RAPID VIRAL NUCLEIC ACID DETECTION KIT PREPARED BY USING NOVEL RECA ENZYME AND DETECTION METHOD THEREOF

20230212670 · 2023-07-06

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides a rapid viral nucleic acid detection kit prepared by using a novel RecA enzyme and the detection method thereof. By editing the recombinase RecA gene, the expressed RecA protein has better solubility and recombinase activity. The RecA protein is used to prepare recombinase dry powder, further the formula of the recombinase dry powder and the ratio are optimized; and specific primers for the ASFV p72 gene are designed for the rapid nucleic acid detection of ASFV, significantly improving the detection sensitivity. In addition, the detection time is short, which effectively avoids missed detection and false detection, and helps prevention of epidemic.

    Claims

    1. A nucleotide sequence encoding a recombinase RecA, wherein the nucleotide sequence is a sequence of SEQ ID NO: 6.

    2. The nucleotide sequence according to claim 1, wherein the nucleotide sequence of the partial structure encoding T4 bacteriophage protein is inserted after GACATC of the sequence shown in SEQ ID NO: 5 in the Sequence Listing, and the nucleotide sequence SEQ ID NO: 5 is a partial sequence of the wild type Deinococcus radiodurans.

    3. The nucleotide sequence according to claim 2, wherein the nucleotide sequence encoding the T4 phage protein is shown in SEQ ID NO: 13.

    4. A recombinase dry powder, comprising the RecA protein encoded by the RecA gene described in claim 1.

    5. The recombinase dry powder according to claim 4, further comprising uvsY protein, ssb protein and Exo protein.

    6. The recombinase dry powder according to claim 5, wherein the recombinase dry powder comprises 20 ng/μL-50 ng/μL of RecA protein, 10 ng/μL-50 ng/μL of usvY protein, 10 ng/μL-50 ng/μL of DNA polymerase P, 30 ng/μL-100 ng/μL of ssb protein, 20 ng/μL-60 ng/μL of Exo protein.

    7. A rapid viral nucleic acid detection kit, comprising the recombinase dry powder as described in claim 4.

    8. The kit according to claim 7, wherein the kit further comprises a primer-probe set, a reaction Buffer, Buffer B, a negative control and a positive control.

    9. The kit according to claim 8, wherein the virus is ASFV, and the primer-probe set comprises: an upstream primer, whose sequence is shown in SEQ ID NO: 1 in the Sequence Listing; a downstream primer, whose sequence is shown in SEQ ID NO: 2 in the Sequence Listing; and a fluorescent probe sequence whose sequence is shown in SEQ ID NO: 3 in the Sequence Listing.

    10. The kit according to claim 9, wherein the reaction Buffer is 10-30 mM Tris-HCl (pH7.5), 0.1 mM-0.5 mM dNTP, PEG8000 or PEG of other molecular weights at a mass percent of 3%-9%, 1-5 mM DTT, 10-20 mM ATP, 10-50 mM phosphoenolpyruvate, and 500-1500 ng/μL pyruvate kinase.

    11. The kit according to claim 8, wherein the Buffer B is 2-10 mM Mg2+; the positive control is a pseudovirus containing the ASFV p72 gene fragment; and the negative control is normal saline.

    12. The kit according to claim 8, wherein the concentration of the novel RecA protein is 20 ng/μL, the concentration of the uvsY protein is 10 ng/μL, the concentration of the DNA polymerase P is 30 ng/μL, the concentration of the ssb protein is 30 ng/μL, and the concentration of the Exo Protein is 20 ng/μL.

    13. A method for detecting ASFV, comprising the following steps: extracting nucleic acid to be tested, preparing a positive control and a negative control; preparing recombinase dry powder and placing into a reaction tube, adding a reaction Buffer, an upstream primer, a downstream primer, and a fluorescent probe; adding the nucleic acid to be tested, the positive control and the negative control to the reaction tube, then adding Buffer B, shaking and mixing well, and centrifuging; performing isothermal amplification and fluorescence analysis of the sample to be tested; wherein the recombinase dry powder comprises a novel RecA protein encoded by a nucleotide sequence, and the nucleotide sequence is the sequence described in SEQ ID NO: 6.

    14. The method according to claim 13, wherein the recombinase dry powder further comprises uvsY protein, ssb protein and Exo protein.

    15. The method according to claim 13, wherein the recombinase dry powder comprises 20 ng/μL-50 ng/μL of RecA protein, 10 ng/μL-50 ng/μL of usvY protein, 10 ng/μL-50 ng/μL of DNA polymerase P, 30 ng/μL-100 ng/μL of ssb protein, 20 ng/μL-60 ng/μL of Exo protein.

    16. The method according to claim 13, wherein the nucleotide sequence of the partial structure encoding T4 bacteriophage protein is inserted after GACATC of the sequence shown in SEQ ID NO: 5 in the Sequence Listing, and the nucleotide sequence SEQ ID NO: 5 is a partial sequence of the wild type Deinococcus radiodurans.

    17. The method according to claim 13, wherein the nucleotide sequence encoding the T4 bacteriophage protein is shown in SEQ ID NO: 13.

