Anti-Pseudomonas PSL Binding Molecules and Uses Thereof
20190322726 ยท 2019-10-24
Inventors
- Antonio DiGiandomenico (Gaithersburg, MD)
- Paul G. Warrener (Gaithersburg, MD)
- Charles K. Stover (Gaithersburg, MD)
- Bret Sellman (Gaithersburg, MD)
- Sandrine Guillard (Cambridge, GB)
- Ralph Minter (Cambridge, GB)
- Steven Rust (Cambridge, GB)
- Mladen Tomich (New York, NY)
Cpc classification
A61K47/6835
HUMAN NECESSITIES
A61K47/6811
HUMAN NECESSITIES
A61P17/02
HUMAN NECESSITIES
A61P7/00
HUMAN NECESSITIES
A61P19/08
HUMAN NECESSITIES
C07K2317/73
CHEMISTRY; METALLURGY
C07K2317/64
CHEMISTRY; METALLURGY
C07K2317/76
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
C07K2317/71
CHEMISTRY; METALLURGY
International classification
Abstract
This disclosure relates to an anti-Pseudomonas Psl binding molecule and uses thereof, in particular in prevention and treatment of Pseudomonas infection. Furthermore, the disclosure provides compositions and methods for preventing and treating Pseudomonas infection.
Claims
1. An isolated binding molecule or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl, wherein the binding molecule (a) can inhibit attachment of Pseudomonas aeruginosa to epithelial cells, (b) can promote opsonophagocytic killing (OPK) of P. aeruginosa, or (c) can inhibit attachment of P. aeruginosa to epithelial cells and can promote OPK of P. aeruginosa.
2. (canceled)
3. An isolated binding molecule or antigen-binding fragment thereof of claim 1 which specifically binds to the same Pseudomonas Psl epitope as an antibody or antigen-binding fragment thereof comprising the heavy chain variable region (VH) and light chain variable region (VL) region of WapR-004, Cam-003, Cam-004, Cam-005, WapR-001, WapR-002, WapR-003 or WapR-016.
4. An isolated binding molecule or antigen-binding fragment thereof of claim 1 which specifically binds to Pseudomonas Psl, and competitively inhibits Pseudomonas Psl binding by an antibody or antigen-binding fragment thereof comprising the VH and VL of WapR-004, Cam-003, Cam-004, or Cam-005 Cam-005, WapR-001, WapR-002, WapR-003 or WapR-016.
5-59. (canceled)
60. An isolated polynucleotide comprising a nucleic acid encoding the binding molecule or antigen-binding fragment thereof of claim 1.
61. The polynucleotide of claim 60, comprising a nucleic acid encoding the VL and VH of claim 3, wherein a binding molecule or antigen-binding fragment thereof expressed by the polynucleotide specifically binds Pseudomonas Psl.
62. The polynucleotide of claim 61 which encodes an scFv molecule including VH and VL, comprising the nucleotide sequence SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, or SEQ ID NO:70.
63-64. (canceled)
65. A vector comprising the polynucleotide of claim 60.
66. (canceled)
67. A vector comprising the polynucleotide of claim 62.
68-70. (canceled)
71. A host cell comprising the polynucleotide of claim 60.
72. A method of producing a binding molecule or antigen-binding fragment thereof which specifically binds Pseudomonas Psl, comprising culturing the host cell of claim 71, and recovering the binding molecule or fragment thereof.
73-77. (canceled)
78. A method of preventing or treating a Pseudomonas infection in a subject in need thereof, comprising administering to the subject an effective amount of the binding molecule or fragment thereof encoded by the polynucleotide of claim 60, or the polynucleotide of claim 60.
79. The method of claim 78, wherein the Pseudomonas infection is a P. aeruginosa infection.
80. The method of claim 78, wherein the subject is a human.
81-82. (canceled)
83. A method of blocking or preventing attachment of P. aeruginosa to epithelial cells comprising contacting a mixture of epithelial cells and P. aeruginosa with a binding molecule or fragment thereof encoded by the polynucleotide of claim 60, or the polynucleotide of claim 60.
84. A method of enhancing OPK of P. aeruginosa comprising contacting a mixture of phagocytic cells and P. aeruginosa with the binding molecule or fragment thereof encoded by the polynucleotide of claim 60, or, the polynucleotide of claim 60.
85. (canceled)
86. The polynucleotide of claim 61 comprising a nucleic acid encoding a binding molecule or fragment thereof, wherein the VH and VL of WapR-004 comprise SEQ ID NO:11 and SEQ ID NO:12, respectively, the VH and VL of Cam-003 comprise SEQ ID NO:1 and SEQ ID NO:2, respectively, the VH and VL of Cam-004 comprise SEQ ID NO:3 and SEQ ID NO:2, respectively, and the VH and VL of Cam-005 comprise SEQ ID NO:4 and SEQ ID NO:2, respectively, wherein the VH and VL of WapR-001 comprise SEQ ID NO:5 and SEQ ID NO:6, respectively, the VH and VL of WapR-002 comprise SEQ ID NO:7 and SEQ ID NO:8, respectively, and the VH and VL of WapR-003 comprise SEQ ID NO:9 and SEQ ID NO:10, respectively, and wherein the VH and VL of WapR-016 comprise SEQ ID NO:SEQ ID NO: 15 and SEQ ID NO:16, respectively.
87. The polynucleotide of claim 60 comprising a nucleic acid encoding a binding molecule or fragment thereof which specifically binds to Pseudomonas Psl comprising an antibody VH, wherein the VH comprises an amino acid sequence at least 90% identical to SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, or SEQ ID NO: 15, and comprising an antibody VL wherein the VL comprises an amino acid sequence at least 90% identical to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, and SEQ ID NO: 16.
88. The polynucleotide of claim 60 comprising a nucleic acid encoding a binding molecule or fragment thereof which specifically binds to Pseudomonas Psl comprising an antibody VH, wherein the VH comprises a VH complementarity determining region-1 (VHCDR1) amino acid sequence identical to, or identical except for four, three, two, or one amino acid substitutions to: SEQ ID NO: 17, SEQ ID NO: 23, SEQ ID NO: 26, SEQ ID NO: 29, SEQ ID NO: 35, SEQ ID NO: 41, SEQ ID NO: 47, SEQ ID NO: 53, or SEQ ID NO: 59; a VHCDR2 amino acid sequence identical to, or identical except for four, three, two, or one amino acid substitutions to: SEQ ID NO: 18, SEQ ID NO: 24, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 36, SEQ ID NO: 42, SEQ ID NO: 48, SEQ ID NO: 54, or SEQ ID NO: 60; a VHCDR3 amino acid sequence identical to, or identical except for four, three, two, or one amino acid substitutions to: SEQ ID NO: 19, SEQ ID NO: 25, SEQ ID NO: 28, SEQ ID NO: 31, SEQ ID NO: 37, SEQ ID NO: 43, SEQ ID NO: 49, SEQ ID NO: 55, or SEQ ID NO: 61; and comprising an antibody VL, wherein the VL comprises a VL complementarity determining region-1 (VLCDR1) amino acid sequence identical to, or identical except for four, three, two, or one amino acid substitutions to: SEQ ID NO: 20, SEQ ID NO: 32, SEQ ID NO: 38, SEQ ID NO: 44, SEQ ID NO: 50, SEQ ID NO: 56, or SEQ ID NO: 62; a VLCDR2 amino acid sequence identical to, or identical except for four, three, two, or one amino acid substitutions to: SEQ ID NO: 21, SEQ ID NO: 33, SEQ ID NO: 39, SEQ ID NO: 45, SEQ ID NO: 51, SEQ ID NO: 57, or SEQ ID NO: 63; and a VLCDR3 amino acid sequence identical to, or identical except for four, three, two, or one amino acid substitutions to: SEQ ID NO: 22, SEQ ID NO: 34, SEQ ID NO: 40, SEQ ID NO: 46, SEQ ID NO: 52, SEQ ID NO: 58, or SEQ ID NO: 64.
89. The polynucleotide of claim 60 comprising a nucleic acid encoding a binding molecule or fragment thereof which specifically binds to Pseudomonas Psl wherein the binding molecule is a monoclonal antibody, a humanized antibody, a chimeric antibody, a human antibody, an Fab fragment, an Fab fragment, an F(ab)2 fragment or a single chain Fv (scFv) fragment.
90. The polynucleotide of claim 60 comprising a nucleic acid encoding a binding molecule or fragment thereof which specifically binds to Pseudomonas Psl further comprising a nucleic acid encoding a light chain constant region and a heavy chain constant region.
Description
BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES
[0050]
[0051]
[0052]
* Indicates P<0.005 using the Mann-Whitney U-test when comparing Cam-003 vs. R347 binding. (
[0053] (
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
DETAILED DESCRIPTION
I. Definitions
[0072] It is to be noted that the term a or an entity refers to one or more of that entity; for example, a binding molecule which specifically binds to Pseudomonas Psl, is understood to represent one or more binding molecules which specifically bind to Pseudomonas Psl. As such, the terms a (or an), one or more, and at least one can be used interchangeably herein.
[0073] As used herein, the term polypeptide is intended to encompass a singular polypeptide as well as plural polypeptides, and refers to a molecule composed of monomers (amino acids) linearly linked by amide bonds (also known as peptide bonds). The term polypeptide refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product. Thus, peptides, dipeptides, tripeptides, oligopeptides, protein, amino acid chain, or any other term used to refer to a chain or chains of two or more amino acids, are included within the definition of polypeptide, and the term polypeptide can be used instead of, or interchangeably with any of these terms. The term polypeptide is also intended to refer to the products of post-expression modifications of the polypeptide, including without limitation glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino acids. A polypeptide can be derived from a natural biological source or produced by recombinant technology, but is not necessarily translated from a designated nucleic acid sequence. It can be generated in any manner, including by chemical synthesis.
[0074] A polypeptide as disclosed herein can be of a size of about 3 or more, 5 or more, 10 or more, 20 or more, 25 or more, 50 or more, 75 or more, 100 or more, 200 or more, 500 or more, 1,000 or more, or 2,000 or more amino acids. Polypeptides can have a defined three-dimensional structure, although they do not necessarily have such structure. Polypeptides with a defined three-dimensional structure are referred to as folded, and polypeptides which do not possess a defined three-dimensional structure, but rather can adopt a large number of different conformations, and are referred to as unfolded. As used herein, the term glycoprotein refers to a protein coupled to at least one carbohydrate moiety that is attached to the protein via an oxygen-containing or a nitrogen-containing side chain of an amino acid residue, e.g., a serine residue or an asparagine residue.
[0075] By an isolated polypeptide or a fragment, variant, or derivative thereof is intended a polypeptide that is not in its natural milieu. No particular level of purification is required. For example, an isolated polypeptide can be removed from its native or natural environment. Recombinantly produced polypeptides and proteins expressed in host cells are considered isolated as disclosed herein, as are native or recombinant polypeptides which have been separated, fractionated, or partially or substantially purified by any suitable technique.
[0076] Other polypeptides disclosed herein are fragments, derivatives, analogs, or variants of the foregoing polypeptides, and any combination thereof. The terms fragment, variant, derivative and analog when referring to a binding molecule such as an antibody which specifically binds to Pseudomonas Psl as disclosed herein include any polypeptides which retain at least some of the antigen-binding properties of the corresponding native antibody or polypeptide. Fragments of polypeptides include, for example, proteolytic fragments, as well as deletion fragments, in addition to specific antibody fragments discussed elsewhere herein. Variants of a binding molecule, e.g., an antibody which specifically binds to Pseudomonas Psl as disclosed herein include fragments as described above, and also polypeptides with altered amino acid sequences due to amino acid substitutions, deletions, or insertions. Variants can occur naturally or be non-naturally occurring. Non-naturally occurring variants can be produced using art-known mutagenesis techniques. Variant polypeptides can comprise conservative or non-conservative amino acid substitutions, deletions or additions. Derivatives of a binding molecule, e.g., an antibody which specifically binds to Pseudomonas Psl as disclosed herein are polypeptides which have been altered so as to exhibit additional features not found on the native polypeptide. Examples include fusion proteins. Variant polypeptides can also be referred to herein as polypeptide analogs. As used herein a derivative of a binding molecule, e.g., an antibody which specifically binds to Pseudomonas Psl refers to a subject polypeptide having one or more residues chemically derivatized by reaction of a functional side group. Also included as derivatives are those peptides which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids. For example, 4-hydroxyproline can be substituted for proline; 5-hydroxylysine can be substituted for lysine; 3-methylhistidine can be substituted for histidine; homoserine can be substituted for serine; and ornithine can be substituted for lysine.
[0077] The term polynucleotide is intended to encompass a singular nucleic acid as well as plural nucleic acids, and refers to an isolated nucleic acid molecule or construct, e.g., messenger RNA (mRNA) or plasmid DNA (pDNA). A polynucleotide can comprise a conventional phosphodiester bond or a non-conventional bond (e.g., an amide bond, such as found in peptide nucleic acids (PNA)). The term nucleic acid refer to any one or more nucleic acid segments, e.g., DNA or RNA fragments, present in a polynucleotide. By isolated nucleic acid or polynucleotide is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment. For example, a recombinant polynucleotide encoding a binding molecule, e.g., an antibody which specifically binds to Pseudomonas Psl contained in a vector is considered isolated as disclosed herein. Further examples of an isolated polynucleotide include recombinant polynucleotides maintained in heterologous host cells or purified (partially or substantially) polynucleotides in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of polynucleotides. Isolated polynucleotides or nucleic acids further include such molecules produced synthetically. In addition, polynucleotide or a nucleic acid can be or can include a regulatory element such as a promoter, ribosome binding site, or a transcription terminator.
[0078] As used herein, a coding region is a portion of nucleic acid which consists of codons translated into amino acids. Although a stop codon (TAG, TGA, or TAA) is not translated into an amino acid, it can be considered to be part of a coding region, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, and the like, are not part of a coding region. Two or more coding regions can be present in a single polynucleotide construct, e.g., on a single vector, or in separate polynucleotide constructs, e.g., on separate (different) vectors. Furthermore, any vector can contain a single coding region, or can comprise two or more coding regions, e.g., a single vector can separately encode an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region. In addition, a vector, polynucleotide, or nucleic acid can encode heterologous coding regions, either fused or unfused to a nucleic acid encoding an a binding molecule which specifically binds to Pseudomonas Psl, e.g., an antibody, or antigen-binding fragment, variant, or derivative thereof. Heterologous coding regions include without limitation specialized elements or motifs, such as a secretory signal peptide or a heterologous functional domain.
[0079] In certain embodiments, the polynucleotide or nucleic acid is DNA. In the case of DNA, a polynucleotide comprising a nucleic acid which encodes a polypeptide normally can include a promoter and/or other transcription or translation control elements operably associated with one or more coding regions. An operable association is when a coding region for a gene product, e.g., a polypeptide, is associated with one or more regulatory sequences in such a way as to place expression of the gene product under the influence or control of the regulatory sequence(s). Two DNA fragments (such as a polypeptide coding region and a promoter associated therewith) are operably associated if induction of promoter function results in the transcription of mRNA encoding the desired gene product and if the nature of the linkage between the two DNA fragments does not interfere with the ability of the expression regulatory sequences to direct the expression of the gene product or interfere with the ability of the DNA template to be transcribed. Thus, a promoter region would be operably associated with a nucleic acid encoding a polypeptide if the promoter was capable of effecting transcription of that nucleic acid. The promoter can be a cell-specific promoter that directs substantial transcription of the DNA only in predetermined cells. Other transcription control elements, besides a promoter, for example enhancers, operators, repressors, and transcription termination signals, can be operably associated with the polynucleotide to direct cell-specific transcription. Suitable promoters and other transcription control regions are disclosed herein.
[0080] A variety of transcription control regions are known to those skilled in the art. These include, without limitation, transcription control regions which function in vertebrate cells, such as, but not limited to, promoter and enhancer segments from cytomegaloviruses (the immediate early promoter, in conjunction with intron-A), simian virus 40 (the early promoter), and retroviruses (such as Rous sarcoma virus). Other transcription control regions include those derived from vertebrate genes such as actin, heat shock protein, bovine growth hormone and rabbit -globin, as well as other sequences capable of controlling gene expression in eukaryotic cells. Additional suitable transcription control regions include tissue-specific promoters and enhancers as well as lymphokine-inducible promoters (e.g., promoters inducible by interferons or interleukins).
[0081] Similarly, a variety of translation control elements are known to those of ordinary skill in the art. These include, but are not limited to ribosome binding sites, translation initiation and termination codons, and elements derived from picornaviruses (particularly an internal ribosome entry site, or IRES, also referred to as a CITE sequence).
[0082] In other embodiments, a polynucleotide can be RNA, for example, in the form of messenger RNA (mRNA).
[0083] Polynucleotide and nucleic acid coding regions can be associated with additional coding regions which encode secretory or signal peptides, which direct the secretion of a polypeptide encoded by a polynucleotide as disclosed herein, e.g., a polynucleotide encoding a binding molecule which specifically binds to Pseudomonas Psl, e.g., an antibody, or antigen-binding fragment, variant, or derivative thereof. According to the signal hypothesis, proteins secreted by mammalian cells have a signal peptide or secretory leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated. Those of ordinary skill in the art are aware that polypeptides secreted by vertebrate cells generally have a signal peptide fused to the N-terminus of the polypeptide, which is cleaved from the complete or full length polypeptide to produce a secreted or mature form of the polypeptide. In certain embodiments, the native signal peptide, e.g., an immunoglobulin heavy chain or light chain signal peptide is used, or a functional derivative of that sequence that retains the ability to direct the secretion of the polypeptide that is operably associated with it. Alternatively, a heterologous mammalian signal peptide, or a functional derivative thereof, can be used. For example, the wild-type leader sequence can be substituted with the leader sequence of human tissue plasminogen activator (TPA) or mouse -glucuronidase.
[0084] Disclosed herein are certain binding molecules, or antigen-binding fragments, variants, or derivatives thereof. Unless specifically referring to full-sized antibodies such as naturally-occurring antibodies, the term binding molecule encompasses full-sized antibodies as well as antigen-binding fragments, variants, analogs, or derivatives of such antibodies, e.g., naturally occurring antibody or immunoglobulin molecules or engineered antibody molecules or fragments that bind antigen in a manner similar to antibody molecules.
[0085] As used herein, the term binding molecule refers in its broadest sense to a molecule that specifically binds an antigenic determinant. A non-limiting example of an antigen binding molecule is an antibody or fragment thereof that retains antigen-specific binding.
[0086] The terms antibody and immunoglobulin can be used interchangeably herein. An antibody (or a fragment, variant, or derivative thereof as disclosed herein comprises at least the variable domain of a heavy chain and at least the variable domains of a heavy chain and a light chain. Basic immunoglobulin structures in vertebrate systems are relatively well understood. See, e.g., Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988).
[0087] As will be discussed in more detail below, the term immunoglobulin comprises various broad classes of polypeptides that can be distinguished biochemically. Those skilled in the art will appreciate that heavy chains are classified as gamma, mu, alpha, delta, or epsilon, (, , , , ) with some subclasses among them (e.g., 1-4). It is the nature of this chain that determines the class of the antibody as IgG, IgM, IgA IgG, or IgE, respectively. The immunoglobulin subclasses (isotypes) e.g., IgG.sub.1, IgG.sub.2, IgG.sub.3, IgG.sub.4, IgA.sub.1, etc. are well characterized and are known to confer functional specialization. Modified versions of each of these classes and isotypes are readily discernible to the skilled artisan in view of the instant disclosure and, accordingly, are within the scope of this disclosure.
[0088] Light chains are classified as either kappa or lambda (, ). Each heavy chain class can be bound with either a kappa or lambda light chain. In general, the light and heavy chains are covalently bonded to each other, and the tail portions of the two heavy chains are bonded to each other by covalent disulfide linkages or non-covalent linkages when the immunoglobulins are generated either by hybridomas, B cells or genetically engineered host cells. In the heavy chain, the amino acid sequences run from an N-terminus at the forked ends of the Y configuration to the C-terminus at the bottom of each chain.
[0089] Both the light and heavy chains are divided into regions of structural and functional homology. The terms constant and variable are used functionally. In this regard, it will be appreciated that the variable domains of both the light (VL) and heavy (VH) chain portions determine antigen recognition and specificity. Conversely, the constant domains of the light chain (CL) and the heavy chain (CH1, CH2 or CH3) confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, complement binding, and the like. By convention the numbering of the constant region domains increases as they become more distal from the antigen binding site or amino-terminus of the antibody. The N-terminal portion is a variable region and at the C-terminal portion is a constant region; the CH3 and CL domains actually comprise the carboxy-terminus of the heavy and light chain, respectively.
[0090] As indicated above, the variable region allows the binding molecule to selectively recognize and specifically bind epitopes on antigens. That is, the VL domain and VH domain, or subset of the complementarity determining regions (CDRs), of a binding molecule, e.g., an antibody combine to form the variable region that defines a three dimensional antigen binding site. This quaternary binding molecule structure forms the antigen binding site present at the end of each arm of the Y. More specifically, the antigen binding site is defined by three CDRs on each of the VH and VL chains.
