PRODUCTION OF ORGANIC ACIDS FROM ASPERGILLUS CIS-ACONITIC ACID DECARBOXYLASE (CADA) DELETION STRAINS

20190323020 ยท 2019-10-24

Assignee

Inventors

Cpc classification

International classification

Abstract

This application provides recombinant Aspergillus fungi having an endogenous cis-aconitic acid decarboxylase (cadA) gene genetically inactivated, which allows aconitic acid production by the recombinant fungi. Such recombinant fungi can further include an exogenous nucleic acid molecule encoding aspartate decarboxylase (panD), an exogenous nucleic acid molecule encoding -alanine-pyruvate aminotransferase (BAPAT), and an exogenous nucleic acid molecule encoding 3-hydroxypropironate dehydrogenase (HPDH). Kits including these fungi, and methods of using these fungi to produce aconitic acid and 3-hydroxypropionic acid (3-HP) are also provided.

Claims

1. An isolated recombinant Aspergillus fungus comprising a genetic inactivation of an endogenous cis-aconitic acid decarboxylase (cadA) gene.

2. The isolated recombinant Aspergillus fungus of claim 1, wherein the Aspergillus fungus is Aspergillus pseudoterreus.

3. The isolated recombinant Aspergillus fungus of claim 1, wherein the Aspergillus fungus is Aspergillus terreus.

4. The isolated recombinant Aspergillus fungus of claim 1, wherein the endogenous cadA gene is genetically inactivated by complete or partial deletion mutation or by insertional mutation.

5. The isolated recombinant Aspergillus fungus of claim 1, wherein the cadA gene prior to its genetic inactivation encodes a protein having at least 80% sequence identity to SEQ ID NO: 50 or 52.

6. The isolated recombinant Aspergillus fungus of claim 1, wherein the cadA gene prior to its genetic inactivation comprises a coding sequence comprising at least 80% sequence identity to SEQ ID NO:49, 51, 59 or 92.

7. The isolated recombinant Aspergillus fungus of claim 1, further comprising an exogenous nucleic acid molecule encoding aspartate 1-decarboxylase (panD), an exogenous nucleic acid molecule encoding -alanine-pyruvate aminotransferase (BAPAT), and an exogenous nucleic acid molecule encoding 3-hydroxypropionate dehydrogenase (HPDH).

8. The isolated recombinant Aspergillus fungus of claim 7, wherein the exogenous nucleic acid molecule encoding panD comprises at least 80% sequence identity to SEQ ID NO: 53 or 65, and/or encodes a panD protein comprising at least 80% sequence identity to SEQ ID NO: 54.

9. The isolated recombinant Aspergillus fungus of claim 7, wherein the exogenous nucleic acid molecule encoding BAPAT comprises at least 80% sequence identity to SEQ ID NO: 55 or 71, and/or encodes a BAPAT protein comprising at least 80% sequence identity to SEQ ID NO: 56.

10. The isolated recombinant Aspergillus fungus of claim 7, wherein the exogenous nucleic acid molecule encoding HPDH comprises at least 80% sequence identity to SEQ ID NO: 57 or 80, and/or encodes a HPDH protein comprising at least 80% sequence identity to SEQ ID NO: 58.

11. The isolated recombinant Aspergillus fungus of claim 7, wherein the exogenous nucleic acid molecule encoding panD, the exogenous nucleic acid molecule encoding BAPAT, and the exogenous nucleic acid molecule encoding HPDH are part of a single exogenous nucleic acid molecule.

12. A composition comprising the isolated recombinant Aspergillus fungus of claim 1.

13. A kit, comprising: the isolated recombinant Aspergillus fungus of claim 1; and a medium for culturing the fungus.

14. A method of making aconitic acid, comprising: culturing the isolated recombinant Aspergillus fungus of claim 1 under conditions that permit the fungus to make aconitic acid; thereby making aconitic acid.

15. The method of claim 14, wherein the fungus is cultured in Riscaldati medium.

16. The method of claim 14, further comprising isolating the aconitic acid from culture media or from the fungus.

17. The method of claim 14, wherein the aconitic acid is cis-aconitic acid.

18. A method of making 3-hydroxypropionic acid (3-HP), comprising: culturing an isolated fungus of claim 7 under conditions that permit the fungus to make 3-HP; thereby making 3-HP.

19. The method of claim 18, wherein the fungus is cultured in Riscaldati medium or modified Riscaldati medium comprising 20 trace elements.

20. The method of claim 18, further comprising isolating the 3-HP from culture media or from the fungus.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0015] FIG. 1. Hypothesized itaconic acid (IA) production and transport pathway in Aspergillus pseudoterreus and Aspergillus terreus. Glucose is utilized by A. terreus and A. pseudoterreus to form pyruvate and is subsequently converted to citric acid for tricarboxylic acid (TCA) cycle in the mitochondria. Citric acid is dehydrated to cis-aconitic acid, which is then transported from mitochondria to cytosol through transporter mttA. In the cytosol, cis-aconitic acid is decarboxylated into itaconic acid and CO.sub.2 by cis-aconitic decarboxylase. Finally, itaconic acid secreted outside of cell through transporters, for example mfsA.

[0016] FIG. 2. Aspergillus pseudoterreus ATCC 32359 fermentation data for collecting samples for EST sequencing. A 20 L volume of Riscaldati production medium (see Riscaldati et al., J Biotechnol 2000, 83:219-230) in a 30 L working volume Sartorius fermenter was inoculated with 10.sup.6 A. pseudoterreus spores per ml. The three samples referred to as preproduction, production onset and production were collected at 40, 50 and 62 hours, respectively. Itaconic acid and glucose data are shown on the left y-axis and fungal ash free dry weight (AFDW) is shown on the right y-axis.

[0017] FIGS. 3A-3B. Aspergillus pseudoterreus IA Cluster Analysis after five days growth in Riscadati medium. Spores 0.510.sup.8 were inoculated into 50 ml of production media for IA production as described in Riscaldati et al. (J Biotechnol 2000, 83:219-230). The cultivation was performed at 30 C. on a rotary shaker at 150 rpm. At the end of five days, samples were obtained for HPLC analysis and biomass measurement. (A) Dry mass measurement of wild type and mutant strains (B) Itaconic acid production of wild type and mutant strains. The average obtained from three independent experiments are shown. Error bars represent standard deviations from the means.

[0018] FIG. 4. Kinetics of itaconic acid production by wild type A. pseudoterreus and tf strains grown in production media at 30 C. Spores 0.510.sup.8 were inoculated into 50 ml of production media for itaconic acid production as described in Riscaldati et al. (J Biotechnol 2000, 83:219-230). The cultivation was performed at 30 C. on a rotary shaker at 150 rpm. All experiments were done in three replicates. At day 2, 4, 6, and 7, HPLC analysis was performed to determine amount of IA produced. Each sample was measured in five replicates. Error bars represent standard deviation from the means.

[0019] FIG. 5. Real-time (RT)-PCR analysis of the relative levels of mttA, cadA, mfsA mRNAs in wild type and tf strains. Spores 0.510.sup.8 were inoculated into 50 ml of production media for itaconic acid production as described in Riscaldati et al. (J Biotechnol 2000, 83:219-230). The cultivation was performed at 30 C. on a rotary shaker at 150 rpm. All experiments were done in three biological replicates. At day 3, samples were collected and RNA was extracted for RT-PCR. The average of results obtained from five independent RNA preparations is shown. All transcript levels were measured in triplicate for each RNA preparation. Error bars represent standard deviations from the means. Compared to wild type, expression level of mttA, cadA and mfsA were decreased 57, 37 and 23 fold in the tf strain.

[0020] FIGS. 6A-6C. Aconitic acid production in cadA strain. The cultivation was performed at 30 C. on a rotary shaker at 150 rpm. All experiments were done in three biological replicates. (A) at day 5, only cadA produced cis-aconitic and trans-aconitic acid, while wild type and other mutants did not. (B) Time course of cis- and trans-aconitic acid production in cad strain over 10 days. (C) Comparison of total aconitic acid production between wild type and cadA mutant strains.

[0021] FIG. 7. Arrangement of transgene expression cassette for 3-HP Production in A. pseudoterreus with a synthetic beta-alanine pathway. A description of each

[0022] Fragment is described in Example 8. The relevant fragments were cloned into pBlueScript SK() vector linearized with restriction enzyme H3/PstI. The whole expression cassette was linearized with restriction enzyme XhoI for the protoplast transformation for homologous recombination at cadA locus.