    18. The method according to claim 13, wherein the primer-probe set comprises: an upstream primer, whose sequence is shown in SEQ ID NO: 1 in the Sequence Listing; a downstream primer, whose sequence is shown in SEQ ID NO: 2 in the Sequence Listing; and a fluorescent probe sequence whose sequence is shown in SEQ ID NO: 3 in the Sequence Listing.

    19. The method according to claim 13, wherein the concentration of the novel RecA protein is 20 ng/μL, the concentration of the uvsY protein is 10 ng/μL, the concentration of the DNA polymerase P is 30 ng/μL, the concentration of the ssb protein is 30 ng/μL, and the concentration of the Exo Protein is 20 ng/μL.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0058] FIGS. 1 to 3 show the detection results of 3 groups of primer-probe sets in the Example 3, wherein FIG. 1 is the detection result of primer-probe set 1, FIG. 2 is the detection result of primer-probe set 2, and FIG. 3 is the detection result of primer-probe set 3;

    [0059] FIGS. 4 to 6 show the detection results of the two groups of recombinase systems for pseudoviruses with different concentrations in the Example 6, wherein FIG. 4 is the detection result of 2×104 copies/μL pseudoviruses, FIG. 5 is the detection result of 2×103 copies/μL pseudoviruses, and FIG. 6 is the detection result of 200 copies/μL pseudoviruses;

    [0060] FIGS. 7 to 9 show the detection results of pseudoviruses with different concentrations in the Example 7, wherein FIG. 7 is the detection results of samples with high concentrations (2×104 copies/μL, 2×103 copies/μL), FIG. 8 is the detection results of samples with medium concentrations (200 copies/μL, 100 copies/μL, 50 copies/μL), and FIG. 9 is the detection results of samples with low concentrations (50 copies/μL, 20 copies/μL and 5 copies/μL).

    DETAILED DESCRIPTION OF THE EMBODIMENTS

    [0061] The present invention will be further described in detail below with reference to the embodiments. It should be noted that, the following embodiments are intended to facilitate the understanding of the present invention, but do not constitute any limitation on the present invention. All reagents that are not specified in the embodiments are all known products and are commercially available.

    Example 1 Editing of the RecA Gene Provided by the Present Invention

    [0062] This example was directed to the RecA gene (Gene ID: 68370659, SEQ ID NO: 5) of wild type Deinococcus radiodurans, and the gene sequence was as follows:

    TABLE-US-00002 ATGAGCAAGGACGCCACCAAAGAAATCTCCGCCCCCACCGACGCCAAGG AACGCAGCAAGGCCATCGAAACAGCCATGAGCCAGATCGAAAAGGCCTT CGGCAAGGGCTCGATCATGAAACTGGGCGCCGAGAGCAAACTCGACGTG CAGGTCGTCAGCACCGGCAGCCTCAGCCTTGACCTCGCACTGGGCGTGG GCGGCATTCCGCGTGGCCGCATCACCGAGATCTACGGCCCCGAGTCGGG CGGCAAGACCACCCTGGCCCTCGCCATCGTCGCGCAGGCCCAGAAAGCG GGCGGCACCTGTGCGTTTATCGACGCCGAGCACGCGCTCGACCCGGTGT ACGCCCGCGCCCTGGGCGTGAACACCGACGAACTGCTGGTGTCGCAGCC CGACAACGGCGAGCAGGCGCTCGAAATCATGGAACTGCTGGTGCGTTCG GGCGCGATTGATGTGGTGGTCGTGGACTCGGTGGCTGCTCTGACCCCCC GCGCCGAAATCGAGGGCGACATGGGCGACAGCCTGCCCGGTCTTCAGGC CCGCCTGATGTCGCAGGCGCTGCGCAAGCTGACGGCGATTCTCTCCAAG ACCGGCACCGCCGCCATCTTCATCAACCAGGTTCGCGAGAAAATCGGCG TGATGTACGGCAACCCCGAAACCACCACCGGGGGCCGGGCGCTGAAGTT CTACGCCAGCGTGCGCCTCGACGTGCGTAAGATCGGCCAGCCCACCAAG GTCGGCAACGACGCGGTCGCCAACACCGTCAAGATCAAGACCGTGAAGA ACAAGGTCGCCGCCCCCTTCAAGGAAGTCGAACTCGCGCTGGTCTACGG CAAGGGCTTCGACCAGCTCAGCGACCTCGTGGGCCTGGCCGCCGACATG GACATCATCAAGAAGGCCGGCAGCTTCTACTCCTACGGCGACGAGCGCA TCGGCCAGGGCAAGGAAAAGACCATCGCCTACATCGCCGAGCGCCCCGA GATGGAGCAGGAAATCCGCGACCGCGTGATGGCCGCCATCCGCGCGGGC AACGCGGGCGAAGCACCGGCCCTGGCCCCCGCGCCTGCCGCGCCCGAAG CCGCCGAAGCGTAA

    [0063] The gene editing was performed on the wild type RecA gene. A partial domain of the T4 phage recombinant protein was introduced into the RecA protein; by inserting the sequence “AAAAATGGCTGGTATGCTCGTGAATTTCTTGACGAAGAAACTGGCGAGATGATTCGC GAAGAAAAATCTTGGCGTGCAAAAGATACTAACTGCACTACATTCTGG” (SEQ ID NO: 13) after the wild type “GGACATC”, the novel RecA gene (SEQ ID NO: 6) was obtained, as follows:

    TABLE-US-00003 ATGAGCAAGGACGCCACCAAAGAAATCTCCGCCCCCACCGACGCCAAGG AACGCAGCAAGGCCATCGAAACAGCCATGAGCCAGATCGAAAAGGCCTT CGGCAAGGGCTCGATCATGAAACTGGGCGCCGAGAGCAAACTCGACGTG CAGGTCGTCAGCACCGGCAGCCTCAGCCTTGACCTCGCACTGGGCGTGG GCGGCATTCCGCGTGGCCGCATCACCGAGATCTACGGCCCCGAGTCGGG CGGCAAGACCACCCTGGCCCTCGCCATCGTCGCGCAGGCCCAGAAAGCG GGCGGCACCTGTGCGTTTATCGACGCCGAGCACGCGCTCGACCCGGTGT ACGCCCGCGCCCTGGGCGTGAACACCGACGAACTGCTGGTGTCGCAGCC CGACAACGGCGAGCAGGCGCTCGAAATCATGGAACTGCTGGTGCGTTCG GGCGCGATTGATGTGGTGGTCGTGGACTCGGTGGCTGCTCTGACCCCCC GCGCCGAAATCGAGGGCGACATGGGCGACAGCCTGCCCGGTCTTCAGGC CCGCCTGATGTCGCAGGCGCTGCGCAAGCTGACGGCGATTCTCTCCAAG ACCGGCACCGCCGCCATCTTCATCAACCAGGTTCGCGAGAAAATCGGCG TGATGTACGGCAACCCCGAAACCACCACCGGGGGCCGGGCGCTGAAGTT CTACGCCAGCGTGCGCCTCGACGTGCGTAAGATCGGCCAGCCCACCAAG GTCGGCAACGACGCGGTCGCCAACACCGTCAAGATCAAGACCGTGAAGA ACAAGGTCGCCGCCCCCTTCAAGGAAGTCGAACTCGCGCTGGTCTACGG CAAGGGCTTCGACCAGCTCAGCGACCTCGTGGGCCTGGCCGCCGACATG GACATCAAAAATGGCTGGTATGCTCGTGAATTTCTTGACGAAGAAACTG GCGAGATGATTCGCGAAGAAAAATCTTGGCGTGCAAAAGATACTAACTG CACTACATTCTGGATCAAGAAGGCCGGCAGCTTCTACTCCTACGGCGAC GAGCGCATCGGCCAGGGCAAGGAAAAGACCATCGCCTACATCGCCGAGC GCCCCGAGATGGAGCAGGAAATCCGCGACCGCGTGATGGCCGCCATCCG CGCGGGCAACGCGGGCGAAGCACCGGCCCTGGCCCCCGCGCCTGCCGCG CCCGAAGCCGCCGAAGCGTAA

    [0064] Shanghai Sangon Biotech was entrusted to perform gene synthesis. A novel RecA protein was obtained by expressing the novel RecA gene in E. coli. The specific expression method and purification were obtained by traditional methods. The protein amino acid sequencing analysis showed that the expressed recombinant protein was normally translated by the nucleotide sequence.

    [0065] Example 2 the Rapid Viral Nucleic Acid Detection Kit Provided in the Present Invention and Use Thereof in Virus Detection

    [0066] The components of the detection kit prepared with the novel RecA protein provided by Example 1 were as follows:

    [0067] 1. Enzyme dry powder tube: 1.0 μg-2.5 μg (equivalent to 20 ng/μL-50 ng/μL) of the novel RecA protein (Hangzhou Heqishi, lot: A20211011), 0.5 μg-2.5 μg (equivalent to 10 ng/μL-50 ng/μL) of uvsY (Hangzhou Heqishi, lot: Y20111011), 0.5 μg-2.5 μg (equivalent to 10 ng/μL-50 ng/μL) of DNA polymerase P (Hangzhou Heqishi, lot: P20211014) and 1.5 μg-5 μg (equivalent to 30 ng/μL-100 ng/μL) of ssb protein (Hangzhou Heqishi, lot: S20210910), 1.0 m-3.0 m (equivalent to 20 ng/μL-60 ng/μL) of Exo protein (Hangzhou Heqishi, lot: E20210911).

    [0068] 2. Reaction Buffer: 10-30 mM Tris-HCl (pH7.5), 0.1 mM-0.5 mM dNTP, PEG8000 or PEG of other molecular weights at a mass percent of 3%-9%, 1-5 mM DTT, 10-20 mM ATP, 10-50 mM phosphoenolpyruvate, 500-1500 ng/μl pyruvate kinase;

    [0069] 3. Activator (Buffer B): 2-10 mM Mg2+;

    [0070] 4. Primer-probe set: For the virus to be tested, the corresponding upstream primers, downstream primers and probes were designed, and the ratio was as follows: 0.5-2 μL of 10 mM upstream primer, 0.5-2 μL of 10 mM downstream primer, 0.5-1 μL of 10 mM probe;

    [0071] 5. Positive control: pseudovirus containing the gene segment of the virus to be tested;

    [0072] 6. Negative control: normal saline.

