COMPOSITION FOR TREATMENT AND/OR NUTRITION OF POULTRY

Abstract

A composition for the treatment and/or nutrition of poultry such as broiler chickens is disclosed as comprising (i) one more probiotics which are commensal selected from one or more of Bifidobacterium animalis, Collinsella tanakaei, Lactobacillus reuteri, Anaerostipes, Lactobacillus crispatus, Pediococcus acidilactici, Lactobacillus pontis, Faecalibacterium prausnitzii, Coprococcus catus, Roseburia intestinalis, Anaerostipes butyraticus, Butyricicoccus, Lactobacillus johnsonii, and Ruminococcus sp.; and (ii) a prebiotic material. The application also discloses the use of such a composition for the treatment of enteric disease in poultry, such as necrotic enteritis.

Claims

1.-19. (canceled)

20. A composition comprising: (i) a probiotic selected from one or more of the bacteria Bifidobacterium animalis, Collinsella tanakaei, Lactobacillus reuteri, Anaerostipes, Lactobacillus crispatus, Pediococcus acidilactici, Lactobacillus pontis, Faecalibacterium prausnitzii, Coprococcus catus, Roseburia intestinalis, Anaerostipes butyraticus, Butyricicoccus, Lactobacillus johnsonii, and Ruminococcus sp. wherein the one or more bacteria are selected from Bifidobacterium animalis subsp. lactis str. V9, Collinsella tanakaei str. YIT 12064, Lactobacillus reuteri str. BCS136, Anaerostipes sp. str. 35-7, Lactobacillus crispatus str. ST1, Lactobacillus crispatus str. DC21, Lactobacillus crispatus str. DC21.1 (NCIMB 42771), Lactobacillus johnsonii DC22.2 (NCIMB 42772), Lactobacillus reuteri DC1B4 (NCIMB 42773), and Ruminococcus sp. DC3A4 (NCIMB 42774); and (ii) a prebiotic material.

21. A composition according to claim 20, wherein the composition comprises two or more probiotics.

22. A composition according to claim 21, wherein the composition comprises two or more probiotics in combination with only one prebiotic material.

23. A composition according to claim 22 wherein a first probiotic is taken from a group comprising specific facultative anaerobic commensal bacteria, and a second probiotic is taken from a group comprising specific strictly anaerobic commensal bacteria.

24. A composition according to claim 20, wherein the prebiotic material is substantially indigestible in the gastrointestinal system of a chicken.

25. A composition according to claim 20, wherein the prebiotic material is a polymeric saccharide.

26. A composition according to claim 25, wherein the polymeric saccharide is an oligosaccharide.

27. A composition according to claim 25, wherein the polymeric saccharide is selected from one or more of fructo-oligosaccharide, isomaltooligosaccharide, mannanoligosaccharide, galactooligosaccharide, xylo-oligosaccharide, arabinoxylo-oligosaccharide, glucooligosaccharide, soyoligosaccharide, pectic oligosaccharide, and inulin.

28. A composition according to claim 20, further comprising a nutrient food source.

29. A composition according to claim 28, wherein the nutrient food source is a source of protein, starch, amino acids, fat, or a combination of any one or more thereof.

30. A composition according to claim 20, wherein the composition is a starter feed or grower feed.

31. A composition according to 30, wherein the starter feed comprises a prebiotic in an amount between 55% to 95% (w/w) solids concentration syrup.

32. A composition according to claim 30, wherein the starter feed comprises a prebiotic added at a dose rate between 0.50% to 5.00% (w/w complete starter feed).

33. A composition according to claim 30, wherein the grower feed comprises a prebiotic in an amount between 55% to 95% (w/w) solids concentration syrup.

34. A composition according to claim 30, wherein the grower feed comprises a prebiotic added at a dose rate between 0.20% to 5.00% (w/w complete grower feed).

35. A composition according to claim 20 for use in the treatment of enteric bacterial disease in poultry.

36. A composition according to claim 35, wherein the enteric bacterial disease is infection by one or more of the following: Clostridium perfringens, Salmonella spp, pathogenic and toxigenic Escherichia coli (EPEC and ETEC).

37. A method of producing a composition according to claim 20.

Description

DETAILED DESCRIPTION

[0073] According to one embodiment of the invention, the composition may comprise two or more probiotics. For example, a first probiotic preparation may be taken from a group comprising specific facultative anaerobic commensal bacteria, for example Lactobacillus spp. and Bifidobacterium spp., which produce acetate and lactate when acting on a prebiotic, and a second probiotic preparation may be taken from a group comprising specific strictly anaerobic commensal bacteria which produce butyrate feeding on the acetate and lactate produced by the probiotic preparation of the first group. A probiotic preparation is considered to comprise one or more probiotic bacteria taken from the respective facultative anaerobic or strictly anaerobic group.

[0074] According to another embodiment of the invention, the composition may comprise the two or more probiotics in combination with only one prebiotic material. An example of a potential combination of a composition according to this embodiment may be a first probiotic, for example Lactobacillus spp. or Bifidobacterium spp., taken from a group comprising specific facultative anaerobic commensal bacteria which produce acetate and lactate when acting on the prebiotic, and a second probiotic taken from a group comprising specific strictly anaerobic commensal bacteria which produce butyrate feeding on the acetate and lactate produced by the first probiotic, in combination with a prebiotic, for example, Nutrabiotic GOS.

[0075] The bacteria array comprise facultative anaerobic bacteria or strictly anaerobic bacteria

[0076] According to another embodiment of the invention, the composition may comprise facultative anaerobic bacteria in combination with a prebiotic. The combination may create acetate and lactate.

[0077] According to another embodiment of the invention, the composition may comprise strictly anaerobic bacteria in combination with acetate and lactate. The combination may create organic acids. The organic acids may be, for example, butyrate.

[0078] The prebiotic material used in the composition of the invention is typically substantially indigestible in the gastrointestinal system of a chicken.

[0079] Another aspect of the present invention was to identify specific probiotics which respond favourably to the use of polymeric saccharide, such as an oligosaccharide sugar, as a prebiotic material; and whose populations with the broiler gastrointestinal tract can, therefore, be increased by the use of such prebiotics. Therefore, the prebiotic material is typically a polymeric saccharide, such as an oligosaccharide.

[0080] The oligosaccharide used in the composition of the invention may be selected from one or more of fructooligosaccharide (also known as oligofructose) which is a partial hydrolysate of inulin, mannanoligosaccharide (MOS), galactooligosaccharide (GOS), xylooligosaccharide, arabinoxylanoligosaccharide, soyoligosaccharide, lactulose, lactosucrose, isomalto-oligosaccharides, gluco-oligosaccharides, pectic oligosaccharides, and inulin. Typically, the oligosaccharide is a galactooligosaccharide.

[0081] Galactooligosaccharides (GOS) have the general form (galactosyl).sub.n-lactose and typically range in size from trisaccharides to octasaccharides. Structural complexity is introduced by the different intermolecular bonds. Products said to comprise GOS therefore typically contain a mixture of galactooligosaccharides, lactose, glucose and galactose, and the term GOS is used herein in a manner intended to encompass such products.

[0082] GOS (galacto-oligosaccharide) is sold by Dairy Crest under the trade name Nutrabiotic GOS for animal feed.

[0083] Typically, Nutrabiotic GOS L is used as the prebiotic in the composition of the present invention. Nutrabiotic GOS L complies with UK and EU Regulations and recommended purity specifications, including heavy metals, for feed and food ingredients. An analysis of Nutrabiotic GOS L is provided in Table 21.