[0023] FIG. 8. Southern blot confirmation of cadA gene interruption by 3HP transgene expression cassette (FIG. 7). The cadA gene in the transgenic strains #2 (3HP-2) and #6 (3HP-6) was disrupted by the homologous recombination, while the random integration occurred in the strains #4 (3HP-4) and #5 (3HP-5). No insertion was observed in strains #1 and #3.

[0024] FIGS. 9A-9B. 3-HP production. FIG. 8. Southern blot confirmation of cadA interruption by 3HP transgene expression construct (FIG. 7). A. pseudoterreus having a genetically inactivated cadA locus alone (cad1), or additionally expressing panD, BAPAT, and HPDH (3HP-2, 3HP-4, 3HP-5, and 3-HP6), were grown at 30 C. on a rotary shaker at 200 rpm for (A) 7 days, or (B) over 8 days, in the Riscaldati media with 20 TE, and 3-HP present in the supernatant measured using HPLC.

SEQUENCE LISTING

[0025] The nucleic acid sequences listed in the accompanying sequence listing are shown using standard abbreviations for nucleotide bases and amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The sequence listing submitted herewith, generated on Apr. 24, 2019, 80 kb, is herein incorporated by reference. In the accompanying sequence listing:

[0026] SEQ ID NOS: 1-8 are primers used to delete the tf gene in A. pseudoterreus.

[0027] SEQ ID NOS: 9-16 are primers used to delete the mttA gene in A. pseudoterreus.

[0028] SEQ ID NOS: 17-24 are primers used to delete the cadA gene in A. pseudoterreus.

[0029] SEQ ID NOS: 25-32 are primers used to delete the mfsA gene in A. pseudoterreus.

[0030] SEQ ID NOS: 33-40 are primers used to delete the p450 gene in A. pseudoterreus.

[0031] SEQ ID NOS: 41-42 are primers used to amplify mttA in A. pseudoterreus.

[0032] SEQ ID NOS: 43-44 are primers used to amplify cadA in A. pseudoterreus.

[0033] SEQ ID NOS: 45-46 are primers used to amplify mfsA in A. pseudoterreus.

[0034] SEQ ID NOS: 47-48 are primers used to amplify benA in A. pseudoterreus.

[0035] SEQ ID NOS: 49 and 50 are exemplary cadA nucleic acid and protein sequences, respectively, from A. terreus (GenBank Accession Nos. AB326105.1 and BAG49047.1).

[0036] SEQ ID NOS: 51 and 52 are exemplary cadA nucleic acid and protein sequences, respectively, from A. vadensis CBS 113365 (GenBank Accession Nos. XM_025706777.1 and XP_025563141.1).

[0037] SEQ ID NOS: 53 and 54 are exemplary aspartate 1-decarboxylase (panD) nucleic acid and protein sequences, respectively, from Tribolium castaneum (GenBank Accession Nos. NM_001102585.1 and NP_001096055.1). Coding sequence nt 41-1663.

[0038] SEQ ID NOS: 55 and 56 are exemplary -alanine-pyruvate aminotransferase (BAPAT) nucleic acid and protein sequences, respectively, from Bacillus cereus AH1272 (GenBank Accession Nos. ACMS01000158.1 (complement (10606 . . . 11961)) and EEL86940.1).

[0039] SEQ ID NOS: 57 and 58 are exemplary 3-hydroxypropionate dehydrogenase (HPDH) nucleic acid and protein sequences (GenBank Accession No. WP_000636571), respectively.

[0040] SEQ ID NO: 59 is an A. pseudoterreus 5-cadA nucleic acid sequence.

[0041] SEQ ID NOS: 60-61 are primers used to isolate an A. pseudoterreus 5-cadA gene.

[0042] SEQ ID NO: 62 is an A. niger gpdA promoter nucleic acid sequence.

[0043] SEQ ID NOS: 63-64 are primers used to isolate an A. niger gpdA promoter.

[0044] SEQ ID NO: 65 is panD cDNA of Tribolium castaneum with codon optimization for A. pseudoterreus.

[0045] SEQ ID NOS: 66-67 are primers used to isolate panD cDNA of Tribolium castaneum with codon optimization for A. pseudoterreus.

[0046] SEQ ID NO: 68 is a bidirectional terminator from A. niger elf3/multifunctional chaperone.

[0047] SEQ ID NOS: 69-70 are primers used to isolate bidirectional terminator from A. niger elf3/multifunctional chaperone.

[0048] SEQ ID NO: 71 is codon optimized synthetic cDNA of -alanine-pyruvate aminotransferase (BAPAT) of Bacillus cereus.

[0049] SEQ ID NOS: 72-73 are primers used to isolate a codon optimized synthetic cDNA of BAPAT of Bacillus cereus.

[0050] SEQ ID NO: 74 is an A. niger enol promoter.

[0051] SEQ ID NOS: 75-76 are primers used to isolate an A. niger enol promoter.

[0052] SEQ ID NO: 77 is an A. nidulans gpdA promoter.

[0053] SEQ ID NOS: 78-79 are primers used to isolate an A. nidulans gpdA promoter.

[0054] SEQ ID NO: 80 is the codon optimized synthetic cDNA of E. coli 3-hydroxypropionate dehydrogenase (HPDH).

[0055] SEQ ID NOS: 81-82 are primers used to isolate a codon optimized synthetic cDNA of E. coli HPDH.

[0056] SEQ ID NO: 83 is a trpC terminator of A. nidulans.

[0057] SEQ ID NOS: 84-85 are primers used to isolate the trpC terminator of A. nidulans.

[0058] SEQ ID NO: 86 is a trpC terminator of A. nidulans.

[0059] SEQ ID NOS: 87-88 are primers used to isolate a trpC terminator of A. nidulans.

[0060] SEQ ID NO: 89 is an A. oryzae ptrA selection marker gene.

[0061] SEQ ID NOS: 90-91 are primers used to isolate the A. oryzae ptrA selection marker gene.

[0062] SEQ ID NO: 92 is an A. pseudoterreus 3-cadA gene.

[0063] SEQ ID NOS: 93-94 are primers used to isolate an A. pseudoterreus 3-cadA gene fragment.

[0064] SEQ ID NO: 95 is a combination of Fragments 7 to 9 (SEQ ID NOS: 77, 80, and 83, respectively).

[0065] SEQ ID NO: 96 is a primer used to isolate Fragments 7 to 9 (in combination with SEQ ID NO: 88).

[0066] SEQ ID NO: 97 is a combination of Fragments 11 and 12 (SEQ ID NOS: 89 and 92, respectively).

[0067] SEQ ID NO: 98 is a primer used to isolate Fragments 11 to 12 (in combination with SEQ ID NO: 90).

DETAILED DESCRIPTION

[0068] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

[0069] The singular terms a, an, and the include plural referents unless context clearly indicates otherwise. Similarly, the word or is intended to include and unless the context clearly indicates otherwise. Hence comprising A or B means including A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, references and Genbank Accession numbers (the sequence available on Apr. 24, 2019) mentioned herein are incorporated by reference in their entireties. The materials, methods, and examples are illustrative only and not intended to be limiting.

[0070] In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:

[0071] 3-hydroxypropionate dehydrogenase (HPDH): EC 1.1.1.59 An enzyme that catalyzes the chemical reaction: 3-hydroxypropanoate+NAD.sup.+3-oxopropanoate+NADH+H.sup.+. The term HPDH includes any HPDH gene (such as a bacterial or fungal panD sequence), cDNA, mRNA, or protein, that is a HPDH that can covert 3-hydroxypropanoate and NAD into 3-oxopropanoate, NADH, and H.sup.+ and vice versa. Expression or increased expression of HPDH, for example in an Aspergillus also expressing BAPAT and panD and having a genetically inactivated cadA gene (cadA), results in a fungus that has an ability to produce more 3-HP than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60% at least 70%, at least 100%, at least 200%, at least 300%, or at least 400% more than a parent strain under the same growing conditions).

