6]DMSO): d=10.22 (s, 1H), 7.69 (d, J=8.5 Hz, 1H), 7.54 (d, J=15.4 Hz, 1H), 7.42 (m, 3H), 7.33 (m, 2H), 6.97 (dd, J=2.5, 8.5 Hz, 1H), 6.87 (d, J=2.5 Hz, 1H), 6.39 (d, J=15.4 Hz, 1H), 4.03 (t, J=6.6 Hz, 2H), 1.78 (m, 2H), 1.01 ppm (t, J=7.5 Hz, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=163.5, 159.8, 140.0, 140.2, 136.9, 130.0, 128.8, 128.2, 128.1, 125.4, 118.0, 116.0, 115.1, 69.7, 22.5, 10.8 ppm; HRMS-ESI: m/z [M+Na]+ calcd for C.sub.18H.sub.19NNaO.sub.3: 320.1263, found: 320.1257.
(E)-N-Hydroxy-4-butoxy-2-phenylcinnamide (27b)
[0301] NaOH (100 mg, 2.50 mmol) in 50% NH.sub.2OH(aq) (2 mL) in an ice bath was added to a solution of 26b (162 mg, 0.50 mmol) in MeOH/THF (1 mL:1 mL). Following the procedure as described for 27a gave 27b (88 mg, 57%) as a white solid: mp: 140-144 C.; .sup.1H NMR (500 MHz, [D6]DMSO): d=10.61 (s, 1H), 8.87 (s, 1H), 7.61 (d, J=8.7 Hz, 1H), 7.45 (d, J=15.7 Hz, 1H), 7.42 (m, 2H), 7.28 (m, 3H), 6.99 (dd, J=2.3, 8.7 Hz, 1H), 6.82 (d, J=2.3 Hz, 1H), 6.28 (d, J=15.7 Hz, 1H), 4.02 (t, J=7.4 Hz, 2H), 1.69 (m, 2H), 1.41 (m, 2H), 0.91 ppm (t, J=7.4 Hz, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=163.5, 159.8, 144.0, 140.2, 136.9, 130.0, 128.8, 128.1, 125.4, 118.0, 115.9, 115.2, 67.9, 31.2, 19.2, 14.2 ppm; HRMS-ESI: m/z [M+Na]+ calcd for C.sub.19H.sub.21NNaO.sub.3: 334.1419, found: 334.1414.
(E)-N-Hydroxy-4-pentoxy-2-phenylcinnamide (27c)
[0302] NaOH (100 mg, 2.50 mmol) in 50% NH.sub.2OH(aq) (2 mL) in an ice bath was added to a solution of 26c (169 mg, 0.50 mmol) in MeOH/THF (1 mL: 1 mL). Following the procedure as described for 27a gave 27c (86 mg, 53%) as a white solid: mp: 121-124 C.; .sup.1H NMR (500 MHz, [D6]DMSO): d=10.61 (s, 1H), 9.47 (s, 1H), 7.62 (d, J=8.7 Hz, 1H), 7.47 (d, J=15.6 Hz, 1H), 7.46 (m, 1H), 7.42 (m, 1H), 7.29 (m, 3H), 7.00 (dd, J=2.6, 8.7 Hz, 1H), 6.83 (d, J=2.6 Hz, 1H), 6.29 (d, J=15.6 Hz, 1H), 4.02 (t, J=6.5 Hz, 2H), 1.71 (m, 2H), 1.36 (m, 4H), 0.88 ppm (t, J=6.5 Hz, 3H); .sup.13C NMR (125 MHz, [D6]DMSO): d=163.5, 159.8, 158.4, 144.0, 140.2, 136.9, 130.0, 128.8, 128.1, 128.0, 125.4, 118.0, 115.9, 115.2, 68.2, 28.8, 28.1, 22.3, 14.4 ppm; HRMS-ESI: m/z [M+Na]+ calcd for C.sub.20H.sub.23NNaO.sub.3: 348.1576, found: 348.1570.
(E)-N-Hydroxy-2,4-diphenylcinnamide (27d)
[0303] NaOH (191 mg, 4.78 mmol) in 50% NH.sub.2OH(aq) (4 mL) in an ice bath was added to a solution of 32 (300 mg, 0.96 mmol) in MeOH/THF (2 mL:2 mL) was added. Following the procedure as described for 27a gave 27d (133 mg, 44%) as a white solid: mp: 135-137 OC; .sup.1H NMR (500 MHz, [D6]DMSO): d=7.64 (d, J=15.4 Hz, 1H), 7.74 (d, J=7.4 Hz, 2H), 7.71 (dd, J=1.5, 8.2 Hz, 1H), 7.63 (d, J=1.5 Hz, 1H), 7.49 (m, 3H), 7.45 (m, 1H), 7.42 (m, 3H), 7.32 (m, 1H), 6.58 ppm (d, J=15.4 Hz, 1H); .sup.13C NMR (125 MHz, [D6]DMSO): d=163.1, 142.9, 141.4, 140.2, 139.6, 136.8, 132.2, 130.2, 129.5, 129.4, 128.9, 128.4, 128.1, 127.4, 127.3, 126.7, 120.5 ppm; HRMS-ESI: m/z [M+Na]+ calcd for C.sub.21H.sub.17NNaO.sub.2: 338.1157, found: 338.1151.
Example 3. Initial Biological Evaluation
[0304] The para-benzyl N-hydroxycinnamides 8a-f and ortho-benzyl N-hydroxycinnamides 13a-e were screened for inhibitory activity against HDAC8 at a concentration of 1 m, using SAHA as a reference compound. Ortho-substituted series 13a-e showed higher potency than parasubstituted 8a-f. Compounds 13a, 13c, and 13d were further evaluated for IC.sub.50 values against HDAC8, as well as against HeLa nuclear extract that contained mainly HDACs1-3, to analyze isoform selectivity (Table 4).
TABLE-US-00004 TABLE 4 Inhibition of HDAC8 and HeLa nuclear HDAC by compounds 13a, 13c, and 13d.
[0305] These compounds appeared to prefer HDAC8 (IC.sub.50=206-613 nm) over other class I isoforms (IC.sub.50>10 000 nm), suggesting that the ortho-oriented benzyl group may exploit the secondary hydrophobic surface pocket of HDAC8.
[0306] Next, N-hydroxycinnamides 18a-d were synthesized with various linker chains added to the ortho-aryl groups, as well as ortho-phenyl N-hydroxycinnamide 22a with a shortened linker chain (Table 5, Table 6).
TABLE-US-00005 TABLE 5 Inhibition of HDAC8 and HeLa nuclear HDAC by compounds with varying chain length (n).
[0307] Although the enzyme inhibitory activity of compounds 18a-d (IC.sub.50=112-191 nm) were all increased relative to the original benzyl-substituted series, compound 22a with no flexible linker showed the best HDAC8 inhibitory activity (IC50=72 nm), which was compatible to PCI34051 (IC.sub.50=56 nm).
