Use of insecticidal protein

Abstract

Related is a use of an insecticidal protein. The insecticidal protein may be used to control Monolepta hieroglyphica (Motschulsky). A method for controlling the Monolepta hieroglyphica (Motschulsky) includes: allowing the Monolepta hieroglyphica (Motschulsky) to be at least in contact with an ACh1 protein. In the present application, the Monolepta hieroglyphica (Motschulsky) is controlled through producing the ACh1 protein that can kill the Monolepta hieroglyphica (Motschulsky) in bacteria and/or a plant in vivo.

Claims

1. A method for controlling Monolepta hieroglyphica (Motschulsky), comprising allowing the Monolepta hieroglyphica (Motschulsky) to be at least in contact with an ACh1 protein; preferably, the ACh1 protein is present in a host cell that produces at least the ACh1 protein, and the Monolepta hieroglyphica (Motschulsky) is in contact with at least the ACh1 protein by ingesting the host cell; and more preferably, the ACh1 protein is present in at least a bacterium or a transgenic plant that generates the ACh1 protein, the Monolepta hieroglyphica (Motschulsky) is in contact with at least the ACh1 protein by ingesting the bacterium or a tissue of the transgenic plant, and after contacting, the growth of the Monolepta hieroglyphica (Motschulsky) is inhibited and/or death is caused, so as to achieve the control of the damage of the Monolepta hieroglyphica (Motschulsky) to plants.

2. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 1, wherein the transgenic plant is soybean, wheat, barley, corns, tobacco, rice, rape, cotton, or sunflowers.

3. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 1, wherein the tissue of the transgenic plant is a root, a leaf, a stem, a tassel, an ear, an anther, or a filament.

4. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 1, wherein the ACh1 protein is an ACh1_1 protein, an ACh1_2 protein, an ACh1_3 protein, or an ACh1_4 protein.

5. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 4, wherein the ACh1 protein has an amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.

6. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 4, wherein a nucleotide sequence of the ACh1 protein in the bacteria is shown in SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8; and a nucleotide sequence of the ACh1 protein in the transgenic plant is shown in SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

7. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 1, wherein the transgenic plant further comprises at least a second nucleotide different from the nucleotide encoding the ACh1 protein.

8. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 7, wherein the second nucleotide encodes a Cry-like insecticidal protein, a Vip-like insecticidal protein, a protease inhibitor, lectin, α-amylase, or a peroxidase.

9. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 8, wherein the second nucleotide encodes a Cry3Bb protein.

10. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 9, wherein the Cry3Bb protein has an amino acid sequence shown in SEQ ID NO:13.

11. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 10, wherein the second nucleotide has a nucleotide sequence shown in SEQ ID NO:14.

12. The method for controlling Monolepta hieroglyphica (Motschulsky) according to claim 7, wherein the second nucleotide is a dsRNA that inhibits an important gene in a target insect pest.

13. A method of producing a plant for controlling Monolepta hieroglyphica (Motschulsky), comprising introducing a polynucleotide sequence encoding an ACh1 protein into a genome of the plant.

14. The method of producing a plant for controlling Monolepta hieroglyphica (Motschulsky) according to claim 13, wherein the polynucleotide sequence of the ACh1 protein is shown in SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

15. The method of producing a plant for controlling Monolepta hieroglyphica (Motschulsky) according to claim 13, wherein the ACh1 protein has an amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.

16. A method of producing a plant seed for controlling Monolepta hieroglyphica (Motschulsky), comprising hybridizing a plant obtained by the method according to claim 13 with a second plant, so as to produce a seed containing a polynucleotide sequence encoding an ACh1 protein.

17. A method of cultivating a plant for controlling Monolepta hieroglyphica (Motschulsky), comprising: planting at least one plant seed, wherein the genome of the plant seed comprises a polynucleotide sequence encoding an ACh1 protein; growing the plant seed into a plant; and growing the plant under conditions that the Monolepta hieroglyphica (Motschulsky) is artificially inoculated and/or the hazard of the Monolepta hieroglyphica (Motschulsky) naturally occurs, and harvesting a plant that has an attenuated plant damage and/or has an increased plant yield compared with other plants that do not have the polynucleotide sequences encoding the ACh1 protein.

