USES OF NOVEL FATTY ACID DESATURASES AND ELONGASES AND PRODUCTS THEREOF
20190323022 · 2019-10-24
Inventors
Cpc classification
C12N9/0071
CHEMISTRY; METALLURGY
C12N15/8247
CHEMISTRY; METALLURGY
C12Y114/19
CHEMISTRY; METALLURGY
A01H5/00
HUMAN NECESSITIES
C12Y114/19004
CHEMISTRY; METALLURGY
C12P7/6427
CHEMISTRY; METALLURGY
C12Y602/01003
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
C12Y114/19006
CHEMISTRY; METALLURGY
C12P7/6472
CHEMISTRY; METALLURGY
International classification
C12N15/82
CHEMISTRY; METALLURGY
C12N9/00
CHEMISTRY; METALLURGY
Abstract
The invention provides isolated nucleic acid molecules which encode novel fatty acid desaturases and elongases from the organism Emiliana huxleyi. The invention also provides recombinant expression vectors containing desaturase or elongase nucleic acid molecules, host cells into which the expression vectors have been introduced, and methods for large-scale production of long chain polyunsaturated fatty acids (LCPUFAs), e.g. arachidonic acid (ARA), eicosapentaenoic acid (EPA) or docosahexaenoic acid (DHA).
Claims
1. Plant seed oil obtained from seeds of a transgenic plant comprising docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA), and docosapentaenoic acid (DPA), wherein the oil comprises at least 1% DHA and not more than 6% EPA, based on the total fatty acids of the transgenic seeds, and wherein the oil has a ratio of DHA to DPA of at least 2.
2. The oil of claim 1, wherein the transgenic plant is a transgenic oilseed plant.
3. The oil of claim 2, wherein the oilseed plant is flax (Linum sp.), rapeseed (Brassica sp.), soybean (Glycine sp.), sunflower (Helianthus sp.), cotton (Gossypium sp.), corn (Zea mays), olive (Olea sp.), safflower (Carthamus sp.), cocoa (Theobroma cacoa), peanut (Arachis sp.), hemp, camelina, crambe, oil palm, coconuts, groundnuts, sesame, castor bean, lesquerella, tallow tree, sheanuts, tungnuts, kapok fruit, poppy, jojoba, or perilla.
4. The oil of claim 2, wherein the oilseed plant is from the plant family of Brassicaceae.
5. The oil of claim 2, wherein the oilseed plant is a Brassica plant.
6. The oil of claim 1, wherein the oil has a ratio of DHA to DPA of 2.9.
7. The oil of claim 1, wherein the oil comprises at least 1% but not more than 5% EPA.
8. The oil of claim 1, wherein the DHA, EPA and DPA are triglyceride esters.
9. Plant seed oil obtained from seeds of a transgenic plant plant comprising docosahexaenoic acid (DHA), eicosapentaenoic acid (EPA), and docosapentaenoic acid (DPA), wherein the oil comprises at least 1% DHA and not more than 6% EPA, based on the total fatty acids of the transgenic seed, and wherein the seeds of the transgenic plant have a conversion rate of DPA to DHA of at least 75%.
10. The oil of claim 9, wherein the transgenic plant is a transgenic oilseed plant.
11. The oil of claim 10, wherein the oilseed plant is flax (Linum sp.), rapeseed (Brassica sp.), soybean (Glycine sp.), sunflower (Helianthus sp.), cotton (Gossypium sp.), corn (Zea mays), olive (Olea sp.), safflower (Carthamus sp.), cocoa (Theobroma cacoa), peanut (Arachis sp.), hemp, camelina, crambe, oil palm, coconuts, groundnuts, sesame, castor bean, lesquerella, tallow tree, sheanuts, tungnuts, kapok fruit, poppy, jojoba, or perilla.
12. The oil of claim 10, wherein the oilseed plant is from the plant family of Brassicaceae.
13. The oil of claim 10, wherein the oilseed plant is a Brassica plant.
14. The oil of claim 9, wherein the oil has a ratio of DHA to DPA of at least 2.
15. The oil of claim 14, wherein the ratio of DHA to DPA is 2.9.
16. The oil of claim 9, wherein the oil comprises not more than 5% EPA.
17. The oil of claim 9, wherein the DHA, EPA and DPA are triglyceride esters.
Description
FIGURES
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089] This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patents and published patent applications cited throughout this application, as well as the figures, are incorporated herein by reference.