    [0073] The kit provided in this example could be used for the detection of any virus, and the detection method was as follows:

    [0074] (1) Extract the nucleic acid to be tested, and prepare positive and negative controls;

    [0075] (2) Add a reaction Buffer, an upstream primer, a downstream primer and a fluorescent probe to an enzyme dry powder tube;

    [0076] (3) Add the nucleic acid to be tested, positive control and negative control to the reaction tube, then add Buffer B, shake and mix well, and centrifuge;

    [0077] (4) Perform isothermal amplification and fluorescence analysis of the sample to be tested.

    [0078] Due to limited space, only ASFV was used as an example for illustration in this example.

    [0079] The primer-probe set designed for the p72 gene of ASFV included an upstream primer ASF-FP (SEQ ID NO: 1), a downstream primer ASF-RP (SEQ ID NO: 2) and a probe ASF-P (SEQ ID NO: 3).

    [0080] The specific components of the rapid detection kit for ASFV nucleic acid were as follows:

    [0081] 1. Enzyme dry powder tube: 1.0 m-2.5 μg (equivalent to 20 ng/μL-50 ng/μL) of the novel RecA protein (Hangzhou Heqishi, lot: A20211011), 0.5 μg-2.5 μg (equivalent to 10 ng/μL-50 ng/μL) of uvsY (Hangzhou Heqishi, lot: Y20111011), 0.5 m-2.5 μg (equivalent to 10 ng/μL-50 ng/μL) of DNA polymerase P (Hangzhou Heqishi, lot: P20211014) and 1.5 m-5 μg (equivalent to 30 ng/μL-100 ng/μL) ssb protein (Hangzhou Heqishi, lot: S20210910), 1.0 m-3.0 m (equivalent to 20 ng/μL-60 ng/μL) of Exo protein (Hangzhou Heqishi, lot: E20210911).

    [0082] 2. Reaction Buffer: 10-30 mM Tris-HCl (pH7.5), 0.1 mM-0.5 mM dNTP, PEG8000 or PEG of other molecular weights at a mass percent of 3%-9%, 1-5 mM DTT, 10-20 mM ATP, 10-50 mM phosphoenolpyruvate, 500-1500 ng/μl pyruvate kinase;

    [0083] 3. Activator (Buffer B): 2-10 mM Mg.sup.2+;

    [0084] 4. Primer-probe set: 0.5-24, of 10 mM upstream primer ASF-FP (SEQ ID NO: 1), 0.5-24, of 10 mM downstream primer ASF-RP (SEQ ID NO: 2), 0.5-14, of 10 mM probe ASF-P (SEQ ID NO: 3);

    [0085] 5. Positive control: pseudovirus containing ASFV p72 gene fragment, as shown in SEQ ID NO: 4;

    [0086] 6. Negative control: normal saline.

    [0087] The method for rapid detection of ASFV using the rapid detection kit of ASFV nucleic acid comprised the following steps:

    [0088] (1) extract nucleic acids according to the instructions of the viral nucleic acid extraction kit, and extract the positive and negative controls simultaneously;

    [0089] (2) add 10 μL of reaction Buffer, 1 μL of 10 mM upstream primer, 1 μL of 10 mM downstream primer, and 0.5 μL of 10 mM probe into an dry enzyme powder tube;

    [0090] (3) add 5 μL of nucleic acid extraction product, 5 μL of positive control and 5 μL of negative control to the reaction tube, then add 2.5 μL of Buffer B, supplement the reaction system with 30 μL of ddH.sub.2O to 50 μL, shake and mix well, and centrifuge quickly for 5-10S;

    [0091] (4) Place the reaction tube into the PCR system, react at 25-42° C. for 5-20 minutes, collect the fluorescent signal once every 30 s; after the detection, judge whether the sample was a positive sample according to the fluorescent signals.

    [0092] The reaction program of isothermal amplification was shown in Table 1:

    TABLE-US-00004 TABLE 1 Reaction program of isothermal amplification Number of Collection Step Temperature Time/cycle cycles of text missing or illegible when filed Preheating 37-42° C. 40 s 1 custom-character Amplificatitext missing or illegible when filed 37-42° C. 30 s 40 custom-character text missing or illegible when filed indicates data missing or illegible when filed

    [0093] Remarks: During the amplification process, high-concentration samples only needed 10-20 cycles to amplify the curve, while low-concentration samples needed 30-40 cycles to amplify the curve.

    Example 3 Screening of Primer-Probe Set for Detection of ASFV

    [0094] Unlike conventional PCR, which uses the complementary binding of primers and templates in the annealing process, the isothermal nucleic acid technology utilizes the polymer of recombinase and primers to search for the complementary sequences on the template DNA that completely match with them under normal temperature conditions; then with the aid of the single-stranded DNA binding protein, the double-stranded structure of the template DNA is opened, and a new DNA complementary strand is formed under the action of DNA polymerase P. Since the principle of isothermal amplification technology is different from that of conventional PCR, the design of the primer is also completely different. The length of the primer is longer, about 30 nt, to ensure the identification and specificity of the chain during the amplification process. Because the primer is longer, it is easier to form secondary structures, which is amplified with the primer dimer at 37-42° C. The secondary structure is not easy to open, which will affect the amplification efficiency, so the design is more difficult.

    [0095] At present, there is no design software for primer probes for recombinase-aid amplification, and extensive screening is required. The probe design of recombinase-aid amplification is unique. The fluorescent group and the quenching group are modified inside the sequence, and are connected by a tetrahydrofuran bond. The exonuclease recognizes the tetrahydrofuran bond, cuts the probe and releases fluorescence, and the 3′ end of the probe is phosphorylated to block.