[0072] HPDH sequences are publicly available. For example, SEQ ID NO: 57 discloses an HPDH coding sequence and GenBank Accession No: WP_000636571 discloses an HPDH protein sequence (SEQ ID NO: 58); GenBank Accession Nos. FR729477.2 (nt 1005136 . . . 1005885) and CBY27203.1 disclose exemplary Yersinia enterocolitica subsp. palearctica Y11 HPDH nucleic acid and protein sequences, respectively; and GenBank Accession Nos: CP004083.1 (complement (1399227 . . . 1399973) and AJQ99264.1 disclose exemplary Enterobacteriaceae bacterium bta3-1 HPDH nucleic acid and protein sequences, respectively. However, one skilled in the art will appreciate that in some examples, a HPDH sequence can include variant sequences (such as allelic variants and homologs) that retain HPDH activity and when expressed in an Aspergillus also expressing BAPAT and panD and with a genetically inactivated cadA gene (cadA), results in a fungus that has an ability to produce more 3-HP than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60% at least 70%, at least 100%, at least 200%, at least 300%, or at least 400% more than a parent strain under the same growing conditions).

[0073] Aconitic acid: An organic acid with two isomers, cis- and trans-aconitic acid. The cadA fungi provided herein can be used to produce cis- and trans-aconitic acid.

##STR00001##

[0074] Aspartate 1-decarboxylase (panD): EC 4.1.1.11. An enzyme that catalyzes the chemical reaction: L-aspartatebeta-alanine+CO.sub.2. The term panD includes any panD gene (such as a bacterial or fungal panD sequence), cDNA, mRNA, or protein, that is a panD that can covert L-aspartate into beta-alanine+CO.sub.2 and vice versa. Expression or increased expression of panD, for example in an Aspergillus also expressing BAPAT and HPDH and having a genetically inactivated cadA gene (cadA), results in a fungus that has an ability to produce more 3-HP than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60% at least 70%, at least 100%, at least 200%, at least 300%, or at least 400% more than a parent strain under the same growing conditions) panD sequences are publicly available. For example, GenBank Accession Nos: NM_001102585.1 and NP_001096055.1 disclose Tribolium castaneum panD nucleic acid and protein sequences, respectively (SEQ ID NOS: 55 and 56); GenBank Accession Nos. CP002745.1 (complement (4249351 . . . 4249824)) and AEK63458.1 disclose exemplary Collimonas fungivorans Ter331 panD nucleic acid and protein sequences, respectively; and GenBank Accession Nos: CP029034.1 (nt 1201611 . . . 1201994) and AWE15802.1 disclose exemplary Bacillus velezensis panD nucleic acid and protein sequences, respectively. However, one skilled in the art will appreciate that in some examples, a panD sequence can include variant sequences (such as allelic variants and homologs) that retain panD activity and when expressed in an Aspergillus also expressing BAPAT and HPDH and with a genetically inactivated cadA gene (cadA), results in a fungus that has an ability to produce more 3-HP than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60% at least 70%, at least 100%, at least 200%, at least 300%, or at least 400% more than a parent strain under the same growing conditions).

[0075] -alanine-pyruvate aminotransferase (BAPAT): EC 2.6.1.18. An enzyme that can catalyze the reaction L-alanine+3-oxopropanoatebeta-alanine+pyruvate. The term BAPAT includes any BAPAT gene (such as a bacterial or fungal panD sequence), cDNA, mRNA, or protein, that is a BAPAT that can convert beta-alanine and pyuvate to L-alanine and 3-oxopropanoate [or malonic semialdehyde], and vice versa. Expression or increased expression of BAPAT, for example in an Aspergillus also expressing HPDH and panD and having a genetically inactivated cadA gene (cadA), results in a fungus that has an ability to produce more 3-HP than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60% at least 70%, at least 100%, at least 200%, at least 300%, or at least 400% more than a parent strain under the same growing conditions).

[0076] BAPAT sequences are publicly available. For example, GenBank Accession Nos: ACMS01000158.1 (complement (10606 . . . 11961)) and EEL86940.1 disclose Bacillus cereus AH1272 BAPAT nucleic acid and protein sequences, respectively (SEQ ID NOS: 55 and 56); GenBank Accession Nos. DF820429.1 (complement (241627 . . . 242967)) and GAK28710.1 disclose exemplary Serratia liquefaciens FK01 BAPAT nucleic acid and protein sequences, respectively; and GenBank Accession Nos: LGUJ01000001.1 complement (92812 . . . 94140) and KOY12524.1 disclose exemplary Bradyrhizobium diazoefficiens BAPAT nucleic acid and protein sequences, respectively. However, one skilled in the art will appreciate that in some examples, a BAPAT sequence can include variant sequences (such as allelic variants and homologs) that retain BAPAT activity and when expressed in an Aspergillus also expressing HPDH and panD and with a genetically inactivated cadA gene (cadA), results in a fungus that has an ability to produce more 3-HP than the parent strain (such as at least 20%, at least 30%, at least 40%, 50%, at least 60% at least 70%, at least 100%, at least 200%, at least 300%, or at least 400% more than a parent strain under the same growing conditions).

[0077] cadA (cis-aconitic acid decarboxylase): The cadA gene encodes an enzyme (EC 4.1.1.6) that catalyzes the chemical reaction cis-aconitateitaconate+CO.sub.2. The term cadA (or cadA) includes any cadA gene (such as a fungal cadA sequence), cDNA, mRNA, or protein, that is a cadA that can catalyze the decarboxylation of cis-aconitate to itaconate and CO.sub.2 and vice versa, and when genetically inactivated results in a fungus that produces more aconitic acid than the parent strain without a genetically inactivated cadA gene (such as at least 20%, at least 30%, at least 50%, at least 60%, at least 75%, at least 100%, at least 200%, at least 500%, or 1000% more than a parent strain under the same growing conditions, for example at day 5 of production). In some examples, a parental strain containing a functional native cadA sequence does not produce detectable aconitic acid. In some examples, genetic inactivation of cadA results in a fungus that produces more trans-aconitic acid than cis-aconitic acid at day 10 of production, (such as at least 2-fold, at least 3-fold, at least 4-fold, or at least 5-fold more at day 10 of production).

[0078] cadA sequences are publicly available for many species of Aspergillus. For example, GenBank Accession Nos: AB326105.1 and BAG49047.1 disclose Aspergillus terreus cadA nucleic acid and protein sequences, respectively (SEQ ID NOS: 49 and 50); GenBank Accession Nos: XM_025706777.1 and XP_025563141.1 disclose Aspergillus vadensis CBS 113365 cadA nucleic acid and protein sequences, respectively (SEQ ID NOS: 51 and 52); and GenBank Accession Nos: XM_025663103.1 and XP_025520527.1 disclose Aspergillus piperis CBS 112811 cadA nucleic acid and protein sequences, respectively. However, one skilled in the art will appreciate that in some examples, a cadA sequence can include variant sequences (such as allelic variants and homologs) that retain cadA activity but when genetically inactivated in Aspergillus results in a fungus that has an ability to produce more aconitic acid than the parent strain without a genetically inactivated cadA gene (such as at least 20%, at least 30%, at least 50%, at least 60%, at least 75%, at least 100%, at least 200%, at least 500%, or 1000% more than a parent strain under the same growing conditions, for example at day 5 of production).

[0079] Detectable: Capable of having an existence or presence ascertained. For example, production of aconitic acid or 3-HP is detectable if the signal generated is strong enough to be measurable.

[0080] Exogenous: The term exogenous as used herein with reference to nucleic acid and a particular cell refers to any nucleic acid that does not originate from that particular cell as found in nature. Thus, a non-naturally-occurring nucleic acid is considered to be exogenous to a cell once introduced into the cell. A nucleic acid that is naturally-occurring also can be exogenous to a particular cell. For example, an entire chromosome isolated from cell X is an exogenous nucleic acid with respect to cell Y once that chromosome is introduced into cell Y, even if X and Y are the same cell type.

[0081] In some examples, the panD, BAPAT, and HPDH nucleic acid or protein expressed in an Aspergillus terreus or Aspergillus pseudoterreus fungi does not naturally occur in the Aspergillus terreus or Aspergillus pseudoterreus fungi and is therefore exogenous to that fungi. For example, the panD, BAPAT, and HPDH nucleic acid molecule introduced into an Aspergillus terreus or Aspergillus pseudoterreus fungi can be from another organism, such as a bacterial panD, BAPAT, and HPDH sequence.