EXAMPLES
Example 1: Organism and Culture Conditions
[0090] Emiliana huxleyi was grown as described in Sciandra et al. (2003) Marine Ecology Progress Series 261:111-122 with following conditions:
[0091] Growth in 50 ml inconical flasks using K/2 medium (Keller et al. (1987) Journal of Phycology 23:633-638). The flasks were placed in a growth chamber at a temperature of 170.1 C. under 14L:10D irradiance. Light was provided by fluorescent lamps giving a photon fluxdensity (400 to 700 nm) of 170 mol photon m2 s1.
Example 2: Cloning of Novel Desaturase and Elongase Sequences
[0092] RNA from cells grown as described under Example 1 was extracted using the RNA-extraction Kit from Qiagen, a RACE-library was generated using the RACE-Kit from Clontech. From the RACE-library sequences for desaturase and elongases were amplified with PCR using following primer pairs and PCR conditions.
[0093] PCR reaction (50 L):
[0094] 5.00 L Template cDNA
[0095] 5.00 L 10 Puffer (Advantage-Polymerase)+25 mM MgCl.sub.2
[0096] 5.00 L 2 mM dNTP
[0097] 1.25 L je Primer (10 pmol/L)
[0098] 0.50 L Advantage-Polymerase
[0099] The Advantage polymerase mix from Clontech was used.
[0100] Reaction conditions of the PCR:
[0101] Annealing: 1 min 55 C.
[0102] Denaturation: 1 min 94 C.
[0103] Elongation: 2 min 72 C.
[0104] Cycles: 35
[0105] Primer pairs used in PCR:
TABLE-US-00002 Name Primerpair(5 orientation) SEQIDNO. Eh4ff CCATGGGAGGCGCCGGCGCGAG 11 Eh4rv CTAGTCCGCCTTGAGGTTCTC 12 Eh5ff ACCATGTGCAAGGCGAGCGGCCT 13 Eh5rv TCACCAATCATGAGGAAGGT 14 Eh8ff CCATGGGCAAGGGCGGCAACGC 15 Eh8rv GGGCAGAGATGCCGCACTAG 16 Eh9ff ACCATGCTCGATCGCGCCTCGTC 17 Eh9rv TCACAGCGCCTTGCGGGTAGC 18
[0106] The PCR reactions resulted in following polynucleotide sequences:
TABLE-US-00003 Gene Activity Length in bp SEQ ID NO. D4Des(Eh) D4-desaturase 1280 5 D8Des(Eh) D8-desaturase 1256 1 D9Elo(Eh) D9-elongase 804 3 D5Elo(Eh) Multi-elongase 921 7
[0107] A list of identified full-length coding sequences is shown in Table 1.
TABLE-US-00004 TABLE 1 List of full-length coding sequences and deduced amino acid sequences Coding sequence Amino acid SEQ ID NO: Gene in bp sequence 1 D8Des(Eh) 1254 417 3 D9Elo(Eh) 801 266 5 D4Des(Eh) 1278 425 7 D5Elo(Eh) 918 305
[0108] Open reading frames as shown in Table 1 were cloned into the pESC(Leu) vector from Stratagene according to manufactures reaction conditions. Reactions were transformed into E. coli DH5 and plasmid DNA was isolated. The plasmids pESC-d4Des(Eh), pESC-d8Des(Eh), pESC-d9Elo(Eh), pESC-d5Elo(Eh) were then used for yeast transformation.
Example 3: Yeast Transformation and Growth Conditions
[0109] S. cerevisiae strain INVSC from Invitrogen was transformed with the constructs pESC-d4Des(Eh), pESC-d8Des(Eh), pESC-d9Elo(Eh), pESC-d5Elo(Eh) and pESC using the S. C. EasyComp Transformation Kit (Invitrogen, Carlsbad, Calif.) with selection on leucine-deficient medium.