    [0096] In this example, the kit and detection method provided by Example 2 were used to detect ASFV, wherein the recombinase dry powder was composed of 20 ng/μL of novel RecA protein, 10 ng/μL of uvsY, 30 ng/μL of DNA polymerase P and 30 ng/μL of ssb protein, 20 ng/μL Exo protein; and multiple groups of primer-probe sets were designed for the p72 gene of ASFV. Three groups were selected and listed in Table 2, namely, group 1, group 2, and group 3. Synthesis was performed in Shanghai Sangon Biotech and the primers and probes were diluted to 10 mM according to the dilution method.

    TABLE-US-00005 TABLE 2 Primer-probe set designed for ASFV p72 gene Group Name Sequence Group ASF-FP CAGATATAGATGAACATGCGTCTGGAAG (SEQ ID NO: 1) 1 ASF-RP ATCCTCATCAACACCGAGATTGGCACA (SEQ ID NO: 2) ASF-P TATCTCTGCGTGGTGAGTGGGCTGCA/I6FAMdT/A/idSP// IBHQ1dT/GGCGTTAACAACAT (SEQ ID NO: 3) Group ASF-FP1 TGTGCCAATCTCGGTGTTGATGAGGAT (SEQ ID NO: 7) 2 ASF-RP1 CCACACCAACAATAACCACCACGATG (SEQ ID NO: 8) ASF-P1 GTTCCAGGTAGGTTTTAATCCTATAAACA/I6FAMdT/A/idSP/A/ IBHQ1dT/TCAATGGGCCAT (SEQ ID NO: 9) Group ASF-FP2 CCGAACTTGTGCCAATCTCGGTGTTGATG (SEQ ID NO: 10) 3 ASF-RP2 AACGCAGGTGACCCACACCAACAATAACC (SEQ ID NO: 11) ASF-P2 TAGGTTTTAATCCTATAAACATATAT/I6FAMdT/C/idSP/A/ IBHQ1dT/GGGCCATTTAAGAGC (SEQ ID NO: 12)

    [0097] The synthesized pseudovirus was diluted with physiological saline to different concentration gradients (0, 50, 100, 200 copies/μL), and then extracted with a purchased viral nucleic acid extraction kit [Tiangen Biotech (Beijing) Co., Ltd., viral genomic DNA/RNA extraction kit (DP315)]. According to the instructions, 200 μL of the sample was taken for nucleic acid extraction, then eluted with 100 μL of RNase-Free ddH2O, and then 5 μL of the eluted product was taken for rapid nucleic acid detection.

    [0098] Reaction System:

    TABLE-US-00006 Reaction Buffer 10 μL DNA 5.0 μL Activator 2.5 μL Upstream primer 1 μL Downstream primer 1 μL Probe 0.5 μL ddH2O 30 μL Total 50.0 μL

    Reaction Program of Isothermal Amplification:

    [0099]

    TABLE-US-00007 Number of Collection of Step Temperature Time/cycle cycles fluorescence Preheating 37-42° C. 40 s 1 Yes Amplificatitext missing or illegible when filed 37-42° C. 30 s 40 Nottext missing or illegible when filed text missing or illegible when filed indicates data missing or illegible when filed

    [0100] Remarks: During the amplification process, high-concentration samples only needed 10-20 cycles to amplify the curve, and low-concentration samples needed 30-40 cycles to amplify the curve.

    [0101] The test results were shown in FIGS. 1 to 3 respectively, wherein FIG. 1 was the detection result of the primer-probe set 1, FIG. 2 was the detection result of the primer-probe set 2, and FIG. 3 was the detection result of the primer-probe set 3.

    [0102] According to the results in FIGS. 1 to 3, the primer probe of group 1 had an obviously high sensitivity and a better amplification curve (S-shaped), and a higher fluorescence intensity (ordinate value) when detected. When the sample concentration was as low as 50 copies/μL, it could still be accurately detected. So, the primer-probe set of the kit was preferably group 1.

    Example 4 Influence of Novel RecA Protein and Existing RecA Protein on ASFV Detection

    [0103] In this example, the kit and detection method provided by Example 2 were used to detect the ASFV p72 gene. The recombinase dry powder was composed of 30 ng/μL of RecA protein, 20 ng/μL of uvsY, 30 ng/μL of DNA polymerase P, 30 ng/μL of ssb protein, 50 ng/μL of Exo protein; wherein the RecA protein used the novel RecA protein provided by Example 1 and the existing RecA protein (Hangzhou Heqishi, lot: R20210912). The synthesized pseudovirus was diluted with normal saline to 0, 5, 20, 50, 100, 150, 200 copies/μL for detection. The detection results were shown in Table 3.

    TABLE-US-00008 TABLE 3 Influence of novel RecA protein and existing RecA protein on ASFV detection Recombinase dry powder Sensitivity (copies/μL) Detection time Novel RecA protein 5  5-20 min Existing RecA protein 150 20-30 min

    [0104] As shown in Table 3, the novel RecA protein expressed by the novel RecA gene could significantly improve the detection sensitivity of the ASFV p72 gene, so that the detection sensitivity reached 5 copies/μL, and the detection time was shortened to 5-20 min.