[0082] Genetic enhancement or up-regulation: When used in reference to the expression of a nucleic acid molecule, such as a gene, refers to any process which results in an increase in production of a gene product. A gene product can be RNA (such as mRNA, rRNA, tRNA, and structural RNA) or protein. Examples of processes that increase transcription include those that facilitate formation of a transcription initiation complex, those that increase transcription initiation rate, those that increase transcription elongation rate, those that increase processivity of transcription and those that relieve transcriptional repression (for example by blocking the binding of a transcriptional repressor). Gene up-regulation can include inhibition of repression as well as expression above an existing level. Examples of processes that increase translation include those that increase translational initiation, those that increase translational elongation and those that increase mRNA stability. In one example, additional copies of genes are introduced into a cell in order to increase expression of that gene in the resulting transgenic cell.

[0083] Gene up-regulation includes any detectable increase in the production of a gene product. In certain examples, production of a gene product increases by at least 1.5-fold, at least 2-fold, or at least 5-fold), such as aspartate decarboxylase (panD), -alanine-pyruvate aminotransferase (BAPAT), and 3-hydroxypropironate dehydrogenase (HPDH). For example, expression of a panD, BAPAT, and HPDH genes in Aspergillus (e.g., A. terreus) results in an Aspergillus strain having increased levels of the panD, BAPAT, and HPDH proteins, respectively, relative to the parent strain, which can permit the recombinant fungus to produce 3-HP. Genetic enhancement is also referred to herein as enhancing or increasing expression.

[0084] Genetic inactivation or down-regulation: When used in reference to the expression of a nucleic acid molecule, such as a gene, refers to any process which results in a decrease in production of a gene product. A gene product can be RNA (such as mRNA, rRNA, tRNA, and structural RNA) or protein. Therefore, gene down-regulation or deactivation includes processes that decrease transcription of a gene or translation of mRNA.

[0085] For example, a mutation, such as a substitution, partial or complete deletion, insertion, or other variation, can be made to a gene sequence that significantly reduces (and in some cases eliminates) production of the gene product or renders the gene product substantially or completely non-functional. For example, a genetic inactivation of the cadA gene in Aspergillus (e.g., A. pseudoterreus) results in Aspergillus having a non-functional or non-existent cadA protein, which results in the recombinant fungus to produce more aconitic acid. Genetic inactivation is also referred to herein as functional deletion.

[0086] Isolated: To be significantly separated from other agents. An isolated biological component (such as a nucleic acid molecule or protein) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component occurs, for example, other chromosomal and extra-chromosomal DNA and RNA, and proteins. Nucleic acid molecules and proteins which have been isolated include nucleic acid molecules and proteins purified by standard purification methods. The term also embraces nucleic acid molecules and proteins prepared by recombinant expression in a host cell as well as chemically synthesized proteins and nucleic acids. Samples of isolated biological components include samples of the biological component wherein the biological component represents greater than 90% (for example, greater than 95%, such as greater than 98%) of the sample.

[0087] An isolated microorganism (such as a cadA strain of Aspergillus) has been substantially separated or purified away from microorganisms of different types, strains, or species. Microorganisms can be isolated by a variety of techniques, including serial dilution and culturing and resistance to certain chemicals, such as antibiotics. In some examples, an isolated cadA strain of Aspergillus is at least 90% (for example, at least 95%, as at least 98%, at least 99%, or at least 99.99%) pure.

[0088] Mutation: A change in a nucleic acid sequence (such as a gene sequence) or amino acid sequence, for example as compared to a nucleic acid or amino acid sequence present in a wild-type or native organism. In particular examples, a mutation is introduced into a cadA gene in Aspergillus. Mutations can occur spontaneously, or can be introduced, for example using molecular biology methods (e.g., thereby generating a recombinant or transformed cell or microorganism). In particular examples, a mutation includes one or more nucleotide substitutions, deletions, insertions, or combinations thereof. In particular examples, the presence of one or more mutations in a gene can significantly inactivate and reduce expression of that gene.

[0089] Promoter: An array of nucleic acid control sequences which direct transcription of a nucleic acid. A promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. A promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription. In some examples, a promoter is bi-directional. Native and non-native promoters can be used to drive expression of a gene, such as panD, BAPAT, and HPDH. Exemplary promoters that can be used include but are not limited to: enol promoter from A. niger, and dth1 from A. nidulans or A. niger.

[0090] Examples of promoters include, but are not limited to the SV40 promoter, the CMV enhancer-promoter, and the CMV enhancer/-actin promoter. Both constitutive and inducible promoters can be used in the methods provided herein (see e.g., Bitter et al., Methods in Enzymology 153:516-544, 1987). Also included are those promoter elements which are sufficient to render promoter-dependent gene expression controllable for cell-type specific, tissue-specific, or inducible by external signals or agents; such elements may be located in the 5 or 3 regions of the gene. Promoters produced by recombinant DNA or synthetic techniques can also be used to provide for transcription of the nucleic acid sequences.

[0091] Recombinant: A recombinant nucleic acid molecule or protein is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. In particular examples, this artificial combination is accomplished by chemical synthesis or by the artificial manipulation of isolated segments of nucleic acids, for example, by genetic engineering techniques such as those described in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 3d ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N Y, 2001. The term recombinant includes nucleic acid molecules that have been altered solely by addition, substitution, or deletion of a portion of the nucleic acid molecule. A recombinant or transformed organism or cell, such as a recombinant Aspergillus, is one that includes at least one exogenous nucleic acid molecule, such as one used to genetically inactivate an endogenous cadA gene, and one used to express a non-native protein, such as exogenous panD, BAPAT, and HPDH nucleic acid coding sequences.

[0092] Sequence identity/similarity: The identity/similarity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured in terms of percentage similarity (which takes into account conservative amino acid substitutions); the higher the percentage, the more similar the sequences are.

[0093] Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations.

[0094] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, Md. 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Additional information can be found at the NCBI web site.

[0095] BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. To compare two nucleic acid sequences, the options can be set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second nucleic acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastn; -o is set to any desired file name (e.g., C:\output.txt); -q is set to 1; -r is set to 2; and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two sequences: C:\B12seq -i c:\seq1.txt -j c:\seq2.txt -p blastn -o c:\output.txt -q -1-r 2.

[0096] To compare two amino acid sequences, the options of B12seq can be set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\B12seq c:\seq1.txt -j c:\seq2.txt -p blastp -o c:\output.txt. If the two compared sequences share homology, then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology, then the designated output file will not present aligned sequences.

[0097] Once aligned, the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (e.g., 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. For example, a nucleic acid sequence that has 1166 matches when aligned with a test sequence having 1554 nucleotides is 75.0 percent identical to the test sequence (i.e., 11661554*100=75.0). The percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2. The length value will always be an integer. In another example, a target sequence containing a 20-nucleotide region that aligns with 20 consecutive nucleotides from an identified sequence as follows contains a region that shares 75 percent sequence identity to that identified sequence (i.e., 1520*100=75).

[0098] For comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). Homologs are typically characterized by possession of at least 70% sequence identity counted over the full-length alignment with an amino acid sequence using the NCBI Basic Blast 2.0, gapped blastp with databases such as the nr or swissprot database. Queries searched with the blastn program are filtered with DUST (Hancock and Armstrong, 1994, Comput. Appl. Biosci. 10:67-70). Other programs use SEG. In addition, a manual alignment can be performed. Proteins with even greater similarity will show increasing percentage identities when assessed by this method, such as at least 75%, 80%, 85%, 90%, 95%, or 99% sequence identity.

[0099] Nucleic acid sequences that do not show a high degree of identity may nevertheless encode identical or similar (conserved) amino acid sequences, due to the degeneracy of the genetic code. Changes in a nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein. Such homologous nucleic acid sequences can, for example, possess at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% sequence identity determined by this method.

[0100] One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is possible that strongly significant homologs could be obtained that fall outside the ranges provided. Thus, a variant cadA, panD, BAPAT, or HPDH protein or nucleic acid molecule that can be used with the organisms and methods of the present disclosure can have at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the SEQ ID NOs: and GenBank Accession Nos. provided herein.

[0101] Transformed: A cell, such as a fungal cell, into which a nucleic acid molecule has been introduced, for example by molecular biology methods. As used herein, the term transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including, but not limited to chemical methods (e.g., calcium-phosphate transfection), physical methods (e.g., electroporation, microinjection, particle bombardment), fusion (e.g., liposomes), receptor-mediated endocytosis (e.g., DNA-protein complexes, viral envelope/capsid-DNA complexes) and by biological infection by viruses such as recombinant viruses. In one example, the protoplast transformation provide herein, such as in Example 1, is used.