[0110] Yeast were grown after transformation in complete medium containing all amino acids and nucleotides. Then yeast were plated on different medium containing either the complete medium (SD) or the complete medium lacking leucine (SD-Leu). Only yeast containing pESC-d4Des(Eh), pESC-d8Des(Eh), pESC-d9Elo(Eh), pESC-d5Elo(Eh) or pESC vector can grow on this medium.
Example 4: Functional Expression of Desaturases and Elongases in Yeast and Gas Chromatographic Analysis
[0111] Yeast cells containing the respective pESC plasmids as prepared above were incubated 12 h in liquid DOB-U medium at 28 C., 200 rpm inkubiert and than additional 12 h in induction medium (DOB-U+2% (w/v) galactose+2% (w/v) raffinose). To the induction medium 250 M of the respective fatty acids were added to check for enzyme activity and specificity.
[0112] Yeast cells were analyzed as following:
[0113] Yeast cells from induction medium were harvested by centrifugation (100g, 5 min, 20 C.) and washed with 100 mM NaHCO.sub.3, pH 8,0, to remove residual fatty acids. From the yeast pellet a total extract of fatty acid methylesters (FAME) was generated by adding 2 ml 1 N methanolic sulfuric acid and 2% (v/v) Dimethoxypropan for 1 h at 80 C. FAME were extracted two times with Petrolether (PE). Not derivased fatty acids were removed by washing with 2 ml 100 mM NaHCO.sub.3, pH 8,0 and 2 ml Aqua dent. The PE-phases were dried with Na.sub.2SO.sub.4 and eluted in 100 l PE. The samples were then separated with a DB-23-column (30 m, 0.25 mm, 0,25 m, Agilent) in a Hewlett-Packard 6850-machine with FID using following conditions: oven temperature 50 C. to 250 C. with a rate of 5 C./min and finally 10 min at 250 C.
[0114] The identification of the fatty acids was done using the retention times of known fatty acid standards (Sigma). The method is described e.g. in Napier and Michaelson, 2001, Lipids. 36(8):761-766; Sayanova et al., 2001, Journal of Experimental Botany. 52(360):1581-1585, Sperling et al., 2001, Arch. Biochem. Biophys. 388(2):293-298 and Michaelson et al., 1998, FEBS Letters. 439(3):215-218.
Example 5: Functional Characterization of d4Des(Eh)
[0115] As described above d4Des(Eh) was functionally characterized in yeast. The result of the analysis is shown in
Example 6: Functional Characterization of d8Des(Eh)
[0116] As described above d8Des(Eh) was functionally characterized in yeast. The result of the analysis is shown in
Example 7: Functional Characterization of d9Elo(Eh)
[0117] As described above d9Elo(Eh) was functionally characterized in yeast. The result of the analysis is shown in
Example 8: Functional Characterization of d5Elo(Eh)
[0118] As described above d5Elo(Eh) was functionally characterized in yeast. The result of the analysis is shown in
Example 9: Expression of Novel Elongases from Emiliana huxleyi in Plants
[0119] The novel desaturases and elongases were cloned into a plant transformation vector as described in WO2003/093482, WO2005/083093 or WO2007/093776. Exemplary suitable combinations of genes are described in Table 2, 3 and 4.