[0091] In naturally occurring antibodies, the six complementarity determining regions or CDRs present in each antigen binding domain are short, non-contiguous sequences of amino acids that are specifically positioned to form the antigen binding domain as the antibody assumes its three dimensional configuration in an aqueous environment. The remainder of the amino acids in the antigen binding domains, referred to as framework regions, show less inter-molecular variability. The framework regions largely adopt a -sheet conformation and the CDRs form loops which connect, and in some cases form part of, the -sheet structure. Thus, framework regions act to form a scaffold that provides for positioning the CDRs in correct orientation by inter-chain, non-covalent interactions. The antigen binding domain formed by the positioned CDRs defines a surface complementary to the epitope on the immunoreactive antigen. This complementary surface promotes the non-covalent binding of the antibody to its cognate epitope. The amino acids comprising the CDRs and the framework regions, respectively, can be readily identified for any given heavy or light chain variable region by one of ordinary skill in the art, since they have been precisely defined (see, Sequences of Proteins of Immunological Interest, Kabat, E., et al., U.S. Department of Health and Human Services, (1983); and Chothia and Lesk, J. Mol. Biol., 196:901-917 (1987), which are incorporated herein by reference in their entireties).
[0092] In the case where there are two or more definitions of a term which is used and/or accepted within the art, the definition of the term as used herein is intended to include all such meanings unless explicitly stated to the contrary. A specific example is the use of the term complementarity determining region (CDR) to describe the non-contiguous antigen combining sites found within the variable region of both heavy and light chain polypeptides. This particular region has been described by Kabat et al., U.S. Dept. of Health and Human Services, Sequences of Proteins of Immunological Interest (1983) and by Chothia et al., J. Mol. Biol. 196:901-917 (1987), which are incorporated herein by reference, where the definitions include overlapping or subsets of amino acid residues when compared against each other. Nevertheless, application of either definition to refer to a CDR of an antibody or variants thereof is intended to be within the scope of the term as defined and used herein. The appropriate amino acid residues which encompass the CDRs as defined by each of the above cited references are set forth below in Table I as a comparison. The exact residue numbers which encompass a particular CDR will vary depending on the sequence and size of the CDR. Those skilled in the art can routinely determine which residues comprise a particular CDR given the variable region amino acid sequence of the antibody.
TABLE-US-00001 TABLE 1 CDR Definitions.sup.1 Kabat Chothia VH CDR1 31-35 26-32 VH CDR2 50-65 52-58 VH CDR3 95-102 95-102 VL CDR1 24-34 26-32 VL CDR2 50-56 50-52 VL CDR3 89-97 91-96 .sup.1Numbering of all CDR definitions in Table 1 is according to the numbering conventions set forth by Kabat et al. (see below).
[0093] Kabat et al. also defined a numbering system for variable domain sequences that is applicable to any antibody. One of ordinary skill in the art can unambiguously assign this system of Kabat numbering to any variable domain sequence, without reliance on any experimental data beyond the sequence itself. As used herein, Kabat numbering refers to the numbering system set forth by Kabat et al., U.S. Dept. of Health and Human Services, Sequence of Proteins of Immunological Interest (1983). Unless otherwise specified, references to the numbering of specific amino acid residue positions in a binding molecule which specifically binds to Pseudomonas Psl, e.g., an antibody, or antigen-binding fragment, variant, or derivative thereof as disclosed herein are according to the Kabat numbering system.
[0094] Binding molecules, e.g., antibodies or antigen-binding fragments, variants, or derivatives thereof include, but are not limited to, polyclonal, monoclonal, human, humanized, or chimeric antibodies, single chain antibodies, epitope-binding fragments, e.g., Fab, Fab and F(ab).sub.2, Fd, Fvs, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv), fragments comprising either a VL or VH domain, fragments produced by a Fab expression library. ScFv molecules are known in the art and are described, e.g., in U.S. Pat. No. 5,892,019. Immunoglobulin or antibody molecules encompassed by this disclosure can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecule.
[0095] By specifically binds, it is generally meant that a binding molecule, e.g., an antibody or fragment, variant, or derivative thereof binds to an epitope via its antigen binding domain, and that the binding entails some complementarity between the antigen binding domain and the epitope. According to this definition, a binding molecule is said to specifically bind to an epitope when it binds to that epitope, via its antigen binding domain more readily than it would bind to a random, unrelated epitope. The term specificity is used herein to qualify the relative affinity by which a certain binding molecule binds to a certain epitope. For example, binding molecule A may be deemed to have a higher specificity for a given epitope than binding molecule B, or binding molecule A may be said to bind to epitope C with a higher specificity than it has for related epitope D.
[0096] By preferentially binds, it is meant that the antibody specifically binds to an epitope more readily than it would bind to a related, similar, homologous, or analogous epitope. Thus, an antibody which preferentially binds to a given epitope would more likely bind to that epitope than to a related epitope, even though such an antibody can cross-react with the related epitope.
[0097] By way of non-limiting example, a binding molecule, e.g., an antibody can be considered to bind a first epitope preferentially if it binds said first epitope with a dissociation constant (K.sub.D) that is less than the antibody's K.sub.D for the second epitope. In another non-limiting example, a binding molecule such as an antibody can be considered to bind a first antigen preferentially if it binds the first epitope with an affinity that is at least one order of magnitudeless than the antibody's K.sub.D for the second epitope. In another non-limiting example, a binding molecule can be considered to bind a first epitope preferentially if it binds the first epitope with an affinity that is at least two orders of magnitude less than the antibody's K.sub.D for the second epitope.
[0098] In another non-limiting example, a binding molecule, e.g., an antibody or fragment, variant, or derivative thereof can be considered to bind a first epitope preferentially if it binds the first epitope with an off rate (k(off)) that is less than the antibody's k(off) for the second epitope. In another non-limiting example, a binding molecule can be considered to bind a first epitope preferentially if it binds the first epitope with an affinity that is at least one order of magnitude less than the antibody's k(off) for the second epitope. In another non-limiting example, a binding molecule can be considered to bind a first epitope preferentially if it binds the first epitope with an affinity that is at least two orders of magnitude less than the antibody's k(off) for the second epitope.
[0099] A binding molecule, e.g., an antibody or fragment, variant, or derivative thereof disclosed herein can be said to bind a target antigen, e.g., a polysaccharide disclosed herein or a fragment or variant thereof with an off rate (k(off)) of less than or equal to 510.sup.2 sec.sup.1, 10.sup.2 sec.sup.1, 510.sup.3 sec.sup.1 or 10.sup.3 sec.sup.1. A binding molecule as disclosed herein can be said to bind a target antigen, e.g., a polysaccharide with an off rate (k(off)) less than or equal to 510.sup.4 sec.sup.1, 10.sup.4 sec.sup.1, 510.sup.5 sec.sup.1, or 10.sup.5 sec.sup.1 510.sup.6 sec.sup.1, 10.sup.6 sec.sup.1, 510.sup.7 sec.sup.1 or 10.sup.7 sec.sup.1.
[0100] A binding molecule, e.g., an antibody or antigen-binding fragment, variant, or derivative disclosed herein can be said to bind a target antigen, e.g., a polysaccharide with an on rate (k(on)) of greater than or equal to 10.sup.3 M.sup.1 sec.sup.1, 510.sup.3 M.sup.1 sec.sup.1, 10.sup.4 M.sup.1 sec.sup.1 or 510.sup.4 M.sup.1 sec.sup.1. A binding molecule as disclosed herein can be said to bind a target antigen, e.g., a polysaccharide with an on rate (k(on)) greater than or equal to 10.sup.5 M.sup.1 sec.sup.1, 510.sup.5 M.sup.1 sec.sup.1, 10.sup.6 M.sup.1 sec.sup.1, or 510.sup.6 M.sup.1 sec.sup.1 or 10.sup.7 M.sup.1 sec.sup.1.
[0101] A binding molecule, e.g., an antibody or fragment, variant, or derivative thereof is said to competitively inhibit binding of a reference antibody or antigen binding fragment to a given epitope if it preferentially binds to that epitope to the extent that it blocks, to some degree, binding of the reference antibody or antigen binding fragment to the epitope. Competitive inhibition can be determined by any method known in the art, for example, competition ELISA assays. A binding molecule can be said to competitively inhibit binding of the reference antibody or antigen binding fragment to a given epitope by at least 90%, at least 80%, at least 70%, at least 60%, or at least 50%.
[0102] As used herein, the term affinity refers to a measure of the strength of the binding of an individual epitope with the CDR of an immunoglobulin molecule. See, e.g., Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) at pages 27-28. As used herein, the term avidity refers to the overall stability of the complex between a population of immunoglobulins and an antigen, that is, the functional combining strength of an immunoglobulin mixture with the antigen. See, e.g., Harlow at pages 29-34. Avidity is related to both the affinity of individual immunoglobulin molecules in the population with specific epitopes, and also the valencies of the immunoglobulins and the antigen. For example, the interaction between a bivalent monoclonal antibody and an antigen with a highly repeating epitope structure, such as a polymer, would be one of high avidity.
[0103] Binding molecules or antigen-binding fragments, variants or derivatives thereof as disclosed herein can also be described or specified in terms of their cross-reactivity. As used herein, the term cross-reactivity refers to the ability of a binding molecule, e.g., an antibody or fragment, variant, or derivative thereof, specific for one antigen, to react with a second antigen; a measure of relatedness between two different antigenic substances. Thus, a binding molecule is cross reactive if it binds to an epitope other than the one that induced its formation. The cross reactive epitope generally contains many of the same complementary structural features as the inducing epitope, and in some cases, can actually fit better than the original.
[0104] A binding molecule, e.g., an antibody or fragment, variant, or derivative thereof can also be described or specified in terms of their binding affinity to an antigen. For example, a binding molecule can bind to an antigen with a dissociation constant or K.sub.D no greater than 510.sup.2 M, 10.sup.2 M, 510.sup.3 M, 10.sup.3 M, 510.sup.4 M, 10.sup.4 M, 510.sup.5 M, 10.sup.5 M, 510.sup.6 M, 10.sup.6 M, 510.sup.7 M, 10.sup.7 M, 510.sup.8 M, 10.sup.8 M, 510.sup.9 M, 10.sup.9 M, 510.sup.10 M, 10.sup.10 M, 510.sup.11 M, 10.sup.11 M, 510.sup.12 M, 10.sup.12 M, 510.sup.13 M, 10.sup.13 M, 510.sup.14 M, 10.sup.14 M, 510.sup.15 M, or 10.sup.15 M.
[0105] Antibody fragments including single-chain antibodies can comprise the variable region(s) alone or in combination with the entirety or a portion of the following: hinge region, CH1, CH2, and CH3 domains. Also included are antigen-binding fragments also comprising any combination of variable region(s) with a hinge region, CH1, CH2, and CH3 domains. Binding molecules, e.g., antibodies, or antigen-binding fragments thereof disclosed herein can be from any animal origin including birds and mammals. The antibodies can be human, murine, donkey, rabbit, goat, guinea pig, camel, llama, horse, or chicken antibodies. In another embodiment, the variable region can be condricthoid in origin (e.g., from sharks). As used herein, human antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulins and that do not express endogenous immunoglobulins, as described infra and, for example in, U.S. Pat. No. 5,939,598 by Kucherlapati et al.
[0106] As used herein, the term heavy chain portion includes amino acid sequences derived from an immunoglobulin heavy chain. a binding molecule, e.g., an antibody comprising a heavy chain portion comprises at least one of: a CH1 domain, a hinge (e.g., upper, middle, and/or lower hinge region) domain, a CH2 domain, a CH3 domain, or a variant or fragment thereof. For example, a binding molecule, e.g., an antibody or fragment, variant, or derivative thereof can comprise a polypeptide chain comprising a CH1 domain; a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, and a CH2 domain; a polypeptide chain comprising a CH1 domain and a CH3 domain; a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, and a CH3 domain, or a polypeptide chain comprising a CH1 domain, at least a portion of a hinge domain, a CH2 domain, and a CH3 domain. In another embodiment, a binding molecule, e.g., an antibody or fragment, variant, or derivative thereof comprises a polypeptide chain comprising a CH3 domain. Further, a binding molecule for use in the disclosure can lack at least a portion of a CH2 domain (e.g., all or part of a CH2 domain). As set forth above, it will be understood by one of ordinary skill in the art that these domains (e.g., the heavy chain portions) can be modified such that they vary in amino acid sequence from the naturally occurring immunoglobulin molecule.
[0107] The heavy chain portions of a binding molecule, e.g., an antibody as disclosed herein can be derived from different immunoglobulin molecules. For example, a heavy chain portion of a polypeptide can comprise a CH1 domain derived from an IgG1 molecule and a hinge region derived from an IgG3 molecule. In another example, a heavy chain portion can comprise a hinge region derived, in part, from an IgG1 molecule and, in part, from an IgG3 molecule. In another example, a heavy chain portion can comprise a chimeric hinge derived, in part, from an IgG1 molecule and, in part, from an IgG4 molecule.
[0108] As used herein, the term light chain portion includes amino acid sequences derived from an immunoglobulin light chain. The light chain portion comprises at least one of a VL or CL domain.
[0109] Binding molecules, e.g., antibodies or antigen-binding fragments, variants, or derivatives thereof disclosed herein can be described or specified in terms of the epitope(s) or portion(s) of an antigen, e.g., a target polysaccharide that they recognize or specifically bind. The portion of a target polysaccharide which specifically interacts with the antigen binding domain of an antibody is an epitope, or an antigenic determinant. A target antigen, e.g., a polysaccharide can comprise a single epitope, but typically comprises at least two epitopes, and can include any number of epitopes, depending on the size, conformation, and type of antigen.
[0110] As previously indicated, the subunit structures and three dimensional configuration of the constant regions of the various immunoglobulin classes are well known. As used herein, the term VH domain includes the amino terminal variable domain of an immunoglobulin heavy chain and the term CH1 domain includes the first (most amino terminal) constant region domain of an immunoglobulin heavy chain. The CH1 domain is adjacent to the VH domain and is amino terminal to the hinge region of an immunoglobulin heavy chain molecule.
[0111] As used herein the term CH2 domain includes the portion of a heavy chain molecule that extends, e.g., from about residue 244 to residue 360 of an antibody using conventional numbering schemes (residues 244 to 360, Kabat numbering system; and residues 231-340, EU numbering system; see Kabat E A et al. op. cit. The CH2 domain is unique in that it is not closely paired with another domain. Rather, two N-linked branched carbohydrate chains are interposed between the two CH2 domains of an intact native IgG molecule. It is also well documented that the CH3 domain extends from the CH2 domain to the C-terminal of the IgG molecule and comprises approximately 108 residues.
[0112] As used herein, the term hinge region includes the portion of a heavy chain molecule that joins the CH1 domain to the CH2 domain. This hinge region comprises approximately 25 residues and is flexible, thus allowing the two N-terminal antigen binding regions to move independently. Hinge regions can be subdivided into three distinct domains: upper, middle, and lower hinge domains (Roux et al., J. Immunol. 161:4083 (1998)).
[0113] As used herein the term disulfide bond includes the covalent bond formed between two sulfur atoms. The amino acid cysteine comprises a thiol group that can form a disulfide bond or bridge with a second thiol group. In most naturally occurring IgG molecules, the CH1 and CL regions are linked by a disulfide bond and the two heavy chains are linked by two disulfide bonds at positions corresponding to 239 and 242 using the Kabat numbering system (position 226 or 229, EU numbering system).
[0114] As used herein, the term chimeric antibody will be held to mean any antibody wherein the immunoreactive region or site is obtained or derived from a first species and the constant region (which can be intact, partial or modified) is obtained from a second species. In some embodiments the target binding region or site will be from a non-human source (e.g. mouse or primate) and the constant region is human.
[0115] As used herein, the term engineered antibody refers to an antibody in which the variable domain in either the heavy and light chain or both is altered by at least partial replacement of one or more CDRs from an antibody of known specificity and, if necessary, by partial framework region replacement and sequence changing. Although the CDRs can be derived from an antibody of the same class or even subclass as the antibody from which the framework regions are derived, it is envisaged that the CDRs will be derived from an antibody of different class and preferably from an antibody from a different species. An engineered antibody in which one or more donor CDRs from a non-human antibody of known specificity is grafted into a human heavy or light chain framework region is referred to herein as a humanized antibody. It may not be necessary to replace all of the CDRs with the complete CDRs from the donor variable region to transfer the antigen binding capacity of one variable domain to another. Rather, it may only be necessary to transfer those residues that are necessary to maintain the activity of the target binding site. Given the explanations set forth in, e.g., U.S. Pat. Nos. 5,585,089, 5,693,761, 5,693,762, and 6,180,370, it will be well within the competence of those skilled in the art, either by carrying out routine experimentation or by trial and error testing to obtain a functional engineered or humanized antibody.
[0116] As used herein the term properly folded polypeptide includes polypeptides (e.g., anti-Pseudomonas Psl antibodies) in which all of the functional domains comprising the polypeptide are distinctly active. As used herein, the term improperly folded polypeptide includes polypeptides in which at least one of the functional domains of the polypeptide is not active. In one embodiment, a properly folded polypeptide comprises polypeptide chains linked by at least one disulfide bond and, conversely, an improperly folded polypeptide comprises polypeptide chains not linked by at least one disulfide bond.
[0117] As used herein the term engineered includes manipulation of nucleic acid or polypeptide molecules by synthetic means (e.g. by recombinant techniques, in vitro peptide synthesis, by enzymatic or chemical coupling of peptides or some combination of these techniques).
[0118] As used herein, the terms linked, fused or fusion are used interchangeably. These terms refer to the joining together of two more elements or components, by whatever means including chemical conjugation or recombinant means. An in-frame fusion refers to the joining of two or more polynucleotide open reading frames (ORFs) to form a continuous longer ORF, in a manner that maintains the correct translational reading frame of the original ORFs. Thus, a recombinant fusion protein is a single protein containing two or more segments that correspond to polypeptides encoded by the original ORFs (which segments are not normally so joined in nature.) Although the reading frame is thus made continuous throughout the fused segments, the segments can be physically or spatially separated by, for example, in-frame linker sequence. For example, polynucleotides encoding the CDRs of an immunoglobulin variable region can be fused, in-frame, but be separated by a polynucleotide encoding at least one immunoglobulin framework region or additional CDR regions, as long as the fused CDRs are co-translated as part of a continuous polypeptide.
[0119] In the context of polypeptides, a linear sequence or a sequence is an order of amino acids in a polypeptide in an amino to carboxyl terminal direction in which residues that neighbor each other in the sequence are contiguous in the primary structure of the polypeptide.
[0120] The term expression as used herein refers to a process by which a gene produces a biochemical, for example, a polypeptide. The process includes any manifestation of the functional presence of the gene within the cell including, without limitation, gene knockdown as well as both transient expression and stable expression. It includes without limitation transcription of the gene into messenger RNA (mRNA), and the translation of such mRNA into polypeptide(s). If the final desired product is a biochemical, expression includes the creation of that biochemical and any precursors. Expression of a gene produces a gene product. As used herein, a gene product can be either a nucleic acid, e.g., a messenger RNA produced by transcription of a gene, or a polypeptide which is translated from a transcript. Gene products described herein further include nucleic acids with post transcriptional modifications, e.g., polyadenylation, or polypeptides with post translational modifications, e.g., methylation, glycosylation, the addition of lipids, association with other protein subunits, proteolytic cleavage, and the like.
[0121] As used herein, the terms treat or treatment refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change, infection, or disorder. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilized (i.e., not worsening) state of disease, clearance or reduction of an infectious agent such as P. aeruginosa in a subject, a delay or slowing of disease progression, amelioration or palliation of the disease state, and remission (whether partial or total), whether detectable or undetectable. Treatment can also mean prolonging survival as compared to expected survival if not receiving treatment. Those in need of treatment include those already with the infection, condition, or disorder as well as those prone to have the condition or disorder or those in which the condition or disorder is to be prevented, e.g., in burn patients or immunosuppressed patients susceptible to P. aeruginosa infection.
[0122] By subject or individual or animal or patient or mammal, is meant any subject, particularly a mammalian subject, for whom diagnosis, prognosis, or therapy is desired. Mammalian subjects include humans, domestic animals, farm animals, and zoo, sports, or pet animals such as dogs, cats, guinea pigs, rabbits, rats, mice, horses, cattle, cows, bears, and so on.
[0123] As used herein, phrases such as a subject that would benefit from administration of an anti-Pseudomonas Psl antibody and an animal in need of treatment includes subjects, such as mammalian subjects, that would benefit from administration of an anti-Pseudomonas Psl antibody used, e.g., for detection of Pseudomonas Psl (e.g., for a diagnostic procedure) and/or from treatment, i.e., palliation or prevention of a disease, with an anti-Pseudomonas Psl antibody. As described in more detail herein, the anti-Pseudomonas Psl antibody can be used in unconjugated form or can be conjugated, e.g., to a drug, prodrug, or an isotope.