[0084] The recommended inclusion, or dose, rate of Nutrabiotic GOS in animal feed diets depends on a number of factors. For example: [0085] the animal (e.g. broiler (chicken for fattening) or piglet); [0086] life cycle and the feeding regime (e.g. the different feeds being used and the duration of their use; use, and commencement of use, of a creep (pre-starter) feed; age of piglets at weaning etc.); [0087] formulation of the Nutrabiotic GOS product and, to a lesser extent, the batch of the Nutrabiotic GOS product being used.

[0088] The data presented in Table 22 are recommendations based on typical feeding regimes and ones that have been used in both research and commercial trials. They can be modified as required.

[0089] The data presented in Table 24 provides an estimate of the metabolizable energy values of Nutrabiotic GOS L in broilers and piglets.

[0090] Nutrabiotic GOS contains no significant quantities of protein or fat, or vitamins, minerals etc. as shown in Table 21. Nutrabiotic GOS contains a range of carbohydrates that

[0091] are either digested as sugars, or fermented as soluble fibre. In the context of energy value for animal feed applications and specific animals, the definition of what is considered fibre is

[0092] complicated as an appreciable number of disaccharides present in Nutrabiotic GOS L are

[0093] fermented. Moreover the proportion of disaccharides that are fermented will differ depending on the animal (e.g. piglets compared to poultry).

[0094] Starter, grower and finisher refer to the diets at the different stages of the broiler production cycle. The diets correspond to the following periods (day 0 is defined as the day the broiler chicks are placed in the poultry shed, although at day 0 the broiler chicks are usually 1 day old):

TABLE-US-00001 0-10 days Starter feed (sieved crumb, but can alternatively be in the form of a mash feed) 11-24 days Grower feed (pellets 3 mm diam.) 25-35 days Finisher feed (pellets 3 mm diam.)

[0095] The feeds, after the mixing of all the raw materials are pelleted (after steam injection and treatment) are extruded through a defined die to typically give a 3 mm pellet, that is the final broiler feed.

[0096] The pelleting process may follow typical methods known to a person skilled in

[0097] Suitable feed and pellet size may be known to a person skilled in the art.

[0098] Crumb refers to a crumbed (broken into crumb) pelleted feedtypically to give smaller feed pieces that the broiler chicks can manage. A mash feed (a feed mixture that has not been pelleted) may be used instead of a crumb feed for the started feed.

[0099] The production cycle in this example is 35 days, which is reasonably common for experiments involving male (we only use the faster growing males to decrease the statistical variation in experimental systems) Ross 308 birds. Poultry cycles are more complex with birds being harvested at 35-42 days to get different weight ranges for commercial purposes.

[0100] Typically, the production cycle is 35 days, which is reasonably common for experiments involving male Aviagen Ross 308 birds, as typically used in the present invention.

[0101] The composition of the invention typically includes an amount of between about 10.sup.4 colony forming units (cfu) to 10.sup.12 cfu, typically between about 10.sup.5 cfu to 10.sup.10 cfu, more typically between about 10.sup.6 cfu to 10.sup.8 cfu and most typically 10.sup.7 cfu. CFU is essentially the number of live bacteria added at day 9 of a trial. Preferably, the addition of CFU should not preclude the probiotic being added at different times, or continuously, as part of the feed, in a commercial operation.

[0102] The composition of the invention includes a prebiotic, typically Nutrabiotic GOS.

[0103] Typically, a starter feed includes an amount of prebiotic, for example Nutrabiotic GOS, between about 55% to 95% (w/w) solids concentration syrup, typically between about 65% to 85% (w/w) solids concentration syrup, more typically between about 70% to 80% (w/w) solids concentration syrup, and most typically about 75% (w/w) solids concentration syrup.

[0104] Typically, in the starter feed the prebiotic, for example Nutrabiotic GOS, is added at a dose rate between about 0.50% to 5.00% (w/w complete starter feed), typically between about 1.50% to 3.50% (w/w complete starter feed), more typically between about 2.00% to 3.00%, even more typically between about 2.20% to 2.60% (w/w complete starter feed), even more typically between about 2.40% to 2.50%, and most typically about 2.47% (w/w complete starter feed).

[0105] Typically, a grower feed includes an amount of prebiotic, for example Nutrabiotic GOS, between about 55% to 95% (w/w) solids concentration syrup, typically, between about 65% to 85% (w/w) solids concentration syrup, more typically between about 70% to 80% (w/w) solids concentration syrup, and most typically about 75% (w/w) solids concentration syrup.

[0106] Typically, in the grower feed the prebiotic, for example Nutrabiotic GOS, is added at a dose rate between about 0.20% to 5.00% (w/w complete grower feed), typically between about 0.60% to 3.50% (w/w complete grower feed), more typically between about 0.90% to 2.80%, even more typically between about 1.10% to 2.00% (w/w complete grower feed), even more typically between about 1.15% to 1.60%, even more typically between about 1,20% to 1,40%, and most typically about 1.24% (w/w complete grower feed).

[0107] Typically, the prebiotic, for example, Nutrabiotic GOS, is not added to the finisher feed.

[0108] In a typical trial experiment, the addition of the bacteria is typically made in 0.10 ml of MRD (Maximum Recovery Diluent), giving 10.sup.7 cfu (colony forming units) or viable cells, by cloacal gavage.

[0109] A further aspect of the present invention relaxes to a composition as defined hereinabove for the treatment and/or nutrition of poultry, such as broiler chickens, to which at least one of the probiotics responds to produce an increase in population.

[0110] The composition of the invention may also further comprise a nutrient food source. The nutrient food source may contain a source of protein, starch, amino acids, fat, or a combination of any two or more thereof. The nutrient food source may also contain one or more food additives which can be found in poultry feed, such as, but not limited to, vaccines, antibiotics, and coccidiostats, or a combination thereof. The antibiotics may be those used in treatment or as growth promoters.

[0111] The composition of the invention, containing the probiotic bacteria which are responsive to the probiotics, and whose presence correlates with improved broiler performance, is able to impart benefits to the development of the poultry compared with poultry which is not exposed to the composition, such as an increased rate of growth, and/or a higher final weight, and/or a larger ratio of kilograms of feed required per kilogram of growth of the poultry.

[0112] The inventors have been able to show that gastrointestinal populations of the probiotic bacteria respond to the administration of probiotics, such as oligosaccharides; and that increases in populations of one or more of the probiotic bacteria correlate to improved weight within broilers.

[0113] Also provided by the present invention is a composition for use in the treatment of enteric bacterial disease in poultry, the composition comprising: [0114] (i) a probiotic selected from one or more of the bacteria Bifidobacterium animalis, Collinsella tanakaei, Lactobacillus reuteri, Anaerostipes, Lactobacillus crispatus, Pediococcus acidilactici, Lactobacillus pontis, Faecalibacterium prausnitzii, Coprococcus catus, Roseburia intestinalis, Anaerostipes butyraticus, Butyricicoccus, Lactobacillus johnsonii, and Ruminococcus sp.; and [0115] (ii) a prebiotic material.

[0116] The definitions and embodiments defined above for the composition of the invention also apply to the composition for use in the treatment of enteric bacterial disease in poultry.

[0117] The enteric bacterial disease is infection by one or more of the following: Clostridium perfringens, Salmonella spp, pathogenic and toxigenic Escherichia coli (EPEC and ETEC).