TABLE-US-00005 TABLE 2 Gene combinations for the production of ARA. Gene Activity SEQ ID NO: D6Des(Ot) 6-Desaturase 19 D6Elo(Pp) 6-Elongase 21 D5Des(Eh) 5-Desaturase 9 D12Des(Ps) 12-Desaturase 23 D6Elo(Tp) 6-Elongase 25 D8Des(Eh) 8-Desaturase 1 D9Elo(Eh) 9-Elongase 3
TABLE-US-00006 TABLE 3 Gene combinations for the production of EPA. Gene Activity SEQ ID NO: D6Des(Ot) 6-Desaturase 19 D5Elo(Eh) 5-Elongase 7 D5Des(Eh) 5-Desaturase 9 D12Des(Ps) 12-Desaturase 23 D6Elo(Tp) 6-Elongase 25 o3-Des(Pi) Omega 3-Desaturase 27 D15Des(Cp) 15-Desaturase 29 D8Des(Eh) 8-Desaturase 1 D9Elo(Eh) 9-Elongase 3
TABLE-US-00007 TABLE 4 Gene combinations for the production of DHA. Gene Activity SEQ ID NO: D6Des(Ot) 6-Desaturase 19 D5Elo(Eh) 5-Elongase 7 D5Des(Eh) 5-Desaturase 9 D12Des(Ps) 12-Desaturase 23 D6Elo(Tp) 6-Elongase 25 3-Des(Pi) Omega 3-Desaturase 27 D15Des(Cp) 15-Desaturase 29 D5Elo(Ot) 5-elongase 31 D4Des(Eh) 4-desaturase 5 D8Des(Eh) 8-Desaturase 1 D9Elo(Eh) 9-Elongase 3
[0120] Based on the gene combinations as described in Table 2, Table 3 or Table 4 following combinations were designed: [0121] AP2: LuCnI-d5Des(Eh)_LuCnI-d8Des8Eh)_Napin-o3Des(Pi)_Napin-d12Des(Ps)_LuCnI-d9Elo(Eh) [0122] OstELO5EmD4: VfUSP-d6Elo(Pp)_LuCnI-d5Des8Tc)_VfSBP-d6Des(Ot)_Napin-o3Des(Pi)_Napin-d12Des(Ps)_LuCnI-d5Elo(Ot)_LuCnI-d4Des(Eh) [0123] OstELO5TcD4: VfUSP-d6Elo(Pp)_LuCnI-d5Des8Tc)_VfSBP-d6Des(Ot)_Napin-o3Des(Pi)_Napin-d12Des(Ps)_LuCnI-d5Elo(Ot)_LuCnI-d4Des(Tc)
[0124] Transgenic rapeseed lines were generated as described in Deblaere et al, 1984, Nucl. Acids. Res. 13, 4777-4788 and seeds of transgenic rapeseed plants are analyzed as described in Qiu et al. 2001, J. Biol. Chem. 276, 31561-31566.
[0125] Transgenic Arabidopsis plants were generated as described in Bechtholdt et al. 1993 C. R. Acad. Sci. Ser. III Sci. Vie., 316, 1194-1199. Seeds of transgenic Arabidopsis plants expressing d9Elo(Eh) by using the seed-specific promoter Glycinin from soybean (Lelievre et al. (1992) Plant Physiol 98:387-391) were analyzed by gas chromatography (
[0126] To further prove the activity of d9Elo(Eh) expressed in seeds of Arabidopsis thaliana AcylCoA-measurements were done. Substrates and products of the d9Elo(Eh) elongation reaction are AcylCoA-esters, which are then further incorporated into triacylglycerides (oil). The analysis of the acylCoA-pool reveals the formation and flux of the elongation reaction.
[0127]
[0128] The massive occurrence of 20:2n-6-CoA proves the expression of d9Elo(Eh) as this is the direct product of its enzymatic activity.
[0129] Further, transgenic Arabidopsis lines have been generated to validate the activity of d8Des(Eh) and d5Des(Eh). Vector AP2 has been constructed according to standard molecular biology steps as described in WO2003/093482, WO2005/083093, WO2007/093776 or WO2009/016202 and transformed into Arabidopsis thaliana as described above. Analysis of transgenic seeds is shown in
[0130] Further, transgenic Arabidopsis lines have been generated to validate the activity of d4Des(Eh). Construct OstELO5EmD4 was transformed into Arabidopsis as described above and seeds of a number of individual lines have been analyzed by gas chromatography (
[0131] Further, transgenic Arabidopsis lines have been generated to validate the activity of d5Elo(Eh). Construct EmELO5TcD4 was transformed into Arabidopsis as described above and seeds of a number of individual lines have been analyzed by gas chromatography (
[0132] Further, transgenic Arabidopsis lines have been generated to validate the activity and substrate specificity of d5Des(Eh). For this purpose two 6-desaturases were selected based on their different substrate specificity. The borage6 is expected to use phosphatidylcholin-18:2 as substrate (WO96/21022), whereas the Ostreococcus 6 (Ostr6) uses Acyl-CoA ester (WO2005/012316). In combination with the d6-elongase from Physcomitrella patens (WO2001/059128) both d6-desaturases produce DGLA or 20:4n-3, respectively. The ratio of ARA to EPA is for the borage6 2.9, for the Ostr6 2.3. It is noted that the use of Ostr6 results in 3-4 times higher levels of products compared to the borage6. The further combination of the d5Des(Eh) resulted in the production of ARA and EPA, demonstrating the functionality of the d5Des(Eh). The conversion of d5Des(Eh) of DGLA to ARA is 29% (borage6) or 47% (Ostr6). For 20:4n-3 to EPA it is 33% (borage6) or 26% (Ostr6).