    Example 5 Effect of Adding uvsY Protein on ASFV Detection

    [0105] In this example, the kit and detection method provided by Example 2 were used to detect the ASFV p72 gene. The recombinase dry powder was composed of 30 ng/μL of RecA protein, 20 ng/μL of uvsY, 30 ng/μL of DNA polymerase P and 50 ng/μL of ssb protein, 20 ng/μL of Exo protein. Wherein, the uvsY protein was added or not added to the recombinase dry powder, respectively, to investigate whether the uvsY protein had the effect of auxiliary-mediated amplification on RecA protein. The synthesized pseudovirus was diluted with normal saline to 0, 5, 20, 50, 100, 150, 200 copies/μL for detection. The detection results were shown in Table 4.

    TABLE-US-00009 TABLE 4 Influence of the novel RecA protein and existing RecA protein on ASFV detection Recombinase dry powder Sensitivity (copies/μL) Detection time uvsY-containing protein 5  5-20 min uvsY-free protein 50 10-20 min

    [0106] As shown in Table 4, the uvsY protein had a very significant auxiliary effect on the novel RecA protein. The addition of the uvsY protein could significantly improve the detection sensitivity of the ASFV p72 gene and further shorten the detection time. The possible reason was that a partial domain of the T4 phage recombinant protein was introduced to the novel RecA protein, and the uvsY protein could assist the RecA protein to bind to the target fragment; therefore, the uvsY protein could assist the novel RecA protein and increase the recombinase-mediated efficiency, thereby improving the amplification efficiency, shortening the amplification time and improving the detection sensitivity.

    [0107] The detection time was also closely related to the virus concentration of the sample to be tested. When the concentration was low, the amplification time would be longer. However, when the virus concentration of the sample to be tested was the same, the addition of uvsY protein could further shorten the amplification time, thereby shortening the detection time.

    Example 6 Optimization of Recombinase Amplification System

    [0108] The reaction Buffer is used to maintain the pH value of the reaction system, provide raw materials and energy for DNA synthesis. Buffer B is the activator of the reaction, and an appropriate amount of Buffer B is added to start the reaction. The ssb protein is a single-chain binding protein, and the RecA protein is a homologous recombination protein, when cloned and expressed in Deinococcus radiodurans, Deinococcus radiodurans has extreme radiation resistance and an efficient DNA damage repair mechanism, which can quickly repair various DNA damages. RecA protein is one of the important DNA repair proteins, which performs homologous recombination repair of DNA. The RecA protein derived from Deinococcus radiodurans has strong stress resistance, but for the wild-type RecA protein cloned from the genome of Deinococcus radiodurans, the product in the E. coli expression system is an inclusion body with low in vitro enzyme activity. Gene editing (SeQ.NO6) was performed on the basis of the wild-type recA gene (SEQ.NO5), which improved the solubility of the expressed product and the recombinase activity. The melting of templates mediated by the novel RecA protein, Uvs Y and ssb proteins and the strand replacement between the template and the primer require ATP for energy. DNA polymerase P is derived from DNA polymerase I of Escherichia coli and can specifically extend the DNA after strand replacement. The Exo protein recognizes the tetrahydrofuran bond of the probe, cuts the probe, releases fluorescence, and performs fluorescence detection.

    [0109] In this example, the kit and detection method provided by Example 2 were used to detect the ASFV p72 gene, and it was found that the ratio and concentration of various proteins in the system were critical to the sensitivity and specificity of the reaction, especially the RecA, UvsY and ssb proteins that mediated the melting of the template and achieved the chain replacement between the template and the primer. In this example, on the basis of the existing reaction system, further optimization was carried out to increase the contents of ssb protein, novel RecA protein and UvsY protein, and obviously improve the detection sensitivity.

    [0110] Preparation of Recombinase Dry Powder:

    [0111] Group 1: 20 ng/μL novel RecA protein, 10 ng/μL uvsY protein, 30 ng/μL DNA polymerase P and 30 ng/μL ssb protein, 20 ng/μL Exo protein;

    [0112] Group 2: 30 ng/μL novel RecA protein, 20 ng/μL uvsY protein, 30 ng/μL DNA polymerase P and 50 ng/μL ssb protein, 20 ng/μL Exo protein.

    [0113] The synthesized pseudovirus was diluted with physiological saline to different concentration gradients (20000, 2000, 200 copies/μL), and then extracted with a purchased viral nucleic acid extraction kit [Tiangen Biotech (Beijing) Co., Ltd., viral genomic DNA/RNA extraction kit (DP315)]. According to the instructions, 200 μL of the sample was taken for nucleic acid extraction, then eluted with 100 μL of RNase-Free ddH2O, and then 5 μL of the eluted product was taken for rapid nucleic acid detection. The reaction solution system and the reaction procedure were shown in Example 3.

    [0114] The detection results were shown in FIGS. 4 to 6, wherein FIG. 4 was the detection result of 2×104 copies/μL pseudoviruses, FIG. 5 was the detection result of 2×103 copies/μL pseudoviruses, and FIG. 6 was the detection result of 200 copies/μL pseudoviruses; as shown in FIGS. 4 to 6, regardless of the virus content of 200 copies/μL, 2000 copies/μL or 2×104 copies/μL, when the recombinase dry powder system of group 2 was used, the peak would be apparently earlier than that of group 1, and there was a more obvious exponential phase and plateau phase, the amplification effect was better, the sensitivity was high, and the appearance time was faster. Therefore, the recombinase dry powder system of group 2 was preferably used, namely, 30 ng/μL of novel RecA protein, 20 ng/μL of uvsY protein, 30 ng/μL of DNA polymerase P, 50 ng/μL of ssb protein, and 20 ng/μL of Exo protein.