[0102] Vector: A nucleic acid molecule as introduced into a host cell, thereby producing a transformed or recombinant host cell. A vector may include nucleic acid sequences that permit it to replicate in the host cell, such as an origin of replication. A vector may also include a panD, BAPAT, or HPDH coding sequence, or a sequence used to genetically inactivate cadA for example in combination with a promoter, and/or selectable marker genes, and other genetic elements. A vector can transduce, transform or infect a cell, thereby causing the cell to express nucleic acids and/or proteins other than those native to the cell. A vector optionally includes materials to aid in achieving entry of the nucleic acid into the cell, such as a viral particle, liposome, protein coating or the like. In one example, a vector is a plasmid.

Overview

[0103] The filamentous fungus Aspergillus pseudoterreus has been used for industrial production of itaconic acid. cis-aconitic acid decarboxylase (cadA) is the key enzyme in itaconic acid production. The itaconic acid biosynthesis cluster is composed of genes tf, mttA, cadA and mfsA. As shown in FIG. 1, itaconic acid (IA) is produced from glucose. Glucose is utilized in the cell mainly by the glycolytic pathway and metabolized to pyruvate, which forms citric acid. cis-aconitic acid is derived from citric acid as a primary precursor of IA. cis-aconitic acid decarboxylase (cadA) removes carbon dioxide from cis-aconitic acid and forms itaconic acid. However, cadA is localized in the cytosol, while cis-aconitic acid is formed from the TCA cycle in the mitochondria. mttA is localized on the mitochondrial membrane and functioned to transport cis-aconitic acid from mitochondria to cytosol. Another transporter, mfsA is also an organic acid transporter that may be involved in exporting itaconic acid out of cells.

[0104] The first demonstration of genetically inactivating the cadA gene in Aspergillus pseudoterreus is shown herein. In the cadA deletion strain (cadA), no more itaconic acid is produced. At the same time significant amount of cis-aconitic acid and trans-aconitic acid are detected. Blocking the itaconic acid production pathway permits the carbon to be diverted towards other organic acid production. The cadA Aspergillus can be used as a host for chemical platform, and provides a new way to produce aconitic acid and other organic acids (for example by expressing other genes needed for procution of those acids, such as panD, BAPAT, and HPDH for 3-HP production). This strain works as biocatalyst that converts biomass into aconitic acid through bioproduction method at room temperature (such as about 20-35 C.) and ordinary pressure (such as about 1 atm). Current processes of aconitic acid production include chemical synthesis that require high temperatures and harmful reagents.

[0105] The EST data provided herein demonstrated that four genes, tf, cadA, mttA and mfsA show high transcription frequency after IA production starts, but not before IA production begins. The high expression of these genes persists through the production process. Genes upstream and downstream of the cluster did not show expression differences before and after production. One gene downstream next to mfsA, a p450 enzyme, also showed high expression after IA production started, however, deletion of this gene did not effect IA yield.

[0106] Correlations between the IA gene cluster and IA production were further investigated by constructing deletion strains. In a cad strain, no IA was detected, while trace amounts of IA were detected in an mttA knockout. IA production in an mfsA deletion strain decreased one third compared with wild type. This indicates mfsA can transport IA across the cell membrane. In the tf strain, IA production decreased eight fold and slowed the production rate compared to wild type. Also in the tf deletion strain, expression of cadA, mttA and mfsA significantly decreased. RT-PCR results indicated that the expression level of genes in the IA cluster was regulated by tf, which is turned on by IA production conditions.

[0107] The cadA strain produced aconitc acid. During the production, cis-aconitic acid was detected first, followed by the appearance of trans-aconitic acid. cis-aconitic acid levels remained consistent from day 5 forward. The trans-aconitic acid levels continued to increase from days 4 to 10. By day 10, more than 10 g/L trans-aconitic acid was detected in the supernatant. In the cadA strain, cis-aconitic acid decarboxylase is not produced, and the cis-aconitic acid cannot be converted to itaconic acid by decarboxylation and accumulates in the cell. cis-aconitic acid was transported outside the cell. cis-aconitic acid is not stable in the acid solution and is rapidly converted into trans-aconitic acid.

[0108] Aconitic acid is an unsaturated tricarcoxylic acid and is noted as a top 30 potential building block by United States Department of Energy (DOE). Trans-aconitic acid can be used to make polymers. Currently, trans-aconitc acid is produced by chemical synthesis and requires high temperature and harmful solvents. Generation of trans-aconitic acid has been achieved by metabolic engineering aconitase isomerase from Pseudomonas sp. WU-0701 into E. coli. However, the substrate for the recombinant E. coli to produce trans-aconitic acid is citric acid, which has to be generated first from fermentation. In contrast, the disclosed cadA fungi can produce trans-aconitic acid directly from renewable biomass substrates. Also since the cadA is not functional and precursors from TAC cycle accumulate in the cell, the carbon can be rerouted to generate other organic acid since A. pseudoterreus is industrial filamentous fungi and tolerant to low pH.

[0109] Based on these observations, provided herein are isolated recombinant (i.e., transformed) Aspergillus fungi that include a genetic inactivation (also referred to as a functional deletion) of an endogenous cis-aconitic acid decarboxylase (cadA) gene. Such fungi are referred to herein as cadA fungi. Exemplary Aspergillus species that can be used include Aspergillus pseudoterreus and Aspergillus terreus. In some examples, the endogenous cadA gene is genetically inactivated by mutation (such as a complete or partial deletion of the cadA gene) or by insertional mutation (such as by insertion of another nucleic acid molecule into the cadA gene, such as an antibiotic resistance marker).

[0110] In some examples, the cadA gene prior to its genetic inactivation encodes a protein having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 50 or 52. In some examples, the cadA gene (or its coding sequence) prior to its genetic inactivation comprises at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 49, 51, 59 or 92.

[0111] The disclosed cadA fungi can include other exogenous genes to express proteins needed to permit the fungi to produce other organic acids. For example, the disclosed cadA fungi can further include an exogenous nucleic acid molecule encoding aspartate 1-decarboxylase (panD), an exogenous nucleic acid molecule encoding -alanine-pyruvate aminotransferase (BAPAT), and an exogenous nucleic acid molecule encoding 3-hydroxypropionate dehydrogenase (HPDH). panD, BAPAT, and HPDH coding sequences can be part of a one or more nucleic acid molecules, such as a vector. In addition, expression of the panD, BAPAT, and HPDH coding sequences can be driven by one or more promoters, such as a bi-directional promoter. In some examples, the promoter is native to the gene it is expressing. In some examples, the promoter is from A. niger. In some examples, the panD, BAPAT, and/or HPDH coding sequences are inserted into the cadA gene, genetically inactivating cadA. In some examples, the exogenous nucleic acid molecule encoding panD has at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 53 or 65, and/or encodes a panD protein comprising at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 54. In some examples, the exogenous nucleic acid molecule encoding BAPAT has at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 55, and/or encodes a BAPAT protein having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 56. In some examples, the exogenous nucleic acid molecule encoding HPDH has at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 57, and/or encodes a HPDH protein having at least 80%, at least 90%, at least 95%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 58.

[0112] The disclosure also provides compositions that include the cadA fungi, and the cadA fungi expressing other genes (such as panD, BAPAT, and HPDH). Such a composition can include a solid or liquid culture or growth media, such as complete media, minimal media, or Riscaldati medium (such as modified Riscaldati medium with 20 trace elements).

[0113] The disclosure also provides kits that include the cadA fungi, and the cadA fungi expressing other genes (such as panD, BAPAT, and HPDH). Such a kits can include a solid or liquid culture or growth media, such as complete media, minimal media, or Riscaldati medium (such as modified Riscaldati medium with 20 trace elements).

[0114] Also provided are methods of using the disclosed cadA fungi to make aconitic acid. Such a method can include culturing the recombinant Aspergillus cadA fungi under conditions that permit the fungus to make aconitic acid, such as growth in Riscaldati medium, thereby making aconitic acid. In some examples the aconitic acid generated is cis-aconitic acid, trans-aconitic acid, or both. In some examples, the fungi are cultured at room temperature (e.g., 20-35 C.) at normal atmospheric pressure (e.g., 1 atm). In some examples, the method includes purifying or isolating the aconitic acid, for example from the culture media or from the cultured fungus. In some examples, the aconitic acid is isolated at least 2 days, at least 3 days, at least 5 days, at least 8 days or at least 10 days after the start of culturing, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days after the start of culturing.