[0133] Based on these results it is concluded that for Acyl-CoA substrates d5Des(Eh) is specific for the omega6 fatty acid DGLA. This is a novel substrate specificity not observed in the state of the art d5-desaturases.
REFERENCE LIST
[0134] Arondel, V., Lemieux, B., Hwang, I., Gibson, S., Goodman, H. M., and Somerville, C. R. (1992). Map-based cloning of a gene controlling omega-3 fatty acid desaturation in Arabidopsis. Science 258, 1353-1355. [0135] Broadwater, J. A., Whittle, E., and Shanklin, J. (2002). Desaturation and hydroxylation. Residues 148 and 324 of Arabidopsis FAD2, in addition to substrate chain length, exert a major influence in partitioning of catalytic specificity. J. Biol. Chem. 277, 15613-15620. [0136] Broun, P., Shanklin, J., Whittle, E., and Somerville, C. (1998b). Catalytic plasticity of fatty acid modification enzymes underlying chemical diversity of plant lipids. Science 282, 1315-1317. [0137] Calvo, A. M., Gardner, H. W., and Keller, N. P. (2001). Genetic connection between fatty acid metabolism and sporulation in Aspergillus nidulans. J. Biol. Chem. 276, 25766-25774. [0138] Knutzon, D. S., Thurmond, J. M., Huang, Y. S., Chaudhary, S., Bobik, E. G., Jr., Chan, G. M., Kirchner, S. J., and Mukerji, P. (1998). Identification of Delta5-dehydratase from Mortierella alpina by heterologous expression in Bakers' yeast and canola. J. Biol. Chem. 273, 29360-29366. [0139] Mantle, P. G. and Nisbet, L. J. (1976). Differentiation of Claviceps purpurea in axenic culture. J. Gen. Microbiol. 93, 321-334. [0140] Mey, G., Oeser, B., Lebrun, M. H., and Tudzynski, P. (2002). The biotrophic, non-appressorium-forming grass pathogen Claviceps purpurea needs a Fus3/Pmk1 homologous mitogen-activated protein kinase for colonization of rye ovarian tissue. Mol. Plant Microbe Interact. 15, 303-312. [0141] Okuley, J., Lightner, J., Feldmann, K., Yadav, N., Lark, E., and Browse, J. (1994). Arabidopsis FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid synthesis. Plant Cell 6, 147-158. [0142] Qi, B., Fraser, T., Mugford, S., Dobson, G., Sayanova, O., Butler, J., Napier, J. A., Stobart, A. K., and Lazarus, C. M. (2004). Production of very long chain polyunsaturated omega-3 and omega-6 fatty acids in plants. Nat. Biotechnol. 22, 739-745. [0143] Qiu, X., Hong, H., and McKenzie, SL. (2001) Identification of a Delta 4 fatty acid desaturase from Thraustochytrium sp. involved in the biosynthesis of docosahexanoic acid by heterologous expression in Saccharomyces cerevisiae and Brassica juncea. J Biol Chem 276, 31561-6. [0144] Shanklin, J. and Cahoon, E. B. (1998). DESATURATION AND RELATED MODIFICATIONS OF FATTY ACIDS1. Annu. Rev. Plant Physiol Plant Mol. Biol. 49, 611-641. [0145] Tudzynski, P., Correia, T., and Keller, U. (2001). Biotechnology and genetics of ergot alkaloids. Appl. Microbiol. Biotechnol. 57, 593-605.
[0146] All references cited in this specification are herewith incorporated by reference with respect to their entire disclosure content and the disclosure content specifically mentioned in this specification.