[0118] The composition of the invention may be administered in any suitable manner, including, but not limited to, orally (via feed, which may need to be encapsulated in order to protect the probiotic from the acidic environment in a chicken's stomach), via intracloacal delivery (Arsi, Donoghue, Woo-Ming, Blore and Donoghue: Intracloacal Inoculation, an Effective Screening Method for Determining the Efficacy of Probiotic Bacterial Isolates against Campylobacter Colonisation in Broiler Chickens, Journal of Food Protection, Vol 78, No. 1 2015, Pages 209-213), or via a spray, such as onto chicks so they consume the composition by licking their feathers.

[0119] A further aspect of the present invention is a composition for the treatment and/or nutrition of poultry, such as a broiler chicken, comprising one or more specific probiotics and a prebiotic material which produce organic acids in the gastrointestinal tract, which impart benefits to the health of the broiler chickens.

[0120] All of the probiotics listed hereinabove are able to act in an strictly anaerobic manner, while some are also able to act in a facultative anaerobic manner.

[0121] It is those (e.g. Lactobacillus spp. and Bifidobacterium spp.) which act in a facultative anaerobic manner which produce organic acids, such as acetic and lactic acids, in the gastrointestinal tract such as acetic and lactic acids, when fermenting the prebiotic. The probiotics which are strict anaerobes, produce butyrate and other organic acids when supplied with a prebiotic and the acetate and lactate. These probiotics include, for example, Coprococcus catus, Roseburia intestinalis, and Anaerostipes butyraticus, Ruminococcus sp., Butyricicoccus, and Faecalibacterium prausnitzii.

[0122] These bacteria are known to feed upon fibre in the gastrointestinal act of a broiler chicken. That feeding process generates the organic acids which are beneficial in at least two ways. Firstly, they reduce the pH within the tract which, generally speaking, tends to assist the growth of beneficial gut flora whilst simultaneously inhibiting the growth of more harmful flora. Secondly, the acids are directly beneficial per se as nutrients to the broiler and so the presence of one or more of these bacteria produces useable sources of energy.

[0123] The probiotics used in the invention serve the additional benefit of reducing populations of harmful gut flora. Examples of such harmful flora are Clostridium perfringens which is known to cause necrotic enteritis, and Salmonella whose presence is extremely harmful to humans and so desirably eliminated from broilers.

[0124] Although one or more of the compositions set out above can be used to treat, for example, the presence of undesirable gut flora in broiler chickens, they may advantageously also be used in feed compositions for prophylactic purposes.

[0125] The invention will now be described further by way of example with reference to the following examples, which are intended to be illustrative only and in no way limiting upon the scope of the invention.

EXAMPLES

[0126] An example of a trial experiment using the composition of the invention included the following: [0127] prebiotic (Nutrabiotic (EOS) at the following dose rates: [0128] starter feed: Nutrabiotic GOS a 75% (w/w) solids concentration syrup added at a dose rate of 2.47% (w/w complete starter feed) [0129] grower feed: Nutrabiotic GOS a 75% (w/w) solids concentration syrup added at a dose rate of 1.235% (w/w complete grower feed) [0130] finisher feed: Nutrabiotic GOS is not added to the finisher feed; [0131] Single addition of a probiotic preparation of 10.sup.7 cfu, added at day 9 of the trial. Addition was made in 0.10 ml of MRD (Maximum Recovery Diluent) by cloacal gavage. This method of addition was solely for the purpose to ensure proof of concept. It is not envisaged that this method of addition would be used in a production environment.

[0132] Table 1 provides a list of the ingredients in a commercially available poultry feed mixture, with which the composition of the invention may be combined for administration to the poultry.

TABLE-US-00002 TABLE 1 CONTROL: CONTROL: CONTROL: ROSS 308 BROILER ROSS 308 BROILER ROSS 308 BROILER RM Name 2015 - STARTER 2015 - GROWER 2015 - FINISHER WHEAT 59.999 60.716 66.319 EXT. HIPRO SOYA 32.5 30.8 25.3 MEAL LIMESTONE 0.60 0.40 0.40 GRANULES SOYABEAN OIL 3.65 5.52 5.60 LYSINE HCL 0.296 0.119 0.123 METHIONINE DL 0.362 0.263 0.231 DICALCIUM 1.59 1.28 1.12 PHOSPHATE SODIUM 0.269 0.188 0.193 BICARBONATE SALT 0.150 0.210 0.210 THREONINE 0.134 0.054 0.054 TM - Blank Premix for 0.400 0.400 0.400 Broiler Formulation RONOZYME P5000 0.030 0.030 0.030 (CT) Ronozyme WX (Xyl) 0.020 0.020 0.020 Key RMRaw material Ext. Hipro Soya MealExtruded Hipro soya meal (and extruded high protein soybean meal) Lysine HCl(lysine hydrochloride) and Methionine DL (a racemic mixture of the methionine D and L isomers) amino acids Threonine - an amino acid Dicalcium phosphate, sodium bicarbonate, and salt (sodium chloride) are commonly used nutrients TM - Blank Premix for Broiler Formulation is the premix of vitamins and trace elements listed in Table 2. Ronozyme P5000 (CT) and Ronozyme WX (Xyl) are commercial names for enzymes that are commonly used in wheat-based feeds, specifically: Ronozyme P5000 (CT) is a coated phytase enzyme Ronozyme WX is a xylanase

[0133] Reference is also made to Aviagen Ross 308 Broiler Nutrition Specifications 2014 documentation as examples of broiler diets

[0134] Table 2 provides the details of the TM Blank Premix for Broiler Formation listed in the ingredients in Table 1.

TABLE-US-00003 TABLE 2 Nutrient Analysis USAGE 4.0000 VIT A 13.5000 VIT D3 5.0000 VIT E 100.0000 VIT B1 3.0000 VIT B2 10.0000 VIT B6 3.0000 VIT B12 30.0000 HETRA 5.0000 NICO 60.0000 PANTO 15.0000 FOLIC 1.5000 BIOTIN 251.0000 CHOLCHL 250.0000 FE 20.0000 MN 100.0000 CU 10.0000 ZN 80.0000 I 1.0000 SE 0.2500 MO 0.5000 *CA/USA 24.9103 *ASH/USA 74.3901

[0135] Tables 3-8 provide information regarding a trial experiment (Trial 1) carried out by the Applicant. Trial 1 concerned the performance and the up-regulation of certain commensal bacteria in GOS test treatments.

Trial 1

Trial Design, Measures and Analysis

[0136] Objective(s): Indicate optimum % (w/w) inclusion rate of galacto-oligosaccharides reduce and vary the galacto-oligosaccharides % (w/w) inclusion rate in the different feed periods over the lifetime of the bird. The initial objective of the trial was to investigate the effect of Nutrabiotic GOS L on the broiler microbiota by NGS and metagenomic analysis (along with analyses of gut morphology and changes in immune function response). [0137] Samples for the analysis of gut morphology are stored in formaldehyde awaiting analysis. [0138] Results from NGS and metagenomic analysis of the caecal microbiota, along with changes in immune function response (as determined through the up/down regulation of cytokines and chemokines) will be available in the coming weeks. [0139] Product: Nutrabiotic GOS La GOS 50% syrup containing approximately 72% (w/w) dry solids [0140] Base diet: wheat-based (xylanase and phytase included), no coccidiostat [0141] Type of bird: male Ross 308 (good chicks from strong 35 week old breeders) [0142] Number of treatments: 1control+5GOS tests

Quality Control

[0143] Feed screened for Salmonella prior to arrival of birds to ensure no contamination at feed mill. [0144] Birds screened on arrival for Salmonella and during the trial for both Campylobacter and Salmonella.
Relevant facts/observations

[0145] General [0146] Bird health was good with one bird suffering from hip dislocation and another suffering from sudden death. No comments were received concerning gut lesions.