[0115] Also provided are methods of using the disclosed cadA fungi expressing panD, BAPAT, and HPDH to make 3-HP. Such a method can include culturing the recombinant Aspergillus cadA fungi expressing panD, BAPAT, and HPDH under conditions that permit the fungus to make 3-HP, such as growth in Riscaldati medium (such as modified Riscaldati medium with 20 trace elements), thereby making 3-HP. In some examples, the fungi are cultured at room temperature (e.g., 20-35 C.) at normal atmospheric pressure (e.g., 1 atm). In some examples, the method includes purifying or isolating the 3-HP, for example from the culture media or from the cultured fungus. In some examples, the 3-HP is isolated at least 2 days, at least 3 days, at least 5 days, at least 8 days or at least 10 days after the start of culturing, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days after the start of culturing.

Recombinant cadA Fungi

[0116] The present disclosure provides isolated recombinant Aspergillus fungi having its endogenous cadA gene genetically inactivated (e.g., functional deletion) of. Such fungi are referred to herein as cadA fungal strains. It is shown herein that cadA Aspergillus strains have increased aconitic acid production as compared to Aspergillus having native levels of cadA expression.

[0117] Any variety or strain of Aspergillus can be used. In particular examples, the Aspergillus fungus is A. terreus or A. pseudoterreus, as well as particular strains thereof (for example A. terreus NRRL 1960, A. pseudoterreus ATCC 32359).

[0118] In addition, any method for genetic inactivation can be used, as long as the expression of the cadA gene is significantly reduced or eliminated, or the function of the cadA protein is significantly reduced or eliminated. In particular examples, the cadA gene is genetically inactivated by complete or partial deletion mutation or by insertional mutation. In some examples genetic inactivation need not be 100%. In some embodiments, genetic inactivation refers to at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% gene or protein inactivation. The term reduced or decreased as used herein with respect to a cell and a particular gene or protein activity refers to a lower level of activity than that measured in a comparable cell of the same species. For example, a particular A. terreus or A. pseudoterreus lacking cadA activity has reduced cadA activity if a comparable A. terreus or A. pseudoterreus not having an cadA genetic inactivation has detectable cadA activity.

[0119] cadA sequences are disclosed herein and others are publicly available, for example from GenBank or EMBL. In some examples, the cadA gene functionally deleted encoded a protein having at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 50 or 52 prior to is genetic inactivation. In some examples, the endogenous cadA gene functionally deleted comprises at least 80%, at least 90%, at least 95%, at least 97%, or at least 98% sequence identity to SEQ ID NO: 49, 51, 59, or 92 prior to is genetic inactivation.

[0120] The genetic inactivation of cadA results in many phenotypes in the recombinant cadA Aspergillus, such as A. terreus or A. pseudoterreus. For example, cadA mutants can have one or more of the following phenotypes: produces at least 2-fold, at least 3-fold, at least 3.5 fold, at least 5-fold, at least 8-fold, or at least 10-fold more total aconitic acid than a wild-type Aspergillus terreus or Aspergillus pseudoterreus (for example at day 3, 4, 5, 6, 7, 8, 9 or 10 of production); produces at least 2-fold more cis-aconitic acid at day 5, 6, 7, 8, 9, or 10 of culturing in Riscaldati medium than a wild-type Aspergillus terreus or Aspergillus pseudoterreus; produces at least 2-fold, at least 3-fold, at least 5-fold, or at least 10-fold more trans-aconitic acid at day 10 of culturing in Riscaldati medium than a wild-type Aspergillus terreus or Aspergillus pseudoterreus; or combinations thereof. In some examples, such increases are relative to Aspergillus terreus strain ATCC 32359 grown under the same conditions as the cadA mutant. In some examples, an increased total aconitic acid production by cadA fungi occurs at least 3 days (such as at least 4, 5, 6, 7, 8, 9, or 10 days) after inoculation in Riscaldati medium (such as at least 0.5 g/L aconitic acid or at least 1 g/L aconitic acid), as compared to no detectable aconitic acid produced by Aspergillus terreus strain ATCC 32359 at the same time point.

[0121] Additional genes can also be inactivated in the cadA fungi, wherein the additional genes may or may not provide additional enhancement of aconitic acid production to the fungus. In one example, the cadA fungi includes overexpressed or upregulated aconitic acid transporters.

[0122] In some examples, cadA fungi include one or more additional exogenous nucleic acid molecules, for example to permit production of other organic acids by the recombinant fungi. In one example, the cadA fungi includes an exogenous nucleic acid molecule encoding aspartate decarboxylase (panD), an exogenous nucleic acid molecule encoding -alanine-pyruvate aminotransferase (BAPAT), and an exogenous nucleic acid molecule encoding 3-hydroxypropironate dehydrogenase (HPDH). Such exogenous nucleic acid molecules can be part of one or more exogenous nucleic acid molecules (such as 1, 2 or 3 exogenous nucleic acid molecules). In some examples, exogenous nucleic acid molecules can be part of a vector, such as a plasmid or viral vector. In some examples, expression of the exogenous nucleic acid molecules is driven by one or more promoters, such as a constitutive or inducible promoter, or a bi-directional promoter. In some examples, the promoter used to drive expression of panD, BAPAT, and HPDH is a native promoter (e.g., native to the panD, BAPAT, and HPDH gene expressed). In other examples, the promoter used to drive expression of panD, BAPAT, and HPDH is a non-native promoter (e.g., exogenous to the panD, BAPAT, and HPDH gene expressed). In some examples, such a cadA fungi expressing panD, BAPAT, and HPDH are used to produce 3-HP.

[0123] A. Methods of Functionally Deleting cadA

[0124] As used herein, an inactivated or functionally deleted cadA gene means that the cadA gene has been mutated, for example by insertion, deletion, or substitution (or combinations thereof) of one or more nucleotides such that the mutation substantially reduces (and in some cases abolishes) expression or biological activity of the encoded cadA gene product. The mutation can act through affecting transcription or translation of the cadA gene or its mRNA, or the mutation can affect the cadA polypeptide product itself in such a way as to render it substantially inactive.

[0125] In one example, a strain of Aspergillus is transformed with a vector which has the effect of down-regulating or otherwise inactivating a cadA gene. This can be done by mutating control elements such as promoters and the like which control gene expression, by mutating the coding region of the gene so that any protein expressed is substantially inactive, or by deleting the cadA gene entirely. For example, a cadA gene can be functionally deleted by complete or partial deletion mutation (for example by deleting a portion of the coding region of the gene) or by insertional mutation (for example by inserting a sequence of nucleotides into the coding region of the gene, such as a sequence of about 1-5000 nucleotides). In one example, the cadA gene is genetically inactivated by inserting coding sequences for panD, BAPAT, and/or HPDH. Thus, the disclosure provides transformed fungi that include at least one exogenous nucleic acid molecule which genetically inactivates a cadA gene. In one example, such a transformed cell produces more aconitic acid, for example relative to a comparable fungus with a native or wild-type cadA sequence.

[0126] In particular examples, an insertional mutation includes introduction of a sequence that is in multiples of three bases (e.g., a sequence of 3, 9, 12, or 15 nucleotides) to reduce the possibility that the insertion will be polar on downstream genes. For example, insertion or deletion of even a single nucleotide that causes a frame shift in the open reading frame, which in turn can cause premature termination of the encoded cadA polypeptide or expression of a substantially inactive polypeptide. Mutations can also be generated through insertion of foreign gene sequences, for example the insertion of a gene encoding antibiotic resistance (such as hygromycin or bleomycin), or panD, BAPAT, and/or HPDH coding sequences.

[0127] In one example, genetic inactivation is achieved by deletion of a portion of the coding region of the cadA gene. For example, some, most (such as at least 50%) or virtually the entire coding region can be deleted. In particular examples, about 5% to about 100% of the gene is deleted, such as at least 20% of the gene, at least 40% of the gene, at least 75% of the gene, or at least 90% of the cadA gene.

[0128] Deletion mutants can be constructed using any of a number of techniques. In one example, homologous double crossover with fusion PCR products is employed to genetically inactivate one or more genes in Aspergillus. A specific example of such a method is described in Example 1 below.