[0308] We further performed molecular docking for HDAC8 crystal structure with compound 22a and PCI34051, which showed that further hydrophobic incorporation into the ortho-phenyl moiety of compound 22a may potentially make additional contacts to the active site of HDAC8. To test the molecular modeling results, we synthesized compounds 22b-g and 27a-d and examined the resulting compounds for enzyme inhibitory activity. Compounds 22b, 22d, 22 f, and 22g showed inhibitory activities superior to PCI34051 for HDAC8; in particular, 22b and 22d were around ten- and two-fold more potent, respectively. Compound 22b was 13-fold more potent than 22a, suggesting that introduction of a para-bromo group results in a significant increase in binding affinity. Compounds 22d and 22 f-g were two- to threefold more potent than 22a, indicating that the introduction of additional coplanar phenyl group leads to an increase in activity. Compound 22e was three-fold less potent than 22a, suggesting that the dramatic loss of activity is perhaps due to the twisted phenyl conformation adopted in ether moiety. The para-alkyl-substituted phenyl N-hydroxycinnamides 27a-d were approximately two- to fourfold less potent than 22a, suggesting that increasing the carbon chain length attached to the para-oxygen position weakens binding affinity.
TABLE-US-00006 TABLE 6 Inhibition of HDAC8 and HeLa nuclear HDAC by compounds 22a-g and 27a-d.
[0309] We evaluated the potent HDAC8 inhibitors 22b, 22d, 22 f, and 22g for anti-proliferative activity in human lung cancer cell lines, including A549 cells, H1299 cells, CL-1 cells, and CL1-5 cells using SAHA and PCI34051 as reference compounds (Table 7).
TABLE-US-00007 TABLE 7 Cytotoxicity of compounds 22b, 22d, 22 f, and 22g against various lung cancer cell lines. IC.sub.50 [nM].sup.[a] Compound A549 H1299 Cl1-1 Cl1-5 22b >10 >10 >10 >10 22d 7.9 1.5 7.2 0.7 >10 7.0 1.5 22f >10 8.4 0.2 >10 >10 22g >10 6.6 0.7 8.5 1.2 8.7 0.1 SAHA 1.5 0.7 4.9 0.3 2.9 0.5 6.2 0.6 PCI34051 >10 >10 >10 >10 .sup.[a]Data are expressed as the mean_SD of three determinations.
[0310] Compound 22b exhibited low cytotoxicity in all four cancer cell lines. In addition, compounds 22d and 22g showed higher cytotoxicity than PCI34051 in three cancer cell lines. Although compound 22d showed moderate anti-proliferative effects in human lung cancer A549 and H1299 cells, it exhibited activity similar to that of SAHA in CL1-5 cells with no significant cytotoxicity in normal IMR-90 cells. The HDAC8 level in CL1-5 is higher than that in H1299 and A549. To verify whether these compounds were HDAC8-selective, we tested inhibitory activities of compounds 22b and 22d against a panel of purified HDACs, including class I (HDAC1, 2, 3),[28] class II (HDAC4, 6, 10)[29] and class IV (HDAC11)[30] enzymes. Table 8 shows that these compounds were inactive toward most other HDACs and had limited activity against HDAC1 and 3.
TABLE-US-00008 TABLE 8 Inhibition of class I (1, 2, 3), II (4, 6, 10), and IV (11) HDACs by compounds 22b, 22d, and PCI34051. IC.sub.50 [nM].sup.[a] Compound 1 2 3 4 6 10 11 22b 4.5 0.1 >20 4.8 0.5 >20 >20 >20 >20 22d 3.0 0.2 >20 3.0 0.1 >20 >20 >20 >20 PCI34051 7.5 0.4 >20 >20 >20 >20 >20 >20 .sup.[a]Data are expressed as the mean_SD of three determinations.
Example 4. Inhibition of HDAC8 Reactivates p53 and Abrogates Leukemia Stem Cell Activity in CBF-SMMHC Associated Acute Myeloid Leukemia
[0311] Introduction.
[0312] Acute myeloid leukemia (AML) arises from disordered hematopoiesis as a consequence of multiple cooperative mutations or alternations disrupting differentiation, proliferation and survival programs in hematopoietic progenitors. Recurrent chromosomal abnormalities in AML involve transcription factor fusion proteins that contribute to unique etiology and prognosis [1]. The core-binding factor (CBF) transcription complex is a regulator of hematopoietic development and a frequent target of leukemia associated chromosomal translocation or inversion [2]. A functional CBF complex consists of a DNA-binding a subunit (RUNX1, RUNX2, RUNX3) and a non-DNA binding subunit (CBF), which increases DNA-binding affinity and may be essential for transactivation activity [3-5]. Chromosomal 16 inversion, inv(16)(p13.1q22) or t(16;16)(p13.1;q22) is found in approximately 5-12% of AML patients and is associated with the FAB M4Eo AML subtype [6-11]. This inversion results in fusion of CBFB with the MYH11 gene, which encodes a smooth muscle myosin heavy chain (SMMHC) protein [12]. The CBFB-MYH11 fusion gene encodes a fusion protein CBF-SMMHC, which retains the RUNX1 binding interface of CBF and the coiled-coil rod region of SMMHC. A knock-in allele for Cbfb-MYH11 was previously generated in mice and resultant Cbfb-MYH11 heterozygotes showed a profound defect in definitive hematopoiesis and exhibited lethal hemorrhage at E12.5 [13]. These phenotypes are identical to those of Runx1- or Cbfb-null mice [14,15], suggesting that CBF-SMMHC is a dominant inhibitor of CBF function. Using a conditional Cbfb-MYH11 knock-in mouse model, we showed that CBF-SMMHC expression in adult hematopoietic stem cells (HSCs) leads to impaired differentiation of multiple hematopoietic lineages and produces pre-leukemic stem and progenitor populations at risk for acquiring cooperating alterations required for AML transformation [16].
[0313] Dominant inhibition of RUNX1 has been considered the main function of CBF-SMMHC. CBF-SMMHC was shown to contain an additional RUNX1 binding site within SMMHC near the inversion breakpoint, and thus binds to RUNX1 with a much higher affinity than CBF [17]. Therefore, it is proposed that CBF-SMMHC transdominantly inhibits RUNX1 function through high affinity binding and cytoplasmic sequestration [18,19]. Meanwhile, CBF-SMMHC was shown to interact with the mSin3A corepressor and histone deacetylase 8 (HDAC8), supporting an alternative model where CBF-SMMHC converts RUNX1 to a constitutive transcriptional repressor [20,21]. We showed that elevated levels of Runx2 expression enhances CBF-SMMHC-mediated leukemic transformation while loss of one Runx2 allele reduces and delays leukemogenesis [22]. This genetic evidence suggests that the leukemogenic function of CBF-SMMHC is in fact dependent on functional RUNX proteins rather than RUNX inhibition. Studies demonstrated that the high affinity RUNX1 binding domain of CBF-SMMHC is dispensable for leukemogenesis [23]. In addition, RUNX1 activity is required for the growth and maintenance of inv(16) AML cells [24,25].
[0314] The tumor suppressor p53 is a genomic guardian that centrally coordinates cellular responses including cell cycle progression, DNA repair, and apoptosis. Genetic mutations that inactivate p53 function occur in approximately half of all cases of human cancer; however, these TP53 mutations are relatively rare in de novo AML (approximately 10%). TP53 mutation in AML is correlated with complex karyotype, drug resistance and dismal outcome [26-28]. Loss of p53 is shown to promote AML pathogenesis in mice by enabling aberrant self-renewal [29]. Wide spectrum post-translational modifications including phosphorylation, acetylation, ubiquitination, methylation, sumoylation and neddylation act to coordinate and modulate specific functions of p53 [30]. Given the low TP53 mutation rate, alternative mechanisms affecting protein stability or modifications are expected to be involved in disrupting p53 function during AML pathogenesis.