18. The method of cultivating a plant for controlling Monolepta hieroglyphica (Motschulsky) according to claim 17, wherein the polynucleotide sequence of the ACh1 protein is shown in SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, or SEQ ID NO:12.

19. The method of cultivating a plant for controlling Monolepta hieroglyphica (Motschulsky) according to claim 17, wherein the ACh1 protein has an amino acid sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0083] FIG. 1 is a construction flowchart of a recombinant expression vector DBN01-P containing an ACh1 nucleotide sequence for the use of the insecticidal protein according to the present disclosure.

[0084] FIG. 2 is a construction flowchart of a recombinant expression vector DBN01-T containing an ACh1 nucleotide sequence for the use of the insecticidal protein according to the present disclosure.

[0085] FIG. 3 is a construction flowchart of a plant recombinant expression vector DBN01-B containing an ACh1 nucleotide sequence for the use of the insecticidal protein according to the present disclosure.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0086] The technical schemes of the use of the insecticidal protein of the present disclosure are further described below by specific embodiments.

First Embodiment: Acquisition and Synthesis of Gene

1. Acquisition of the Nucleotide Sequence

[0087] An amino acid sequence of an ACh1_1 insecticidal protein (309 amino acids) is shown in SEQ ID NO:1 in a sequence listing. An ACh1_1 bacterial nucleotide sequence (930 nucleotides) encoding the amino acid sequence corresponding to the ACh1_1 insecticidal protein in bacteria is shown in SEQ ID NO: 5 in the sequence listing. An ACh1_1 plant nucleotide sequence (930 nucleotides) encoding the amino acid sequence corresponding to the ACh1_1 insecticidal protein is shown in SEQ ID NO:9 in the sequence listing.

[0088] An amino acid sequence of an ACh1_2 insecticidal protein (306 amino acids) is shown in SEQ ID NO:2 in a sequence listing. An ACh1_2 bacterial nucleotide sequence (921 nucleotides) encoding the amino acid sequence corresponding to the ACh1_2 insecticidal protein in bacteria is shown in SEQ ID NO: 6 in the sequence listing. An ACh1_2 plant nucleotide sequence (921 nucleotides) encoding the amino acid sequence corresponding to the ACh1_2 insecticidal protein is shown in SEQ ID NO:10 in the sequence listing.

[0089] An amino acid sequence of an ACh1_3 insecticidal protein (309 amino acids) is shown in SEQ ID NO:3 in a sequence listing. An ACh1_3 bacterial nucleotide sequence (930 nucleotides) encoding the amino acid sequence corresponding to the ACh1_3 insecticidal protein in bacteria is shown in SEQ ID NO: 7 in the sequence listing. An ACh1_3 plant nucleotide sequence (930 nucleotides) encoding the amino acid sequence corresponding to the ACh1_3 insecticidal protein is shown in SEQ ID NO:11 in the sequence listing.

[0090] An amino acid sequence of an ACh1_4 insecticidal protein (309 amino acids) is shown in SEQ ID NO:4 in a sequence listing. An ACh1_4 bacterial nucleotide sequence (930 nucleotides) encoding the amino acid sequence corresponding to the ACh1_4 insecticidal protein in bacteria is shown in SEQ ID NO: 8 in the sequence listing. An ACh1_4 plant nucleotide sequence (930 nucleotides) encoding the amino acid sequence corresponding to the ACh1_4 insecticidal protein is shown in SEQ ID NO:12 in the sequence listing.

2. Synthesis of Above Nucleotide Sequence

[0091] The bacterial nucleotide sequences (as shown in SEQ ID NO:5 to SEQ ID NO:8 in the sequence listing) of ACh1_1, ACh1_2, ACh1_3, and ACh1_4 and the plant nucleotide sequence (as shown in SEQ ID NO:9) of ACh1_1 are synthesized.