[0129] In one example, a strategy using counterselectable markers can be employed which has been utilized to delete genes. For a review, see Reyrat et al. (Infec. Immun. 66:4011-4017, 1998). In this technique, a double selection strategy is employed wherein a plasmid is constructed encoding both a selectable and counterselectable marker, with flanking DNA sequences derived from both sides of the desired deletion. The selectable marker is used to select for fungi in which the plasmid has integrated into the genome in the appropriate location and manner. The counterselecteable marker is used to select for the very small percentage of fungi that have spontaneously eliminated the integrated plasmid. A fraction of these fungi will then contain only the desired deletion with no other foreign DNA present.

[0130] In another technique, the cre-lox system is used for site specific recombination of DNA (for example see Steiger et al., Appl. Environ. Microbiol. 77(1):114, 2011). The system includes 34 base pair lox sequences that are recognized by the bacterial cre recombinase gene. If the lox sites are present in the DNA in an appropriate orientation, DNA flanked by the lox sites will be excised by the cre recombinase, resulting in the deletion of all sequences except for one remaining copy of the lox sequence. Using standard recombination techniques, the targeted gene of interest (e.g., cadA) can be deleted in the Aspergillus genome and to replace it with a selectable marker (for example a gene coding for kanamycin resistance) that is flanked by the lox sites. Transient expression (by electroporation of a suicide plasmid containing the cre gene under control of a promoter that functions in Aspergillus) of the cre recombinase should result in efficient elimination of the lox flanked marker. This process will produce a mutant containing the desired deletion mutation and one copy of the lox sequence.

[0131] In another method, a cadA gene sequence in the Aspergillus genome is replaced with a marker gene, such as green fluorescent protein, -galactosidase, or luciferase. In this technique, DNA segments flanking a desired deletion are prepared by PCR and cloned into a suicide (non-replicating) vector for Aspergillus. An expression cassette, containing a promoter active in Aspergillus and the appropriate marker gene, is cloned between the flanking sequences. The plasmid is introduced into wild-type Aspergillus. Fungi that incorporate and express the marker gene are isolated and examined for the appropriate recombination event (replacement of the wild type cadA gene with the marker gene).

[0132] Thus, for example, a fungal cell can be engineered to have a disrupted cadA gene using common mutagenesis or knock-out technology. (Methods in Yeast Genetics (1997 edition), Adams, Gottschling, Kaiser, and Sterns, Cold Spring Harbor Press, 1998; Datsenko and Wanner, Proc. Natl. Acad. Sci. USA 97: 6640-5, 2000; and Dai et al., Appl. Environ. Microbiol. 70(4):2474-85, 2004). Alternatively, antisense technology can be used to reduce or eliminate the activity of cadA. For example, a fungal cell can be engineered to contain a cDNA that encodes an antisense molecule that prevents cadA from being translated. The term antisense molecule encompasses any nucleic acid molecule or nucleic acid analog (e.g., peptide nucleic acids) that contains a sequence that corresponds to the coding strand of an endogenous cadA gene. An antisense molecule also can have flanking sequences (e.g., regulatory sequences). Thus, antisense molecules can be ribozymes or antisense oligonucleotides. A ribozyme can have any general structure including, without limitation, hairpin, hammerhead, or axehead structures, provided the molecule cleaves RNA. Further, gene silencing can be used to reduce the activity of cadA.

[0133] In one example, to genetically inactivate cadA in A. pseudoterreus or A. terreus, protoplast transformation is used, for example as described in Example 1. For example, conidia of A. pseudoterreus or A. terreus are grown in liquid complete medium at room temperature (e.g., about 20-35 C., such as 30 C.) and grown for at least 12 hours (such as at least 16 hours, or at least 18 hours, such as 12-24 hours, or 16-18 hours), at least 100 rpm, such as at least 150 rpm, for example 100 to 200 rpm. The resulting mycelia are subsequently harvested, for example by filtration. Protoplasts are prepared, for example by treating the harvested mycelia with a lysing enzyme (for example in an osmotic wash buffer for at least 30 min, at least 60 min, at least 120 min, or at leave 240 min, such as 2 h). The resulting protoplasts are collected (e.g., by filtering). Protoplasts can be washed, for example with a Washing Solution (0.6M KCl, 0.1M Tris/HCl, pH 7.0) and Conditioning Solution (0.6M KCl, 50 mM CaCl.sub.2, 10 mM Tris/HCl, pH 7.5). The protoplasts are transformed, for example in the conditioning solution. In some examples, at least 0.5 ug, at least 1 ug, or at least 2 ug of DNA (such as 1-2 ug DNA) is added to at least 10.sup.6 protoplasts (such as at least 10.sup.7 or 210.sup.7 protoplasts). Polyethylene glycol (PEG), such as PEG8000 is added (such as 25% PEG8000, 0.6M KCl, 50 mM CaCl.sub.2, 10 mM Tris/HCl, and pH 7.5) and the reaction incubated for at least 5 min (such as at least 10 min, at least 20 min, or at least 30 min, such as 10-30 min, 15-20 min, or 20 min) on ice. Additional PEG solution can be added and the reaction incubated for at least 1 min, at least 3 min, or at least 5 min, on ice. Conditioning Solution is added to the reaction, and the protoplast suspension mixed with warm selection agar (Minimal media+0.6M KCl+1.5% Agar+100 ug/ml hygromycin) (such as at 50 C.), and poured directly onto petri dish plates and allowed to solidify. Solidified plates can be inverted and incubated overnight at room temperature (e.g., about 20-35 C., such as 30 C.). The following day, the plates can be overlaid with Minimal Medium containing a selection antibiotic, such as hygromycin. Colonies appear after 3-4 days. Transformants can be excised and transferred to MM plate containing the selection antibiotic.

[0134] B. Measuring Gene Inactivation

[0135] A fungus having an inactivated cadA gene can be identified using known methods. For example, PCR and nucleic acid hybridization techniques, such as Northern and Southern analysis, can be used to confirm that a fungus has a genetically inactivated cadA gene. In one example, real-time reverse transcription PCR (qRT-PCR) is used for detection and quantification of targeted messenger RNA, such as mRNA of cadA gene in the parent and mutant strains as grown at the same culture conditions. Immunohisto-chemical and biochemical techniques can also be used to determine if a cell expresses cadA by detecting the expression of the cadA peptide encoded by cadA. For example, an antibody having specificity for cadA can be used to determine whether or not a particular fungus contains a functional nucleic acid encoding cadA protein. Further, biochemical techniques can be used to determine if a cell contains a cadA gene inactivation by detecting a product produced as a result of the lack of expression of the peptide. For example, production of aconitic acid by A. terreus or A. pseudoterreus can indicate that such a fungus contains an inactivated cadA gene.

[0136] C. Measuring Aconitic Acid Production

[0137] Methods of determining whether a genetic inactivation of cadA in Aspergillus, such as A. terreus or A. pseudoterreus. increases aconitic acid production, for example relative to the same strain of A. terreus or A. pseudoterreus with a native cadA sequence (such as a parental strain), are provided herein. Although particular examples are disclosed herein, the methods are not limiting.

[0138] For example, production of aconitic acid by Aspergillus (such as a cadA strain) can be measured using a spectrophotometric assay, by liquid chromatography (LC), or high-pressure liquid chromatography (HPLC) methods. In some examples, the supernatant of the fungus is analyzed for the presence of aconitic acid. In some examples, the culture media containing the cadA strain is filtered prior to measuring aconitic acid in the culture media (supernatant).

[0139] D. cadA Sequences

[0140] cadA protein and nucleic acid sequences are publicly available and specific examples are provided herein. In addition, cadA sequences can be identified using molecular biology methods.

[0141] Examples of cadA nucleic acid sequences are shown in SEQ ID NOS: 49, 51, 59 and 92. However, the disclosure also encompasses variants of SEQ ID NOS: 49, 51, 59 and 92 which encode a functional cadA protein. One skilled in the art will understand variants of the cadA nucleic acid sequences provided herein can be genetically inactivated. Variant sequences may contain a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). In addition, the degeneracy of the code permits multiple nucleic acid sequences to encode the same protein. Such variant cadA nucleic acid molecules can share at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to any cadA nucleic acid sequence, such as SEQ ID NO: 49, 51, 59 or 92.

[0142] Examples of cadA protein sequences are shown in SEQ ID NOS: 50 and 52. However, the disclosure also encompasses variants SEQ ID NOS: 50 and 52 which retain cadA activity. One skilled in the art will understand that variants of these cadA enzyme sequences can be inactivated. Variant sequences can be identified, for example by aligning known cadA sequences. Variant sequences may contain a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). Such cadA peptides share at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to a cadA protein sequence, such as SEQ ID NO: 50 or 52.