[0315] HDACs are a family of enzymes that catalyze the removal of acetyl moieties from -amino groups of lysine residues in a variety of proteins, including histones and transcription factors, and thus play crucial roles in chromatin remodeling and regulation of gene expression. HDAC8 is a class I HDAC, maps to the X chromosome q13 [31-33], and is likely important for diverse biological functions, including smooth muscle contraction [34], telomere protection [35], skull morphogenesis [36], and regulation of cohesin dynamics [37]. HDAC8 is highly expressed in myeloid and lymphoid leukemia cell lines [33] and is likely overexpressed in multiple tumor types, including neuroblastoma, glioma [38] and childhood acute lymphoblastic leukemia [39]. Although HDAC8 has been shown to interact with CBF-SMMHC [21], its role in AML pathogenesis and maintenance remains unclear.
[0316] Without being bound by any particular theory, we hypothesized that p53 activity is disrupted by the leukemogenic CBF-SMMHC fusion protein. We demonstrate that CBF-SMMHC impairs p53 through a previously unknown mechanism involving post-translational modification by HDAC8. Our results provide new molecular insights into the leukemogenic mechanism driven by inv(16) and highlight the therapeutic opportunity of reactivating p53 by HDAC8 inhibition.
[0317] Experimental Methods
[0318] Mice.
[0319] All Cbfb.sup.56M/+ [16] and the Mx1-Cre [58] mice used were backcrossed to C57BL/6 for more than 8 generations. Ai14 Cre reporter tdTomato mice on C57BL/6 background were obtained from the Jackson Laboratory. To induce CBF-SMMHC expression, 4-6 week old Mx1-Cre/Cbfb.sup.56M/+ mice were injected with 250 g of polyinosinic-polycytidylic acid (pIpC) (InvivoGen) every 2 days for 7 doses. Similarly treated Cbfb.sup.56M/+ littermates without Cre were used as control. Pre-leukemic cells were isolated from mice 2 weeks after the last dose of pIpC treatment. For leukemia development, induced mice were monitored up to 6 months and analyzed when moribund. Transplantation of AML cells (210.sup.6 cells/mouse) was performed via tail vein injection into sub-lethally irradiated (6.5 Gy) 6-8-week-old congenic C57BL/6 mice (CD45.1.sup.+/CD45.2.sup.+). All mice were maintained in an AAALAC-accredited animal facility at City of Hope, and all experimental procedures involving mice were performed in accordance with federal and state government guidelines and established institutional guidelines and protocols approved by the Institutional Animal Care and Use Committee at Beckman Research Institute of City of Hope.
[0320] Human Samples.
[0321] Cord blood (CB) samples were provided by Stemcyte (Arcadia, Calif.). Mobilized peripheral blood stem cells (PBSC) were obtained from healthy donors (City of Hope). Inv(16).sup.+ AML samples were obtained from previously untreated patients at the City of Hope. See Table 6X following for characteristics of human samples for studies disclosed herein. CD34.sup.+ cell isolation was performed using magnetic beads (StemCell Technologies, Vancouver, BC, Canada). Leukopheresis samples were processed for CD34.sup.+ cell selection with CliniMACS (Miltenyi Biotech, Germany). All subjects signed an informed consent form. Sample acquisition was approved by the Institutional Review Boards at the City of Hope, in accordance with an assurance filed with and approved by the Department of Health and Human Services.
TABLE-US-00009 TABLE 9 Characteristics of patient samples Sample Disease State ID Sex Age Diag. FAB Class. Type at Collection Risk Status AML020 F 47 AML M4eo PB Untreated Better-risk AML021 F 42 AML M4 BM Untreated Better-risk AML033 M 69 AML non-classified PB Untreated Intermediate risk AML041 F 56 AML M2 PB Untreated Better-risk AML111 M 51 AML M2 BM Untreated Intermediate-risk AML163 M 57 AML M4 PB Relapsed Intermediate-risk AML319 F 46 AML M4 PB Untreated Better-risk AML987 M 50 AML M4 PB Relapsed Intermediate-risk AML1052 F 23 AML M4 BM Relapsed Intermediate-risk AML1070 F 37 AML M4Eo BM Relapsed Better-risk AML270 M 61 AML PB Untreated Poor-risk AML467 F 61 AML PB Untreated Poor-risk AML578 M 38 AML M5b PB Refractory/ Poor-risk Induction failure AML865 F 60 AML PB Untreated Poor-risk Blasts Blasts ID Cytogenetic Other mutation WBC in PB in BM AML020 inv(16) FLT-3 ITD Neg 50.8 67 90 AML021 inv(16) 39.2 60 40 AML033 inv(16), trisomy 22 6.3 30 98 AML041 inv(16), trisomy 8 38.8 63 44 AML111 Inv(16), trisomy 8, 13.4 70 75 trisomy 21 AML163 t(16; 16), trisomy 21, 82.8 94 67 trisomy 22 AML319 CBFB/16q22 1.4 0 rearrangement AML987 t(16; 16), trisomy22, FLT-3 ITD Neg, 64.1 90 CBFB rearrangement FLT-3 D835 Pos., NPM1 Neg., C-KIT Neg AML1052 inv(16), trisomy 8, FLT-3 ITD Neg, 9.9 64 87 trisomy 22 FLT-3 D835 Neg AML1070 der(16) inv(16) (p13.1q22) NPM1 neg 2.7 3 30 del(16) (q22.1q22.?2) [16]/[22] 44% CBFB rearrangement by FISH AML270 Complex abnormalities, FLT-3 ITD Neg 4.4 5 50 including 11q23, MLL gain, loss of TP53/17p13.1, add(2), add(5), add(22), ider(11), del(11) AML467 Complex abnormalities FLT-3 ITD Neg, 44.7 51 80 with trisomy 8, trisomy FLT-3 D835 Neg 9 and trisomy 22 AML578 Trisomy 8, del(9q), FLT-3 ITD Pos, 1.3 41 8 t(2; 18), trisomy 13 FLT-3 D835 Neg, NPM1 Neg AML865 Normal cytogenetics FLT-3 ITD Pos, 86.3 90 90 FLT-3 D835 Neg, JAK2 Neg
[0322] Cell Transduction and Flow Cytometry.
[0323] Bone marrow cells were isolated as previously described [59]. Cell culture employed conditions well known in the art. Bone marrow cells or 32D cells were transduced with MSCV-ires-GFP (MIG) based retroviruses or lentiviruses (pLKO.1 or HIV-7) [40] by spinoculation in the presence of 5 ug/mL polybrene (American Bioanalytical, Natick, Mass.). Human CD34.sup.+ cells were transduced with pLKO.1 lentivirus by two rounds of spinoculation. Cell sorting was performed on a 4-laser, 15-detector FACSAria-III or a 6-laser, 18-detector FACSAria II SORP (BD Bioscience, San Jose, Calif.). Cell proliferation and apoptosis assays were conducted as well known in the art.
[0324] Immunoprecipitation (IP) and Western Blotting.
[0325] Cells were lysed in RIPA buffer containing protease inhibitor cocktail (Roche) and MG132. Antibodies used for IP were conjugated with protein A/G beads using the antibody cross-linking kit (Pierce Biotechnology, Rockford, Ill.) following manufacturer's protocol. For Western blot, proteins were resolved in 10% SDS-PAGE. The antibodies used induced anti-FLAG (Sigma), anti-HDAC8, anti-CBF (Santa Cruz), anti-p53 (DO-1), anti-Ac-p53 (K379) (Cell Signaling), anti-p53 (Cell signaling) and anti--actin (Sigma). Horseradish peroxidase-conjugated anti-rabbit or anti-mouse secondary antibodies (Jackson ImmunoResearch, West Grove Pa.) were used, followed by detection using the SuperFemto kit (Pierce Biotechnology, Rockford, Ill.).