Second Embodiment: Construction of Recombinant Expression Vector and Transformation Of Recombinant Expression Vector into Escherichia Coli to Obtain ACh1 Protein

1. Construction of Recombinant Expression Vector Containing ACh1 Gene

[0092] The ACh1_1 bacterial nucleotide sequence synthesized in the first embodiment is linked into a protein expression vector pET28a (Novagen, USA, CAT: 69864-3); operation steps are performed according to the specification of the product pET28a vector of Novagen, so as to obtain a recombinant expression vector DBN01-P; and a construction flow is shown in FIG. 1 (where Kan represents a kanamycin resistance gene, f1 ori represents the origin of replication of phage f1, Lacl is a Lacl initiation codon, ACh1_1 is an ACh1_1 bacterial nucleotide sequence (SEQ ID NO:5), and MCS represents multiple cloning sites).

[0093] According to the above method for constructing the recombinant expression vector DBN01-P, the synthesized ACh1_2 bacterial nucleotide sequence is linked to the protein expression vector pET28a, so as to obtain a recombinant expression vector DBN02-P, and ACh1_2 is the ACh1_2 bacterial nucleotide sequence (SEQ ID NO:6).

[0094] According to the above method for constructing the recombinant expression vector DBN01-P, the synthesized ACh1_3 bacterial nucleotide sequence is linked to the protein expression vector pET28a, so as to obtain a recombinant expression vector DBN03-P, and ACh1_3 is the ACh1_3 bacterial nucleotide sequence (SEQ ID NO:7).

[0095] According to the above method for constructing the recombinant expression vector DBN01-P, the synthesized ACh1_4 bacterial nucleotide sequence is linked to the protein expression vector pET28a, so as to obtain a recombinant expression vector DBN04-P, and ACh1_4 is the ACh1_4 bacterial nucleotide sequence (SEQ ID NO:8).

2. Transformation of Recombinant Expression Vector Into Escherichia Coli to Obtain ACh1 Protein

[0096] Then, the recombinant expression vectors DBN01-P, DBN02-P, DBN03-P, and DBN04-P are transformed into Escherichia coli BL21(DE3) competent cells (Transgen, China, CAT: CD501) by a heat shock method; a positive colony is picked and placed in an LB liquid medium (10 g/L of a tryptone, 5 g/L of a yeast extract, 10 g/L of NaCl, 100 mg/L of an ampicillin, and pH is adjusted to 7.5 with NaOH); and culture is performed for 16h at 37° C. and at 200 r/min. The culture solution is then transferred to an YT culture medium according to the proportion of 1:10; and culture is performed at 37° C. and at 200 r/min. When an OD=600 value of the culture solution reaches 0.6-0.8, IPTG is added until a final concentration is 0.5 mM, so as to perform inducible expression for 6h, and the culture solution is centrifuged to collect the cells; the supernatant is discarded, resuspending is performed after PBS is added, and then ultrasonic disruption is performed; and the expression protein is detected by SDS-PAGE, the protein concentration is estimated, and preservation is performed at -20° C. for later use.

Third Embodiment, Identification of Inhibitory Activity Against Monolepta Hieroglyphica (Motschulsky) by Feeding ACh1 Protein

[0097] Inhibitory activity against the Monolepta hieroglyphica (Motschulsky), the Callosobruchus chinensis (Linnaeus) and the Henosepilachna vigintioctomaculata (Motschulsky) is detected by using the ACh1_1, ACh1_2, ACh1_3, and ACh1_4 proteins obtained in 2 in Embodiment II. A total of 4 treatments are designed for each pest, which respectively are ACh1_1, ACh1_2, ACh1_3, and ACh1_4; and 1 negative control treatment is designed, which is GFP.

[0098] Monolepta hieroglyphica (Motschulsky): protein liquid of ACh1_1, ACh1_2, ACh1_3, ACh1_4, and GFP are respectively mixed in feed, and a final concentration is 50 .Math.g/g. Each group of treatments is repeated for 3 times.

[0099] Callosobruchus chinensis (Linnaeus): mung beans are immersed in the protein liquid of ACh1_1, ACh1_2, ACh1_3, ACh1_4, and GFP according to the concentration of 50 .Math.g/g. Each group of treatments is repeated for 3 times.