II. Binding Molecules
[0124] One embodiment is directed to an isolated binding molecule e.g., an antibody or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl, wherein the binding molecule (a) can inhibit attachment of Pseudomonas aeruginosa to epithelial cells, (b) can promote, mediate, or enhance opsonophagocytic killing (OPK) of P. aeruginosa, or (c) can inhibit attachment of P. aeruginosa to epithelial cells and can promote, mediate, or enhance OPK of P. aeruginosa. In certain embodiments, the binding molecule or fragment thereof as described above can be antibody or antigen-binding fragment thereof such as Cam-003 or WapR-004.
[0125] As used herein, the term antigen binding domain includes a site that specifically binds an epitope on an antigen (e.g., an epitope of Pseudomonas Psl). The antigen binding domain of an antibody typically includes at least a portion of an immunoglobulin heavy chain variable region and at least a portion of an immunoglobulin light chain variable region. The binding site formed by these variable regions determines the specificity of the antibody.
[0126] The disclosure is more specifically directed to an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof which specifically binds to the same Pseudomonas Psl epitope as an antibody or antigen-binding fragment thereof comprising the heavy chain variable region (VH) and light chain variable region (VL) region of WapR-004, Cam-003, Cam-004, or Cam-005.
[0127] Further included is an isolated binding molecule, e.g., an antibody or fragment thereof which specifically binds to Pseudomonas Psl and competitively inhibits Pseudomonas Psl binding by an antibody or antigen-binding fragment thereof comprising the VH and VL of WapR-004, Cam-003, Cam-004, or Cam-005.
[0128] One embodiment is directed to an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof which specifically binds to the same Pseudomonas Psl epitope as an antibody or antigen-binding fragment thereof comprising the VH and VL region of WapR-001, WapR-002, or WapR-003.
[0129] Also included is an isolated binding molecule, e.g., an antibody or fragment thereof which specifically binds to Pseudomonas Psl and competitively inhibits Pseudomonas Psl binding by an antibody or antigen-binding fragment thereof comprising the VH and VL of WapR-001, WapR-002, or WapR-003.
[0130] Further included is an isolated binding molecule, e.g., an antibody or fragment thereof which specifically binds to Pseudomonas Psl and competitively inhibits Pseudomonas Psl binding by an antibody or antigen-binding fragment thereof comprising the VH and VL of WapR-016.
[0131] Also included is an isolated binding molecule, e.g., an antibody or fragment thereof which specifically binds to Pseudomonas Psl and competitively inhibits Pseudomonas Psl binding by an antibody or antigen-binding fragment thereof comprising the VH and VL of WapR16.
[0132] Methods of making antibodies are well known in the art and described herein. Once antibodies to various fragments of, or to the full-length Pseudomonas Psl without the signal sequence, have been produced, determining which amino acids, or epitope, of Pseudomonas Psl to which the antibody or antigen binding fragment binds can be determined by epitope mapping protocols as described herein as well as methods known in the art (e.g. double antibody-sandwich ELISA as described in Chapter 11Immunology, Current Protocols in Molecular Biology, Ed. Ausubel et al., v.2, John Wiley & Sons, Inc. (1996)). Additional epitope mapping protocols can be found in Morris, G. Epitope Mapping Protocols, New Jersey: Humana Press (1996), which are both incorporated herein by reference in their entireties. Epitope mapping can also be performed by commercially available means (i.e. ProtoPROBE, Inc. (Milwaukee, Wis.)).
[0133] In certain aspects, the disclosure is directed to a binding molecule, e.g., an antibody or fragment, variant, or derivative thereof which specifically binds to Pseudomonas Psl with an affinity characterized by a dissociation constant (K.sub.D) which is less than the K.sub.D for said reference monoclonal antibody.
[0134] In certain embodiments an anti-Pseudomonas Psl binding molecule, e.g., an antibody or antigen-binding fragment, variant or derivative thereof as disclosed herein binds specifically to at least one epitope of Psl, i.e., binds to such an epitope more readily than it would bind to an unrelated, or random epitope; binds preferentially to at least one epitope of Psl, i.e., binds to such an epitope more readily than it would bind to a related, similar, homologous, or analogous epitope; competitively inhibits binding of a reference antibody which itself binds specifically or preferentially to a certain epitope of Psl; or binds to at least one epitope of Psl with an affinity characterized by a dissociation constant K.sub.D of less than about 510.sup.2 M, about 10.sup.2 M, about 510.sup.3 M, about 10.sup.3 M, about 510.sup.4 M, about 10.sup.4 M, about 510.sup.5 M, about 10.sup.5 M, about 510.sup.6 M, about 10.sup.6 M, about 510.sup.7 M, about 10.sup.7 M, about 510.sup.8 M, about 10.sup.8 M, about 510.sup.9 M, about 10.sup.9 M, about 510.sup.10 M, about 10.sup.10 M, about 510.sup.11 M, about 10.sup.11 M, about 510.sup.12 M, about 10.sup.12 M, about 510.sup.13 M, about 10.sup.13 M, about 510.sup.14 M, about 10.sup.14 M, about 510.sup.15 M, or about 10.sup.15 M.
[0135] As used in the context of binding dissociation constants, the term about allows for the degree of variation inherent in the methods utilized for measuring antibody affinity. For example, depending on the level of precision of the instrumentation used, standard error based on the number of samples measured, and rounding error, the term about 10.sup.2 M might include, for example, from 0.05 M to 0.005 M.
[0136] In specific embodiments a binding molecule, e.g., an antibody, or antigen-binding fragment, variant, or derivative thereof binds Pseudomonas Psl with an off rate (k(off)) of less than or equal to 510.sup.2 sec.sup.1, 10.sup.2 sec.sup.1, 510.sup.3 sec.sup.1 or 10.sup.3 sec.sup.1. Alternatively, an antibody, or antigen-binding fragment, variant, or derivative thereof binds Pseudomonas Psl with an off rate (k(off)) of less than or equal to 510.sup.4 sec.sup.1, 10.sup.4 sec.sup.1, 510.sup.5 sec.sup.1, or 10.sup.5 sec.sup.1 510.sup.6 sec.sup.1, 10.sup.6 sec.sup.1, 510.sup.7 sec.sup.1 or 10.sup.7 sec.sup.1.
[0137] In other embodiments, a binding molecule, e.g., an antibody, or antigen-binding fragment, variant, or derivative thereof as disclosed herein binds Pseudomonas Psl with an on rate (k(on)) of greater than or equal to 10.sup.3 M.sup.1 sec.sup.1, 510.sup.3 M.sup.1 sec.sup.1, 10.sup.4 M.sup.1 sec.sup.1 or 510.sup.4 M.sup.1 sec.sup.1. Alternatively, a binding molecule, e.g., an antibody, or antigen-binding fragment, variant, or derivative thereof as disclosed herein binds Pseudomonas Psl with an on rate (k(on)) greater than or equal to 10.sup.5 M.sup.1 sec.sup.1, 510.sup.5 M.sup.1 sec.sup.1, 10.sup.6 M.sup.1 sec.sup.1, or 5106 M.sup.1 sec.sup.1 or 10.sup.7 M.sup.1 sec.sup.1.
[0138] In various embodiments, an anti-Pseudomonas Psl binding molecule, e.g., an antibody, or antigen-binding fragment, variant, or derivative thereof as described herein promotes opsonophagocytic killing of Pseudomonas, or inhibits Pseudomonas binding to epithelial cells. In certain embodiments described herein, the Pseudomonas Psl target is Pseudomonas aeruginosa Psl. In other embodiments, certain binding molecules described herein can bind to structurally related polysaccharide molecules regardless of their source. Such Psl-like molecules would be expected to be identical to or have sufficient structural relatedness to P. aeruginosa Psl to permit specific recognition by one or more of the binding molecules disclosed. For example, certain binding molecules described herein can bind to Psl-like molecules produced by other bacterial species, for example, Psl-like molecules produced by other Pseudomonas species, e.g., Pseudomonas fluorescens, Pseudomonas putida, or Pseudomonas alcaligenes. Alternatively, certain binding molecules as described herein can bind to Psl-like molecules produced synthetically or by host cells genetically modified to produce Psl-like molecules.
[0139] Unless it is specifically noted, as used herein a fragment thereof in reference to a binding molecule, e.g., an antibody refers to an antigen-binding fragment, i.e., a portion of the antibody which specifically binds to the antigen.
[0140] An anti-Pseudomonas Psl binding molecules, e.g., antibodies or antigen-binding fragments, variants, or derivatives thereof can comprise a constant region which mediates one or more effector functions. For example, binding of the C1 component of complement to an antibody constant region can activate the complement system. Activation of complement is important in the opsonization and lysis of pathogens. The activation of complement also stimulates the inflammatory response and can also be involved in autoimmune hypersensitivity. Further, antibodies bind to receptors on various cells via the Fc region, with a Fc receptor binding site on the antibody Fc region binding to a Fc receptor (FcR) on a cell. There are a number of Fc receptors which are specific for different classes of antibody, including IgG (gamma receptors), IgE (epsilon receptors), IgA (alpha receptors) and IgM (mu receptors). Binding of antibody to Fc receptors on cell surfaces triggers a number of important and diverse biological responses including engulfment and destruction of antibody-coated particles, clearance of immune complexes, lysis of antibody-coated target cells by killer cells (called antibody-dependent cell-mediated cytotoxicity, or ADCC), release of inflammatory mediators, placental transfer and control of immunoglobulin production.
[0141] Accordingly, certain embodiments disclosed herein include an anti-Pseudomonas Psl binding molecule, e.g., an antibody, or antigen-binding fragment, variant, or derivative thereof, in which at least a fraction of one or more of the constant region domains has been deleted or otherwise altered so as to provide desired biochemical characteristics such as reduced effector functions, the ability to non-covalently dimerize, increased ability to localize at the site of a tumor, reduced serum half-life, or increased serum half-life when compared with a whole, unaltered antibody of approximately the same immunogenicity. For example, certain binding molecules described herein are domain deleted antibodies which comprise a polypeptide chain similar to an immunoglobulin heavy chain, but which lack at least a portion of one or more heavy chain domains. For instance, in certain antibodies, one entire domain of the constant region of the modified antibody will be deleted, for example, all or part of the CH2 domain will be deleted.
[0142] Modified forms of anti-Pseudomonas Psl binding molecules, e.g., antibodies or antigen-binding fragments, variants, or derivatives thereof can be made from whole precursor or parent antibodies using techniques known in the art. Exemplary techniques are discussed elsewhere herein.
[0143] In certain embodiments both the variable and constant regions of anti-Pseudomonas Psl binding molecules, e.g., antibodies or antigen-binding fragments are fully human. Fully human antibodies can be made using techniques that are known in the art and as described herein. For example, fully human antibodies against a specific antigen can be prepared by administering the antigen to a transgenic animal which has been modified to produce such antibodies in response to antigenic challenge, but whose endogenous loci have been disabled. Exemplary techniques that can be used to make such antibodies are described in U.S. Pat. Nos. 6,150,584; 6,458,592; 6,420,140. Other techniques are known in the art. Fully human anti bodies can likewise be produced by various display technologies, e.g., phage display or other viral display systems, as described in more detail elsewhere herein.
[0144] Anti-Pseudomonas Psl binding molecules, e.g., antibodies or antigen-binding fragments, variants, or derivatives thereof as disclosed herein can be made or manufactured using techniques that are known in the art. In certain embodiments, binding molecules or fragments thereof are recombinantly produced, i.e., are produced using recombinant DNA technology. Exemplary techniques for making antibody molecules or fragments thereof are discussed in more detail elsewhere herein.
[0145] In certain anti-Pseudomonas Psl binding molecules, e.g., antibodies or antigen-binding fragments, variants, or derivatives thereof described herein, the Fc portion can be mutated to decrease effector function using techniques known in the art. For example, the deletion or inactivation (through point mutations or other means) of a constant region domain can reduce Fc receptor binding of the circulating modified antibody thereby increasing tumor localization. In other cases it can be that constant region modifications moderate complement binding and thus reduce the serum half-life and nonspecific association of a conjugated cytotoxin. Yet other modifications of the constant region can be used to modify disulfide linkages or oligosaccharide moieties that allow for enhanced localization due to increased antigen specificity or antibody flexibility. The resulting physiological profile, bioavailability and other biochemical effects of the modifications, such as localization, biodistribution and serum half-life, can easily be measured and quantified using well known immunological techniques without undue experimentation.
[0146] In certain embodiments, anti-Pseudomonas Psl binding molecules, e.g., antibodies or antigen-binding fragments, variants, or derivatives thereof will not elicit a deleterious immune response in the animal to be treated, e.g., in a human. In one embodiment, anti-Pseudomonas Psl binding molecules, e.g., antibodies or antigen-binding fragments, variants, or derivatives thereof are modified to reduce their immunogenicity using art-recognized techniques. For example, antibodies can be humanized, de-immunized, or chimeric antibodies can be made. These types of antibodies are derived from a non-human antibody, typically a murine or primate antibody, that retains or substantially retains the antigen-binding properties of the parent antibody, but which is less immunogenic in humans. This can be achieved by various methods, including (a) grafting the entire non-human variable domains onto human constant regions to generate chimeric antibodies; (b) grafting at least a part of one or more of the non-human complementarity determining regions (CDRs) into a human framework and constant regions with or without retention of critical framework residues; or (c) transplanting the entire non-human variable domains, but cloaking them with a human-like section by replacement of surface residues. Such methods are disclosed in Morrison et al., Proc. Natl. Acad. Sci. 81:6851-6855 (1984); Morrison et al., Adv. Immunol. 44:65-92 (1988); Verhoeyen et al., Science 239:1534-1536 (1988); Padlan, Molec. Immun. 28:489-498 (1991); Padlan, Molec. Immun. 31:169-217 (1994), and U.S. Pat. Nos. 5,585,089, 5,693,761, 5,693,762, and 6,190,370, all of which are hereby incorporated by reference in their entirety.
[0147] De-immunization can also be used to decrease the immunogenicity of an antibody. As used herein, the term de-immunization includes alteration of an antibody to modify T cell epitopes (see, e.g., WO9852976A1, WO0034317A2). For example, VH and VL sequences from the starting antibody are analyzed and a human T cell epitope map from each V region showing the location of epitopes in relation to complementarity-determining regions (CDRs) and other key residues within the sequence. Individual T cell epitopes from the T cell epitope map are analyzed in order to identify alternative amino acid substitutions with a low risk of altering activity of the final antibody. A range of alternative VH and VL sequences are designed comprising combinations of amino acid substitutions and these sequences are subsequently incorporated into a range of binding polypeptides, e.g., Pseudomonas Psl-specific antibodies or antigen-binding fragments thereof disclosed herein, which are then tested for function. Complete heavy and light chain genes comprising modified V and human C regions are then cloned into expression vectors and the subsequent plasmids introduced into cell lines for the production of whole antibody. The antibodies are then compared in appropriate biochemical and biological assays, and the optimal variant is identified.
[0148] Anti-Pseudomonas Psl binding molecules, e.g., antibodies or antigen-binding fragments, variants, or derivatives thereof can be generated by any suitable method known in the art. Polyclonal antibodies to an antigen of interest can be produced by various procedures well known in the art. For example, an anti-Pseudomonas Psl antibody or antigen-binding fragment thereof can be administered to various host animals including, but not limited to, rabbits, mice, rats, chickens, hamsters, goats, donkeys, etc., to induce the production of sera containing polyclonal antibodies specific for the antigen. Various adjuvants can be used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Such adjuvants are also well known in the art.
[0149] Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. For example, monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 2nd ed. (1988)
[0150] DNA encoding antibodies or antibody fragments (e.g., antigen binding sites) can also be derived from antibody libraries, such as phage display libraries. In a particular, such phage can be utilized to display antigen-binding domains expressed from a repertoire or combinatorial antibody library (e.g., human or murine). Phage expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Phage used in these methods are typically filamentous phage including fd and M13 binding domains expressed from phage with scFv, Fab, Fv OE DAB (individual Fv region from light or heavy chains) or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein. Exemplary methods are set forth, for example, in EP 368 684 B1; U.S. Pat. No. 5,969,108, Hoogenboom, H. R. and Chames, Immunol. Today 21:371 (2000); Nagy et al. Nat. Med. 8:801 (2002); Huie et al., Proc. Natl. Acad. Sci. USA 98:2682 (2001); Lui et al., J. Mol. Biol. 315:1063 (2002), each of which is incorporated herein by reference. Several publications (e.g., Marks et al., Bio/Technology 10:779-783 (1992)) have described the production of high affinity human antibodies by chain shuffling, as well as combinatorial infection and in vivo recombination as a strategy for constructing large phage libraries. In another embodiment, Ribosomal display can be used to replace bacteriophage as the display platform (see, e.g., Hanes et al., Nat. Biotechnol. 18:1287 (2000); Wilson et al., Proc. Natl. Acad. Sci. USA 98:3750 (2001); or Irving et al., J. Immunol. Methods 248:31 (2001)). In yet another embodiment, cell surface libraries can be screened for antibodies (Boder et al., Proc. Natl. Acad. Sci. USA 97:10701 (2000); Daugherty et al., J. Immunol. Methods 243:211 (2000)). Such procedures provide alternatives to traditional hybridoma techniques for the isolation and subsequent cloning of monoclonal antibodies.
[0151] In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. For example, DNA sequences encoding VH and VL regions are amplified from animal cDNA libraries (e.g., human or murine cDNA libraries of lymphoid tissues) or synthetic cDNA libraries. In certain embodiments, the DNA encoding the VH and VL regions are joined together by an scFv linker by PCR and cloned into a phagemid vector (e.g., p CANTAB 6 or pComb 3 HSS). The vector is electroporated in E. coli and the E. coli is infected with helper phage. Phage used in these methods are typically filamentous phage including fd and M13 and the VH or VL regions are usually recombinantly fused to either the phage gene III or gene VIII. Phage expressing an antigen binding domain that binds to an antigen of interest (i.e., Pseudomonas Psl) can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead.
[0152] Additional examples of phage display methods that can be used to make the antibodies include those disclosed in Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-186 (1995); Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et al., Gene 187:9-18 (1997); Burton et al., Advances in Immunology 57:191-280 (1994); PCT Application No. PCT/GB91/01134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Pat. Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is incorporated herein by reference in its entirety.
[0153] As described in the above references and in the examples below, after phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria. For example, techniques to recombinantly produce Fab, Fab and F(ab).sub.2 fragments can also be employed using methods known in the art such as those disclosed in PCT publication WO 92/22324; Mullinax et al., BioTechniques 12(6):864-869 (1992); and Sawai et al., AJRI 34:26-34 (1995); and Better et al., Science 240:1041-1043 (1988) (said references incorporated by reference in their entireties).
[0154] Examples of techniques which can be used to produce single-chain Fvs and antibodies include those described in U.S. Pat. Nos. 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology 203:46-88 (1991); Shu et al., PNAS 90:7995-7999 (1993); and Skerra et al., Science 240:1038-1040 (1988). In certain embodiments such as therapeutic administration, chimeric, humanized, or human antibodies can be used. A chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Methods for producing chimeric antibodies are known in the art. See, e.g., Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Gillies et al., J. Immunol. Methods 125:191-202 (1989); U.S. Pat. Nos. 5,807,715; 4,816,567; and 4,816397, which are incorporated herein by reference in their entireties. Humanized antibodies are antibody molecules from non-human species antibody that binds the desired antigen having one or more complementarity determining regions (CDRs) from the non-human species and framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al., U.S. Pat. No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which are incorporated herein by reference in their entireties.) Antibodies can be humanized using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Pat. Nos. 5,225,539; 5,530,101; and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28(4/5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska. et al., PNAS 91:969-973 (1994)), and chain shuffling (U.S. Pat. No. 5,565,332).
[0155] Fully human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies can be made by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also, U.S. Pat. Nos. 4,444,887 and 4,716,111; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incorporated herein by reference in its entirety.
[0156] Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes. For example, the human heavy and light chain immunoglobulin gene complexes can be introduced randomly or by homologous recombination into mouse embryonic stem cells. In addition, various companies can be engaged to provide human antibodies produced in transgenic mice directed against a selected antigen using technology similar to that described above.
[0157] Fully human antibodies which recognize a selected epitope can be generated using a technique referred to as guided selection. In this approach a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope. (Jespers et al., Bio/Technology 12:899-903 (1988). See also, U.S. Pat. No. 5,565,332.)
[0158] In another embodiment, DNA encoding desired monoclonal antibodies can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies). Isolated and subcloned hybridoma cells or isolated phage, for example, can serve as a source of such DNA. Once isolated, the DNA can be placed into expression vectors, which are then transfected into prokaryotic or eukaryotic host cells such as E. coli cells, simian COS cells, Chinese Hamster Ovary (CHO) cells or myeloma cells that do not otherwise produce immunoglobulins. More particularly, the isolated DNA (which can be synthetic as described herein) can be used to clone constant and variable region sequences for the manufacture antibodies as described in Newman et al., U.S. Pat. No. 5,658,570, filed Jan. 25, 1995, which is incorporated by reference herein. Transformed cells expressing the desired antibody can be grown up in relatively large quantities to provide clinical and commercial supplies of the immunoglobulin.