[0147] Performance [0148] Nutrabiotic GOS L improved performance in terms of rate of weight gain with overall the best performance appearing to be for the higher GOS inclusion rate being fed throughout the growth period (P<0.05). These improvements are maintained in the Test treatments. [0149] The confidence intervals of the weight data are quite wide, especially when sample numbers are decreased. [0150] It appears Nutrabiotic GOS L improves FCR for all treatments.

[0151] Standard Microbiological Analyses [0152] Standard microbiological methods were used to analyse on caecal samples, by standard microbiological methods: [0153] Campylobacter counts (CCDA plates, micro-aerobic incubation at 42 C. for 48 h, using the Miles and Misra method); [0154] lactic bacteria counts (MRS plates, anaerobic incubation at 30 C. for 48 h); [0155] coliform counts (MacConkey no. 3 plates, incubation at 37 C. for 24 h).

[0156] Microbiota Analyses [0157] DNA was extracted from the caecal microbiota, targeted amplicon sequencing was employed using 16S RDNA (the gene for bacterial 16S rRNA) as a marker and molecular phylogenetic methods (amplification, sequencing, grouping sequences into OTUs, and the identification of OTUs) are used to infer the composition of the microbial community. [0158] Alpha-diversity (number or richness) of taxa were quantified by the Simpson Index for each treatment with good precision (as shown by asymptotic rarefaction curves) and showed no difference between each treatment, as was expected. [0159] Beta-diversity, which describes how many taxa are shared between treatments (a similarity score and represented by the Yue and Clayton theta similarity coefficient), gave different results: [0160] there was a significant difference (P<0.0010) was found between the GOS[+] and GOS[] groups (taken as a whole); [0161] other measures, including AMOVA (analysis of molecular variance) confirmed these significant differences with the magnitude of the diversity being: GOS 3.37%>GOS 1.685%>control with corresponding significance: (GOS 3.37%GOS 1.685%)>(GOS 1.685%control); [0162] graphical representation of dissimilarities were shown as non-metric multidimensional scaling plots based on dissimilarity matrices built from the Yue and Clayton theta coefficients. [0163] Metastats (White et al., 2009) was used to determine whether there are any OTUs that are differentially represented between the different treatments: [0164] between the GOS[+] and GOS[] groups (taken as a whole) 42 OTUs were identified as significant.

[0165] Subsequent Bioinformatics Analyses

[0166] The major different OTUs in GOS[+] and GOS[] groups have been identified, with the following candidate organisms identified as being GOS responsive. Identification was based on OTUs identified from 16S rDNA sequences from the V4 region of the microbiome. It is not possible to obtain more information of exact bacterial subspecies, and in some cases species, without a more complete analysis of the specific bacterial genome. The identification provided represents the nearest match from the SILVA rRNA database (16S rRNA gene sequences were aligned against a reference alignment based on the SILVA rRNA database and clustered into operational taxonomic units (OTUs) with an average neighbor clustering algorithm. The nearest 16S rRNA gene sequence identities to the OTUs are reported on the basis of BLASTn searches if data matches are from type cultures with a BLAST identity 99%): [0167] Bifidobacterium animalis subsp. lactis str. V9 [0168] Collinsella tanakaei str. YIT 12064 [0169] Ruminococcus torques str. ATCC 27756 [0170] Lactobacillus reuteri str. BCS136 [0171] Anaerostipes sp. str. 35-7 [0172] Lactobacillus crispatus str. ST1 [0173] Pediococcus acidilactici [0174] Faecalibacterium prausnitzii

[0175] Conclusions

[0176] In conclusion it was shown that: [0177] there was an improvement in performance data, against the control, was seen in test treatments containing Nutrabiotic GOS Syrup, particularly at the higher dose rate of 3.37% (w/w); [0178] there was no significant difference between the richness of taxa (alpha-diversity) for each treatment, which is to be expected; [0179] there was a significant different between the number of taxa shared between between groups (beta-diversity) based on the inclusion of GOS in the diet. this allowed identification of bacteria that were responsive to Nutrabiotic GOS.

[0180] Table 3 provides a list of ingredients used in a poultry feed as part of Trial 1