[0100] Henosepilachna vigintioctomaculata (Motschulsky): potato leaves are immersed in the protein liquid of ACh1_1, ACh1_2, ACh1_3, ACh1_4, and GFP according to the concentration of 50 .Math.g/g. Each group of treatments is repeated for 3 times.

TABLE-US-00001 Results of Monolepta hieroglyphica (Motschulsky), the Callosobruchus chinensis (Linnaeus) and the Henosepilachna vigintioctomaculata (Motschulsky) by feeding ACh1 protein Test insect Serial number of proteins Monolepta hieroglyphica (Motschulsky) Callosobruchus chinensis (Linnaeus) Henosepilachna vigintioctomaculata (Motschulsky) ACh1_1 + - - ACh1_2 + - - ACh1_3 + - - ACh1_4 + - - GFP - - - “+” means that there is an inhibitory activity against the pest; and “-” means that there is no inhibitory activity against the pest

[0101] Results of Table 1 show that, the ACh1_1, ACh1_2, ACh1_3, and ACh1_4 proteins have desirable inhibitory activity against the Monolepta hieroglyphica (Motschulsky), and have no inhibitory activity against on the Callosobruchus chinensis (Linnaeus) (same family) and the Henosepilachna vigintioctomaculata (Motschulsky) that belong to the same Coleoptera.

[0102] The above results fully indicate that the toxicity of the insecticidal toxin protein to insects is not necessarily related to the family of insects, but is inseparable from the mechanism of action of the insecticidal protein. That is to say, the enzymatic cleavage activation in insect gut, receptor binding on the insect gut and a physicochemical environment in the insect gut are key points for achieving the effect of a β-pore forming toxin, and the interaction between the β-pore forming protein and enzymes and receptors in insects is complex and unpredictable.

Fourth Embodiment, Construction of Plant Expression Vector

1. Construction of Recombinant Cloning Vector Containing ACh1 Gene

[0103] The synthesized ACh1_1 plant nucleotide sequence is linked to a cloning vector pGEM-T (Promega, Madison, USA, CAT: A3600), and an operation step is performed according to instructions of a pGEM-T vector product of Promega Company, to obtain a recombinant cloning vector DBN01-T, and its construction process is shown in FIG. 2 (herein, Amp represents an ampicillin resistance gene; flori represents the origin of replication of phage f1; LacZ is an LacZ initiation codon; SP6 is an SP6 RNA polymerase promoter; T7 is a T7 RNA polymerase promoter; ACh1_1 is the ACh1_1 plant nucleotide sequence (SEQ ID NO:9); and MCS represents multiple cloning sites).

[0104] Then, the recombinant cloning vector DBN01-T is transformed into Escherichia coli T1 competent cells (Transgen, Beijing, China, CAT: CD501) by a heat shock method, and a white bacterial colony is picked, and placed in a Luria-Bertani (LB) liquid medium (10 g/L of a tryptone, 5 g/L of a yeast extract, 10 g/L of NaCl, 100 mg/L of an ampicillin, and pH is adjusted to 7.5 with NaOH) and cultured overnight at 37° C. Plasmids thereof are extracted by an alkaline method and stored at -20° C. for future use.

[0105] After the extracted plasmid is identified by enzyme digestion, the positive colonies are sequenced and verified, and results show that the ACh1_1 nucleotide sequence inserted in the recombinant cloning vector DBN01-T is the nucleotide sequence shown in the sequence listing (SEQ ID NO:9). That is to say, the ACh1_1 plant nucleotide sequence is correctly inserted.

2. Construction of the Recombinant Expression Vector Containing the ACh1 Gene

[0106] The recombinant cloning vector DBN01-T and the expression vector DBNBC-01 (vector framework: pCAMBIA2301 (provided by the CAMBIA institution)) are digested with restriction endonucleases, and an excised ACh1_1 plant nucleotide sequence fragment is inserted between the restriction endonuclease sites of the expression vector DBNBC-01. It is well-known to those skilled in the art to construct a vector with a conventional enzyme digestion method, the recombinant expression vector DBN01-B is constructed, and the construction flow is shown in FIG. 3 (Kan: kanamycin gene; RB: right border; prUbi: maize ubiquitin gene promoter (SEQ ID NO:15); ACh1_1: ACh1_1 plant nucleotide sequence (SEQ ID NO:9); tNos: terminator of nopaline synthase gene (SEQ ID NO:16); Hpt: hygromycin phosphotransferase gene (SEQ ID NO:17); and LB: left border).