[0159] In one embodiment, an isolated binding molecule, e.g., an antibody comprises at least one heavy or light chain CDR of an antibody molecule. In another embodiment, an isolated binding molecule comprises at least two CDRs from one or more antibody molecules. In another embodiment, an isolated binding molecule comprises at least three CDRs from one or more antibody molecules. In another embodiment, an isolated binding molecule comprises at least four CDRs from one or more antibody molecules. In another embodiment, an isolated binding molecule comprises at least five CDRs from one or more antibody molecules. In another embodiment, an isolated binding molecule of the description comprises at least six CDRs from one or more antibody molecules.
[0160] In a specific embodiment, the amino acid sequence of the heavy and/or light chain variable domains can be inspected to identify the sequences of the complementarity determining regions (CDRs) by methods that are well-known in the art, e.g., by comparison to known amino acid sequences of other heavy and light chain variable regions to determine the regions of sequence hypervariability. Using routine recombinant DNA techniques, one or more of the CDRs can be inserted within framework regions, e.g., into human framework regions to humanize a non-human antibody. The framework regions can be naturally occurring or consensus framework regions, and preferably human framework regions (see, e.g., Chothia et al., J. Mol. Biol. 278:457-479 (1998) for a listing of human framework regions). The polynucleotide generated by the combination of the framework regions and CDRs encodes an antibody that specifically binds to at least one epitope of a desired antigen, e.g., Psl. One or more amino acid substitutions can be made within the framework regions, and, the amino acid substitutions improve binding of the antibody to its antigen. Additionally, such methods can be used to make amino acid substitutions or deletions of one or more variable region cysteine residues participating in an intrachain disulfide bond to generate antibody molecules lacking one or more intrachain disulfide bonds. Other alterations to the polynucleotide are encompassed by the present disclosure and are within the capabilities of a person of skill of the art.
[0161] Also provided are binding molecules that comprise, consist essentially of, or consist of, variants (including derivatives) of antibody molecules (e.g., the VH regions and/or VL regions) described herein, which binding molecules or fragments thereof specifically bind to Pseudomonas Psl. Standard techniques known to those of skill in the art can be used to introduce mutations in the nucleotide sequence encoding a binding molecule or fragment thereof which specifically binds to Pseudomonas Psl, including, but not limited to, site-directed mutagenesis and PCR-mediated mutagenesis which result in amino acid substitutions. The variants (including derivatives) encode polypeptides comprising less than 50 amino acid substitutions, less than 40 amino acid substitutions, less than 30 amino acid substitutions, less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions, less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions, or less than 2 amino acid substitutions relative to the reference VH region, VHCDR1, VHCDR2, VHCDR3, VL region, VLCDR1, VLCDR2, or VLCDR3. A conservative amino acid substitution is one in which the amino acid residue is replaced with an amino acid residue having a side chain with a similar charge. Families of amino acid residues having side chains with similar charges have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Alternatively, mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity (e.g., the ability to bind an Pseudomonas Psl).
[0162] For example, it is possible to introduce mutations only in framework regions or only in CDR regions of an antibody molecule. Introduced mutations can be silent or neutral missense mutations, i.e., have no, or little, effect on an antibody's ability to bind antigen. These types of mutations can be useful to optimize codon usage, or improve a hybridoma's antibody production. Alternatively, non-neutral missense mutations can alter an antibody's ability to bind antigen. The location of most silent and neutral missense mutations is likely to be in the framework regions, while the location of most non-neutral missense mutations is likely to be in CDR, though this is not an absolute requirement. One of skill in the art would be able to design and test mutant molecules with desired properties such as no alteration in antigen binding activity or alteration in binding activity (e.g., improvements in antigen binding activity or change in antibody specificity). Following mutagenesis, the encoded protein can routinely be expressed and the functional and/or biological activity of the encoded protein, (e.g., ability to bind at least one epitope of Pseudomonas Psl) can be determined using techniques described herein or by routinely modifying techniques known in the art.
III. Antibody Polypeptides
[0163] The disclosure is further directed to isolated polypeptides which make up binding molecules, e.g., antibodies or antigen-binding fragments thereof, which specifically bind to Pseudomonas Psl and polynucleotides encoding such polypeptides. Binding molecules, e.g., antibodies or fragments thereof as disclosed herein, comprise polypeptides, e.g., amino acid sequences encoding, for example, Psl-specific antigen binding regions derived from immunoglobulin molecules. A polypeptide or amino acid sequence derived from a designated protein refers to the origin of the polypeptide. In certain cases, the polypeptide or amino acid sequence which is derived from a particular starting polypeptide or amino acid sequence has an amino acid sequence that is essentially identical to that of the starting sequence, or a portion thereof, wherein the portion consists of at least 10-20 amino acids, at least 20-30 amino acids, at least 30-50 amino acids, or which is otherwise identifiable to one of ordinary skill in the art as having its origin in the starting sequence.
[0164] Also disclosed is an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl comprising an immunoglobulin heavy chain variable region (VH) amino acid sequence at least 80%, 85%, 90% 95% or 100% identical to one or more of: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, or SEQ ID NO: 74 as shown in Table 2.
[0165] Further disclosed is an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl comprising a VH amino acid sequence identical to, or identical except for one, two, three, four, five, or more amino acid substitutions to one or more of: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, or SEQ ID NO: 74 as shown in Table 2.
[0166] Some embodiments include an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl comprising a VH, where one or more of the VHCDR1, VHCDR2 or VHCDR3 regions of the VH are at least 80%, 85%, 90%, 95% or 100% identical to one or more reference heavy chain VHCDR1, VHCDR2 or VHCDR3 amino acid sequences of one or more of: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, or SEQ ID NO: 74 as shown in Table 2.
[0167] Further disclosed is an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl comprising a VH, where one or more of the VHCDR1, VHCDR2 or VHCDR3 regions of the VH are identical to, or identical except for four, three, two, or one amino acid substitutions, to one or more reference heavy chain VHCDR1, VHCDR2 and/or VHCDR3 amino acid sequences of one or more of: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, or SEQ ID NO: 74 as shown in Table 2. Thus, according to this embodiment the VH comprises one or more of a VHCDR1, VHCDR2, or VHCDR3 identical to or identical except for four, three, two, or one amino acid substitutions, to one or more of the VHCDR1, VHCDR2, or VHCDR3 amino acid sequences shown in Table 3.
[0168] Also disclosed is an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl comprising an immunoglobulin light chain variable region (VL) amino acid sequence at least 80%, 85%, 90% 95% or 100% identical to one or more of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, or SEQ ID NO: 16 as shown in Table 2.
[0169] Some embodiments disclose an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl comprising a VL amino acid sequence identical to, or identical except for one, two, three, four, five, or more amino acid substitutions, to one or more of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, or SEQ ID NO: 16 as shown in Table 2.
[0170] Also provided is an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl comprising a VL, where one or more of the VLCDR1, VLCDR2 or VLCDR3 regions of the VL are at least 80%, 85%, 90%, 95% or 100% identical to one or more reference light chain VLCDR1, VLCDR2 or VLCDR3 amino acid sequences of one or more of: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, or SEQ ID NO: 16 as shown in Table 2.
[0171] Further provided is an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl comprising a VL, where one or more of the VLCDR1, VLCDR2 or VLCDR3 regions of the VL are identical to, or identical except for four, three, two, or one amino acid substitutions, to one or more reference heavy chain VLCDR1, VLCDR2 and/or VLCDR3 amino acid sequences of one or more of: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, or SEQ ID NO: 16 as shown in Table 2. Thus, according to this embodiment the VL comprises one or more of a VLCDR1, VLCDR2, or VLCDR3 identical to or identical except for four, three, two, or one amino acid substitutions, to one or more of the VLCDR1, VLCDR2, or VLCDR3 amino acid sequences shown in Table 3.
[0172] In other embodiments, an isolated antibody or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl, comprises, consists essentially of, or consists of VH and VL amino acid sequences at least 80%, 85%, 90% 95% or 100% identical to:
(a) SEQ ID NO: 1 and SEQ ID NO: 2, respectively, (b) SEQ ID NO: 3 and SEQ ID NO: 2, respectively, (c) SEQ ID NO: 4 and SEQ ID NO: 2, respectively, (d) SEQ ID NO: 5 and SEQ ID NO: 6, respectively, (e) SEQ ID NO: 7 and SEQ ID NO: 8, respectively, (f) SEQ ID NO: 9 and SEQ ID NO: 10, respectively, (g) SEQ ID NO: 11 and SEQ ID NO: 12, respectively, (h) SEQ ID NO: 13 and SEQ ID NO: 14, respectively; (i) SEQ ID NO: 15 and SEQ ID NO: 16, respectively; or (j) SEQ ID NO: 74 and SEQ ID NO: 12, respectively. In certain embodiments, the above-described antibody or antigen-binding fragment thereof comprises a VH with the amino acid sequence SEQ ID NO: 11 and a VL with the amino acid sequence of SEQ ID NO: 12. In some embodiments, the above-described antibody or antigen-binding fragment thereof comprises a VH with the amino acid sequence SEQ ID NO: 1 and a VL with the amino acid sequence of SEQ ID NO: 2. In other embodiments, the above-described antibody or antigen-binding fragment thereof comprises a VH with the amino acid sequence SEQ ID NO: 11 and a VL with the amino acid sequence of SEQ ID NO: 12.
[0173] In certain embodiments, an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof as described herein specifically binds to Pseudomonas Psl with an affinity characterized by a dissociation constant (K.sub.D) no greater than 510.sup.2 M, 10.sup.2 M, 510.sup.3 M, 10.sup.3 M, 510.sup.4 M, 10.sup.4 M, 510.sup.5 M, 10.sup.5 M, 510.sup.6 M, 10.sup.6 M, 510.sup.7 M, 10.sup.7 M, 510.sup.8 M, 10.sup.8 M, 510.sup.9 M, 10.sup.9 M, 510.sup.10 M, 10.sup.10 M, 510.sup.11 M, 10.sup.11 M, 510.sup.12 M, 10.sup.12 M, 510.sup.13 M, 10.sup.13 M, 510.sup.14 M, 10.sup.14 M, 510.sup.15 M, or 10.sup.15 M.
[0174] In specific embodiments, an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof as described herein specifically binds to Pseudomonas Psl, with an affinity characterized by a dissociation constant (K.sub.D) in a range of about 110.sup.10 to about 110.sup.6 M. In one embodiment, an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof as described herein specifically binds to Pseudomonas Psl, with an affinity characterized by a K.sub.D of about 1.1810.sup.7 M, as determined by the OCTET binding assay described herein. In another embodiment, an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof as described herein specifically binds to Pseudomonas Psl, with an affinity characterized by a K.sub.D of about 1.4410.sup.7 M, as determined by the OCTET binding assay described herein.
[0175] Some embodiments include the isolated binding molecule e.g., an antibody or fragment thereof as described above, which (a) can inhibit attachment of Pseudomonas aeruginosa to epithelial cells, (b) can promote OPK of P. aeruginosa, or (c) can inhibit attachment of P. aeruginosa to epithelial cells and can promote OPK of P. aeruginosa.
[0176] In some embodiments the isolated binding molecule e.g., an antibody or fragment thereof as described above, where maximum inhibition of P. aeruginosa attachment to epithelial cells is achieved at an antibody concentration of about 50 g/ml or less, 5.0 g/ml or less, or about 0.5 g/ml or less, or at an antibody concentration ranging from about 30 g/ml to about 0.3 g/ml, or at an antibody concentration of about 1 g/ml, or at an antibody concentration of about 0.3 g/ml.
[0177] Certain embodiments include the isolated binding molecule e.g., an antibody or fragment thereof as described above, where the OPK EC50 is less than about 0.5 g/ml, less than about 0.05 g/ml, or less than about 0.005 g/ml, or where the OPK EC50 ranges from about 0.001 g/ml to about 0.5 g/ml, or where the OPK EC50 ranges from about 0.02 g/ml to about 0.08 g/ml, or where the OPK EC50 ranges from about 0.002 g/ml to about 0.01 g/ml or where the OPK EC50 is less than about 0.2 g/ml, or wherein the OPK EC50 is less than about 0.02 g/ml. In certain embodiments, an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof described herein specifically binds to the same Psi epitope as monoclonal antibody WapR-004, WapR-004RAD, Cam-003, Cam-004, or Cam-005, or will competitively inhibit such a monoclonal antibody from binding to Pseudomonas Psl. WapR-004RAD is identical to WapR-004 except for an amino acid substitution G98A of the VH amino acid sequence of SEQ ID NO:11.
[0178] Some embodiments include WapR-004 (W4) mutants comprising an scFv-Fc molecule amino acid sequence identical to, or identical except for one, two, three, four, five, or more amino acid substitutions to one or more of: SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145; or SEQ ID NO: 146.
[0179] Other embodiments include WapR-004 (W4) mutants comprising an scFv-Fc molecule amino acid sequence at least 80%, 85%, 90% 95% or 100% identical to one or more of: SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145; or SEQ ID NO: 146.
[0180] In some embodiments, an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof described herein specifically binds to the same epitope as monoclonal antibody WapR-001, WapR-002, or WapR-003, or will competitively inhibit such a monoclonal antibody from binding to Pseudomonas Psl.
[0181] In certain embodiments, an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof described herein specifically binds to the same epitope as monoclonal antibody WapR-016, or will competitively inhibit such a monoclonal antibody from binding to Pseudomonas Psl.
TABLE-US-00002 TABLE2 ReferenceVHandVLaminoacidsequences* Antibody Name VH VL Cam-003 QVRLQQSGPGLVKPSET SSELTQDPAVSVALGQT LSLTCTVSGGSTSPYFW VRITCQGDSLRSYYASW SWLRQPPGKGLEWIGYI YQQKPGQAPVLVIYGKN HSNGGTNYNPSLKSRLT NRPSGIPDRFSGSSSGN ISGDTSKNQFSLNLSFV TASLTITGAQAEDEADY TAADTALYYCARTDYDV YCNSRDSSGNHVVFGGG YGPAFDIWGQGTMVTV TKLTVL SEQIDNO:1 SEQIDNO:2 Cam-004 QVQLQQSGPGRVKPSET SSELTQDPAVSVALGQT LSLTCTVSGYSVSSGYY VRITCQGDSLRSYYASW WGWIRQSPGTGLEWIGS YQQKPGQAPVLVIYGKN ISHSGSTYYNPSLKSRV NRPSGIPDRFSGSSSGN TISGDASKNQFFLRLTS TASLTITGAQAEDEADY VTAADTAVYYCARSEAT YCNSRDSSGNHVVFGGG ANFDSWGRGTLVTVSS TKLTVL SEQIDNO:3 SEQIDNO:2 Cam-005 QVQLQQSGPGLVKPSET SSELTQDPAVSVALGQT LSLTCTVSGGSVSSSGY VRITCQGDSLRSYYASW YWTWIRQPPGKGLEWIG YQQKPGQAPVLVIYGKN SIYSSGSTYYSPSLKSR NRPSGIPDRFSGSSSGN VTISGDTSKNQFSLKLS TASLTITGAQAEDEADY SVTAADTAVYYCARLNW YCNSRDSSGNHVVFGGG GTVSAFDIWGRGTLVTV TKLTVL SEQIDNO:4 SEQIDNO:2 WapR-001 EVQLLESGGGLVQPGGS QAGLTQPASVSGSPGQS LRLSCSASGFTFSRYPM ITISCTGTSSDIATYNY HWVRQAPGKGLEYVSDI VSWYQQHPGKAPKLMIY GTNGGSTNYADSVKGRF EGTKRPSGVSNRFSGSK TISRDNSKNTVYLQMSS SGNTASLTISGLQAEDE LRAEDTAVYHCVAGIAA ADYYCSSYARSYTYVFG AYGFDVWGQGTMVTVSS TGTELTVL SEQIDNO:5 SEQIDNO:6 WapR-002 QVQLVQSGGGLVQPGGS QTVVTQPASVSGSPGQS LRLSCSASGFTFSSYPM ITISCTGTSSDVGGYNY HWVRQAPGKGLDYVSDI VSWYQQHPGKAPKLMIY SPNGGSTNYADSVKGRF EVSNRPSGVSNHFSGSK TISRDNSKNTLFLQMSS SGNTASLTISGLQAEDE LRAEDTAVYYCVMGLVP ADYYCSSYTTSSTYVFG YGFDIWGQGTLVTVSS TGTKVTVL SEQIDNO:7 SEQIDNO:8 WapR-003 QMQLVQSGGGLVQPGGS QTVVTQPASVSASPGQS LRLSCSASGFTFSSYPM ITISCAGTSGDVGNYNF HWVRQAPGKGLDYVSDI VSWYQQHPGKAPKLLIY SPNGGATNYADSVKGRF EGSQRPSGVSNRFSGSR TISRDNSKNTVYLQMSS SGNTASLTISGLQAEDE LRAEDTAVYYCVMGLVP ADYYCSSYARSYTYVFG YGFDNWGQGTMVTVSS TGTKLTVL SEQIDNO:9 SEQIDNO:10 WapR-004 EVQLLESGPGLVKPSET EIVLTQSPSSLSTSVGD LSLTCNVAGGSISPYYW RVTITCRASQSIRSHLN TWIRQPPGKGLELIGYI WYQQKPGKAPKLLIYGA HSSGYTDYNPSLKSRVT SNLQSGVPSRFSGSGSG ISGDTSKKQFSLHVSSV TDFTLTISSLQPEDFAT TAADTAVYFCARGDWDL YYCQQSYSFPLTFGGGT LHALDIWGQGTLVTVSS KLEIK SEQIDNO:11 SEQIDNO:12 WapR-007 EVQLVQSGADVKKPGAS SSELTQDPAVSVALGQT VRVTCKASGYTFTGHNI VRITCQGDSLRSYYTNW HWVRQAPGQGLEWMGWI FQQKPGQAPLLVVYAKN NPDSGATSYAQKFQGRV KRPPGIPDRFSGSSSGN TMTRDTSITTAYMDLSR TASLTITGAQAEDEADY LRSDDTAVYYCATDTLL YCHSRDSSGNHVVFGGG SNHWGQGTLVTVSS TKLTVL SEQIDNO:13 SEQIDNO:14 WapR-016 EVQLVESGGGLVQPGGS QSVLTQPASVSGSPGQS LRLSCAASGYTFSSYAT ITISCTGTSSDVGGYNY SWVRQAPGKGLEWVAGI VSWYQQHPGKAPKLMIY SGSGDTTDYVDSVKGRF EVSNRPSGVSNRFSGSK TVSRDNSKNTLYLQMNS SGNTASLTISGLQAEDE LRADDTAVYYCASRGGL ADYCSSYSSGTVVFGGG GGYYRGGFDFWGQGTMV TELTVL TVSS SEQIDNO:16 SEQIDNO:15 WapR-004RAD EVQLLESGPGLVKPSET EIVLTQSPSSLSTSVGD LSLTCNVAGGSISPYYW RVTITCRASQSIRSHLN TWIRQPPGKGLELIGYI WYQQKPGKAPKLLIYGA HSSGYTDYNPSLKSRVT SNLQSGVPSRFSGSGSG ISGDTSKKQFSLHVSSV TDFTLTISSLQPEDFAT TAADTAVYFCARADWDL YYCQQSYSFPLTFGGGT LHALDIWGQGTLVTVSS KLEIK SEQIDNO:74 SEQIDNO:12 *VH and VL CDR1, CDR2, and CDR3 amino acid sequences are underlined
TABLE-US-00003 TABLE3 ReferenceVHandVLCDR1,CDR2,andCDR3aminoacidsequences Anti- body Name VHCDR1 VHCDR2 VHCDR3 VLCDR1 VLCDR2 VLCDR3 Cam- PYFWS YIHSNGGTNYNPSLKS TDYDVYGPAFDI QGDSLRSYYAS GKNNRPS NSRDSSGNHVV 003 SEQIDNO:17 SEQIDNO:18 SEQIDNO:19 SEQIDNO:20 SEQIDNO:21 SEQIDNO:22 Cam- SGYYWG SISHSGSTYYNPSLKS SEATANFDS QGDSLRSYYAS GKNNRPS NSRDSSGNHVV 004 SEQIDNO:23 SEQIDNO:24 SEQIDNO:25 SEQIDNO:20 SEQIDNO:21 SEQIDNO:22 Cam- SSGYYWT SIYSSGSTYYSPSLKS LNWGTVSAFDI QGDSLRSYYAS GKNNRPS NSRDSSGNHVV 005 SEQIDNO:26 SEQIDNO:27 SEQIDNO:28 SEQIDNO:20 SEQIDNO:21 SEQIDNO:22 WapR- RYPMH DIGTNGGSTNYADSVKG GIAAAYGFDV TGTSSDIATYNYVS EGTKRPS SSYARSYTYV 001 SEQIDNO:29 SEQIDNO:30 SEQIDNO:31 SEQIDNO:32 SEQIDNO:33 SEQIDNO:34 WapR- SYPMH DISPNGGSTNYADSVKG GLVPYGFDI TGTSSDVGGYNYVS EVSNRPS SSYTTSSTYV 002 SEQIDNO:35 SEQIDNO:36 SEQIDNO:37 SEQIDNO:38 SEQIDNO:39 SEQIDNO:40 WapR- SYPMH DISPNGGATNYADSVKG GLVPYGFDN AGTSGDVGNYNFVS EGSQRPS SSYARSYTYV 003 SEQIDNO:41 SEQIDNO:42 SEQIDNO:43 SEQIDNO:44 SEQIDNO:45 SEQIDNO:46 WapR- PYYWT YIHSSGYTDYNPSLKS GDWDLLHALDI RASQSIRSHLN GASNLQS YSFPLT 004 SEQIDNO:47 SEQIDNO:48 SEQIDNO:49 SEQIDNO:50 SEQIDNO:51 SEQIDNO:52 WapR- GHNIH WINPDSGATSYAQKFQG DTLLSNH QGDSLRSYYTN AKNKRPP HSRDSSGNHVV 007 SEQIDNO:53 SEQIDNO:54 SEQIDNO:55 SEQIDNO:56 SEQIDNO:57 SEQIDNO:58 WapR- SYATS GISGSGDTTDYVDSVKG RGGLGGYYRGGFDF TGTSSDVGGYNYVS EVSNRPS SSYSSGTVV 016 SEQIDNO:59 SEQIDNO:60 SEQIDNO:61 SEQIDNO:62 SEQIDNO:63 SEQIDNO:64 WapR- PYYWT YIHSSGYTDYNPSLKS ADWDLLHALDI RASQSIRSHLN GASNLQS YSFPLT 004RAD SEQIDNO:47 SEQIDNO:48 SEQIDNO:75 SEQIDNO:50 SEQIDNO:51 SEQIDNO:52
[0182] Any anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof described herein can further include additional polypeptides, e.g., a signal peptide to direct secretion of the encoded polypeptide, antibody constant regions as described herein, or other heterologous polypeptides as described herein. Additionally, binding molecules or fragments thereof of the description include polypeptide fragments as described elsewhere. Additionally anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof described herein can be fusion polypeptides, Fab fragments, scFvs, or other derivatives, as described herein.