[0326] DUOLINK In Situ Proximity Ligation Assay (PLA).
[0327] The DUOLINK kit (Sigma, St. Louis, Mo.) was used to perform in situ proximity ligation assay (PLA) following manufacturer suggested procedures. Antibodies used included mouse anti-CBF (Santa Cruz), rabbit anti-Ac-p53 (K379) (Cell Signaling) and rabbit anti-p53 (Cell Signaling). Slides were mounted using in anti-fade media containing DAPI (Santa Cruz) and imaged using a Zeiss upright LSM 510 2-photon confocal microscope.
[0328] Statistics.
[0329] Statistical analyses were performed with Student's t test or analysis of variance (ANOVA) for normal distribution. Mann-Whitney U tests were performed when normal distribution was not satisfied. p value less than 0.05 was considered statistically significant (*p<0.05; **p<0.01; ***p<0.001).
[0330] Results and Discussion
[0331] CBF-SMMHC Expression Impairs Activation and Acetylation of p53.
[0332] Without being bound by any particular theory, we hypothesized that CBF-SMMHC exerts its leukemogenic function through affecting molecular and cellular processes operating to safeguard genome integrity. Since p53 represents the master genomic guardian, we tested whether CBF-SMMHC fusion protein impairs p53 function. We generated myeloid progenitor 32D cell lines (p5.sup.3 wild type) expressing CBF-SMMHC (CM) or CBF (all FLAG-tagged) through MSCV-ires-GFP (MIG) retroviral transduction, and sorting of GFP.sup.+ transduced cells. We performed quantitative RT-PCR analysis to analyze induction of p53 target genes including p21 Cdkn1a, Mdm2, Bid, Bax, and Gadd45b in 32D cells after -irradiation (IR) (3 Gy, 24 h). Compared to control cells expressing CBF, CM-expressing cells partially or completely inhibited induction of p53 targets (
[0333] Acetylation of p53 protein is important for protein stabilization and its transcriptional activity. Using western blot analysis with an antibody against an acetylated (Ac)-form of p53 (K379), we tested the effect of CM on p53 acetylation in response to IR (3Gy)-induced DNA damage. The level of Ac-p53 was markedly reduced in CM-expressing cells compared to control cells expressing CBF at all time points (2, 4, 6, 12 h) analyzed (
[0334] CBF-SMMHC Forms an Aberrant Protein Complex with p53 and HDAC8.
[0335] To determine how CM fusion protein impairs p53 activity, we tested whether the CM fusion protein interacts with the p53 protein. We performed co-immunoprecipitation (co-IP) with anti-p53 antibody followed by western blot analysis with anti-CBF antibody in 32D-CM cells compared to 32D-CBF cells. The results showed that anti-p53 is able to pull down CM fusion protein, but not CBF (
[0336] It has been reported that CBF-SMMHC interacts with HDAC8 through the C-terminal SMMHC region [21]. Therefore, we assessed whether CM forms a multimeric complex with HDAC8 and p53 by sequential IP followed by western blot analysis to detect co-immunoprecipitating proteins. We performed primary IP with either anti-HDAC8 or anti-p53 antibodies, and secondary IP with anti-CBF followed by western blot using anti-p53 (
[0337] HDAC8 Mediates the Deacetylation of p53 Associated with CBF-SMMHC.
[0338] Class 1 HDACs, including HDAC1, HDAC2, and HDAC3, reportedly could inhibit p53 activity by deacetylating p53 [41-43]. Based on our observation that p53 acetylation is reduced and that CM forms a protein complex with HDAC8 and p53, without being bound by any particular theory, we hypothesized that HDAC8 mediates the aberrant deacetylation of p53 in CM-expressing cells. To test this, we used lentivirus (pLKO. 1) mediated expression of 2 independent small-hairpin (sh)-RNA sequences against Hdac8 to specifically knock-down Hdac8 in 32D-CM cells. Cells were exposed to IR (3Gy) and analyzed for levels of p53 acetylation 6 h after. Silencing of HDAC8 led to robust increase in Ac-p53 levels while total p53 levels were not affected (
[0339] We next examined whether enhanced p53 acetylation translate into increased p53 transcriptional activity. Using qRT-PCR assay, we accessed induction of p53 target genes in CM-C95, CM, and CBF expressing cells upon IR (3Gy). For target genes assessed, we observed restored activation in CM-C95 cells and a significant increase compared to full-length CM could be detected for most targets (
[0340] Pharmacologic Inhibition of HDAC8 Activates p53 and Selectively Induces Apoptosis of Inv(16).sup.+ AML Stem and Progenitor Cells.
[0341] Given that the frequency of TP53 mutation is relatively low in AML, altered post-translational modification by HDAC8 could represent an alternative p53-inactivating mechanism and contribute to drug resistance of AML stem cells. We first examined the expression of HDAC8 in CD34.sup.+ stem and progenitor cells isolated from patients with inv(16).sup.+ AML compared to normal mobilized peripheral blood stem cells (PBSC). Significant elevation in HDAC8 expression was observed in inv(16).sup.+ AML CD34.sup.+ cells (n=7; p=0.0003) compared to normal CD34.sup.+ cells (n=7) (
[0342] Similar to results obtained in mouse models, we detected protein-protein interaction between CM and p53 in CD34.sup.+ cells isolated from inv(16).sup.+ AML patients (
[0343] Consistent with the enhanced acetylation, 22d treatment also significantly induced expression of p53 target genes, particularly apoptosis related genes (
[0344] Pharmacologic Inhibition of HDAC8 Abrogate Leukemia Initiating Activity of CBF-SMMHC.sup.+ LSCs.