[0107] The recombinant expression vector DBN01-B is transformed into the Escherichia coli T1 competent cells with the heat shock method; the white colony is picked and placed in the LB liquid medium (10 g/L of the tryptone, 5 g/L of the yeast extract, 10 g/L of NaCl, 50 mg/L of the kanamycin, and pH is adjusted to 7.5 with NaOH); and culture is performed overnight at 37° C., and plasmids thereof are extracted by an alkaline method. The extracted plasmid is identified by the restriction endonuclease digestion, and the positive colonies are sequenced and identified. The results show that the nucleotide sequence in the recombinant expression vector DBN01-B is the nucleotide sequence shown in SEQ ID NO:9 in the sequence listing, that is, the ACh1_1 plant nucleotide sequence.

3. Transformation of the Recombinant Expression Vector Into an Agrobacterium

[0108] The correctly constructed recombinant expression vector DBN01-B is transformed into agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) through a liquid nitrogen method, and the transformation conditions are as follows: 100 .Math.l of the agrobacterium LBA4404, and 3 .Math.l of a plasmid DNA (the recombinant expression vector); it is placed in liquid nitrogen for 10 minutes, and a warm water bath is performed at 37° C. for 10 minutes; the transformed agrobacterium LBA4404 is inoculated in an LB tube, cultured for 2 hours under conditions of a temperature of 28° C. and a rotation speed of 200 rpm, and spread on an LB plate containing 50 mg/L of rifampicin and 100 mg/L of kanamycin until positive monoclones grow, the monoclones are picked for culture and plasmids thereof are extracted, the restriction endonuclease is used to verify the recombinant expression vector DBN01-B after being enzyme-digested, and results show that the structure of the recombinant expression vector DBN01-B is completely correct.

Fifth Embodiment, Obtaining of Transgenic Corn Plant

[0109] According to the conventional agrobacterium infection method, the immature embryos of the aseptically cultured maize variety Zong 31 (Z31) are co-cultured with the agrobacterium transformed with the recombinant expression vector described in step 3 in the fourth embodiment, to transfer the T-DNA (including the promoter sequence of maize ubiquitin gene, the ACh1_1 nucleotide sequence, the Hpt gene and the Nos terminator sequence) in the recombinant expression vector DBN01-B constructed in step 2 in the fourth embodiment into a maize genome, so as to obtain a corn plant transformed with the ACh1_1 nucleotide sequence. In addition, a wild corn plant is used as a control.

[0110] For agrobacterium-mediated transformation of corns, briefly, immature embryos are isolated from the corns and are in contact with agrobacterium suspension. The agrobacterium can deliver the ACh1_1 nucleotide sequence to at least one cell (step 1: infection step) of one of the embryos. In this step, the embryos are preferably immersed in the agrobacterium suspension (OD.sub.660=0.4-0.6, an infection medium (4.3 g/L of MS salt, MS vitamins, 300 mg/L of casein, 68.5 g/L of sucrose, 36 g/L of glucose, 40 mg/L of Acetosyringone (AS), and 1 mg/L of 2,4-dichlorophenoxyacetic acid (2,4-D), pH 5.3) to initiate inoculation. The embryos are co-cultured with the agrobacterium for a period of time (3 days) (Step 2: co-culture step). Preferably, the embryos are cultured in a solid culture medium (4.3 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 20 g/L of sucrose, 10 g/L of glucose, 100 mg/L of AS, 1 mg/L of 2,4-D, and 8 g/L of agar, pH5.8) after the infection step. After this co-culture phase, there may be an optional “recovery” step. In the “recovery” step, in a recovery culture medium (4.3 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of 2,4-D, and 8 g/L of agar, pH5.8), there is at least one antibiotic (cephalosporin) known to inhibit the growth of the agrobacterium, and a selective agent for a plant transformant (Step 3: recovery step) is not added. Preferably, the embryos are cultured on a solid medium with the antibiotic without the selective agent, as to eliminate the agrobacterium and provide a recovery period for infected cells. Next, the inoculated embryos are grown on a culture medium containing the selective agent (hygromycin) and a grown transformed callus is selected (Step 4: selection step). Preferably, the embryos are cultured in the solid culture medium (4.3 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 5 g/L of sucrose, 50 mg/L of hygromycin, 1 mg/L of 2,4-D, and 8 g/L of agar, pH5.8) containing the selective agent, so as to cause the transformed cells to selectively grow. The callus are then regenerated into plants (Step 5: regeneration step), preferably, the callus grown on the medium containing the selective agent is cultured on the solid medium (MS differentiation medium and MS rooting medium) to regenerate the plant.