[0183] Also, as described in more detail elsewhere herein, the disclosure includes compositions comprising anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof described herein.
[0184] It will also be understood by one of ordinary skill in the art that anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof described herein can be modified such that they vary in amino acid sequence from the naturally occurring binding polypeptide from which they were derived. For example, a polypeptide or amino acid sequence derived from a designated protein can be similar, e.g., have a certain percent identity to the starting sequence, e.g., it can be 60%, 70%, 75%, 80%, 85%, 90%, or 95% identical to the starting sequence.
[0185] The term percent sequence identity between two polynucleotide or polypeptide sequences refers to the number of identical matched positions shared by the sequences over a comparison window, taking into account additions or deletions (i.e., gaps) that must be introduced for optimal alignment of the two sequences. A matched position is any position where an identical nucleotide or amino acid is presented in both the target and reference sequence. Gaps presented in the target sequence are not counted since gaps are not nucleotides or amino acids. Likewise, gaps presented in the reference sequence are not counted since target sequence nucleotides or amino acids are counted, not nucleotides or amino acids from the reference sequence.
[0186] The percentage of sequence identity is calculated by determining the number of positions at which the identical amino-acid residue or nucleic acid base occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. The comparison of sequences and determination of percent sequence identity between two sequences may be accomplished using readily available software both for online use and for download. Suitable software programs are available from various sources, and for alignment of both protein and nucleotide sequences. One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov). Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, e.g., Needle, Stretcher, Water, or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk/Tools/psa.
[0187] Different regions within a single polynucleotide or polypeptide target sequence that aligns with a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity. It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer.
[0188] One skilled in the art will appreciate that the generation of a sequence alignment for the calculation of a percent sequence identity is not limited to binary sequence-sequence comparisons exclusively driven by primary sequence data. Sequence alignments can be derived from multiple sequence alignments. One suitable program to generate multiple sequence alignments is ClustalW2, available from www.clustal.org. Another suitable program is MUSCLE, available from www.drive5.com/muscle/. ClustalW2 and MUSCLE are alternatively available, e.g., from the EBI.
[0189] It will also be appreciated that sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., location of mutations), or phylogenetic data. A suitable program that integrates heterogeneous data to generate a multiple sequence alignment is T-Coffee, available at www.tcoffee.org, and alternatively available, e.g., from the EBI. It will also be appreciated that the final alignment used to calculated percent sequence identity may be curated either automatically or manually.
[0190] Whether any particular polypeptide is at least about 70%, 75%, 80%, 85%, 90% or 95% identical to another polypeptide can also be determined using methods and computer programs/software known in the art such as, but not limited to, the BESTFIT program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, Wis. 53711). BESTFIT uses the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981), to find the best segment of homology between two sequences. When using BESTFIT or any other sequence alignment program to determine whether a particular sequence is, for example, 95% identical to a reference sequence, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference polypeptide sequence and that gaps in homology of up to 5% of the total number of amino acids in the reference sequence are allowed.
[0191] Furthermore, nucleotide or amino acid substitutions, deletions, or insertions leading to conservative substitutions or changes at non-essential amino acid regions can be made. For example, a polypeptide or amino acid sequence derived from a designated protein can be identical to the starting sequence except for one or more individual amino acid substitutions, insertions, or deletions, e.g., one, two, three, four, five, six, seven, eight, nine, ten, fifteen, twenty or more individual amino acid substitutions, insertions, or deletions. In certain embodiments, a polypeptide or amino acid sequence derived from a designated protein has one to five, one to ten, one to fifteen, or one to twenty individual amino acid substitutions, insertions, or deletions relative to the starting sequence.
[0192] An anti-Pseudomonas Psl binding molecule, e.g., an antibody or fragment, variant or derivative thereof described herein can comprise, consist essentially of, or consist of a fusion protein. Fusion proteins are chimeric molecules which comprise, for example, an immunoglobulin antigen-binding domain with at least one target binding site, and at least one heterologous portion, i.e., a portion with which it is not naturally linked in nature. The amino acid sequences can normally exist in separate proteins that are brought together in the fusion polypeptide or they can normally exist in the same protein but are placed in a new arrangement in the fusion polypeptide. Fusion proteins can be created, for example, by chemical synthesis, or by creating and translating a polynucleotide in which the peptide regions are encoded in the desired relationship.
[0193] The term heterologous as applied to a polynucleotide, polypeptide, or other moiety means that the polynucleotide, polypeptide, or other moiety is derived from a distinct entity from that of the rest of the entity to which it is being compared. In a non-limiting example, a heterologous polypeptide to be fused to a binding molecule, e.g., an antibody or an antigen-binding fragment, variant, or derivative thereof is derived from a non-immunoglobulin polypeptide of the same species, or an immunoglobulin or non-immunoglobulin polypeptide of a different species.
IV. Fusion Proteins and Antibody Conjugates
[0194] In some embodiments, the anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof can be administered multiple times in conjugated form. In still another embodiment, the anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof can be administered in unconjugated form, then in conjugated form, or vice versa.
[0195] In specific embodiments, the anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof can be conjugated to one or more antimicrobial agents, for example, Polymyxin B (PMB). PMB is a small lipopeptide antibiotic approved for treatment of multidrug-resistant Gram-negative infections. In addition to its bactericidal activity, PMB binds lipopolysaccharide (LPS) and neutralizes its proinflammatory effects. (Dixon, R. A. & Chopra, I. J Antimicrob Chemother 18, 557-563 (1986)). LPS is thought to significantly contribute to inflammation and the onset of Gram-negative sepsis. (Guidet, B., et al., Chest 106, 1194-1201 (1994)). Therapies that neutralize and/or clear LPS from circulation have the potential to prevent or delay the onset of sepsis and improve clinical outcome. Polymyxin B (PMB) is a lipopeptide antibiotic approved for treatment of multidrug-resistant Gram-negative infections. In addition to its bactericidal activity, PMB binds LPS and neutralizes its proinflammatory effects. Conjugates of PMB to carrier molecules have been shown to neutralize LPS and mediate protection in animal models of endotoxemia and infection. (Drabick, J. J., et al. Antimicrob Agents Chemother 42, 583-588 (1998)). Also disclosed is a method for attaching one or more PMB molecules to cysteine residues introduced into the Fc region of monoclonal antibodies (mAb) of the disclosure. For example, the Cam-003-PMB conjugates retained specific, mAb-mediated binding to P. aeruginosa and also retained OPK activity. Furthermore, mAb-PMB conjugates bound and neutralized LPS in vitro.
[0196] In certain embodiments, an anti-Pseudomonas Psl binding molecule, e.g., an antibody or fragment, variant or derivative thereof described herein can comprise a heterologous amino acid sequence or one or more other moieties not normally associated with an antibody (e.g., an antimicrobial agent, a therapeutic agent, a prodrug, a peptide, a protein, an enzyme, a lipid, a biological response modifier, pharmaceutical agent, a lymphokine, a heterologous antibody or fragment thereof, a detectable label, polyethylene glycol (PEG), and a combination of two or more of any said agents). In further embodiments, an anti-Pseudomonas Psl binding molecule, e.g., an antibody or fragment, variant or derivative thereof can comprise a detectable label selected from the group consisting of an enzyme, a fluorescent label, a chemiluminescent label, a bioluminescent label, a radioactive label, or a combination of two or more of any said detectable labels.
V. Polynucleotides Encoding Binding Molecules
[0197] Also provided herein are nucleic acid molecules encoding the anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof described herein.
[0198] One embodiment provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding an immunoglobulin heavy chain variable region (VH) amino acid sequence at least 80%, 85%, 90% 95% or 100% identical to one or more of: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, or SEQ IS NO: 74 as shown in Table 2.
[0199] Another embodiment provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding a VH amino acid sequence identical to, or identical except for one, two, three, four, five, or more amino acid substitutions to one or more of: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, or SEQ ID NO: 74 as shown in Table 2.
[0200] Further embodiment provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding a VH, where one or more of the VHCDR1, VHCDR2 or VHCDR3 regions of the VH are identical to, or identical except for four, three, two, or one amino acid substitutions, to one or more reference heavy chain VHCDR1, VHCDR2 and/or VHCDR3 amino acid sequences of one or more of: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, or SEQ ID NO: 74 as shown in Table 2.
[0201] Another embodiment provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl comprising a VH, where one or more of the VHCDR1, VHCDR2 or VHCDR3 regions of the VH are identical to, or identical except for four, three, two, or one amino acid substitutions, to one or more reference heavy chain VHCDR1, VHCDR2 and/or VHCDR3 amino acid sequences of one or more of: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, or SEQ ID NO: 74 as shown in Table 2.
[0202] A further embodiment provides an isolated binding molecule e.g., an antibody or antigen-binding fragment comprising the VH encoded by the polynucleotide specifically or preferentially binds to Pseudomonas Psl.
[0203] Another embodiment provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding an immunoglobulin light chain variable region (VL) amino acid sequence at least 80%, 85%, 90% 95% or 100% identical to one or more of: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, or SEQ ID NO: 16 as shown in Table 2.
[0204] A further embodiment provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding a VL amino acid sequence identical to, or identical except for one, two, three, four, five, or more amino acid substitutions to one or more of: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, or SEQ ID NO: 16 as shown in Table 2.
[0205] Another embodiment provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding a VL, where one or more of the VLCDR1, VLCDR2 or VLCDR3 regions of the VL are at least 80%, 85%, 90%, 95% or 100% identical to one or more reference light chain VLCDR1, VLCDR2 or VLCDR3 amino acid sequences of one or more of: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, or SEQ ID NO: 16 as shown in Table 2.
[0206] A further embodiment provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof which specifically binds to Pseudomonas Psl comprising an VL, where one or more of the VLCDR1, VLCDR2 or VLCDR3 regions of the VL are identical to, or identical except for four, three, two, or one amino acid substitutions, to one or more reference heavy chain VLCDR1, VLCDR2 and/or VLCDR3 amino acid sequences of one or more of: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, or SEQ ID NO: 16 as shown in Table 2.
[0207] In another embodiment, an isolated binding molecule e.g., an antibody or antigen-binding fragment comprising the VL encoded by the polynucleotide specifically or preferentially binds to Pseudomonas Psl.
[0208] One embodiment provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid which encodes an scFv molecule including a VH and a VL, where the scFv is at least 80%, 85%, 90% 95% or 100% identical to one or more of SEQ ID NO:65, SEQ ID NO:66, SEQ ID NO:67, SEQ ID NO:68, SEQ ID NO:69, or SEQ ID NO:70 as shown in Table 4.
TABLE-US-00004 TABLE4 ReferencescFvnucleicacidsequences Anti- body Name scFvnucleotidesequences Cam- CAGCCGGCCATGGCCCAGGTACAGCTGCAGCAGTCAGGCCCAGG 003 ACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCT CTGGTGGCTCCACCAGTCCTTACTTCTGGAGCTGGCTCCGGCAG CCCCCAGGGAAGGGACTGGAGTGGATTGGTTATATCCATTCCAA TGGGGGCACCAACTACAACCCCTCCCTCAAGAGTCGACTCACCA TATCAGGAGACACGTCCAAGAACCAATTCTCCCTGAATCTGAGT TTTGTGACCGCTGCGGACACGGCCCTCTATTACTGTGCGAGAAC GGACTACGATGTCTACGGCCCCGCTTTTGATATCTGGGGCCAGG GGACAATGGTCACCGTCTCGAGTGGTGGAGGCGGTTCAGGCGGA GGTGGCAGCGGCGGTGGCGGATCGTCTGAGCTGACTCAGGACCC TGCTGTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCC AAGGAGACAGCCTCAGAAGCTATTATGCAAGCTGGTACCAGCAG AAGCCAGGACAGGCCCCTGTACTTGTCATCTATGGTAAAAACAA CCGGCCCTCAGGGATCCCAGACCGATTCTCTGGCTCCAGCTCAG GAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGAT GAGGCTGACTATTACTGTAACTCCCGGGACAGCAGTGGTAACCA TGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTGCGG CCGCA SEQIDNO:65 Cam- CAGCCGGCCATGGCCCAGGTACAGCTGCAGCAGTCAGGCCCAGG 004 ACGGGTGAAGCCTTCGGAGACGCTGTCCCTCACCTGCACTGTCT CTGGTTACTCCGTCAGTAGTGGTTACTACTGGGGCTGGATCCGG CAGTCCCCAGGGACGGGGCTGGAGTGGATTGGGAGTATCTCTCA TAGTGGGAGCACCTACTACAACCCGTCCCTCAAGAGTCGAGTCA CCATATCAGGAGACGCATCCAAGAACCAGTTTTTCCTGAGGCTG ACTTCTGTGACCGCCGCGGACACGGCCGTTTATTACTGTGCGAG ATCTGAGGCTACCGCCAACTTTGATTCTTGGGGCAGGGGCACCC TGGTCACCGTCTCTTCAGGTGGAGGCGGTTCAGGCGGAGGTGGC AGCGGCGGTGGCGGATCGTCTGAGCTGACTCAGGACCCTGCCGT GTCTGTGGCCTTGGGACAGACAGTCAGGATCACATGCCAAGGAG ACAGCCTCAGAAGCTATTATGCAAGCTGGTACCAGCAGAAGCCA GGACAGGCCCCTGTACTTGTCATCTATGGTAAAAACAACCGGCC CTCAGGGATCCCAGACCGATTCTCTGGCTCCAGCTCAGGAAACA CAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCT GACTATTACTGTAACTCCCGGGACAGCAGTGGTAACCATGTGGT ATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTGCGGCCGCA SEQIDNO:66 Cam- CAGCCGGCCATGGCCCAGGTACAGCTGCAGCAGTCAGGCCCAGG 005 ACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCTGCACTGTCT CTGGTGGCTCCGTCAGCAGTAGTGGTTATTACTGGACCTGGATC CGCCAGCCCCCAGGGAAGGGGCTGGAGTGGATTGGGAGTATCTA TTCTAGTGGGAGCACATATTACAGCCCGTCCCTCAAGAGTCGAG TCACCATATCCGGAGACACGTCCAAGAACCAGTTCTCCCTCAAG CTGAGCTCTGTGACCGCCGCAGACACAGCCGTGTATTACTGTGC GAGACTTAACTGGGGCACTGTGTCTGCCTTTGATATCTGGGGCA GAGGCACCCTGGTCACCGTCTCGAGTGGTGGAGGCGGTTCAGGC GGAGGTGGCAGCGGCGGTGGCGGATCGTCTGAGCTGACTCAGGA CCCTGCTGTGTCTGTGGCCTTGGGACAGACAGTCAGGATCACAT GCCAAGGAGACAGCCTCAGAAGCTATTATGCAAGCTGGTACCAG CAGAAGCCAGGACAGGCCCCTGTACTTGTCATCTATGGTAAAAA CAACCGGCCCTCAGGGATCCCAGACCGATTCTCTGGCTCCAGCT CAGGAAACACAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAA GATGAGGCTGACTATTACTGTAACTCCCGGGACAGCAGTGGTAA CCATGTGGTATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTG CGGCCGCA SEQIDNO:67 WapR- TCTATGCGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGTTGGAG 001 TCTGGGGGAGGTTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTC CTGTTCAGCCTCTGGGTTCACCTTCAGTCGGTATCCTATGCATT GGGTCCGCCAGGCTCCAGGGAAGGGACTGGAATATGTTTCAGAT ATTGGTACTAATGGGGGTAGTACAAACTACGCAGACTCCGTGAA GGGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACGGTGT ATCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTAT CATTGTGTGGCGGGTATAGCAGCCGCCTATGGTTTTGATGTCTG GGGCCAAGGGACAATGGTCACCGTCTCGAGTGGAGGCGGCGGTT CAGGCGGAGGTGGCTCTGGCGGTGGCGGAAGTGCACAGGCAGGG CTGACTCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGAT CACCATCTCCTGCACTGGAACCAGCAGTGACATTGCTACTTATA ACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAA CTCATGATTTATGAGGGCACTAAGCGGCCCTCAGGGGTTTCTAA TCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACAA TCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGTTCC TCATATGCACGTAGTTACACTTATGTCTTCGGAACTGGGACCGA GCTGACCGTCCTAGCGGCCGC SEQIDNO:68 WapR- CTATGCGGCCCAGCCGGCCATGGCCCAGGTGCAGCTGGTGCAGT 002 CTGGGGGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCC TGTTCAGCCTCTGGATTCACCTTCAGTAGCTATCCTATGCACTG GGTCCGCCAGGCTCCAGGGAAGGGACTGGATTATGTTTCAGACA TCAGTCCAAATGGGGGTTCCACAAACTACGCAGACTCCGTGAAG GGCAGATTCACCATCTCCAGAGACAATTCCAAGAACACACTGTT TCTTCAAATGAGCAGTCTGAGAGCTGAGGACACGGCTGTGTATT ATTGTGTGATGGGGTTAGTACCCTATGGTTTTGATATCTGGGGC CAAGGCACCCTGGTCACCGTCTCGAGTGGAGGCGGCGGTTCAGG CGGAGGTGGCTCTGGCGGTGGCGGAAGTGCACAGACTGTGGTGA CCCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGATCACC ATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTATAACTA TGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAAACTCA TGATTTATGAGGTCAGTAATCGGCCCTCAGGGGTTTCTAATCAC TTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACCATCTC TGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAGCTCAT ATACAACCAGCAGCACTTATGTCTTCGGAACTGGGACCAAGGTC ACCGTCCTAGCGGCCG SEQIDNO:69 WapR- CGGCCCAGCCGGCCATGGCCCAGATGCAGCTGGTGCAGTCGGGG 003 GGAGGCTTGGTCCAGCCTGGGGGGTCCCTGAGACTCTCCTGTTC AGCCTCTGGATTCACCTTCAGTAGCTATCCTATGCACTGGGTCC GCCAGGCTCCAGGGAAGGGACTGGATTATGTTTCAGACATCAGT CCAAATGGGGGTGCCACAAACTACGCAGACTCCGTGAAGGGCAG ATTCACCATCTCCAGAGACAATTCCAAGAACACGGTGTATCTTC AAATGAGCAGTCTGAGAGCTGAAGACACGGCTGTCTATTATTGT GTGATGGGGTTAGTGCCCTATGGTTTTGATAACTGGGGCCAGGG GACAATGGTCACCGTCTCGAGTGGAGGCGGCGGTTCAGGCGGAG GTGGCTCTGGCGGTGGCGGAAGTGCACAGACTGTGGTGACCCAG CCTGCCTCCGTGTCTGCATCTCCTGGACAGTCGATCACCATCTC CTGCGCTGGAACCAGCGGTGATGTTGGGAATTATAATTTTGTCT CCTGGTACCAACAACACCCAGGCAAAGCCCCCAAACTCCTGATT TATGAGGGCAGTCAGCGGCCCTCAGGGGTTTCTAATCGCTTCTC TGGCTCCAGGTCTGGCAACACGGCCTCCCTGACAATCTCTGGGC TCCAGGCTGAGGACGAGGCTGATTATTACTGTTCCTCATATGCA CGTAGTTACACTTATGTCTTCGGAACTGGGACCAAGCTGACCGT CCTAGCGGCCGCA SEQIDNO:70 WapR- TATGCGGCCCAGCCGGCCATGGCCGAGGTGCAGCTGTTGGAGTC 004 GGGCCCAGGACTGGTGAAGCCTTCGGAGACCCTGTCCCTCACCT GCAATGTCGCTGGTGGCTCCATCAGTCCTTACTACTGGACCTGG ATCCGGCAGCCCCCAGGGAAGGGCCTGGAGTTGATTGGTTATAT CCACTCCAGTGGGTACACCGACTACAACCCCTCCCTCAAGAGTC GAGTCACCATATCAGGAGACACGTCCAAGAAGCAGTTCTCCCTG CACGTGAGCTCTGTGACCGCTGCGGACACGGCCGTGTACTTCTG TGCGAGAGGCGATTGGGACCTGCTTCATGCTCTTGATATCTGGG GCCAAGGGACCCTGGTCACCGTCTCGAGTGGAGGCGGCGGTTCA GGCGGAGGTGGCTCTGGCGGTGGCGGAAGTGCACTCGAAATTGT GTTGACACAGTCTCCATCCTCCCTGTCTACATCTGTAGGAGACA GAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTAGGAGCCAT TTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAACTCCT GATCTATGGTGCATCCAATTTGCAAAGTGGGGTCCCATCAAGGT TCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATTAGT AGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGAG TTACAGTTTCCCCCTCACTTTCGGCGGAGGGACCAAGCTGGAGA TCAAAGCGGCCGC SEQIDNO:71 WapR- GCGGCCCAGCCGGCCATGGCCGAAGTGCAGCTGGTGCAGTCTGG 007 GGCTGACGTAAAGAAGCCTGGGGCCTCAGTGAGGGTCACCTGCA AGGCTTCTGGATACACCTTCACCGGCCACAACATACACTGGGTG CGACAGGCCCCTGGACAAGGGCTTGAATGGATGGGATGGATCAA CCCTGACAGTGGTGCCACAAGCTATGCACAGAAGTTTCAGGGCA GGGTCACCATGACCAGGGACACGTCCATCACCACAGCCTACATG GACCTGAGCAGGCTGAGATCTGACGACACGGCCGTATATTACTG TGCGACCGATACATTACTGTCTAATCACTGGGGCCAAGGAACCC TGGTCACCGTCTCGAGTGGTGGAGGCGGTTCAGGCGGAGGTGGC AGCGGCGGTGGCGGATCGTCTGAGCTGACTCAGGACCCTGCTGT GTCTGTGGCCTTGGGACAGACAGTCAGGATCACTTGCCAAGGAG ACAGTCTCAGAAGCTATTACACAAACTGGTTCCAGCAGAAGCCA GGACAGGCCCCTCTACTTGTCGTCTATGCTAAAAATAAGCGGCC CCCAGGGATCCCAGACCGATTCTCTGGCTCCAGCTCAGGAAACA CAGCTTCCTTGACCATCACTGGGGCTCAGGCGGAAGATGAGGCT GACTATTACTGTCATTCCCGGGACAGCAGTGGTAACCATGTGGT ATTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTGCGGCCGCA SEQIDNO:72 WapR- CAGCCGGCCATGGCCGAGGTGCAGCTGGTGGAGTCTGGGGGAGG 016 CTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCT CTGGATACACCTTTAGCAGCTATGCCACGAGCTGGGTCCGCCAG GCTCCAGGGAAGGGGCTGGAGTGGGTCGCAGGTATTAGTGGTAG TGGTGATACCACAGACTACGTAGACTCCGTGAAGGGCCGGTTCA CCGTCTCCAGAGACAATTCCAAGAACACCCTATATCTGCAAATG AACAGCCTGAGAGCCGACGACACGGCCGTGTATTACTGTGCGTC GAGAGGAGGTTTAGGGGGTTATTACCGGGGCGGCTTTGACTTCT GGGGCCAGGGGACAATGGTCACCGTCTCGAGTGGAGGCGGCGGT TCAGGCGGAGGTGGCTCTGGCGGTGGCGGAAGTGCACAGTCTGT GCTGACGCAGCCTGCCTCCGTGTCTGGGTCTCCTGGACAGTCGA TCACCATCTCCTGCACTGGAACCAGCAGTGACGTTGGTGGTTAT AACTATGTCTCCTGGTACCAACAGCACCCAGGCAAAGCCCCCAA ACTCATGATTTATGAGGTCAGTAATCGGCCCTCAGGGGTTTCTA ATCGCTTCTCTGGCTCCAAGTCTGGCAACACGGCCTCCCTGACC ATCTCTGGGCTCCAGGCTGAGGACGAGGCTGATTATTACTGCAG CTCATATACAAGCAGCGGCACTGTGGTATTCGGCGGAGGGACCG AGCTGACCGTCCTAGCGGCCGCA SEQIDNO:73
[0209] In some embodiments, an isolated antibody or antigen-binding fragment thereof encoded by one or more of the polynucleotides described above, which specifically binds to Pseudomonas Psl, comprises, consists essentially of, or consists of VH and VL amino acid sequences at least 80%, 85%, 90% 95% or 100% identical to:
(a) SEQ ID NO: 1 and SEQ ID NO: 2, respectively, (b) SEQ ID NO: 3 and SEQ ID NO: 2, respectively, (c) SEQ ID NO: 4 and SEQ ID NO: 2, respectively, (d) SEQ ID NO: 5 and SEQ ID NO: 6, respectively, (e) SEQ ID NO: 7 and SEQ ID NO: 8, respectively, (f) SEQ ID NO: 9 and SEQ ID NO: 10, respectively, (g) SEQ ID NO: 11 and SEQ ID NO: 12, respectively, (h) SEQ ID NO: 13 and SEQ ID NO: 14, respectively; (i) SEQ ID NO: 15 and SEQ ID NO: 16, respectively; or (j) SEQ ID NO: 74 and SEQ ID NO: 12, respectively.