TABLE-US-00004 TABLE 3 GOS GOS CONTROL: CONTROL: CONTROL: 3.370%: 3.370%: ROSS ROSS ROSS ROSS ROSS 308 308 308 308 308 BROILER BROILER BROILER BROILER BROILER 2015 - 2015 - 2015 - 2015 - 2015 - STARTER GROWER FINISHER STARTER GROWER 2 WHEAT 59.999 60.716 66.319 54.016 54.723 54 EXT. HIPRO SOYA 32.5 30.8 25.3 33.9 32.2 MEAL 60 LIMESTONE 0.60 0.40 0.40 0.60 0.40 GRANULES 69 SOYABEAN OIL 3.65 5.52 5.60 4.88 6.76 106 LYSINE HCL 0.296 0.119 0.123 0.264 0.087 107 METHIONINE DL 0.362 0.263 0.231 0.366 0.267 110 DICALCIUM 1.59 1.28 1.12 1.61 1.30 PHOSPHATE 126 SODIUM 0.269 0.188 0.193 0.249 0.169 BICARBONATE 273 SALT 0.150 0.210 0.210 0.170 0.230 275 THREONINE 0.134 0.054 0.054 0.125 0.044 TMBLANK TM - Blank Premix 0.400 0.400 0.400 0.400 0.400 for Broiler Formulation TM_PROMOV NUTRABIOTIC 0.000 0.000 0.000 3.370 3.370 GOS SYRUP TM_RONO_P5 RONOZYME 0.030 0.030 0.030 0.030 0.030 P5000 (CT) TM_RONO_WX Ronozyme WX 0.020 0.020 0.020 0.020 0.020 (Xyl) Specification [VOLUME] 100 100 100 100 100 Dry matter 88.105 88.189 88.066 87.705 87.790 Oil B 5.707 7.526 7.566 6.844 8.672 Crude Protein (CP) 22.002 21.004 19.019 21.991 20.990 (%) Fibre (%) 2.775 2.745 2.749 2.637 2.608 Ash (%) 5.808 5.236 4.858 5.810 5.239 Lysine (%) 1.430 1.240 1.091 1.429 1.239 Methionine (%) 0.691 0.582 0.521 0.695 0.586 Methionine + 1.070 0.950 0.861 1.070 0.950 Cystine (M + C) (%) Tryptophan (%) 0.270 0.261 0.235 0.271 0.262 Theonine (%) 0.940 0.830 0.741 0.940 0.829 Calcium (%) 1.047 0.886 0.834 1.052 0.892 Total Phosphorus 0.677 0.613 0.565 0.672 0.607 (T:PHOS) (%) Available 0.500 0.450 0.420 0.500 0.450 Phosphorus (A:PHOS) (%) Salt (%) 0.319 0.322 0.326 0.323 0.326 Sodium (%) 0.158 0.160 0.161 0.160 0.162 Linoleic acid (%) 2.318 3.251 3.302 2.903 3.840 Potassium (%) 0.955 0.920 0.822 0.962 0.927 Chloride (%) 0.198 0.200 0.201 0.201 0.202 Broiler ME inc. 12.652 13.204 13.403 12.649 13.203 enzyme contribution (MJ) Degussa poultry digestible amino acid values Lysine (%) 1.306 1.122 0.984 1.305 1.121 Methionine (%) 0.635 0.528 0.473 0.638 0.531 Methionine + 0.949 0.834 0.761 0.947 0.832 Cystine (M + C) (%) Theonine (%) 0.790 0.686 0.614 0.788 0.683 Tryptophan (%) 0.239 0.230 0.205 0.240 0.232 Isoleucine (%) 0.814 0.785 0.703 0.820 0.790 Valine (%) 0.874 0.843 0.759 0.877 0.847 Histidine (%) 0.496 0.479 0.429 0.499 0.481 Arginine (%) 1.275 1.225 1.077 1.293 1.243 GOS GOS GOS GOS 3.370%: 1.685%: 1.685%: 1.685%: ROSS ROSS ROSS ROSS 308 308 308 308 BROILER BROILER BROILER BROILER 2015 - 2015 - 2015 - 2015 - FINISHER STARTER GROWER FINISHER 2 WHEAT 60.337 57.003 57.719 63.324 54 EXT. HIPRO SOYA 26.7 33.2 31.5 26.0 MEAL 60 LIMESTONE 0.40 0.60 0.40 0.40 GRANULES 69 SOYABEAN OIL 6.84 4.27 6.14 6.22 106 LYSINE HCL 0.092 0.280 0.103 0.107 107 METHIONINE DL 0.234 0.364 0.265 0.232 110 DICALCIUM 1.14 1.60 1.29 1.13 PHOSPHATE 126 SODIUM 0.173 0.259 0.179 0.183 BICARBONATE 273 SALT 0.220 0.160 0.220 0.220 275 THREONINE 0.044 0.129 0.049 0.049 TMBLANK TM - Blank Premix 0.400 0.400 0.400 0.400 for Broiler Formulation TM_PROMOV NUTRABIOTIC 3.370 1.685 1.685 1.685 GOS SYRUP TM_RONO_P5 RONOZYME 0.030 0.030 0.030 0.030 P5000 (CT) TM_RONO_WX Ronozyme WX 0.020 0.020 0.020 0.020 (Xyl) Specification [VOLUME] 100 100 100 100 Dry matter 87.667 87.905 87.990 87.867 Oil B 8.713 6.280 8.099 8.139 Crude Protein (CP) 19.008 21.995 20.997 19.012 (%) Fibre (%) 2.611 2.706 2.677 2.680 Ash (%) 4.850 5.809 5.238 4.859 Lysine (%) 1.091 1.429 1.239 1.091 Methionine (%) 0.524 0.693 0.584 0.522 Methionine + 0.860 1.070 0.950 0.860 Cystine (M + C) (%) Tryptophan (%) 0.236 0.270 0.261 0.235 Theonine (%) 0.740 0.939 0.830 0.740 Calcium (%) 0.839 1.050 0.889 0.836 Total Phosphorus 0.560 0.675 0.610 0.562 (T:PHOS) (%) Available 0.420 0.500 0.450 0.420 Phosphorus (A:PHOS) (%) Salt (%) 0.321 0.321 0.324 0.328 Sodium (%) 0.159 0.159 0.161 0.162 Linoleic acid (%) 3.891 2.613 3.545 3.597 Potassium (%) 0.829 0.958 0.924 0.825 Chloride (%) 0.198 0.199 0.201 0.203 Broiler ME inc. 13.404 12.652 13.204 13.403 enzyme contribution (MJ) Degussa poultry digestible amino acid values Lysine (%) 0.984 1.306 1.122 0.984 Methionine (%) 0.475 0.636 0.529 0.474 Methionine + 0.757 0.948 0.833 0.759 Cystine (M + C) (%) Theonine (%) 0.611 0.788 0.684 0.613 Tryptophan (%) 0.207 0.240 0.231 0.206 Isoleucine (%) 0.708 0.817 0.788 0.705 Valine (%) 0.762 0.875 0.845 0.760 Histidine (%) 0.432 0.497 0.480 0.431 Arginine (%) 1.095 1.284 1.234 1.086

[0181] Table 4 provides a comparison of the difference speciation and Degussa poultry digestible amino acid values from Table 3

TABLE-US-00005 TABLE 4 Differences Control - GOS_3.370% Control - GOS_1.685% Specification diets diets [VOLUME] Starter Grower Finisher Starter Grower Finisher Dry matter 0.39934 0.39814 0.39946 0.19913 0.19901 0.199215 Oil B 1.13654 1.14624 1.14646 0.57313 0.57311 0.57315 Crude Protein (CP) (%) 0.011505 0.013285 0.01178 0.00659 0.006695 0.007075 Fibre (%) 0.13749 0.13779 0.13746 0.06888 0.06891 0.06885 Ash (%) 0.002628 0.003062 0.007266 0.00123 0.001832 0.00124 Lysine (%) 0.001166 0.001197 0.000373 0.000597 0.0006 0.000594 Methionine (%) 0.003729 0.003712 0.002741 0.001857 0.001855 0.000869 Methionine + Cystine (M + C) (%) 0.000328 0.000288 0.000658 0.000146 0.000142 0.00084 Tryptophan (%) 0.000921 0.000909 0.000922 0.000455 0.000454 0.000456 Theonine (%) 0.000161 0.000859 0.000826 0.000428 0.000431 0.000425 Calcium (%) 0.005708 0.005704 0.005709 0.002852 0.002852 0.002852 Total Phosphorus (T:PHOS) (%) 0.005249 0.005279 0.005246 0.002638 0.002641 0.002635 Available Phosphorus (A:PHOS) (%) 0.000123 0.000133 0.000122 6.6E05 6.7E05 6.5E05 Salt (%) 0.004309 0.004299 0.005271 0.00215 0.002149 0.002151 Sodium (%) 0.001888 0.002156 0.001982 0.000943 0.001213 0.000943 Linoleic acid (%) 0.584842 0.589782 0.589848 0.294894 0.294888 0.2949 Potassium (%) 0.006868 0.006828 0.006872 0.003416 0.003412 0.00342 Chloride (%) 0.002923 0.002916 0.002963 0.001459 0.001457 0.001459 Broiler ME inc. enzyme 0.002985 0.000741 0.000661 0.000305 0.000436 0.000379 contribution (MJ) Degussa poultry digestible amino acid values Lysine (%) 0.000829 0.000855 4.8E05 0.000426 0.000429 0.000423 Methionine (%) 0.00298 0.002964 0.001988 0.001484 0.001481 0.000491 Methionine + Cystine (M + C) (%) 0.002343 0.00238 0.003333 0.001188 0.001192 0.002178 Theonine (%) 0.002053 0.00307 0.003043 0.001534 0.001536 0.001532 Tryptophan (%) 0.001717 0.001707 0.001718 0.000854 0.000853 0.000855 Isoleucine (%) 0.0051 0.005064 0.005104 0.002535 0.00253 0.002538 Valine (%) 0.003368 0.003328 0.003372 0.001666 0.001662 0.00167 Histidine (%) 0.002517 0.002496 0.002519 0.001249 0.001247 0.001251 Arginine (%) 0.018093 0.01805 0.018097 0.009027 0.009023 0.009031

[0182] Table 5 provides a summary of the treatments used in Trial 1

TABLE-US-00006 TABLE 5 Group 1 Control starter 1 to 10 days Control grower 11 to 24 days Control finisher 25 to 35 days Group 2 3.37% (w/w) GOS starter 1 to 10 days Control feed grower 11 to 24 days Control feed finisher 25 to 35 days Group 3 3.37% (w/w) GOS starter 1 to 10 days 3.37% (w/w) GOS grower 11 to 24 days Control feed finisher 25 to 35 days Group 4 3.37% (w/w) GOS starter 1 to 10 days 3.37% (w/w) GOS grower 11 to 24 days 3.37% (w/w) GOS finisher 25 to 35 days Group 5 Control feed starter 1 to 10 days Control feed grower 11 to 24 days 3.37% (w/w) GOS finisher 25 to 35 days Group 6 1.685% (w/w) GOS starter 1 to 10 days 1.685% (w/w) GOS grower 11 to 24 days 1.685% (w/w) GOS finisher 25 to 35 days