    Example 7 Influence of Different Concentrations of Gradient Samples on Detection

    [0115] In this example, the kit and detection method provided by Example 2 were used to detect the ASFV p72 gene. The recombinase dry powder was composed of 30 ng/μL of RecA protein, 20 ng/μL of uvsY, 30 ng/μL of DNA polymerase P and 50 ng/μL of ssb protein, and 20 ng/μL of Exo protein. The synthesized pseudovirus was diluted with physiological saline to different concentration gradients (2×104 copies/μL, 2×103 copies/μL, 200 copies/μL, 100 copies/μL, 50 copies/μL, 20 copies/μL, 5 copies/μL), and then extracted with a purchased viral nucleic acid extraction kit [Tiangen Biotech (Beijing) Co., Ltd., viral genomic DNA/RNA extraction kit (DP315)]. According to the instructions, 200 μL of the sample was taken for nucleic acid extraction, then eluted with 100 μL of RNase-Free ddH2O, and then 5 μL of the eluted product was taken for rapid nucleic acid detection. The reaction solution system and reaction procedure were shown in Example 3.

    [0116] The test results were shown in FIGS. 7 to 9, wherein FIG. 7 was the detection results of samples with high concentrations (2×104 copies/μL, 2×103 copies/μL), FIG. 8 was the detection results of samples with medium concentrations (200 copies/μL, 100 copies/μL, 50 copies/μL), and FIG. 9 was the detection results of samples with low concentrations (50 copies/μL, 20 copies/μL and 5 copies/μL).

    [0117] As shown in FIGS. 7 to 9, under the detection condition of high concentration samples, the fluorescence signal appeared in 2 to 5 minutes; under the detection condition of low concentration samples, the fluorescence signal appeared in 5 to 10 minutes, and reached the plateau phase in 20 minutes. A sample of at least 5 copies/μL could be detected, and the calculated sensitivity was about 50 copies/test (sensitivity=[5 copies/ul×200 ul (sample)/100]×5 ul). The sample detection speed was fast and the sensitivity was high.

    [0118] Although the present invention has been described in detail above with general illustrations and specific embodiments, the foregoing embodiments are exemplary, and the specific features, structures, materials, or characteristics may be combined and incorporated in any suitable manner in any one or more embodiments. It is obvious to those skilled in the art that some modifications or improvements can be made on the basis of the present invention. Therefore, these modifications, improvements, substitutions or variations made without departing from the spirit of the present invention shall fall within the scope of protection of the present invention.