[0210] In certain embodiments, an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof encoded by one or more of the polynucleotides described above, specifically binds to Pseudomonas Psl with an affinity characterized by a dissociation constant (K.sub.D) no greater than 510.sup.2 M, 10.sup.2 M, 510.sup.3 M, 10.sup.3 M, 510.sup.4 M, 10.sup.4 M, 510.sup.5 M, 10.sup.5 M, 510.sup.6 M, 10.sup.6 M, 510.sup.7 M, 10.sup.7 M, 510.sup.8 M, 10.sup.8 M, 510.sup.9 M, 10.sup.9 M, 510.sup.10 M, 10.sup.10 M, 510.sup.11 M, 10.sup.11 M, 510.sup.12 M, 10.sup.12 M, 510.sup.13 M, 10.sup.13 M, 510.sup.14 M, 10.sup.14 M, 510.sup.15 M, or 10.sup.15 M.
[0211] In specific embodiments, an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof encoded by one or more of the polynucleotides described above, specifically binds to Pseudomonas Psl, with an affinity characterized by a dissociation constant (K.sub.D) in a range of about 110.sup.10 to about 110.sup.6 M. In one embodiment, an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof encoded by one or more of the polynucleotides described above, specifically binds to Pseudomonas Psl, with an affinity characterized by a K.sub.D of about 1.1810.sup.7 M, as determined by the OCTET binding assay described herein. In another embodiment, an isolated binding molecule, e.g., an antibody or antigen-binding fragment thereof encoded by one or more of the polynucleotides described above, specifically binds to Pseudomonas Psl, with an affinity characterized by a K.sub.D of about 1.4410.sup.7 M, as determined by the OCTET binding assay described herein.
[0212] In certain embodiments, an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof encoded by one or more of the polynucleotides described above, specifically binds to the same Psl epitope as monoclonal antibody WapR-004, WapR-004RAD, Cam-003, Cam-004, or Cam-005, or will competitively inhibit such a monoclonal antibody from binding to Pseudomonas Psl. WapR-004RAD is identical to WapR-004 except for a nucleic acid substitution G293C of the VH nucleic acid sequence encoding the VH amino acid sequence of SEQ ID NO:11 (a substitution of the nucleotide in the VH-encoding portion of SEQ ID NO:71 at position 317). The nucleic acid sequence encoding the WapR-004RAD VH is presented as SEQ ID NO 76.
[0213] Some embodiments provide an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding a W4 mutant scFv-Fc molecule amino acid sequence identical to, or identical except for one, two, three, four, five, or more amino acid substitutions to one or more of: SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145; or SEQ ID NO: 146.
[0214] Other embodiments provide an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid encoding a W4 mutant scFv-Fc molecule amino acid sequence at least 80%, 85%, 90% 95% or 100% identical to one or more of: SEQ ID NO: 78, SEQ ID NO: 79, SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, SEQ ID NO: 85, SEQ ID NO: 86, SEQ ID NO: 87, SEQ ID NO: 88, SEQ ID NO: 89, SEQ ID NO: 90, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, SEQ ID NO: 94, SEQ ID NO: 95, SEQ ID NO: 96, SEQ ID NO: 97, SEQ ID NO: 98, SEQ ID NO: 99, SEQ ID NO: 100, SEQ ID NO: 101, SEQ ID NO: 102, SEQ ID NO: 103, SEQ ID NO: 104, SEQ ID NO: 105, SEQ ID NO: 106, SEQ ID NO: 107, SEQ ID NO: 108, SEQ ID NO: 109, SEQ ID NO: 110, SEQ ID NO: 111, SEQ ID NO: 112, SEQ ID NO: 113, SEQ ID NO: 114, SEQ ID NO: 115, SEQ ID NO: 116, SEQ ID NO: 117, SEQ ID NO: 118, SEQ ID NO: 119, SEQ ID NO: 120, SEQ ID NO: 121, SEQ ID NO: 122, SEQ ID NO: 123, SEQ ID NO: 124, SEQ ID NO: 125, SEQ ID NO: 126, SEQ ID NO: 127, SEQ ID NO: 128, SEQ ID NO: 129, SEQ ID NO: 130, SEQ ID NO: 131, SEQ ID NO: 132, SEQ ID NO: 133, SEQ ID NO: 134, SEQ ID NO: 135, SEQ ID NO: 136, SEQ ID NO: 137, SEQ ID NO: 138, SEQ ID NO: 139, SEQ ID NO: 140, SEQ ID NO: 141, SEQ ID NO: 142, SEQ ID NO: 143, SEQ ID NO: 144, SEQ ID NO: 145; or SEQ ID NO: 146.
[0215] One embodiment provides an isolated polynucleotide comprising, consisting essentially of, or consisting of a nucleic acid which encodes a W4 mutant scFv-Fc molecule, where the nucleic acid is at least 80%, 85%, 90% 95% or 100% identical to one or more of SEQ ID NO: 147, SEQ ID NO: 148, SEQ ID NO: 149, SEQ ID NO: 150, SEQ ID NO: 151, or SEQ ID NO: 152, SEQ IS NO: 153, SEQ ID NO: 154, SEQ ID NO: 155, SEQ ID NO: 156, SEQ ID NO: 157, SEQ ID NO: 158, SEQ ID NO: 159, SEQ ID NO: 160, SEQ ID NO: 161, SEQ ID NO: 162, SEQ ID NO: 163, SEQ ID NO: 164, SEQ ID NO: 165, SEQ ID NO: 166, SEQ ID NO: 167, SEQ ID NO: 168, SEQ ID NO: 169, SEQ ID NO: 170, SEQ ID NO: 171, SEQ ID NO: 172, SEQ ID NO: 173, SEQ ID NO: 174, SEQ ID NO: 175, SEQ ID NO: 176, SEQ ID NO: 177, SEQ ID NO: 178, SEQ ID NO: 179, SEQ ID NO: 180, SEQ ID NO: 181, SEQ ID NO: 182, SEQ ID NO: 183, SEQ ID NO: 184, SEQ ID NO: 185, SEQ ID NO: 186, SEQ ID NO: 187, SEQ ID NO: 188, SEQ ID NO: 189, SEQ ID NO: 190, SEQ ID NO: 191, SEQ ID NO: 192, SEQ ID NO: 193, SEQ ID NO: 194, SEQ ID NO: 195, SEQ ID NO: 196, SEQ ID NO: 197, SEQ ID NO: 198, SEQ ID NO: 199, SEQ ID NO: 200, SEQ ID NO: 201, SEQ ID NO: 202, SEQ ID NO: 203, SEQ ID NO: 204, SEQ ID NO: 205, SEQ ID NO: 206, SEQ ID NO: 207, SEQ ID NO: 208, SEQ ID NO: 209, SEQ ID NO: 210, SEQ ID NO: 211, SEQ ID NO: 212, SEQ ID NO: 213, SEQ ID NO: 214; or SEQ ID NO: 215.
[0216] In other embodiments, an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof encoded by one or more of the polynucleotides described above, specifically binds to the same epitope as monoclonal antibody WapR-001, WapR-002, or WapR-003, or will competitively inhibit such a monoclonal antibody from binding to Pseudomonas Psl.
[0217] In certain embodiments, an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof encoded by one or more of the polynucleotides described above, specifically binds to the same epitope as monoclonal antibody WapR-016, or will competitively inhibit such a monoclonal antibody from binding to Pseudomonas Psl.
[0218] The disclosure also includes fragments of the polynucleotides as described elsewhere herein. Additionally polynucleotides which encode fusion polynucleotides, Fab fragments, and other derivatives, as described herein, are also provided.
[0219] The polynucleotides can be produced or manufactured by any method known in the art. For example, if the nucleotide sequence of the antibody is known, a polynucleotide encoding the antibody can be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.
[0220] Alternatively, a polynucleotide encoding an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof can be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the antibody can be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+RNA, isolated from, any tissue or cells expressing the antibody or such as hybridoma cells selected to express an antibody) by PCR amplification using synthetic primers hybridizable to the 3 and 5 ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR can then be cloned into replicable cloning vectors using any method well known in the art.
[0221] Once the nucleotide sequence and corresponding amino acid sequence of an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof is determined, its nucleotide sequence can be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1990) and Ausubel et al., eds., Current Protocols in Molecular Biology, John Wiley & Sons, NY (1998), which are both incorporated by reference herein in their entireties), to generate antibodies having a different amino acid sequence, for example to create amino acid substitutions, deletions, and/or insertions.
[0222] A polynucleotide encoding an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof can be composed of any polyribonucleotide or polydeoxribonucleotide, which can be unmodified RNA or DNA or modified RNA or DNA. For example, a polynucleotide encoding an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that can be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, a polynucleotide encoding an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. A polynucleotide encoding an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof can also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. Modified bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, polynucleotide embraces chemically, enzymatically, or metabolically modified forms.
[0223] An isolated polynucleotide encoding a non-natural variant of a polypeptide derived from an immunoglobulin (e.g., an immunoglobulin heavy chain portion or light chain portion) can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of the immunoglobulin such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are made at one or more non-essential amino acid residues.
VI. Expression of Antibody Polypeptides
[0224] As is well known, RNA can be isolated from the original hybridoma cells or from other transformed cells by standard techniques, such as guanidinium isothiocyanate extraction and precipitation followed by centrifugation or chromatography. Where desirable, mRNA can be isolated from total RNA by standard techniques such as chromatography on oligo dT cellulose. Suitable techniques are familiar in the art.
[0225] In one embodiment, cDNAs that encode the light and the heavy chains of the anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof can be made, either simultaneously or separately, using reverse transcriptase and DNA polymerase in accordance with well-known methods. PCR can be initiated by consensus constant region primers or by more specific primers based on the published heavy and light chain DNA and amino acid sequences. As discussed above, PCR also can be used to isolate DNA clones encoding the antibody light and heavy chains. In this case the libraries can be screened by consensus primers or larger homologous probes, such as mouse constant region probes.
[0226] DNA, typically plasmid DNA, can be isolated from the cells using techniques known in the art, restriction mapped and sequenced in accordance with standard, well known techniques set forth in detail, e.g., in the foregoing references relating to recombinant DNA techniques. Of course, the DNA can be synthetic according to the present disclosure at any point during the isolation process or subsequent analysis.
[0227] Following manipulation of the isolated genetic material to provide an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof of the disclosure, the polynucleotides encoding anti-Pseudomonas Psl binding molecules, are typically inserted in an expression vector for introduction into host cells that can be used to produce the desired quantity of anti-Pseudomonas Psl binding molecules.
[0228] Recombinant expression of an antibody, or fragment, derivative or analog thereof, e.g., a heavy or light chain of an antibody which binds to a target molecule described herein, e.g., Psl, requires construction of an expression vector containing a polynucleotide that encodes the antibody. Once a polynucleotide encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof (containing the heavy or light chain variable domain), of the disclosure has been obtained, the vector for the production of the antibody molecule can be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing a protein by expressing a polynucleotide containing an antibody encoding nucleotide sequence are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. The disclosure, thus, provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the disclosure, or a heavy or light chain thereof, or a heavy or light chain variable domain, operably linked to a promoter. Such vectors can include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., PCT Publication WO 86/05807; PCT Publication WO 89/01036; and U.S. Pat. No. 5,122,464) and the variable domain of the antibody can be cloned into such a vector for expression of the entire heavy or light chain.
[0229] The term vector or expression vector is used herein to mean vectors used in accordance with the present disclosure as a vehicle for introducing into and expressing a desired gene in a host cell. As known to those skilled in the art, such vectors can easily be selected from the group consisting of plasmids, phages, viruses and retroviruses. In general, vectors compatible with the instant disclosure will comprise a selection marker, appropriate restriction sites to facilitate cloning of the desired gene and the ability to enter and/or replicate in eukaryotic or prokaryotic cells.
[0230] For the purposes of this disclosure, numerous expression vector systems can be employed. For example, one class of vector utilizes DNA elements which are derived from animal viruses such as bovine papilloma virus, polyoma virus, adenovirus, vaccinia virus, baculovirus, retroviruses (RSV, MMTV or MOMLV) or SV40 virus. Others involve the use of polycistronic systems with internal ribosome binding sites. Additionally, cells which have integrated the DNA into their chromosomes can be selected by introducing one or more markers which allow selection of transfected host cells. The marker can provide for prototrophy to an auxotrophic host, biocide resistance (e.g., antibiotics) or resistance to heavy metals such as copper. The selectable marker gene can either be directly linked to the DNA sequences to be expressed, or introduced into the same cell by cotransformation. Additional elements can also be needed for optimal synthesis of mRNA. These elements can include signal sequences, splice signals, as well as transcriptional promoters, enhancers, and termination signals.
[0231] In some embodiments the cloned variable region genes are inserted into an expression vector along with the heavy and light chain constant region genes (e.g., human) synthetic as discussed above. Of course, any expression vector which is capable of eliciting expression in eukaryotic cells can be used in the present disclosure. Examples of suitable vectors include, but are not limited to plasmids pcDNA3, pHCMV/Zeo, pCR3.1, pEF1/His, pIND/GS, pRc/HCMV2, pSV40/Zeo2, pTRACER-HCMV, pUB6/V5-His, pVAX1, and pZeoSV2 (available from Invitrogen, San Diego, Calif.), and plasmid pCI (available from Promega, Madison, Wis.). In general, screening large numbers of transformed cells for those which express suitably high levels if immunoglobulin heavy and light chains is routine experimentation which can be carried out, for example, by robotic systems.
[0232] More generally, once the vector or DNA sequence encoding a monomeric subunit of the anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof of the disclosure has been prepared, the expression vector can be introduced into an appropriate host cell. Introduction of the plasmid into the host cell can be accomplished by various techniques well known to those of skill in the art. These include, but are not limited to, transfection (including electrophoresis and electroporation), protoplast fusion, calcium phosphate precipitation, cell fusion with enveloped DNA, microinjection, and infection with intact virus. See, Ridgway, A. A. G. Mammalian Expression Vectors Vectors, Rodriguez and Denhardt, Eds., Butterworths, Boston, Mass., Chapter 24.2, pp. 470-472 (1988). Typically, plasmid introduction into the host is via electroporation. The host cells harboring the expression construct are grown under conditions appropriate to the production of the light chains and heavy chains, and assayed for heavy and/or light chain protein synthesis. Exemplary assay techniques include enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), or fluorescence-activated cell sorter analysis (FACS), immunohistochemistry and the like.
[0233] The expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody for use in the methods described herein. Thus, the disclosure includes host cells containing a polynucleotide encoding anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof, or a heavy or light chain thereof, operably linked to a heterologous promoter. In some embodiments for the expression of double-chained antibodies, vectors encoding both the heavy and light chains can be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.
[0234] Certain embodiments include an isolated polynucleotide comprising a nucleic acid which encodes the above-described VH and VL, wherein a binding molecule or antigen-binding fragment thereof expressed by the polynucleotide specifically binds Pseudomonas Psl. In some embodiments the polynucleotide as described encodes an scFv molecule including VH and VL, at least 80%, 85%, 90% 95% or 100% identical to one or more of SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, or SEQ ID NO: 70 as shown in Table 4.
[0235] Some embodiments include vectors comprising the above-described polynucleotides. In further embodiments, the polynucleotides are operably associated with a promoter. In additional embodiments, the disclosure provides host cells comprising such vectors. In further embodiments, the disclosure provides vectors where the polynucleotide is operably associated with a promoter, wherein vectors can express a binding molecule which specifically binds Pseudomonas Psl in a suitable host cell.