[0183] Table 6 provides the weight (g) of the broilers used in Trial 1

TABLE-US-00007 TABLE 6 Weight (g) Group 0 8 15 22 28 35 Days G1 40.8 180.0 498.7 934.5 1411.5 2012.0 Total (g) mean 2.87 13.61 56.25 105.33 176.08 213.64 stdev G2 40.9 188.0 556.4 1032.9 1623.7 2270.7 Total (g) mean 2.85 13.76 61.16 138.65 168.04 253.01 stdev G3 40.9 190.1 531.6 1009.1 1554.1 2126.6 Total (g) mean 2.96 15.80 54.51 119.53 190.86 210.33 stdev G4 41.3 183.5 562.5 1030.5 1608.8 2360.8 Total (g) mean 2.88 14.97 64.93 120.45 155.29 144.36 stdev G5 40.2 185.2 517.0 923.1 1491.1 2197.5 Total (g) mean 2.71 20.25 58.53 127.35 165.93 344.96 stdev G6 40.5 187.9 526.2 974.8 1540.0 2173.5 Total (g) mean 3.14 22.36 57.52 119.99 170.21 216.79 stdev

[0184] Table 7 provides the feed consumption of the broilers used in Trial 1

TABLE-US-00008 TABLE 7 Feed consumption (g) Group 0 10 15 22 25 28 35 Days G1 230 273 657 411 453 1093 Total Interval (g) mean 12 39 86 70 109 117 stdev 230 503 1160 1571 2024 3117 Cumm. (g) G2 230 305 725 452 500 1209 Total Interval (g) mean 10 26 90 35 85 102 stdev 230 535 1260 1712 2212 3421 Cumm. (g) G3 236 270 713 415 468 1292 Total Interval (g) mean 13 33 82 62 92 71 stdev 236 506 1219 1634 2102 3394 Cumm. (g) G4 224 300 740 461 515 1356 Total Interval (g) mean 8 22 82 59 69 55 stdev 224 524 1264 1725 2240 3596 Cumm. (g) G5 222 289 717 428 495 1225 Total Interval (g) mean 12 32 84 58 93 105 stdev 222 511 1228 1656 2151 3376 Cumm. (g) G6 238 241 719 450 502 1188 Total Interval (g) mean 18 42 76 56 91 54 stdev 238 479 1198 1648 2150 3338 Cumm. (g)

[0185] Table 8 provides the cumulative feed consumption ratio of the broilers used in Trial 1

TABLE-US-00009 TABLE 8 Weight (g) Group 0 8 15 22 28 35 Days G1 0.890 1.000 1.240 1.434 1.549 Total G2 0.850 0.962 1.220 1.363 1.507 Total G3 0.870 0.953 1.210 1.353 1.596 Total G4 0.860 0.948 1.220 1.393 1.524 Total G5 0.850 0.990 1.330 1.442 1.537 Total G6 0.880 0.897 1.230 1.396 1.536 Total

[0186] Tables 9-20 provide information regarding a trial experiment (Trial 2) carried out by the Applicant. Trial 2 concerned the use of Lactobacillus crispatus DC21.1 (NCIMB 42771) as a probiotic

Trial 2

Objectives

[0187] To test the persistence and efficacy of Lactobacillus crispatus was provided as a probiotic to male Ross 308 broilers fed a standard wheat-based feed in the presence and absence of the galacto-oligosaccharide contain productNutrabiotic GOS.

Design

[0188] 4 treatments each containing 20-24 male Ross 308 broiler that were fed a standard wheat-based starter, grower and finisher feed. The feeds contained no antibiotic or coccidiostat products, but Nutrabiotic GOS and Lactobacillus crispatus DC21.1 (NCIMB 42771). Details of the feed are given below and in the associated files. The trial was carried out for 35 days, and the Lactobacillus crispatus was added on day 9 by cloacal gavage with 10.sup.7 cfu (viable cells) being administered in 0.10 ml MRD (maximum recovery diluent) from a syringe that had been preloaded in an anerobic cabinet.

TABLE-US-00010 Group 1: Pen 6 Nutrabiotic GOS Lactobacillus crispatus Group 2: Pen 7 Nutrabiotic GOS not added Group 3: Pen 8 not added not added Group 4: Pen 9 not added Lactobacillus crispatus

Results

[0189] There was only a single addition of the Lactobacillus crispatus was added on day 9 after bird placement. Persistence of the Lactobacillus crispatus was determined as follows: [0190] DNA extractions were made from from caeca contents (MPBio kit) with concentration ranges of 80-250 ng/l; [0191] DNA concentrations were normalised; [0192] qPCR was used, with absolute quantification using a standard curve based on extracted Lactobacillus crispatus DNA at different dilutions.

[0193] The concentration of the Lactobacillus crispatus, which is a commensal strain, when administered on day 9 after bird placement was present at the end of the trial at 1.9-2.9the concentration in treatments where it had not been added by oral gavage.

[0194] Whilst this was not a large trial, lacking statistical power, and the results were not significant in that P>0.05, the increase in bird weight at 35 days was greatest for group 1 (Nutrabiotic GUS+Lactobacillus crispatus) with, in some comparisons P<0.10.

Conclusions

[0195] Lactobacillus crispatus DC21.1 (NCIMB 42771) persists in the broiler caecum at the end of the experiment period, at day 35, when administered at day 9. The probiotic was present a concentrations of 1.9-2.9the concentration in control treatments. Whilst the trial lacked statistical power, and the results were not significant in that P>0.05, the increase in bird weight at 35 days was greatest the test group (Nutrabiotic GOS+Lactobacillus crispatus) with, in some comparisons P<0.10.

[0196] Table 9 provides the performance data of Trial 2Group 1, Pen 6

TABLE-US-00011 TABLE 9 Group 1 Pen 6 GOS2 Lactobacillus crispatus Date 8 Nov. 2016 15 Nov. 2016 18 Nov. 2016 28 Nov. 2016 5 Dec. 2016 13 Dec. 2016 Time (days) 0 7 10 20 27 35 Weight Weight Weight Weight Weight Weight Bird (g) (g) (g) (g) (g) (g) 1 41 214 262 740 2 40 198 345 985 1321 1931 3 35 189 323 803 4 39 198 313 876 1159 1745 5 38 219 332 937 1432 2270 6 37 181 297 715 7 40 183 282 758 1298 1803 8 41 185 302 792 1379 2240 9 34 218 299 782 10 41 171 292 742 1240 1958 11 43 173 313 925 1202 1998 12 38 191 272 746 13 35 186 276 717 14 39 203 230 862 15 39 196 298 867 16 37 147 204 617 17 39 177 263 862 1372 2260 18 41 171 319 986 1361 2080 19 40 196 330 828 1294 2040 20 41 149 251 779 average weight 38.9 187.3 290.2 816.0 1305.8 2032.5 st. dev. 2.4 19.6 35.8 96.5 85.5 184.4 RSD (%) 6.1% 10.5% 12.3% 11.8% 6.5% 9.1% cum. feed per 163 339 1023 1896 3196 bird (g) FCR 0.870 1.168 1.254 1.452 1.572