    TABLE-US-00010 Sequence Listing SEQ ID NO: 1 ASF-FP: CAGATATAGATGAACATGCGTCTGGAAG SEQ ID NO: 2 ASF-RP: ATCCTCATCAACACCGAGATTGGCACA SEQ ID NO: 3 ASF-P: TATCTCTGCGTGGTGAGTGGGCTGCA/I6FAMdT/A/idSP//IBHQ1dT/GGCGTTAACAACAT SEQ ID NO: 4 P72: AGGTAATGTGATCGGATACGTAACGGGGCTAATATCAGATATAGATGAACATGCGTCTG GAAGAGCTGTATCTCTATCCTGAAAGCTTATCTCTGCGTGGTGAGTGGGCTGCATAAT GGCGTTAACAACATGTCCGAACTTGTGCCAATCTCGGTGTTGATGAGGATTTTGATCG GAGATGTTCCAGGTAGGTTTTAATCCTATAAACATATATTCAATGGGCCATTTAAGAGC AGACATTAGTTTTTCATCGTGGTGGTTATTGTTGGTGTGGGTCACCTGCGTTTTATGGA CACGTATCAGCGAAAAGCGAACGCGTTTTACAAAAAGGTTGTGTATTTCAGGGGTTA CAAACAGGTTAT SEQ ID NO: 5 Wild type RecA: ATGAGCAAGGACGCCACCAAAGAAATCTCCGCCCCCACCGACGCCAAGGAACGCAG CAAGGCCATCGAAACAGCCATGAGCCAGATCGAAAAGGCCTTCGGCAAGGGCTCGA TCATGAAACTGGGCGCCGAGAGCAAACTCGACGTGCAGGTCGTCAGCACCGGCAGC CTCAGCCTTGACCTCGCACTGGGCGTGGGCGGCATTCCGCGTGGCCGCATCACCGAG ATCTACGGCCCCGAGTCGGGCGGCAAGACCACCCTGGCCCTCGCCATCGTCGCGCAG GCCCAGAAAGCGGGCGGCACCTGTGCGTTTATCGACGCCGAGCACGCGCTCGACCC GGTGTACGCCCGCGCCCTGGGCGTGAACACCGACGAACTGCTGGTGTCGCAGCCCG ACAACGGCGAGCAGGCGCTCGAAATCATGGAACTGCTGGTGCGTTCGGGCGCGATTG ATGTGGTGGTCGTGGACTCGGTGGCTGCTCTGACCCCCCGCGCCGAAATCGAGGGCG ACATGGGCGACAGCCTGCCCGGTCTTCAGGCCCGCCTGATGTCGCAGGCGCTGCGCA AGCTGACGGCGATTCTCTCCAAGACCGGCACCGCCGCCATCTTCATCAACCAGGTTC GCGAGAAAATCGGCGTGATGTACGGCAACCCCGAAACCACCACCGGGGGCCGGGCG CTGAAGTTCTACGCCAGCGTGCGCCTCGACGTGCGTAAGATCGGCCAGCCCACCAAG GTCGGCAACGACGCGGTCGCCAACACCGTCAAGATCAAGACCGTGAAGAACAAGGT CGCCGCCCCCTTCAAGGAAGTCGAACTCGCGCTGGTCTACGGCAAGGGCTTCGACCA GCTCAGCGACCTCGTGGGCCTGGCCGCCGACATGGACATCATCAAGAAGGCCGGCA GCTTCTACTCCTACGGCGACGAGCGCATCGGCCAGGGCAAGGAAAAGACCATCGCCT ACATCGCCGAGCGCCCCGAGATGGAGCAGGAAATCCGCGACCGCGTGATGGCCGCC ATCCGCGCGGGCAACGCGGGCGAAGCACCGGCCCTGGCCCCCGCGCCTGCCGCGCC CGAAGCCGCCGAAGCGTAA SEQ ID NO: 6 Novel typeRecA: ATGAGCAAGGACGCCACCAAAGAAATCTCCGCCCCCACCGACGCCAAGGAACGCAG CAAGGCCATCGAAACAGCCATGAGCCAGATCGAAAAGGCCTTCGGCAAGGGCTCGA TCATGAAACTGGGCGCCGAGAGCAAACTCGACGTGCAGGTCGTCAGCACCGGCAGC CTCAGCCTTGACCTCGCACTGGGCGTGGGCGGCATTCCGCGTGGCCGCATCACCGAG ATCTACGGCCCCGAGTCGGGCGGCAAGACCACCCTGGCCCTCGCCATCGTCGCGCA GGCCCAGAAAGCGGGCGGCACCTGTGCGTTTATCGACGCCGAGCACGCGCTCGACC CGGTGTACGCCCGCGCCCTGGGCGTGAACACCGACGAACTGCTGGTGTCGCAGCCC GACAACGGCGAGCAGGCGCTCGAAATCATGGAACTGCTGGTGCGTTCGGGCGCGAT TGATGTGGTGGTCGTGGACTCGGTGGCTGCTCTGACCCCCCGCGCCGAAATCGAGGG CGACATGGGCGACAGCCTGCCCGGTCTTCAGGCCCGCCTGATGTCGCAGGCGCTGC GCAAGCTGACGGCGATTCTCTCCAAGACCGGCACCGCCGCCATCTTCATCAACCAGG TTCGCGAGAAAATCGGCGTGATGTACGGCAACCCCGAAACCACCACCGGGGGCCGG GCGCTGAAGTTCTACGCCAGCGTGCGCCTCGACGTGCGTAAGATCGGCCAGCCCAC CAAGGTCGGCAACGACGCGGTCGCCAACACCGTCAAGATCAAGACCGTGAAGAACA AGGTCGCCGCCCCCTTCAAGGAAGTCGAACTCGCGCTGGTCTACGGCAAGGGCTTCG ACCAGCTCAGCGACCTCGTGGGCCTGGCCGCCGACATGGACATCAAAAATGGCTGGT ATGCTCGTGAATTTCTTGACGAAGAAACTGGCGAGATGATTCGCGAAGAAAAATCTT GGCGTGCAAAAGATACTAACTGCACTACATTCTGGATCAAGAAGGCCGGCAGCTTCT ACTCCTACGGCGACGAGCGCATCGGCCAGGGCAAGGAAAAGACCATCGCCTACATC GCCGAGCGCCCCGAGATGGAGCAGGAAATCCGCGACCGCGTGATGGCCGCCATCCG CGCGGGCAACGCGGGCGAAGCACCGGCCCTGGCCCCCGCGCCTGCCGCGCCCGAAG CCGCCGAAGCGTAA SEQ ID NO: 7 ASF-FP1: TGTGCCAATCTCGGTGTTGATGAGGAT SEQ ID NO: 8 ASF-RP1: CCACACCAACAATAACCACCACGATG SEQ ID NO: 9 ASF-P1: GTTCCAGGTAGGTTTTAATCCTATAAACA/I6FAMdT/A/idSP/A/IBHQ1dT/TCAATGGGCC AT SEQ ID NO: 10 ASF-FP2: CCGAACTTGTGCCAATCTCGGTGTTGATG SEQ ID NO: 11 ASF-RP2: AACGCAGGTGACCCACACCAACAATAACC SEQ ID NO: 12 ASF-P2: TAGGTTTTAATCCTATAAACATATAT/I6FAMdT/C/idSP/A/IBHQ1dT/GGGCCATTTAAGAG C SEQ ID NO: 13 AAAAATGGCTGGTATGCTCGTGAATTTCTTGACGAAGAAACTGGCGAGATGATTCGC GAAGAAAAATCTTGGCGTGCAAAAGATACTAACTGCACTACATTCTGG