[0236] Also provided is a method of producing a binding molecule or fragment thereof which specifically binds Pseudomonas Psl, comprising culturing a host cell containing a vector comprising the above-described polynucleotides, and recovering said antibody, or fragment thereof. In further embodiments, the disclosure provides an isolated binding molecule or fragment thereof produced by the above-described method.
[0237] As used herein, host cells refers to cells which harbor vectors constructed using recombinant DNA techniques and encoding at least one heterologous gene. In descriptions of processes for isolation of antibodies from recombinant hosts, the terms cell and cell culture are used interchangeably to denote the source of antibody unless it is clearly specified otherwise. In other words, recovery of polypeptide from the cells can mean either from spun down whole cells, or from the cell culture containing both the medium and the suspended cells.
[0238] A variety of host-expression vector systems can be utilized to express antibody molecules for use in the methods described herein. Such host-expression systems represent vehicles by which the coding sequences of interest can be produced and subsequently purified, but also represent cells which can, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule of the disclosure in situ. These include but are not limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BLK, 293, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Bacterial cells such as Escherichia coli, or eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule. For example, mammalian cells such as Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking et al., Gene 45:101 (1986); Cockett et al., Bio/Technology 8:2 (1990)).
[0239] The host cell line used for protein expression is often of mammalian origin; those skilled in the art are credited with ability to determine particular host cell lines which are best suited for the desired gene product to be expressed therein. Exemplary host cell lines include, but are not limited to, CHO (Chinese Hamster Ovary), DG44 and DUXB11 (Chinese Hamster Ovary lines, DHFR minus), HELA (human cervical carcinoma), CVI (monkey kidney line), COS (a derivative of CVI with SV40 T antigen), VERY, BHK (baby hamster kidney), MDCK, 293, WI38, R1610 (Chinese hamster fibroblast) BALBC/3T3 (mouse fibroblast), HAK (hamster kidney line), SP2/O (mouse myeloma), P363-Ag3.653 (mouse myeloma), BFA-1c1BPT (bovine endothelial cells), RAJI (human lymphocyte) and 293 (human kidney). Host cell lines are typically available from commercial services, the American Tissue Culture Collection or from published literature.
[0240] In addition, a host cell strain can be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products can be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product can be used.
[0241] For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the antibody molecule can be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells can be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method can advantageously be used to engineer cell lines which stably express the antibody molecule.
[0242] A number of selection systems can be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler et al., Cell 11:223 (1977)), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA 48:202 (1992)), and adenine phosphoribosyltransferase (Lowy et al., Cell 22:817 1980) genes can be employed in tk-, hgprt- or aprt-cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA 78:1527 (1981)); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78:2072 (1981)); neo, which confers resistance to the aminoglycoside G-418 Clinical Pharmacy 12:488-505; Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62:191-217 (1993); TIB TECH 11(5):155-215 (May, 1993); and hygro, which confers resistance to hygromycin (Santerre et al., Gene 30:147 (1984). Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, N Y (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, N Y (1990); and in Chapters 12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, N Y (1994); Colberre-Garapin et al., J. Mol. Biol. 150:1 (1981), which are incorporated by reference herein in their entireties.
[0243] The expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Academic Press, New York, Vol. 3. (1987)). When a marker in the vector system expressing antibody is amplifiable, increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will also increase (Crouse et al., Mol. Cell. Biol. 3:257 (1983)).
[0244] In vitro production allows scale-up to give large amounts of the desired polypeptides. Techniques for mammalian cell cultivation under tissue culture conditions are known in the art and include homogeneous suspension culture, e.g. in an airlift reactor or in a continuous stirrer reactor, or immobilized or entrapped cell culture, e.g. in hollow fibers, microcapsules, on agarose microbeads or ceramic cartridges. If necessary and/or desired, the solutions of polypeptides can be purified by the customary chromatography methods, for example gel filtration, ion-exchange chromatography, chromatography over DEAE-cellulose or (immuno-)affinity chromatography, e.g., after preferential biosynthesis of a synthetic hinge region polypeptide or prior to or subsequent to the HIC chromatography step described herein.
[0245] Constructs encoding anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof, as disclosed herein can also be expressed non-mammalian cells such as bacteria or yeast or plant cells. Bacteria which readily take up nucleic acids include members of the enterobacteriaceae, such as strains of Escherichia coli or Salmonella; Bacillaceae, such as Bacillus subtilis; Pneumococcus; Streptococcus, and Haemophilus influenzae. It will further be appreciated that, when expressed in bacteria, the heterologous polypeptides typically become part of inclusion bodies. The heterologouspolypeptides must be isolated, purified and then assembled into functional molecules. Where tetravalent forms of antibodies are desired, the subunits will then self-assemble into tetravalent antibodies (WO02/096948A2).
[0246] In bacterial systems, a number of expression vectors can be advantageously selected depending upon the use intended for the antibody molecule being expressed. For example, when a large quantity of such a protein is to be produced, for the generation of pharmaceutical compositions of an antibody molecule, vectors which direct the expression of high levels of fusion protein products that are readily purified can be desirable. Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al., EMBO J. 2:1791 (1983)), in which the antibody coding sequence can be ligated individually into the vector in frame with the lacZ coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res. 13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem. 24:5503-5509 (1989)); and the like. pGEX vectors can also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption and binding to a matrix glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
[0247] In addition to prokaryotes, eukaryotic microbes can also be used. Saccharomyces cerevisiae, or common baker's yeast, is the most commonly used among eukaryotic microorganisms although a number of other strains are commonly available, e.g., Pichia pastoris.
[0248] For expression in Saccharomyces, the plasmid YRp7, for example, (Stinchcomb et al., Nature 282:39 (1979); Kingsman et al., Gene 7:141 (1979); Tschemper et al., Gene 10:157 (1980)) is commonly used. This plasmid already contains the TRP1 gene which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics 85:12 (1977)). The presence of the trpl lesion as a characteristic of the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
[0249] In an insect system, Autographa californica nuclear polyhedrosis virus (AcNPV) is typically used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The antibody coding sequence can be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter).
[0250] Once the anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof, as disclosed herein has been recombinantly expressed, it can be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. Another method for increasing the affinity of antibodies of the disclosure is disclosed in US 2002 0123057 A1.
VII. Identification of Serotype-Indifferent Binding Molecules
[0251] The disclosure encompasses a target indifferent whole-cell approach to identify serotype independent therapeutic binding molecules e.g., antibodies or fragments thereof with superior or desired therapeutic activities. The method can be utilized to identify binding molecules which can antagonize, neutralize, clear, or block an undesired activity of an infectious agent, e.g., a bacterial pathogen. As is known in the art, many infectious agents exhibit significant variation in their dominant surface antigens, allowing them to evade immune surveillance. The identification method described herein can identify binding molecules which target antigens which are shared among many different Pseudomonas species or other Gram-negative pathogens, thus providing a therapeutic agent which can target multiple pathogens from multiple species. For example, the method was utilized to identify a series of binding molecules which bind to the surface of P. aeruginosa in a serotype-independent manner, and when bound to bacterial pathogens, mediate, promote, or enhance opsonophagocytic (OPK) activity against bacterial cells such as bacterial pathogens, e.g. opportunistic Pseudomonas species (e.g., Pseudomonas aeruginosa, Pseudomonas fluorescens, Pseudomonas putida, and Pseudomonas alcaligenes) and/or inhibit the attachment of such bacterial cells to epithelial cells.
[0252] Certain embodiments disclose a method of identifying serotype-indifferent binding molecules comprising: (a) preparing nave and/or convalescent antibody libraries in phage, (b) removing serotype-specific antibodies from the library by depletion panning, (c) screening the library for antibodies that specifically bind to whole cells independent of serotype, and (d) screening of the resulting antibodies for desired functional properties.
[0253] Certain embodiments provide a whole-cell phenotypic screening approach as disclosed herein with antibody phage libraries derived from either naive or P. aeruginosa infected convalescing patients. Using a panning strategy that initially selected against serotype-specific reactivity, different clones that bound P. aeruginosa whole cells were isolated. Selected clones were converted to human IgG1 antibodies and were confirmed to react with P. aeruginosa clinical isolates regardless of serotype classification or site of tissue isolation (See Examples). Functional activity screens described herein indicated that the antibodies were effective in preventing P. aeruginosa attachment to mammalian cells and mediated opsonophagocytic (OPK) killing in a concentration-dependent and serotype-independent manner.
[0254] In further embodiments, the above-described binding molecules or fragments thereof, antibodies or fragments thereof, or compositions, bind to two or more, three or more, four or more, or five or more different P. aeruginosa serotypes, or to at least 80%, at least 85%, at least 90% or at least 95% of P. aeruginosa strains isolated from infected patients. In further embodiments, the P. aeruginosa strains are isolated from one or more of lung, sputum, eye, pus, feces, urine, sinus, a wound, skin, blood, bone, or knee fluid.
VIII. Pharmaceutical Compositions Comprising Anti-Pseudomonas Psl Binding Molecules
[0255] The pharmaceutical compositions used in this disclosure comprise pharmaceutically acceptable carriers well known to those of ordinary skill in the art. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Certain pharmaceutical compositions as disclosed herein can be orally administered in an acceptable dosage form including, e.g., capsules, tablets, aqueous suspensions or solutions. Certain pharmaceutical compositions also can be administered by nasal aerosol or inhalation. Preservatives and other additives can also be present such as for example, antimicrobials, antioxidants, chelating agents, and inert gases and the like. Suitable formulations for use in the therapeutic methods disclosed herein are described in Remington's Pharmaceutical Sciences, Mack Publishing Co., 16th ed. (1980).
[0256] The amount of an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof, that can be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. Dosage regimens also can be adjusted to provide the optimum desired response (e.g., a therapeutic or prophylactic response). The compositions can also comprise the anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof dispersed in a biocompatible carrier material that functions as a suitable delivery or support system for the compounds.
IX. Treatment Methods Using Therapeutic Binding Molecules
[0257] Methods of preparing and administering an anti-Pseudomonas Psl binding molecule, e.g., an antibody or fragment, variant or derivative thereof, as disclosed herein to a subject in need thereof are well known to or are readily determined by those skilled in the art. The route of administration of the anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof, can be, for example, oral, parenteral, by inhalation or topical. The term parenteral as used herein includes, e.g., intravenous, intraarterial, intraperitoneal, intramuscular, or subcutaneous administration. A suitable form for administration would be a solution for injection, in particular for intravenous or intraarterial injection or drip. However, in other methods compatible with the teachings herein, an anti-Pseudomonas Psl binding molecule, e.g., antibody or fragment, variant or derivative thereof, as disclosed herein can be delivered directly to the site of the adverse cellular population e.g., infection thereby increasing the exposure of the diseased tissue to the therapeutic agent. For example, an anti-Pseudomonas Psl binding molecule can be directly administered to ocular tissue, burn injury, or lung tissue.
[0258] Anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof, as disclosed herein can be administered in a pharmaceutically effective amount for the in vivo treatment of Pseudomonas infection. In this regard, it will be appreciated that the disclosed binding molecules will be formulated so as to facilitate administration and promote stability of the active agent. For the purposes of the instant application, a pharmaceutically effective amount shall be held to mean an amount sufficient to achieve effective binding to a target and to achieve a benefit, e.g., treat, ameliorate, lessen, clear, or prevent Pseudomonas infection.
[0259] Some embodiments are directed to a method of preventing or treating a Pseudomonas infection in a subject in need thereof, comprising administering to the subject an effective amount of the binding molecule or fragment thereof, the antibody or fragment thereof, the composition, the polynucleotide, the vector, or the host cell described herein. In further embodiments, the Pseudomonas infection is a P. aeruginosa infection. In some embodiments, the subject is a human. In certain embodiments, the infection is an ocular infection, a lung infection, a burn infection, a wound infection, a skin infection, a blood infection, a bone infection, or a combination of two or more of said infections. In further embodiments, the subject suffers from acute pneumonia, burn injury, corneal infection, cystic fibrosis, or a combination thereof.
[0260] Certain embodiments are directed to a method of blocking or preventing attachment of P. aeruginosa to epithelial cells comprising contacting a mixture of epithelial cells and P. aeruginosa with the binding molecule or fragment thereof, the antibody or fragment thereof, the composition, the polynucleotide, the vector, or the host cell described herein.
[0261] Also disclosed is a method of enhancing OPK of P. aeruginosa comprising contacting a mixture of phagocytic cells and P. aeruginosa with the binding molecule or fragment thereof, the antibody or fragment thereof, the composition, the polynucleotide, the vector, or the host cell described herein. In further embodiments, the phagocytic cells are differentiated HL-60 cells or human polymorphonuclear leukocytes (PMNs).
[0262] In keeping with the scope of the disclosure, anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof, can be administered to a human or other animal in accordance with the aforementioned methods of treatment in an amount sufficient to produce a therapeutic effect. The anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof, disclosed herein can be administered to such human or other animal in a conventional dosage form prepared by combining the antibody of the disclosure with a conventional pharmaceutically acceptable carrier or diluent according to known techniques.
[0263] Effective doses of the compositions of the present disclosure, for treatment of Pseudomonas infection vary depending upon many different factors, including means of administration, target site, physiological state of the patient, whether the patient is human or an animal, other medications administered, and whether treatment is prophylactic or therapeutic. Usually, the patient is a human but non-human mammals including transgenic mammals can also be treated. Treatment dosages can be titrated using routine methods known to those of skill in the art to optimize safety and efficacy.
[0264] Anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof can be administered multiple occasions at various frequencies depending on various factors known to those of skill in the art. Alternatively, anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof can be administered as a sustained release formulation, in which case less frequent administration is required. Dosage and frequency vary depending on the half-life of the antibody in the patient.
[0265] The compositions of the disclosure can be administered by any suitable method, e.g., parenterally, intraventricularly, orally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir. The term parenteral as used herein includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques.
X. Immunoassays
[0266] Anti-Pseudomonas Psl binding molecules, e.g., antibodies or fragments, variants or derivatives thereof can be assayed for immunospecific binding by any method known in the art. The immunoassays which can be used include but are not limited to competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), sandwich immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, to name but a few. Such assays are routine and well known in the art (see, e.g., Ausubel et al., eds, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, Vol. 1 (1994), which is incorporated by reference herein in its entirety). Exemplary immunoassays are described briefly below (but are not intended by way of limitation).
[0267] There are a variety of methods available for measuring the affinity of an antibody-antigen interaction, but relatively few for determining rate constants. Most of the methods rely on either labeling antibody or antigen, which inevitably complicates routine measurements and introduces uncertainties in the measured quantities. Antibody affinity can be measured by a number of methods, including OCTET, BIACORE, ELISA, and FACS.
[0268] The OCTET system uses biosensors in a 96-well plate format to report kinetic analysis. Protein binding and dissociation events can be monitored by measuring the binding of one protein in solution to a second protein immobilized on the FortBio biosensor. In the case of measuring binding of anti-Psl antibodies to Psl, the Psl is immobilized onto OCTET tips followed by analysis of binding of the antibody, which is in solution. Association and disassociation of antibody to immobilized Psl is then detected by the instrument sensor. The data is then collected and exported to GraphPad Prism for affinity curve fitting.
[0269] Surface plasmon resonance (SPR) as performed on BIACORE offers a number of advantages over conventional methods of measuring the affinity of antibody-antigen interactions: (i) no requirement to label either antibody or antigen; (ii) antibodies do not need to be purified in advance, cell culture supernatant can be used directly; (iii) real-time measurements, allowing rapid semi-quantitative comparison of different monoclonal antibody interactions, are enabled and are sufficient for many evaluation purposes; (iv) biospecific surface can be regenerated so that a series of different monoclonal antibodies can easily be compared under identical conditions; (v) analytical procedures are fully automated, and extensive series of measurements can be performed without user intervention. BIAapplications Handbook, version AB (reprinted 1998), BIACORE code No. BR-1001-86; BIAtechnology Handbook, version AB (reprinted 1998), BIACORE code No. BR-1001-84.
[0270] SPR based binding studies require that one member of a binding pair be immobilized on a sensor surface. The binding partner immobilized is referred to as the ligand. The binding partner in solution is referred to as the analyte. In some cases, the ligand is attached indirectly to the surface through binding to another immobilized molecule, which is referred as the capturing molecule. SPR response reflects a change in mass concentration at the detector surface as analytes bind or dissociate.
[0271] Based on SPR, real-time BIACORE measurements monitor interactions directly as they happen. The technique is well suited to determination of kinetic parameters. Comparative affinity ranking is extremely simple to perform, and both kinetic and affinity constants can be derived from the sensorgram data.
[0272] When analyte is injected in a discrete pulse across a ligand surface, the resulting sensorgram can be divided into three essential phases: (i) Association of analyte with ligand during sample injection; (ii) Equilibrium or steady state during sample injection, where the rate of analyte binding is balanced by dissociation from the complex; (iii) Dissociation of analyte from the surface during buffer flow.
[0273] The association and dissociation phases provide information on the kinetics of analyte-ligand interaction (k.sub.a and k.sub.d, the rates of complex formation and dissociation, k.sub.d/k.sub.a=K.sub.D). The equilibrium phase provides information on the affinity of the analyte-ligand interaction (K.sub.D).
[0274] BIAevaluation software provides comprehensive facilities for curve fitting using both numerical integration and global fitting algorithms. With suitable analysis of the data, separate rate and affinity constants for interaction can be obtained from simple BIACORE investigations. The range of affinities measurable by this technique is very broad ranging from mM to pM.
[0275] Epitope specificity is an important characteristic of a monoclonal antibody. Epitope mapping with BIACORE, in contrast to conventional techniques using radioimmunoassay, ELISA or other surface adsorption methods, does not require labeling or purified antibodies, and allows multi-site specificity tests using a sequence of several monoclonal antibodies. Additionally, large numbers of analyses can be processed automatically.
[0276] Pair-wise binding experiments test the ability of two MAbs to bind simultaneously to the same antigen. MAbs directed against separate epitopes will bind independently, whereas MAbs directed against identical or closely related epitopes will interfere with each other's binding. These binding experiments with BIACORE are straightforward to carry out.
[0277] For example, one can use a capture molecule to bind the first Mab, followed by addition of antigen and second MAb sequentially. The sensorgrams will reveal: 1. how much of the antigen binds to first Mab, 2. to what extent the second MAb binds to the surface-attached antigen, 3. if the second MAb does not bind, whether reversing the order of the pair-wise test alters the results.
[0278] Peptide inhibition is another technique used for epitope mapping. This method can complement pair-wise antibody binding studies, and can relate functional epitopes to structural features when the primary sequence of the antigen is known. Peptides or antigen fragments are tested for inhibition of binding of different MAbs to immobilized antigen. Peptides which interfere with binding of a given MAb are assumed to be structurally related to the epitope defined by that MAb.
[0279] The practice of the disclosure will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., Sambrook et al., ed., Cold Spring Harbor Laboratory Press: (1989); Molecular Cloning: A Laboratory Manual, Sambrook et al., ed., Cold Springs Harbor Laboratory, New York (1992), DNA Cloning, D. N. Glover ed., Volumes I and II (1985); Oligonucleotide Synthesis, M. J. Gait ed., (1984); Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization, B. D. Hames & S. J. Higgins eds. (1984); Transcription And Translation, B. D. Hames & S. J. Higgins eds. (1984); Culture Of Animal Cells, R. I. Freshney, Alan R. Liss, Inc., (1987); Immobilized Cells And Enzymes, IRL Press, (1986); B. Perbal, A Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology, Academic Press, Inc., N.Y.; Gene Transfer Vectors For Mammalian Cells, J. H. Miller and M. P. Calos eds., Cold Spring Harbor Laboratory (1987); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.); Immunochemical Methods In Cell And Molecular Biology, Mayer and Walker, eds., Academic Press, London (1987); Handbook Of Experimental Immunology, Volumes I-IV, D. M. Weir and C. C. Blackwell, eds., (1986); Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1986); and in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989).
[0280] Standard reference works setting forth general principles of immunology include Current Protocols in Immunology, John Wiley & Sons, New York; Klein, J., Immunology: The Science of Self-Nonself Discrimination, John Wiley & Sons, New York (1982); Roitt, I., Brostoff, J. and Male D., Immunology, 6.sup.th ed. London: Mosby (2001); Abbas A., Abul, A. and Lichtman, A., Cellular and Molecular Immunology, Ed. 5, Elsevier Health Sciences Division (2005); and Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Press (1988).
[0281] Having now described the disclosure in detail, the same will be more clearly understood by reference to the following examples, which are included herewith for purposes of illustration only and are not intended to be limiting of the disclosure. All patents and publications referred to herein are expressly incorporated by reference in their entireties.