[0111] The screened resistant callus are transferred to the MS differentiation medium (4.3 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 30 g/L of sucrose, 2 mg/L of 6-benzyladenine, 50 mg/L of hygromycin, and 8 g/L of agar, pH5.8), and culture differentiation is performed at 25° C. The differentiated seedling is transferred to the MS rooting medium (2.15 g/L of the MS salt, the MS vitamins, 300 mg/L of casein, 30 g/L of sucrose, 1 mg/L of indole-3-acetic acid, and 8 g/L of agar, pH5.8); and the seedling is cultured to a height of about 10 cm at 25° C., and then moved to a greenhouse to grow until fruiting. In the greenhouse, culture is performed for 16h at 28° C. every day, and then culture is performed for 8 h at 20° C.

Sixth Embodiment: Verification of Transgenic Maize Plants With TaqMan

[0112] About 100 mg of leaves of the corn plant transformed with the ACh1_1 plant nucleotide sequence is taken as a sample, and the genome DNA is extracted with DNeasy Plant Maxi Kit of Qiagen, and the copy number of the Hpt gene is detected by a Taqman probe fluorescence quantitative PCR method to determine the copy number of the ACh1_1 gene. At the same time, the wild corn plant is used as a control, and the detection and analysis are performed according to the above method. The experiment is repeated for 3 times, and the average value is taken.

[0113] A specific method to detect the copy number of the Hpt gene is as follows.

[0114] Step 11, 100 mg of the leaves of the corn plant transformed with the ACh1_1 nucleotide sequence and the wild corn plant are taken respectively, and ground into uniform slurry with liquid nitrogen in a mortar, and 3 replicates for each sample are taken.

[0115] Step 12, Qiagen’s DNeasy Plant Mini Kit is used to extract the genome DNA of the above samples, and a specific method refers to its product specification.

[0116] Step 13, NanoDrop 2000 (Thermo Scientific) is used to measure the genome DNA concentration of the above samples.

[0117] Step 14, the genome DNA concentration of the above samples is adjusted to the same concentration value, and the range of the concentration value is 80-100 ng/.Math.l.

[0118] Step 15, the Taqman probe fluorescence quantitative PCR method is used to identify the copy number of the sample, the sample with the known copy number after the identification is used as a standard substance, and the sample of the wild corn plant is used as a control, 3 replicates for each sample are taken, and its average value is taken; and fluorescence quantitative PCR primer and probe sequences are as follows.

[0119] The following primers and probes are used to detect the Hpt nucleotide sequence.

[0120] Primer 1: cagggtgtcacgttgcaaga is as shown in SEQ ID NO:18 in the sequence listing.

[0121] Primer 2: ccgctcgtctggctaagatc is as shown in SEQ ID NO:19 in the sequence listing.

[0122] Probe 1: tgcctgaaaccgaactgcccgctg is as shown in SEQ ID NO:20 in the sequence listing.

[0123] A PCR reaction system is as follows.

TABLE-US-00002 JumpStart™ Taq ReadyMix™ (Sigma) 10 .Math.l 50× primer/probe mixture 1 .Math.l Genomic DNA 3 .Math.l Water (ddH.sub.2O) 6 .Math.l

[0124] The 50× primer/probe mixture contains 45 .Math.l of each primer at a concentration of 1 mM, 50 .Math.l of the probe at a concentration of 100 .Math.M and 860 .Math.l of 1×TE buffer, and is stored in a centrifuge tube at 4° C.