[0345] AML LSCs are functionally characterized by their capacity to engraft and reproduce AML disease in transplanted host. We reason that p53 activation induced by HDAC8i could reduce or eliminate LSC engraftment and leukemia-initiating capacity. To test this, we made use of our murine CM-induced AML model allowing for high-level engraftment and reproducible disease upon secondary transplantation. To facilitate tracking of CM-expressing AML cells, we created Cbfb.sup.56M/+/Mx1-Cre mice with a Cre-reporter line expressing tdTomato fluorescence protein following Cre-mediated recombination. AML can be induced in Cbfb.sup.56M/+/Mx1-Cre/tdTomato.sup.+ mice 3-6 months following pIpC and the AML cells are predominately dTomato.sup.+/cKit.sup.+ (data not shown). Freshly isolated AML cells (210.sup.6) from BM of moribund animals were treated with 22d (10 M) or vehicle for 48 h before transplanting into sub-lethally irradiated congenic recipients (
[0346] We performed preclinical studies to determine the efficacy of in vivo administration of 22d. AML cells (110.sup.6 or 210.sup.6) were directly transplanted into sub-lethally irradiated congenic recipients. After 5-6 weeks, transplanted mice were randomized into two groups, one group treated with vehicle and the other treated with 22d by intraperitoneal injection (50 mg/kg/dose) twice a day for 2 weeks (
[0347] AML transformation requires multiple genetic and/or epigenetic alterations, which cooperatively impair differentiation, and confer proliferation and survival signals. Previous studies demonstrated that CBF-SMMHC expression dominantly inhibits CBF/RUNX1 function and disrupts hematopoietic differentiation [13,16,46,47]. It has been long thought that dominant inhibition of CBF/RUNX1 function underlies the leukemogenic function of CBF-SMMHC. However, recent genetic studies suggested that CBF-SMMHC-mediated leukemogenesis requires functional Runx proteins [22], and that RUNX1 dominant inhibition is not essential for transformation [23]. On the contrary, RUNX1 activity is now shown to be required for the growth and survival of AML cells, including RUNX1-ETO and CBF-SMMHC associated leukemia [24,25]. Recent genome wide binding analyses further revealed that CBF-SMMHC binds to target DNA in a RUNX1-dependent manner [48]. In this study, we show a novel mechanism of CBF-SMMHC-mediated transformation whereby CBF-SMMHC fusion protein disrupts p53 activity through aberrant post-translational modification. It has been previously reported that CBF-SMMHC reduces p53 mRNA transcription and slows apoptosis in Ba/F3 pro-B cell line [49]. We did not observe significant changes in p53 mRNA or protein levels by CBF-SMMHC expression in 32D myeloid progenitor cell line (
[0348] The acetylation of p53 promotes p53 stabilization, inhibits formation of repressive complexes and recruits cofactors for transcriptional activity. Histone deacetylases, including HDAC1, 2, 3 and Sirtuin I (SIRT1) are known to modulate p53 activity through deacetylating p53 [41-43,50]. We found that CBF-SMMHC reduced acetylated p53 levels particularly at later time points after stimulation (
[0349] AML is maintained by LSCs that are relatively resistant to chemotherapy and can persist as potential sources of relapse. Even though AML with CBF translocations are considered to have favorable prognosis, the incidence of relapse is still 25-58% with chemotherapy [51-53]. Novel strategies directed to eradicate LSCs are required to improve treatment outcome. We show that inhibiting HDAC8 by an isotype-selective inhibitor, 22d, leads to restoration of p53 acetylation and activity, induction of apoptosis, and abrogates engraftment and leukemia-initiating activity of inv(16).sup.+ AML LSCs. Whether additional mechanisms besides increased apoptosis contribute to the reduced engraftment capacity remains to be examined. Importantly, this effect is selective for LSCs as normal HSCs display relatively low levels of p53 target activation (
[0350] Given that TP53 is rarely mutated in inv(16).sup.+ AML, our results not only provide insights into an alternative p53 inactivating mechanism but also highlight the potential therapeutic opportunity. Inhibition of MDM2 by Nutlins and other inhibitors has been explored as an approach to activate p53 in AML [54,55]. Various degrees of sensitivity and resistance influenced by multiple distinct mechanisms have been observed, underscoring the need to further dissect the heterogeneity and distinct pathogenic pathways amongst AML subtypes. Many broad-spectrum HDAC inhibitors have potent anticancer activities, however, considerable toxicity and lack of selectivity related to the pleiotropic biological effects have greatly hampered their clinical application and efficacy. More selective inhibition of mechanistically defined HDAC targets is needed to efficaciously eliminate cancer cells while minimizing toxicity. It has been recently shown that selective inhibition of a class III HDAC, SIRT1, enhances elimination of chronic myelogenous leukemia LSCs while preserving normal HSC function [56]. Herein, we discovered that HDAC8 function can potentially be exploited to modulate p53 activity in AML and other cancers overexpressing HDAC8. Indeed, inhibition of HDAC8 results in reduced clonogenic growth and enhanced differentiation in neuroblastoma where high HDAC8 expression is associated with poor prognosis [38]. Most broad-spectrum HDAC inhibitors currently used or being tested in clinical trails display low activity against HDAC8 [57]. Besides the selective hydroxamic acid inhibitor PCI-34051 previously reported [44], our team developed a series of ortho-aryl N-hydroxycinnamides as potent HDAC8 selective inhibitors with anti-HDAC8 activity superior to PCI-34051 [45]. Herein, we tested several HDAC8i in parallel and have found similar biological effects consistent with their HDAC8 inhibitory activities. In addition, inhibiting HDAC8 using 22d show a differential activity in enhancing p53 acetylation in CBF-SMMHC expressing cells compared to other class I HDAC (MS-275), class III HDAC (TV6) or broad-spectrum (PCI-24781) inhibitors (
[0351] Without being bound by any particular theory, we propose a model that CBF-SMMHC impairs p53 function through aberrant protein interaction with p53 and HDAC8, and that HDAC8-mediated deacetylation of p53 contributes to CBF-SMMHC-associated AML LSC maintenance (
Example 5. Primers
[0352] Primers used in the experimental procedures disclosed herein are set forth in Table 10 following.
TABLE-US-00010 TABLE10 Listingofprimers SEQ Primer ID Gene Cells type Sequence NO: p21 Mouse Forward GCGGCTGTTTTTCTTGGTAG 1 Mouse Reverse AGACGAGGAAAGCAGTTCCA 2 Mdm2 Mouse Forward TTAGTGGCTGTAAGTCAGCAAGA 3 Mouse Reverse CCTTCAGATCACTCCCACCT 4 Bax Mouse Forward GTGAGCGGCTGCTTGTCT 5 Mouse Reverse GGTCCCGAAGTAGGAGAGGA 6 Bid Mouse Forward GACAGCTAGCCGCACAGTT 7 Mouse Reverse GGCCAGGCAGTTCCTTTT 8 Puma Mouse Forward TTCTCCGGAGTGTTCATGC 9 Mouse Reverse TACAGCGGAGGGCATCAG 10 Hprt Mouse Forward TCCTCCTCAGACCGCTTTT 11 Mouse Reverse CCTGGTTCATCATCGCTAATC 12 HDAC8 Human Forward GGTGACGTGTCTGATGTTGG 13 Human Reverse GACACTTGCCAATTCCCACT 14 p21 Human Forward TACCCTTGTGCCTCGCTCAG 15 Human Reverse CGGCGTTTGGAGTGGTAGA 16 HDM2 Human Forward CCTTCGTGAGAATTGGCTTC 17 Human Reverse CAACACATGACTCTCTGGAATCA 18 14-3-3 Human Forward CTCTCCTGCGAAGAGCGAAAC 19 Human Reverse CCTCGTTGCTTTTCTGCTCAA 20 PUMA Human Forward GACCTCAACGCACAGTACGAG 21 Human Reverse AGGAGTCCCATGATGAGATTGT 22 ACTB Human Forward GTGGATCAGCAAGCAGGAG 23 Human Reverse TTTGTCAAGAAAGGGTGTAACG 24
Example 6. Inhibition of HDAC8 and HeLa Nuclear HDACs
[0353] Results of inhibition studies of HDAC8 and HeLA nuclear HDACs by compounds disclosed herein are tabulated in Table 11 following.
TABLE-US-00011 TABLE 11 Inhibition of HDAC8 (A) and HeLa nuclear HDACs (IC.sub.50, nM) by compounds 5a-h
Example 7. Inhibition of HDAC8 and HeLa Nuclear HDACs and Cytotoxicity for Compounds 6a-6f
[0354] Results of inhibitions studies of Cmpds 6a-6f and PCI-34051 are tabulated in Table 12 following.
TABLE-US-00012 TABLE 12 Inhibition of HDAC8 (A) and HeLa nuclear HDACs (IC.sub.50, nM) and cytotoxicity (IC.sub.50, M) by compounds 6a-f
Example 8. Inhibition of HDAC8 and HeLa Nuclear HDACs by Cmpds 15a-15e, 21 and 25
[0355] Results of inhibition studies on HDAC8 and HeLa nuclear HDACS by Cmpds 15a-15e, 21 and 25 are tabulated in Table 13 following.