EXAMPLES
Example 1: Construction and Screening of Human Antibody Phage Display Libraries
[0282] This example describes a target indifferent whole cell panning approach with human antibody phage libraries derived from both naive and P. aeruginosa infected convalescing patients to identify novel protective antigens against Pseudomonas infection (
[0283]
[0284] In addition to the patient library, a nave human scFv phage display library containing up to 110.sup.11 binding members (Lloyd, C., et al., Protein Eng Des Sel 22, 159-168 (2009)) was used for antibody isolation (Vaughan, T. J., et al., Nat Biotechnol 14, 309-314 (1996)). Heat killed P. aeruginosa (110.sup.9) was immobilized in IMMUNO Tubes (Nunc; MAXISORP) followed for phage display selections as described (Vaughan, T. J., et al., Nat Biotechnol 14, 309-314 (1996)) with the exception of triethanolamine (100 nM) being used as the elution buffer. For selection on P. aeruginosa in suspension, heat killed cells were blocked followed by addition of blocked phage to cells. After washing, eluted phage was used to infect E. coli cells as described (Vaughan, 1996). Rescue of phage from E. coli and binding to heat-killed P. aeruginosa by ELISA was performed as described (Vaughan, 1996).
[0285] Following development and validation of the whole-cell affinity selection methodology, both the new convalescing patient library and a previously constructed naive library (Vaughan, T. J., et al., Nat Biotechnol 14, 309-314 (1996)) underwent affinity selection on suspensions of P. aeruginosa strain 3064 possessing a complete O-antigen as well as an isogenic wapR mutant strain which lacked surface expression of O-antigen.
[0286] For IgG expression, the VH and VL chains of selected antibodies were cloned into human IgG1 expression vectors, co-expressed in HEK293 cells, and purified by protein A affinity chromatography as described (Persic, L., et al., Gene 187, 9-18 (1997)). Human IgG1 antibodies made with the variable regions from these selected serotype independent phage were confirmed for P. aeruginosa specificity and prioritized for subsequent analysis by whole cell binding to dominant clinically relevant serotypes by FACS analysis (
Example 2: Evaluation of mAbs Promoting OPK of P. aeruginosa
[0287] This example describes the evaluation of prioritized human IgG1 antibodies to promote OPK of P. aeruginosa.
[0288] The ability of the WapR-004 and Cam-003 antibodies to mediate OPK activity against another clinically relevant O-antigen serotype strain, 9882-80.lux, was evaluated.
[0289] The ability of Cam-003 to mediate OPK activity against representative non-mucoid strains from clinically relevant O-antigen serotypes and against mucoid P. aeruginosa strains which were derived from cystic fibrosis patients was evaluated. Cam-003 mediated potent OPK of all non-mucoid clinical isolates tested (
[0290] In addition, this example describes the evaluation of WapR-004 (W4) mutants in scFv-Fc format to promote OPK of P. aeruginosa. One mutant, Wap-004RAD (W4-RAD), was specifically created through site-directed mutagenesis to remove an RGD motif in VH. Other W4 mutants were prepared as follows. Nested PCR was performed as described (Roux, K. H., PCR Methods Appl 4, S185-194 (1995)), to amplify W4 variants (derived from somatic hypermutation) from the scFv library derived from the convalescing P. aeruginosa infected patients, for analysis. This is the library from which WapR-004 was derived. W4 variant fragments were subcloned and sequenced using standard procedures known in the art. W4 mutant light chains (LC) were recombined with the WapR-004 heavy chain (HC) to produce W4 mutants in scFv-Fc format. In addition WapR-004 RAD heavy chain (HC) mutants were recombined with parent LCs of M7 and M8 in the scFv-Fc format. Constructs were prepared using standard procedures known in the art.
Example 3: Serotype Independent Anti-P. aeruginosa Antibodies Target the Psl Exopolysaccharide
[0291] This example describes identification of the target of anti-P. aeruginosa antibodies derived from phenotypic screening. Target analysis was performed to test whether the serotype independent antibodies targeted protein or carbohydrate antigens. No loss of binding was observed in ELISA to PAO1 whole cell extracts exhaustively digested with proteinase K, suggesting that reactivity targeted surface accessible carbohydrate residues (data not shown). Isogenic mutants were constructed in genes responsible for O-antigen, alginate, and LPS core biosynthesis; wbpL (O-antigen-deficient); wbpL/algD (O-antigen and alginate deficient); rmlC (O-antigen-deficient and truncated outer core); and galU (O-antigen-deficient and truncated inner core). P. aeruginosa mutants were constructed based on the allele replacement strategy described by Schweizer (Schweizer, H. P., Mol Microbiol 6, 1195-1204 (1992); Schweizer, H. D., Biotechniques 15, 831-834 (1993)). Vectors were mobilized from E. coli strain 517.1 into P. aeruginosa strain PAO1; recombinants were isolated as described (Hoang, T. T., et al., Gene 212, 77-86 (1998)). Gene deletion was confirmed by PCR. P. aeruginosa mutants were complemented with pUCP30T-based constructs harboring wild type genes. Reactivity of antibodies was determined by indirect ELISA on plates coated with above indicated P. aeruginosa strains:
[0292] To confirm that all of the antibodies bound to the same antigen, a Psl capture binding assay was performed using a FORTEBIO OCTET 384 instrument as described above. The antigen was proteinase K-treated enriched carbohydrate purified from PAO1wbpL/algD/pelA (O-antigen-, alginate- and Pel exopolysaccharide-deficient). Individual antibodies were bound to aminopropylsilane biosensors followed by blocking and the addition of the enriched carbohydrate antigen. After washing to remove unbound antigen, binding of unlabelled mAbs to captured antigen was assessed. All bound antibodies (Cam-003, Cam-004, Cam-005, WapR-001, WapR-002, WapR-003, WapR-007 and WapR-016), with the exception of the control mAb R347, were capable of capturing antigen that reacted with each of Cam-003, WapR-001, WapR-002, WapR-003, and WapR-016 (
Example 4: Anti-Psl mAbs Block Attachment of P. aeruginosa to Cultured Epithelial Cells
[0293] This example shows that anti-Psl antibodies blocked P. aeruginosa association with epithelial cells. Anti-Psl antibodies were added to a confluent monolayer of A549 cells (an adenocarcinoma human alveolar basal epithelial cell line) grown in opaque 96-well plates (Nunc Nunclon Delta). Log-phase luminescent P. aeruginosa PAO1 strain (PAO1.lux) was added at an MOI of 10. After incubation of PAO1.lux with A549 cells at 37 C. for 1 hour, the A549 cells were washed, followed by addition of LB+0.5% glucose. Bacteria were quantified following a brief incubation at 37 C. as performed in the OPK assay described in Example 2. Measurements from wells without A549 cells were used to correct for non-specific binding.
Example 5: In Vivo Passaged P. aeruginosa Strains Maintain/Increase Expression of Psl
[0294] To test if Psl expression in vivo is maintained, mice were injected intraperitoneally with P. aeruginosa isolates followed by harvesting of bacteria by peritoneal lavage four hours post-infection. The presence of Psl was analyzed with a control antibody and Cam-003 by flow cytometry as conditions for antibody binding are more stringent and allow for quantification of cells that are positive or negative for Psl expression. For ex vivo binding, bacterial inocula (0.1 ml) was prepared from an overnight TSA plate and delivered intraperitoneally to BALB/c mice. At 4 hr. following challenge, bacteria were harvested, RBCs lysed, sonicated and resuspended in PBS supplemented with 0.1% Tween-20 and 1% BSA. Samples were stained and analyzed as previously described in Example 1.
[0295] The level of Psl expression/accessibility on the surface of P. aeruginosa strains PAO1 and 6206 in the acute pneumonia model was also assessed. Bacteria prepared from overnight-incubated, confluent plates, as described above, were intranasally administered to BALB/c mice. At 4 and 24 hours post-infection, bacteria were recovered from the lungs by bronchoalveolar lavage. Samples were stained and analyzed as previously described in Example 1. Strong Cam-003 staining was observed for PAO1 at 4 hours post-infection, but was minimal for 6206 at this time point (
[0296] The binding of P. aeruginosa specific antibodies (Cam-003, Cam-004 and Cam-005) to representative strains from unique P. aeruginosa serotypes (PAO1(O5) (
Example 6: Survival Rates for Animals Treated with Anti-Psl Monoclonal Antibodies Cam-003 and WapR-004 in a P. aeruginosa Acute Pneumonia Model
[0297] Antibodies or PBS were administered 24 hours before infection in each model. P. aeruginosa acute pneumonia, keratitis, and thermal injury infection models were performed as described (DiGiandomenico, A., et al., Proc Natl Acad Sci USA 104, 4624-4629 (2007)), with modifications. In the acute pneumonia model, BALB/c mice (The Jackson Laboratory) were infected with P. aeruginosa strains suspended in a 0.05 ml inoculum. In the thermal injury model, CF-1 mice (Charles River) received a 10% total body surface area burn with a metal brand heated to 92 C. for 10 seconds. Animals were infected subcutaneously with P. aeruginosa strain 6077 at the indicated dose. For organ burden experiments, acute pneumonia was induced in mice followed by harvesting of lungs, spleens, and kidneys 24 hours post-infection for determination of CFU.
[0298] Monoclonal antibodies Cam-003 and WapR-004 were evaluated in an acute lethal pneumonia model against P. aeruginosa strains representing the most frequent serotypes associated with clinical disease.
[0299] Cam-003 and WapR-004 were next examined for their ability to reduce P. aeruginosa organ burden in the lung and spread to distal organs, and later the animals were treated with various concentrations of WapR-004, Cam-003, or control antibodies at several different concentrations. Cam-003 was effective at reducing P. aeruginosa lung burden against all four strains tested. Cam-003 was most effective against the highly pathogenic cytotoxic strain, 6077, where the low dose was as effective as the higher dose (
Example 7: Survival Rates for Animals Treated with Anti-Psl Monoclonal Antibodies Cam-003 and WapR-004 in a P. aeruginosa Corneal Infection Model
[0300] Cam-003 and WapR-004 efficacy was next evaluated in a P. aeruginosa corneal infection model which emphasizes the pathogens ability to attach and colonize damaged tissue.
Example 8: A Cam-003 Fc Mutant Antibody, Cam-003-TM, has Diminished OPK and In Vivo Efficacy but Maintains Anti-Cell Attachment Activity
[0301] Given the potential for dual mechanisms of action, a Cam-003 Fc mutant, Cam-003-TM, was created which harbors mutations in the Fc domain that reduces its interaction with Fc receptors (Oganesyan, V., et al., Acta Crystallogr D Biol Crystallogr 64, 700-704 (2008)), to identify if protection was more correlative to anti-cell attachment or OPK activity. P. aeruginosa mutants were constructed based on the allele replacement strategy described by Schweizer (Schweizer, H. P., Mol Microbiol 6, 1195-1204 (1992); Schweizer, H. D., Biotechniques 15, 831-834 (1993)). Vectors were mobilized from E. coli strain 517.1 into P. aeruginosa strain PAO1; recombinants were isolated as described (Hoang, T. T., et al., Gene 212, 77-86 (1998)). Gene deletion was confirmed by PCR. P. aeruginosa mutants were complemented with pUCP30T-based constructs harboring wild type genes.
Example 9: Epitope Mapping and Relative Affinity for Anti-Psl Antibodies
[0302] Epitope mapping was performed by competition ELISA and confirmed using an OCTET flow system with Psl derived from the supernatant of an overnight culture of P. aeruginosa strain PAO1. For competition ELISA, antibodies were biotinylated using the EZ-Link Sulfo-NHS-Biotin and Biotinylation Kit (Thermo Scientific). Antigen coated plates were treated with the EC50 of biotinylated antibodies coincubated with unlabeled antibodies. After incubation with HRP-conjugated streptavidin (Thermo Scientific), plates were developed as described above. Competition experiments between anti-Psl mAbs determined that antibodies targeted at least three unique epitopes, referred to as class 1, 2, and 3 antibodies (
[0303] Antibody affinity was determined by the OCTET binding assays using Psl derived from the supernatant of overnight PAO1 cultures. Antibody K.sub.D was determined by averaging the binding kinetics of seven concentrations for each antibody. Affinity measurements were taken with a FORTEBIO OCTET 384 instrument using 384 slanted well plates. The supernatant from overnight PAO1 culturesthe pslA gene were used as the Psl source. Samples were loaded onto OCTET AminoPropylSilane (hydrated in PBS) sensors and blocked, followed by measurement of anti-Psl mAb binding at several concentrations, and disassociation into PBS+1% BSA. All procedures were performed as described (Wang, X., et al., J Immunol Methods 362, 151-160). Association and disassociation raw nM data were curve-fitted with GraphPad Prism.
Example 10: Binding of Polymyxin B (PMB)-mAb Conjugates to P. aeruginosa PAO1 Cells was Evaluated by FACS
[0304] In this Example, PMB conjugated to an opsonic monoclonal antibody (mAb) that was capable of mediating bacterial clearance was evaluated to determine whether the conjugate would improve and/or expand mAb functionality, while also reducing the toxicity of PMB. CAM-003, a mAb targeting the P. aeruginosa Psl surface exopolysaccharide, which mediates potent opsonophagocytic killing (OPK) activity and protection in vivo, was selected for conjugate evaluation.
[0305] This example evaluates binding of various Polymyxin B (PMB)-mAbs conjugates to P. aeruginosa PAO1 cells. Using a two-step site-directed conjugation method (
[0306] CAM-003 is specific for the P. aeruginosa Psl surface exopolysaccharide and mediates potent OPK activity and protection in multiple in vivo models.
Example 11: Evaluation of PMB-mAb Conjugates Promoting OPK of P. aeruginosa
[0307] This example describes two series of experiments evaluating the ability of PMB-mAb conjugates to promote OPK of P. aeruginosa. In the first experiments (
Example 12: Neutralization of P. aeruginosa LPS by PMB-mAb Conjugates
[0308] Neutralization of P. aeruginosa 010 LPS activity was evaluated by preincubating the PMB-mAb conjugates or PMB alone with LPS for 1 h, followed by stimulation of murine RAW 264.7 macrophages and quantification of TNF secretion. Final concentration of LPS was 2 ng/ml. TNF was quantified by the FACS-based BD Cytometric Bead Array (CBA) method (BD Biosciences) after 6 h stimulation. LPS neutralization was measured by a decrease in TNF production relative to the LPS maximal response. PMB-Cam-003 conjugates, but not mock-conjugated wild-type Cam-003 exhibited LPS neutralization. Efficiency of neutralization was directly proportional to the average number of PMB in the conjugate (DM2>DM1>SM) (
Example 13: Evaluation of Cam-003-PMB Site-Directed Conjugates in Murine Models
[0309] The efficacy of Cam-003-PMB conjugates were evaluated in two types of murine models: 1) endotoxemia (LPS) challenge model, to determine the ability of the conjugates to neutralize and/or detoxify LPS in vivo; and 2) in P. aeruginosa sepsis model, to evaluate if Cam-003-PMB conjugates effect improved protection against bacterial challenge relative to the antibody alone through PMB-mediated LPS neutralization and/or clearance, in addition to the antibody-mediated bacterial clearance. Other P. aeruginosa challenge models can also be used to test the efficacy of Cam-003-PMB conjugates (see below).
A. Endotoxemia Model
[0310] It is well established that PMB can bind and neutralize LPS in vivo, and mediate protection against LPS challenge (Morrison, D C. et al. J. Immunochemistry 13(10):813-818 (1976), Drabick, J J. et al., Antimicrob Agents Chemother. 42(3):583-588 (1998)). In the endotoxemia model, Cam-003-PMB conjugates will be evaluated for their ability to protect animals from LPS challenge. Purified LPS from Gram-negative bacteria, including P. aeruginosa and E. coli, will be used to challenge mice at the established minimal lethal doses (LD100). As mice are relatively resistant to LPS, D-galactosamine may also be coadministered, as it greatly increases the sensitivity of mice to LPS to roughly that of humans (Galanos, C. et al., Proc Natl Acad Sci USA. 76(11):5939-5943 (1979)). Such models have been widely used for preclinical efficacy evaluation of LPS neutralizing molecules, including antibodies and polymyxin-protein conjugates (Bailat, S. et al., Infect Immun. 65(2):811-814 (1997), Birkenmeier, G. et al., J Pharmacol Exp Ther. 318(2):762-771 (2006), Drabick, J J. et al., Antimicrob Agents Chemother. 42(3):583-588 (1998)). Cam-003-PMB conjugates, control conjugates and unconjugated Cam-003 can be administered either therapeutically or prophylactically, and their ability to protect animals from LPS challenge can be evaluated. The extent of protection mediated by PMB conjugates can be correlated with levels of proinflammatory cytokines and chemokines measured in sera or plasma, including TNF, KC and IL-6.
B. P. aeruginosa Challenge Models
[0311] Several murine models of P. aeruginosa infection can be used to evaluate the ability of Cam-003-PMB conjugates to mediate protection. P. aeruginosa can be administered to mice intraperitoneally (sepsis model), intravenously (bacteremia model) or intranasally (pneumonia model) at the determined LD100 doses. These models have previously been used for preclinical efficacy studies of passive or active vaccines (Frank, D W. et al., J Infect Dis. 186(1):64-73. (2002), Secher, T. et al., J Antimicrob Chemother. 66(5):1100-1109 (2011), Miyazaki, S. et al., J Med Microbiol. 43(3):169-175 (1995), Dunn, D L. et al., Surgery 96(2):440-446 (1984)).
[0312] As in the endotoxemia model, it may also be necessary to sensitize mice with D-galactosamine prior to bacterial challenge to overcome their innate resistance to LPS toxicity and to be able to evaluate the contribution of LPS neutralization and/or clearance to in vivo efficacy of the PMB conjugates. D-galactosamine has been demonstrated to reduce the LD100 of Gram-negative bacteria, likely by increasing sensitivity to LPS shed during infection (Bucklin, S E. et al., J Infect Dis. 172(6):1519-27 (1995)).
[0313] Cam-003-PMB conjugates, control conjugates and unconjugated Cam-003 can be administered either therapeutically or prophylactically. The ability of CAM-003 conjugates to effect increased protection over Cam-003 alone by neutralizing and/or clearing the bacterial LPS via the conjugated PMB moiety can be determined in survival studies. The efficacy of Cam-003-PMB conjugates in mediated bacterial clearance can also be evaluated by quantifying P. aeruginosa bacteria in serum and organs, including spleen, kidneys and lungs, following infection. Serum or plasma LPS levels can also be quantified to evaluate the extent of bacterial clearance and LPS clearance and/or neutralization by the Cam-003-PMB conjugates and compare it to those of unconjugated Cam-003 and control antibody-PMB conjugates.
C. Endotoxemia Model Data
[0314] In particular, C57Bl/6 mice (10 per group) were dosed i.p. with mAb or PMB-mAb conjugate 6 h prior to challenge with P. aeruginosa PAO10 LPS (Sigma) and D-galactosamine. PMB control was dosed i.p. 2 h prior to challenge at 0.2 mg/kg and typically provides 80-100% protection. Control mice dosed with unconjugated CAM-003 all died within 18 h.
[0315] TM conjugates were dosed at 45, 15 and 5 mg/kg. As shown in
D. Sepsis Model Data
[0316] C57Bl/6 mice (10 per group) were dosed with mAb or PMB-mAb conjugates i.p (10, 1 and 0.1 mg/kg) 6 h prior to i.p. challenge with LD.sub.80-100 dose of P. aeruginosa strain 6294 (4E7 CFU). Data from two studies was combined in this analysis. Survival was monitored over 72 h. Combined results of two studies are shown in
[0317] High conjugation efficiency of PMB to engineered Fc cysteine residues was achieved using the SM-PEG.sub.12 heterobifunctional linker. A series of site-directed PMB conjugates of CAM-003, a potent opsonic and protective mAb targeting P. aeruginosa Psl exopolysaccharide, was evaluated in vitro and in vivo. CAM-003-PMB conjugates retained in vitro OPK activity. However the OPK activity was impacted by the increase in the average number of PMB per mAb. DM and TM PMB-mAb conjugates conferred protection in mouse P. aeruginosa endotoxemia model, demonstrating that LPS neutralization function of PMB was conferred onto the mAb. CAM-003-PMB conjugates showed greater protective activity than unconjugated CAM-003 mAb in the P. aeruginosa sepsis model at high doses (10 mg/kg), and reduced activity at low dose (0.1 mg/kg). These data suggest that conjugated PMB can complement bacterial clearance mediated by the opsonic CAM-003 mAb and improve protection by LPS neutralization. The improvement in protective activity by CAM-003-PMB conjugates in the sepsis model is lost at lower doses, where levels of conjugated PMB are too low to neutralize LPS, and the primary mode of protection is likely mAb-mediated bacterial clearance. The loss of protective activity of the CAM-003-PMB conjugates at lower doses is consistent with the reduction in in vitro OPK activity as a result of PMB conjugation. These studies show that conjugated PMB on an opsonic mAb can confer LPS neutralization activity and result in increased protective activity in a systemic P. aeruginosa infection model. Optimization of conjugation sites to reduce the negative impact on OPK activity may further improve the protective activity of PMB conjugates relative to unconjugated opsonic mAb.
[0318] The disclosure is not to be limited in scope by the specific embodiments described which are intended as single illustrations of individual aspects of the disclosure, and any compositions or methods which are functionally equivalent are within the scope of this disclosure. Indeed, various modifications of the disclosure in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and accompanying drawings. Such modifications are intended to fall within the scope of the appended claims.
[0319] All publications and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.