[0197] Table 10 provides the performance data of Trial 2Group 2, Pen 7

TABLE-US-00012 TABLE 10 Group 2 Pen 7 GOS2 Date 8 Nov. 2016 15 Nov. 2016 18 Nov. 2016 28 Nov. 2016 5 Dec. 2016 13 Dec. 2016 Time (days) 0 7 10 20 27 35 Weight Weight Weight Weight Weight Weight Bird (g) (g) (g) (g) (g) (g) 1 36 178 295 782 2 33 148 248 621 3 35 179 262 757 1042 1567 4 35 148 234 628 5 38 179 256 799 1317 2018 6 40 189 254 892 7 41 168 256 766 1112 1787 8 41 175 263 792 1282 1946 9 38 168 299 717 10 38 172 275 778 11 41 164 329 788 12 37 161 308 746 1082 1632 13 38 166 282 781 14 39 201 320 862 1192 1769 15 40 197 324 898 1186 1738 16 39 154 294 728 1132 1670 17 38 166 242 719 18 43 207 276 986 1372 2149 19 42 204 355 978 1524 2289 20 40 176 251 779 average weight 38.6 175.0 281.2 789.9 1224.1 1856.5 st. dev. 2.5 17.4 33.3 95.7 149.3 236.2 RSD (%) 6.6% 9.9% 11.8% 12.1% 12.2% 12.7% cum. feed per 158 336 939 1699 2945 bird (g) FCR 0.900 1.193 1.189 1.388 1.586

[0198] Table 11 provides the performance data of Trial 2Group 3, Pen 8

TABLE-US-00013 TABLE 11 Group 3 Pen 8 Date 8 Nov. 2016 15 Nov. 2016 18 Nov. 2016 28 Nov. 2016 5 Dec. 2016 13 Dec. 2016 Time (days) 0 7 10 20 27 35 Weight Weight Weight Weight Weight Weight Bird (g) (g) (g) (g) (g) (g) 1 40 214 319 900 1492 2172 2 43 198 364 985 1424 2020 3 39 189 294 658 1156 1932 4 39 198 249 626 1154 2002 5 36 219 264 626 1176 1780 6 37 181 290 705 7 37 183 264 692 8 39 185 293 772 1294 1789 9 39 218 294 737 1094 1693 10 43 171 285 870 1482 2109 11 44 173 307 930 1374 2039 12 38 191 256 705 13 42 186 283 930 1336 1720 14 42 203 314 893 15 38 196 258 753 1161 1803 16 41 147 310 857 17 42 177 303 870 1294 1720 18 41 171 287 802 19 40 196 297 840 1424 2123 20 38 169 283 781 21 37 149 249 589 22 41 182 287 802 23 30 190 282 858 1482 2163 24 42 171 267 799 average weight 39.5 185.7 287.5 790.8 1310.2 1933.2 st. dev. 3.0 18.5 25.8 107.3 141.0 177.6 RSD (%) 7.6% 10.0% 9.0% 13.6% 10.8% 9.2% cum. feed per 158 328 999 1760 2932 bird (g) FCR 0.848 1.142 1.263 1.344 1.517

[0199] Table 12 provides the performance data of Trial 2Group 4, Pen 9

TABLE-US-00014 TABLE 12 Group 4 Pen 9 Lactobacillus crispatus Date 8 Nov. 2016 15 Nov. 2016 18 Nov. 2016 28 Nov. 2016 5 Dec. 2016 13 Dec. 2016 Time (days) 0 7 10 20 27 35 Weight Weight Weight Weight Weight Weight Bird (g) (g) (g) (g) (g) (g) 1 41 214 272 720 2 40 198 230 715 1084 1718 3 35 189 244 739 4 39 198 315 703 5 38 219 261 658 1078 1700 6 37 181 266 679 1061 1676 7 40 183 237 691 8 41 185 274 668 1180 1890 9 34 218 306 714 1089 1525 10 41 171 315 802 11 43 173 287 791 1324 2015 12 38 191 343 920 1422 2080 13 35 186 350 952 1548 2300 14 39 203 330 872 1361 2052 15 39 196 290 819 1248 1825 16 37 147 272 719 1261 1932 17 39 177 263 720 18 41 171 297 752 19 40 196 280 742 1214 1840 20 41 149 281 779 21 38 185 309 799 1312 1970 22 36 152 244 791 23 40 188 276 801 1328 1890 24 41 207 311 895 average weight 38.9 186.5 285.5 768.4 1250.7 1886.6 st. dev. 2.3 19.7 32.3 79.6 144.4 197.2 RSD (%) 5.9% 10.6% 11.3% 10.4% 11.5% 10.5% cum. feed per 158 323 938 1719 2872 bird (g) FCR 0.847 1.131 1.221 1.375 1.522

[0200] Table 13 provides the t-Test data from Trial 2

TABLE-US-00015 TABLE 13 t-Test Time (days) 0 7 10 20 27 35 Test P-values Gp 1 0.7011 0.0433 0.4151 0.3959 0.1506 0.0797 vs 2 Gp 1 0.4711 0.7901 0.7737 0.4232 0.9308 0.1974 vs 3 Gp 1 0.9718 0.9058 0.6559 0.0801 0.2940 0.0802 vs 4

[0201] Table 14 provides the feed consumption data from Trial 2Group 1, Pen 6

TABLE-US-00016 TABLE 14 GOS2 Lactobacillus crispatus Pen 6 feed feed feed cum. feed no of feed cum. feed Group 1 Age start end consumed consumed birds per bird per bird Date (days) (g) (g) (g) (g) (g) (g) (g) 8 Nov. 2016 0 4000 740 15 Nov. 2016 7 5000 1480 3260 3260 20 163 163 18 Nov. 2016 10 14600 920 3520 6780 20 176 339 28 Nov. 2016 20 12000 3274 13680 20460 20 684 1023 5 Dec. 2016 27 16000 3000 8726 29186 10 873 1896 13 Dec. 2016 35 13000 42186 10 1300 3196

[0202] Table 15 provides the feed consumption data from Trial 2Group 2, Pen 7

TABLE-US-00017 TABLE 15 Group 2 Pen 7 GOS2 feed feed feed cum. feed no of feed cum. feed Age start end consumed consumed birds per bird per bird Date (days) (g) (g) (g) (g) (g) (g) (g) 8 Nov. 2016 0 4000 850 15 Nov. 2016 7 5000 1440 3150 3150 20 158 158 18 Nov. 2016 10 14600 2526 3560 6710 20 178 336 28 Nov. 2016 20 12000 4400 12074 18784 20 604 939 5 Dec. 2016 27 16000 3540 7600 26384 10 760 1699 13 Dec. 2016 35 12460 38844 10 1246 2945

[0203] Table 16 provides the feed consumption data from Trial 2Group 3, Pen 8

TABLE-US-00018 TABLE 16 Group 3 Pen 8 feed feed feed cum. feed no of feed cum. feed Age start end consumed consumed birds per bird per bird Date (days) (g) (g) (g) (g) (g) (g) (g) 8 Nov. 2016 0 4000 220 15 Nov. 2016 7 5000 900 3780 3780 24 158 158 18 Nov. 2016 10 16200 109 4100 7880 24 171 328 28 Nov. 2016 20 12000 1338 16091 23971 24 670 999 5 Dec. 2016 27 20000 3599 10662 34633 14 762 1760 13 Dec. 2016 35 16401 51034 14 1172 2932