TABLE-US-00013 TABLE 13 Inhibition of HDAC 8 (A) and HeLa nuclear HDACs (IC.sub.50, nM) by compounds 15a-e, 21 and 25.
Example 9. HDAC8 Inhibition Activates p53 and Induces p53-Dependent Apoptosis in Human AML Cells
[0356] Survival of human AML cell lines upon contact with an HDAC8i (e.g. Cmpd 22d) was investigated. As shown in the
[0357]
[0358] The fold change in mRNA levels of p53 targets after treatment with PCI-48012 for 16-hrs is depicted in
[0359] Western blot analysis of p53, b-actin and MV4-11 cells transduced with control or sh-p53 is provided in
Example 10. Activity of HDAC8i Compounds on AML Cell Proliferation and Survival
[0360] Relative survival of non-p53 mutated AML cell lines (MV4-11, MOLM13, and OCI-AML3) treated with HDAC8i compounds (Cmp[ds 22d, 5b, 5e, 5h) for 48-hr was determined by Annexin V labeling and normalization to vehicle-treated controls. See
[0361] Relative proliferation of AML cell lines (MV4-11 and MOLM13) treated with HDAC8i (Cmpds 22d, 5b, 5e, 5h) for 48-hr was determined by luminescent cell viability assay, normalized to vehicle treated control. See
[0362] Resulting inhibitory activity of HDAC8i compounds is tabulated in Table 14 following.
TABLE-US-00014 TABLE 14 Inhibitory activity of HDAC8i compounds on AML cell growth and survival. IC.sub.50 (uM) OCI- MV4-11 Com- MV4-11 MOLM13 AML3 Prolifer- MOLM13 pound Apoptosis Apoptosis Apoptosis ation Proliferation 22d 2.713 3.615 8.115 2.484 2.421 5b 0.5243 0.3453 2.352 0.0825 0.05327 5e 11.92 11.7 12.48 7.494 3.358 5h ~22733 90.87 ~170501 16.59 7.174
Example 11. Apoptosis Studies, Cmpd 22D
[0363] Analysis of CD34.sup.+ cells from PBSC and CB showed no significant difference based on cell origin upon contact with Cmpd 22d. See
Example 12. Changes in p53 mRNA or Protein Levels by CBFb-SMMHC Expression
[0364] It has been previously reported that CBF-SMMHC reduces p53 mRNA transcription and slows apoptosis in Ba/F3 pro-B cell line. We did not observe significant changes in p53 mRNA or protein levels by CBF-SMMHC expression in 32D myeloid progenitor cell line (
Example 13. Gel Analyses of p53 and Ac-p53
[0365] The effect of agents PCI-24781, PCI-48012 and Nutlin on protein express employing Ac-p53, p53 and -actin is depicts in
Example 14. Effects of HDAC8 Inhibitors on Interaction Between p53 and CM
[0366] The effects of Cmpd 22d on IgG and IP expression were investigated. See
Example 15. Inhibition of HDAC8 Selectively Activate p53 in Inv(16)+ AML CD34+ Cells
[0367] Western blotting of Ac-p53, (K382), and p53 levels was conducted in inv(16)+ AML CD34+ cells upon contact with Cmpd 22d. Results are depicted in
VI. REFERENCES
[0368] 1. Look, A. T. 1997, Science 278:1059-1064. [0369] 2. Speck, N. A., and Gilliland, D. G. 2002, Nat Rev Cancer 2:502-513. [0370] 3. Wang, S., et al., 1993, Mol Cell Biol 13:3324-3339. [0371] 4. Ogawa, E., et al., 1993, Virology 194:314-331. [0372] 5. Huang, G., et al., 2001, Embo J 20:723-733. [0373] 6. Liu, P. P., et al., 1995, Blood 85:2289-302. [0374] 7. Grimwade, D., and Hills, R. K. 2009, Hematology Am Soc Hematol Educ Program: 385-395. [0375] 8. Grimwade, et al., 2010, Blood 116:354-365. [0376] 9. Mrzek, K., et al., 2004, Blood Rev 18:115-136. [0377] 10. Mrzek, K., et al., 2012, J Clin Oncol 30:4515-4523. [0378] 11. von Neuhoff, C., et al., 2010, J Clin Oncol 28:2682-2689. [0379] 12. Liu, P., et al., 1993, Science 261:1041-1044. [0380] 13. Castilla, L. H., et al., 1996, Cell 87:687-696. [0381] 14. Okuda, T., et al., 1996, Cell 84:321-30. [0382] 15. Wang, Q., et al., 1996, Cell 87:697-708. [0383] 16. Kuo, Y.-H., et al., 2006, Cancer Cell 9:57-68. [0384] 17. Lukasik, S. M., et al., 2002, Nat Struct Biol 9:674-679. [0385] 18. Adya, N., et al., 1998, Mol Cell Biol 18:7432-7443. [0386] 19. Kanno, Y., et al., 1998, Mol Cell Biol 18:4252-4261. [0387] 20. Lutterbach, B., et al., 1999, Proc Natl Acad Sci USA 96:12822-12827. [0388] 21. Durst, K. L., et al., 2003m, Mol Cell Biol 23:607-619. [0389] 22. Kuo, Y.-H., et al., L. H. 2009. Blood 113(14):3323-32. [0390] 23. Kamikubo, Y., et al., P. P. 2010. Cancer Cell 17:455-468. [0391] 24. Ben-Ami, O., et al., Y. 2013. Cell Rep 4:1131-1143. [0392] 25. Goyama, S., et al., 2013. J Clin Invest. [0393] 26. Rcker, F. G., et al., 2012. Blood 119:2114-2121. [0394] 27. Haferlach, C., et al., 2008. Leukemia 22:1539-1541. [0395] 28. Nahi, H et al., 2008. Leuk Lymphoma 49:508-516. [0396] 29. Zhao, Z., et al., 2010. p5 Genes Dev 24:1389-1402. [0397] 30. Dai, C., and Gu, W. 2010. Trends Mol Med 16:528-536. [0398] 31. Buggy, J. J., et al., 2000. Biochem J 350 Pt 1:199-205. [0399] 32. Hu, E., et al., 2000. J Biol Chem 275:15254-15264. [0400] 33. Van den Wyngaert, I., et al., 2000. FEBS Lett 478:77-83. [0401] 34. Waltregny, D., et al., 2005. FASEB J 19:966-968. [0402] 35. Lee, H., et al., 2006. Mol Cell Biol 26:5259-5269. [0403] 36. Haberland, M., et al., 2009. Genes Dev 23:1625-1630. [0404] 37. Deardorff, M. A., et al., 2012. Nature. [0405] 38. Oehme, I., et al., 2009. Clin Cancer Res 15:91-99. [0406] 39. Moreno, D. A., et al., 2010. Br J Haematol 150:665-673. [0407] 40. Lo, H.-L., et al., 2007. Gene Ther 14:1503-1512. [0408] 41. Luo, J., et al., 2000. Nature 408:377-381. [0409] 42. Juan, L. J., et al., 2000. J Biol Chem 275:20436-20443. [0410] 43. Ito, A., et al., 2002. EMBO J 21:6236-6245. [0411] 44. Balasubramanian, S., et al., 2008 Leukemia 22:1026-1034. [0412] 45. Huang, W.-J., et al., 2012. ChemMedChem. [0413] 46. Kuo, Y.-H., et al., 2008. Blood 111:1543-1551. [0414] 47. Zhao, L., et al., 2007. Blood 109:3432-3440. [0415] 48. Mandoli, A., et al., 2013. Leukemia. [0416] 49. Britos-Bray, M., et al., 1998. Blood 92:4344-4352. [0417] 50. Luo, J., et al., 2001. Cell 107:137-148. [0418] 51. Appelbaum, F. R., et al., 2006. Br J Haematol 135:165-173. [0419] 52. Prbet, T et al., 2009. J Clin Oncol 27:4747-4753. [0420] 53. Kurosawa, S., et al., 2013. Haematologica 98:1525-1531. [0421] 54. Kojima, K., et al., 2005. Blood 106:3150-3159. [0422] 55. Long, J., et al., 2010. Blood 116:71-80. [0423] 56. Li, L., et al., 2012. Cancer Cell 21:266-281. [0424] 57. Khan, N., et al., 2008. Biochem J 409:581-589. [0425] 58. Khn, R., et al., 1995. Science 269:1427-1429. [0426] 59. Jeannet, R., et al., 2012. Alcam Regulates Long-term Hematopoietic Stem Cell Engraftment and Self-Renewal. Stem Cells.