[0125] PCR reaction conditions are as follows.

TABLE-US-00003 Step Temperature Time 21 95° C. 5 min 22 95° C. 30 s 23 60° C. 1 min 24 Returning to Step 22, and repeating for 40 times

[0126] Data is analyzed with SDS 2.3 software (Applied Biosystems).

[0127] The experimental results by analyzing the copy number of the Hpt genes show that, the ACh1_1 nucleotide sequence has been integrated into the genome of the tested corn plants, and the corn plants transformed with the ACh1_1 nucleotide sequence all obtain single-copy transgenic corn plants.

Seventh Embodiment, Identification of Inhibitory Activity of Transgenic Corn Plants

[0128] The corn plant transformed with the ACh1_1 nucleotide sequence, the corresponding wild corn plant, and the corn plant identified as non-transgenic by Taqman are detected for the inhibitory activity against the Monolepta hieroglyphica (Motschulsky).

[0129] Fresh leaves (heart leaves) of the corn plant transformed with the ACh1_1 nucleotide sequence, the wild corn plant, and the corn plant (Stage V3-V4) identified as non-transgenic by Taqman are taken respectively, washed with sterile water and dried with gauze; then, the veins are removed from the corn leaves, the leaves are cut into strips of about 1 cm × 2 cm, and 1 piece of the cut strip-like leaf is taken and put the leaf on a moisturizing filter paper at the bottom of a circular plastic petri dish; 10 Monolepta hieroglyphica (Motschulsky) (larvae) are put in each petri dish; after the insect-testing petri dish is covered, the petri dish is put for 1 day under the conditions of a temperature of 24±2° C., a relative humidity of 70%-80%, and a photoperiod (light/dark) of 24:0; from the second day after infestation, the positive leaves are replaced every 2 days until the end of the experiment at Day 10 to test whether there was a significant difference in survival rate. A total of 3 lines are transformed into ACh1_1 nucleotide sequence, 1 line is identified as non-transgenic (NGM) by Taqman, and 1 line is identified as wild (CK). 5 plants are selected from each line for test, and each plant is tested repeatedly for 3 times. Results are shown in Table 2.

TABLE-US-00004 Inhibitory activity experimental results of transgenic corn plants inoculated with Monolepta hieroglyphica (Motschulsky) Test insect Serial number of proteins Monolepta hieroglyphica (Motschulsky) ACh1_1 + NGM - CK - “+” means that there is an inhibitory activity against pest; and “-” means that there is no inhibitory activity against pest

[0130] The results show that the corn plants transformed with the ACh1_1 nucleotide sequence have a desirable lethal effect on the Monolepta hieroglyphica (Motschulsky). Therefore, it indicates that the ACh1_1 protein shows resistance activity against the Monolepta hieroglyphica (Motschulsky) both in bacteria and in plants, and this activity is sufficient to have adverse effects on the growth of the Monolepta hieroglyphica (Motschulsky), so that the Monolepta hieroglyphica (Motschulsky) can be controlled in the fields. In addition, it is also possible to reduce the occurrence of diseases on the transgenic ACh1 plants by controlling the damage of the Monolepta hieroglyphica (Motschulsky), thereby greatly improving the yield and quality of the transgenic ACh1 plants.

[0131] In conclusion, through the use of the insecticidal protein of the present disclosure, ACh1 protein that can kill the Monolepta hieroglyphica (Motschulsky) is produced in bacteria and/or a plant body to control the Monolepta hieroglyphica (Motschulsky). Compared with an agricultural control method, a chemical control method, a physical control method and a biological control method used in the prior art, the present disclosure achieves the protection of whole growth period and whole plant on the plants so as to control the infestation of the Monolepta hieroglyphica (Motschulsky), and is pollution-free, residue-free, stable in effect, thorough, simple, convenient and economical.

[0132] Finally, it should be noted that the above embodiments are only used to illustrate the technical schemes of the present disclosure and not to limit them. Although the present disclosure is described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical schemes of the present disclosure may be modified or equivalently replaced without departing from the spirit and scope of the technical schemes of the present disclosure.