[0204] Table 17 provides the feed consumption data from Trial 2Group 4, Pen 9

TABLE-US-00019 TABLE 17 Group 4 Pen 9 Lactobacillus crispatus feed feed feed cum. feed no of feed cum. feed Age start end consumed consumed birds per bird per bird Date (days) (g) (g) (g) (g) (g) (g) (g) 8 Nov. 2016 0 4000 210 15 Nov. 2016 7 5000 1040 3790 3790 24 158 158 18 Nov. 2016 10 16200 1433 3960 7750 24 165 323 28 Nov. 2016 20 12000 1063 14767 22517 24 615 938 5 Dec. 2016 27 20000 3865 10937 33454 14 781 1719 13 Dec. 2016 35 16135 49589 14 1153 2872

[0205] Table 18 is the feed formulation used in Trial 2, days 0-10

[0206] Table 19 provides the feed formulation used in Trial 2, days 11-24

TABLE-US-00020 TABLE 19 11-24 days Grower feed (pellets 3 mm diam.) GOS Intake Cumm. intake (kg/ No. (kg/ (kg/ (kg/ (kg/ Group L. crispatus te) birds bird) trt) bird) trt) 1 + 11.93 20 1.312 26.24 1.606 32.12 2 11.93 20 1.312 26.24 1.606 32.12 3 24 1.312 31.488 1.606 38.544 4 + 24 1.312 31.488 1.606 38.544 Totals 88 115.456 141.328

[0207] Table 20 is the feed formulation used in Trial 2, days 25-35

TABLE-US-00021 TABLE 20 25-35 days Finisher feed (pellets 3 mm diam.) GOS Intake Cumm. intake (kg/ No. (kg/ (kg/ (kg/ (kg/ Group L. crispatus te) birds bird) trt) bird) trt) 1 + 0 20 1.904 38.08 3.51 70.2 2 0 20 1.904 38.08 3.51 70.2 3 24 1.904 45.696 3.51 84.24 4 + 24 1.904 45.696 3.51 84.24 Totals 88 167.552 308.88

[0208] Table 21 provides a description of Nutrabiotic GUS L with which the composition of the invention may comprise as a prebiotic.

TABLE-US-00022 TABLE 21 Nutrabiotic GOS L Description: galacto-oligosaccharide syrup Typical analysis: dry matter: 75% (w/w) of which galacto-oligosaccharides: 59% (w/w DM), lactose: 17% (w/w DM), glucose: 17% (w/w DM), galactose: 7% (w/w DM) Sensorial: clear yellow to colourless liquid syrup, slightly sweet taste. Specification Method of analysis Chemical and physical: Dry matter 74 2% (w/w) IDF 26A (1993), 2 h 102 2 C. Galacto-oligosaccharides 57% (w/w DM) Lactose 23% (w/w DM) Dairy Crest methods: Glucose 22% (w/w DM) C-T.09, issue 01, Aug-2014 Galactose 0.8% (w/w DM) C-T.10, issue 06, Mar-2016 Total Nitrogen 0.1% (w/w DM) IDF 20B (1993), Kjeldahl Sulphated ash 0.3% (w/w DM) AOAC 17 ed. (2000) 930.30, sulphated = 550 C. to constant weight Viscosity 1000-5000 mPa .Math. s HAAKE pH 3.1-3.8 ISO 10523 (1994), potentiometric (10% w/w) Microbiological: Total plate count 1000 cfu/g IDF 100B (1991), PCMA 72 h 30 C. Yeasts 50 cfu/g IDF 94B (1990), OGYE 5 days 25 C. Moulds 50 cfu/g IDF 94B (1990), OGYE 5 days 25 C. Enterobacteriaceae absent in 1 g BDI 23, VRBG 24 h 30 C. Escherichia coli absent in 5 g IDF 170A-1 (1999), LSTB 48 h 37 C., ECB 48 h 44 C. Salmonelleae absent in 25 g IDF 93B (1995) Packaging: 1200 kg IBC Storage: keep in clean, dry and dark conditions, keep away from strongly odorous materials. Shelf life: 18 months after production date.

[0209] Table 22 provides recommendations based on typical feeding regimes and ones that have been used in both research and commercial trials. They can be modified as required. A comparison between broilers and piglets is also provided.

TABLE-US-00023 TABLE 22 Batch number - Nutrabiotic GOS L batch no. AQ6215 Dry matter 74.2% (w/w) Water 25.8% (w/w) Broilers Starter feed day 0-10 24.70 kg per metric tonne of complete feed Grower feed day 11-24 12.35 kg per metric tonne of complete feed Finisher feed day 25- not generally required Piglets Creep (pre-starter) feed day 10-weaning 15.1 kg per metric tonne of complete feed Weaning day 28 Starter feed day 28-35 9.1 kg per metric tonne of complete feed Link feed day 35-49 9.1 kg per metric tonne of complete feed Grower feed day 49-63 as required Notes Dose rates for Nutrabiotic GOS L are given for the syrup product as is.

[0210] Table 23 provides primers sequence 5-3 for the genes expression determined by qPCR.

TABLE-US-00024 TABLE23 Target Primer Product NCBIAccession gene sequence(5-3) size(bp) number Reference GAPDH F:GACGTGCAGCAGGAACACTA 343 NM_204305.1 Nangetal. R:TCTCCATGGTGGTGA (2011) AGACA IFN- F:TGAGCCAGATTGTTTCGATG 152 NM_205149.1 Nangetal. R:CTTGGCCAGGTCCATGATA (2011) IL-1 F:GGATTCTGAGCACACCACAGT 272 NM_204524.1 Nangetal. R:TCTGGTTGATGTCGAAGATGT (2011) C IL-4 F:GGAGAGCATCCGGATAGTGA 186 NM_001007079.1 Nangetal. R:TGACGCATGTTGAGGAAGAG (2011) IL-10 F:GCTGCGCTTCTACACAGATG 203 NM_001004414.2 Nangetal. R:TCCCGTTCTCATCCATCTTC (2011) IL-6 F:GCTCGCCGGCTTCGA 71 NM_204628.1 Kaiseretal. R:GGTAGGTCTGAAAGGCGAAC (2003) AG IL17-A F:CATGGGATTACAGGATCGATG 68 NM_204460.1 Reidatal. A (2016) R:GCGGCACTGGGCATCA IL17-F F:TGACCCTGCCTCTAGGATGAT 78 XM_426223.5 Reidatal. C (2016) R:GGGTCCTCATCGAGCCTGTA ChCXCLi1 F:CCGATGCCAGTGCATAGAG 191 NM_205018.1 Rasolietal, R:CCTTGTCCAGAATTGCCTTG (2015) ChCXCLi2 F:CCTGGTTTCAGCTGCTCTGT 128 NM_205498.1 Rasoliatal, R:GCGTCAGCTTCACATCTTGA (2015)

[0211] Table 24 provides an estimate of the metabolizable energy values of Nutrabiotic GOS L in broilers and piglets.

TABLE-US-00025 TABLE 24 Batch number Nutrabiotic GOS L batch no. AQ6215 Dry matter 74.2% (w/w) Water 25.8% (w/w) Net Metabolizable Energy (NME): broilers 6.06 kJ/g Nutrabiotic GOS L syrup product 1.45 kcal/g Nutrabiotic GOS L syrup product Net Metabolizable Energy (NME): piglets 7.26 kJ/g Nutrabiotic GOS L syrup product 1.74 kcal/g Nutrabiotic GOS L syrup product Notes The NME values are expressed per weight of the Nutrabiotic GOS L product as is, i.e. the syrup product that is added.

[0212] It is of course to be understood that the present invention is not intended to be restricted to the foregoing examples which are described by way of example only.

[0213] The present invention relates to compositions for use in the treatment and/or nutrition of poultry, such as broiler chickens (Gallus gallus domesticus). However it is not beyond the scope of the invention that the present invention may also relate to game birds such as grouse, pheasant or quail, for example.