VII. EMBODIMENTS
[0427] Embodiment P1 A compound having formula:
##STR00064##
R.sup.1 is substituted or unsubstituted C.sub.1-C.sub.20 alkyl, substituted or unsubstituted 2 to 20 membered heteroalkyl, substituted or unsubstituted 3 to 7 membered cycloalkyl, substituted or unsubstituted 3 to 7 membered heterocycloalkyl, substituted or unsubstituted 3 to 7 membered aryl, or substituted or unsubstituted 3 to 7 membered heteroaryl; and R.sup.2 is substituted or unsubstituted C.sub.1-C.sub.20 alkyl, substituted or unsubstituted 2 to 20 membered heteroalkyl, substituted or unsubstituted 3 to 7 membered cycloalkyl, substituted or unsubstituted 3 to 7 membered heterocycloalkyl, substituted or unsubstituted 3 to 7 membered aryl, or substituted or unsubstituted 3 to 7 membered heteroaryl.
[0428] Embodiment P2 The compound of embodiment P1 having the formula:
##STR00065##
[0429] Embodiment P3 The compound of any one of embodiments P1 to P2, wherein said compound is a HDAC8 inhibitor.
[0430] Embodiment P4 A method of treating cancer, the method comprising administering to a subject in need thereof a therapeutically effective amount the compound of any one of embodiments P1 to P3.
[0431] Embodiment P5 The method of embodiment P4, wherein said cancer is a hematological cancer.
[0432] Embodiment P6 The method of any one of embodiments P4 to P5, wherein said cancer is acute myeloid leukemia.
[0433] Embodiment 1 A compound having the formula:
##STR00066##
[0434] A is cycloalkyl, heterocycloalkyl, aryl, or heteroaryl. X is C(R.sup.4) or N. Y is a bond, N(R.sup.5), O, or S. L.sup.1 is a bond, C(O), C(O)O, O, S, N(R.sup.6), C(O)N(R.sup.6), S(O).sub.n6, S(O)N(R.sup.6), substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene. R.sup.1 is halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.1A, C(O)R.sup.1A, NR.sup.1AR.sup.1B, C(O)OR.sup.1A, C(O)NR.sup.1AR.sup.1B, NO.sub.2, SR.sup.1A, S(O).sub.n1R.sup.1A, S(O).sub.n1OR.sup.1A, S(O).sub.n1NR.sup.1AR.sup.1B, NHNR.sup.1AR.sup.1B, ONR.sup.1AR.sup.1B, NHC(O)NHNR.sup.1AR.sup.1B, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. R.sup.2 is halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.2A, C(O)R.sup.2A, NR.sup.2AR.sup.2B, C(O)OR.sup.2A, C(O)NR.sup.2AR.sup.2B, NO.sub.2, SR.sup.2A, S(O).sub.n2R.sup.2A, S(O).sub.n2OR.sup.2A, S(O).sub.n2NR.sup.2AR.sup.2B, NHNR.sup.2AR.sup.2B, ONR.sup.2AR.sup.2B, NHC(O)NHNR.sup.2AR.sup.2B, substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.3 is independently hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.4 is hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.4A, C(O)R.sup.4A, NR.sup.4AR.sup.4B, C(O)OR.sup.4A, C(O)NR.sup.4AR.sup.4B, NO.sub.2, SR.sup.4A, S(O).sub.n4R.sup.4A, S(O).sub.n4OR.sup.4A, S(O).sub.n4NR.sup.4AR.sup.4B, NHNR.sup.4AR.sup.4B, ONR.sup.4AR.sup.4B, NHC(O)NHNR.sup.4AR.sup.4B, substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.5 is hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.5A, C(O)R.sup.5A, NR.sup.5AR.sup.5B, C(O)OR.sup.5A, C(O)NR.sup.5AR.sup.5B, NO.sub.2, SR.sup.5A, S(O).sub.n5R.sup.5A, S(O)OR.sup.5A, S(O).sub.n5NR.sup.5AR.sup.5B, NHNR.sup.5AR.sup.5B, ONR.sup.5AR.sup.5B, NHC(O)NHNR.sup.5AR.sup.5B, substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl. R.sup.6 is hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, OR.sup.6A, C(O)R.sup.6A, NR.sup.6AR.sup.6B, C(O)OR.sup.6A, C(O)NR.sup.6AR.sup.6B, NO.sub.2, SR.sup.6A, S(O).sub.n6R.sup.6A, S(O).sub.n6OR.sup.6A, S(O).sub.n6NR.sup.6AR.sup.6B, NHNR.sup.6AR.sup.6B, ONR.sup.6AR.sup.6B, NHC(O)NHNR.sup.6AR.sup.6B, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. R.sup.1A, R.sup.1B, R.sup.2A, R.sup.2B, R.sup.4A, R.sup.4B, R.sup.5A, R.sup.5B, R.sup.6A, and R.sup.6B are independently hydrogen, oxo, halogen, CF.sub.3, CN, OH, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2Cl, S(O).sub.3H, S(O).sub.4H, S(O).sub.2NH.sub.2, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, NHC(O)NH.sub.2, NHS(O).sub.2H, NHC(O)H, NHC(O)OH, NHOH, OCF.sub.3, OCHF.sub.2, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl. n1, n2, n4, n5, and n6 are independently 1, 2, or 3. m1 is 0, 1, 2, 3, or 4. m2 is 0, 1, 2, 3, 4, 5, or 6. m3 is 0, 1, or 2.
[0435] Embodiment 2 The compound of embodiment 1, wherein X is C(R.sup.4).
[0436] Embodiment 3 The compound of any one of embodiments 1 to 2, wherein R.sup.2 is halogen, CF.sub.3, OR.sup.2A, NO.sub.2, substituted or unsubstituted C.sub.1-C.sub.5 alkyl, or substituted or unsubstituted 2 to 5 membered heteroalkyl.
[0437] Embodiment 4 The compound of one of embodiments 1 to 3, wherein R.sup.2 is OR.sup.2A, wherein R.sup.2A is substituted or unsubstituted C.sub.1-C.sub.3 alkyl.
[0438] Embodiment 5 The compound of one of embodiments 1 to 4, wherein R.sup.3 is hydrogen, halogen, or OR.sup.3A.
[0439] Embodiment 6 The compound of embodiment 5, wherein R.sup.3 is hydrogen.
[0440] Embodiment 7 The compound of one of embodiments 1 to 6, wherein m2 is 0.
[0441] Embodiment 8 The compound of one of embodiments 1 to 7, wherein Y is a bond or N(R.sup.5).
[0442] Embodiment 9 The compound of embodiment 8, wherein Y is a bond or NH.
[0443] Embodiment 10 The compound of one of embodiments 1 to 9, wherein L.sup.1 is a bond, C(O), O, NH, substituted or unsubstituted alkylene, substituted or unsubstituted heteroalkylene, substituted or unsubstituted cycloalkylene, substituted or unsubstituted heterocycloalkylene, substituted or unsubstituted arylene, or substituted or unsubstituted heteroarylene.
[0444] Embodiment 11 The compound of one of embodiments 1 to 10, wherein R.sup.1 is halogen, CF.sub.3, NO.sub.2, NH.sub.2, OR.sup.1A, substituted or unsubstituted alkyl, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.
[0445] Embodiment 12 The compound of one of embodiments 1 to 11, wherein R.sup.1 is halogen, CF.sub.3, NO.sub.2, NH.sub.2, OR.sup.1A.
[0446] Embodiment 13 The compound of one of embodiments 1 to 12, wherein R.sup.1 is OR.sup.1A, wherein R.sup.1A is substituted or unsubstituted C.sub.1-C.sub.5 alkyl, substituted or unsubstituted 2 to 5 membered heteroalkyl, substituted or unsubstituted 3 to 6 membered cycloalkyl, substituted or unsubstituted 3 to 6 membered heterocycloalkyl, substituted or unsubstituted 5 or 6 membered aryl, or substituted or unsubstituted 5 or 6 membered heteroaryl.
[0447] Embodiment 14 The compound of one of embodiments 1 to 13, wherein R.sup.1 is R.sup.10-substituted or unsubstituted alkyl, R.sup.10-substituted or unsubstituted heteroalkyl, R.sup.10-substituted or unsubstituted cycloalkyl, R.sup.10-substituted or unsubstituted heterocycloalkyl, R.sup.10-substituted or unsubstituted aryl, or R.sup.10-substituted or unsubstituted heteroaryl, wherein R.sup.10 is hydrogen, halogen, N.sub.3, CF.sub.3, CCl.sub.3, CBr.sub.3, CI.sub.3, CN, C(O)H, OCH.sub.3, OCH.sub.2CH.sub.3, NH.sub.2, COOH, CONH.sub.2, NO.sub.2, SH, S(O).sub.2H, NHNH.sub.2, ONH.sub.2, NHC(O)NHNH.sub.2, substituted or unsubstituted heteroalkyl, substituted or unsubstituted cycloalkyl, substituted or unsubstituted heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl.
[0448] Embodiment 15 The compound of one of embodiments 1 to 14, wherein m1 is 1, 2, or 3.
[0449] Embodiment 16 The compound of one of embodiments 1 to 15, wherein A is aryl or heteroaryl.
[0450] Embodiment 17 The compound of one of embodiments 1 to 16, wherein said compound has the formula:
##STR00067##
[0451] Embodiment 18 The compound of embodiment 17, wherein [0452] R.sup.2 is halogen or OR.sup.2A, wherein R.sup.2A is hydrogen or unsubstituted C.sub.1-C.sub.5 alkyl; [0453] X is CH.sub.2 or N; [0454] Y is NH or O; [0455] L.sup.1 is a bond; [0456] R.sup.1 is halogen, NO.sub.2, NH.sub.2, OR.sup.1A, wherein R.sup.1A is hydrogen or unsubstituted C.sub.1-C.sub.5 [0457] alkyl; and [0458] m1 is 1, 2, or 3.
[0459] Embodiment 19 The compound of one of embodiments 1 to 16, wherein A is aryl, 5,6-fused ring heteroaryl, 6,5-fused ring heteroaryl, or 6,6-fused ring heteroaryl.
[0460] Embodiment 20 The compound of embodiment 19, wherein said compound has the formula:
##STR00068##
wherein A is 5,6-fused ring heteroaryl, 6,5-fused ring heteroaryl, or 6,6-fused ring heteroaryl.
[0461] Embodiment 21 The compound of embodiment 20, wherein [0462] R.sup.2 is halogen or OR.sup.2A, wherein R.sup.2A is hydrogen or unsubstituted C.sub.1-C.sub.5 alkyl; [0463] X is CH.sub.2 or N; [0464] Y is NH or O; [0465] L.sup.1 is a bond; [0466] R.sup.1 is halogen, NO.sub.2, NH.sub.2, OR.sup.1A, wherein R.sup.1A is hydrogen or unsubstituted C.sub.1-C.sub.5 alkyl; and [0467] m1 is 1, 2, or 3.
[0468] Embodiment 22 A method of treating cancer in a subject in need thereof, said method comprising administering an effective amount of an HDAC8 inhibitor to said subject.
[0469] Embodiment 23 The method of embodiment 22, wherein said cancer is a non-mutated p53 cancer.
[0470] Embodiment 24 The method of any one of embodiments 22 to 23, wherein said non-mutated p53 cancer is acute myeloid leukemia (AML), acute lymphoblastic leukemia (ALL), lymphoma, neuroblastoma, glioma, bladder cancer, lung cancer, non-small cell lung cancer, breast cancer, or triple-negative breast cancer.
[0471] Embodiment 25 The method of any one of embodiments 22 to 24, wherein said non-mutated p53 cancer is acute myeloid leukemia (AML).
[0472] Embodiment 26 The method of any one of embodiments 22 to 25, wherein said non-mutated p53 cancer has increased HDAC8 activity or HDAC8 expression compared to a mutated p53 cancer.
[0473] Embodiment 27 The method of any one of embodiments 22 to 26, wherein said method further comprises prior to said treating, determining whether said cancer in said subject is a non-mutated p53 cancer.
[0474] Embodiment 28 The method of any one of embodiments 22 to 27, further comprising determining whether said non-mutated p53 cancer has increased HDAC8 activity or HDAC8 expression.
[0475] Embodiment 29 The method of any one of embodiments 22 to 28, wherein said HDAC8 inhibitor is a HDAC8 inhibitor compound.
[0476] Embodiment 30 The method of any one of embodiments 22 to 29, wherein said HDAC8 inhibitor is a compound described herein.
[0477] Embodiment 31 The method of any one of embodiments 22 to 28, wherein said HDAC8 inhibitor is a HDAC8 inhibitor antibody, a HDAC8 inhibitor siRNA, a HDAC8 inhibitor shRNA, or a HDAC8 inhibitor protein.
[0478] Embodiment 32 A method of inhibiting HDAC8 mediated deacetylation of p53, said method comprising contacting HDAC8 with a HDAC8 inhibitor in the presence of p53, thereby inhibiting HDAC8 deacetylation of p53.
[0479] Embodiment 33 The method of embodiment 31, wherein said contacting is performed in vitro.
[0480] Embodiment 34 The method of embodiment 31, wherein said contacting is performed in vivo.
[0481] Embodiment 35 The method of embodiment 31, wherein said contacting is performed in an organism.
[0482] Embodiment 36 The method of any one of embodiments 32 to 35, wherein said HDAC8 inhibitor is a compound described herein.
[0483] Embodiment 37 A method of activating p53 in vivo, said method comprising contacting a cell with a HDAC8 inhibitor in the presence of HDAC8 and allowing said HDAC8 inhibitor to contact said HDAC8, thereby inhibiting said HDAC8 and activating p53.
[0484] Embodiment 38 The method of embodiment 36, wherein said contacting is performed in an organism.
[0485] Embodiment 39 The method of any one of embodiments 37 to 38, wherein said HDAC8 inhibitor is a compound described herein.