[0143] In some examples, a cadA sequence that is to be genetically inactivated encodes or includes one or more conservative amino acid substitutions. A conservative amino acid substitution is a substitution of one amino acid (such as one found in a native sequence) for another amino acid having similar biochemical properties. Typically, conservative substitutions have little to no impact on the activity of a resulting peptide. In one example, a cadA sequence (such as SEQ ID NO: 50 or 52) includes one or more amino acid substitutions, such as conservative substitutions (for example at 1, 2, 5 or 10 residues). Examples of amino acids which may be substituted for an original amino acid in a protein and which are regarded as conservative substitutions include: Ser for Ala; Lys for Arg; Gln or His for Asn; Glu for Asp; Ser for Cys; Asn for Gln; Asp for Glu; Pro for Gly; Asn or Gln for His; Leu or Val for Be; Ile or Val for Leu; Arg or Gln for Lys; Leu or Be for Met; Met, Leu or Tyr for Phe; Thr for Ser; Ser for Thr; Tyr for Trp; Trp or Phe for Tyr; and Ile or Leu for Val. Further information about conservative substitutions can be found in, among other locations in, Ben-Bassat et al., (J. Bacteriol. 169:751-7, 1987), O'Regan et al., (Gene 77:237-51, 1989), Sahin-Toth et al., (Protein Sci. 3:240-7, 1994), Hochuli et al., (Bio/Technology 6:1321-5, 1988), WO 00/67796 (Curd et al.) and in standard textbooks of genetics and molecular biology.

[0144] The cadA gene inactivated in a fungus, in particular examples, includes a sequence that encodes a cadA protein having at least at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a cadA protein sequence, such as SEQ ID NO: 50 or 52, wherein the protein can catalyze the decarboxylation of cis-aconitate to itaconate and CO.sub.2 and vice versa. In a specific example, the cadA gene inactivated in a fungus encodes a cadA protein shown in SEQ NO: 50 or 52.

[0145] The cadA gene that is to be inactivated in a fungus, in particular examples, includes a sequence (such as a coding sequence) having at least at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a cadA nucleic acid sequence, such as SEQ ID NO: 49, 51, 59, or 92, and encodes a cadA protein that can catalyze the decarboxylation of cis-aconitate to itaconate and CO.sub.2 and vice versa. In a specific example, cadA gene inactivated in a fungus is the sequence of SEQ ID NO: 2 or 4.

[0146] One skilled in the art will appreciate that additional cadA sequences can be identified. For example, cadA nucleic acid molecules that encode a cadA protein can be identified and obtained using molecular cloning or chemical nucleic acid synthesis procedures and techniques, including PCR. In addition, nucleic acid sequencing techniques and software programs that translate nucleic acid sequences into amino acid sequences based on the genetic code can be used to determine whether or not a particular nucleic acid has any sequence homology with known cadA sequences. Sequence alignment software such as MEGALIGN (DNASTAR, Madison, Wis., 1997) can be used to compare various sequences.

[0147] In addition, nucleic acid hybridization techniques can be used to identify and obtain a nucleic acid molecule that encodes a cadA protein. Briefly, any known cadA nucleic acid molecule, or fragment thereof, can be used as a probe to identify similar nucleic acid molecules by hybridization under conditions of moderate to high stringency. Such similar nucleic acid molecules then can be isolated, sequenced, and analyzed to determine whether the encoded protein is a cadA protein.

[0148] E. panD, BAPAT, and HPDH Sequences

[0149] panD, BAPAT, and HPDH protein and nucleic acid sequences are publicly available and specific examples are provided herein. In addition, panD, BAPAT, and HPDH sequences can be identified using molecular biology methods.

[0150] Exemplary of panD coding sequences are shown in SEQ ID NO: 53 and 65. However, the disclosure also encompasses variants of SEQ ID NO: 53 and 65 which encode a functional panD protein. Exemplary of BAPAT coding sequences are shown in SEQ ID NO: 55 and 71. However, the disclosure also encompasses variants of SEQ ID NO: 55 and 71 which encode a functional BAPAT protein. Exemplary of HPDH coding sequences are shown in SEQ ID NO: 57 and 80. However, the disclosure also encompasses variants of SEQ ID NO: 57 and 80 which encode a functional HPDH protein.

[0151] One skilled in the art will understand variants of the panD, BAPAT, and HPDH nucleic acid sequences provided herein can be introduced into an Aspergillus fungus, such as one that is cadA, such as inserting panD, BAPAT, and HPDH expression sequences into the native cadA gene to inactivate it. Variant sequences may contain a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). In addition, the degeneracy of the code permits multiple nucleic acid sequences to encode the same protein. In some examples, a panD, BAPAT, and HPDH sequence that is to be expressed in an Aspergillus fungus is codon optimized for expression in Aspergillus, such as Aspergillus terreus or pseudoterreus. Such variant panD, BAPAT, and HPDH nucleic acid molecules in some examples share at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to any panD, BAPAT, and HPDH nucleic acid sequence, such as SEQ ID NO: 53, 55, or 57, respectively, or SEQ ID NO: 65, 71, or 80, respectively.

[0152] Exemplary panD, BAPAT, and HPDH protein sequences are shown in SEQ ID NOS: 54, 56, and 58, respectively. However, the disclosure also encompasses variants SEQ ID NOS: 54, 56, and 58 which retain panD, BAPAT, and HPDH activity, respectively. One skilled in the art will understand that variants of these panD, BAPAT, and HPDH sequences can be expressed in an Aspergillus fungus, such as one that is cadA, Variant sequences can be identified, for example by aligning known panD, BAPAT, and HPDH sequences. Variant sequences may contain a single insertion, a single deletion, a single substitution, multiple insertions, multiple deletions, multiple substitutions, or any combination thereof (e.g., single deletion together with multiple insertions). Such panD, BAPAT, and HPDH peptides expressed in acadA fungus in some examples share at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to a panD, BAPAT, and HPDH protein sequence, such as SEQ ID NO: 54, 56, or 58, respectively.

[0153] In some examples, a panD, BAPAT, and HPDH sequence that is to be expressed in an Aspergillus fungus encodes or includes one or more conservative amino acid substitutions. In one example, a panD, BAPAT, or HPDH sequence (such as SEQ ID NO: 54, 56, or 58, respectively) includes one or more amino acid substitutions, such as conservative substitutions (for example at 1, 2, 5, or 10 residues). Examples of conservative substitutions are provided elsewhere herein.

[0154] The panD, BAPAT, and HPDH gene expressed in a fungus, in particular examples, includes a sequence that encodes a panD, BAPAT, and HPDH protein having at least at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a panD, BAPAT, and HPDH protein sequence, such as SEQ ID NO: 54, 56, or 58, respectively, wherein the variant protein has the biological activity of panD, BAPAT, or HPDH, respectively. In a specific example, the panD, BAPAT, and HPDH gene expressed in a cadA fungus encodes the protein shown in SEQ ID NO: 54, 56, and 58, respectively.

[0155] One skilled in the art will appreciate that additional panD, BAPAT, and HPDH sequences can be identified. For example, panD, BAPAT, and HPDH nucleic acid molecules that encode a panD, BAPAT, and HPDH protein, respectively can be identified and obtained using molecular cloning or chemical nucleic acid synthesis procedures and techniques, including PCR. In addition, nucleic acid sequencing techniques and software programs that translate nucleic acid sequences into amino acid sequences based on the genetic code can be used to determine whether or not a particular nucleic acid has any sequence homology with panD, BAPAT, or HPDH sequences. Sequence alignment software such as MEGALIGN (DNASTAR, Madison, Wis., 1997) can be used to compare various sequences.

[0156] In addition, nucleic acid hybridization techniques can be used to identify and obtain a nucleic acid molecule that encodes a panD, BAPAT, or HPDH protein. Briefly, any known panD, BAPAT, or HPDH nucleic acid molecule, or fragment thereof, can be used as a probe to identify similar nucleic acid molecules by hybridization under conditions of moderate to high stringency. Such similar nucleic acid molecules then can be isolated, sequenced, and analyzed to determine whether the encoded protein is a panD, BAPAT, or HPDH protein.

[0157] In one example, exogenous panD, BAPAT, and/or HPDH nucleic acid sequences are introduced into A. pseudoterreus or A. terreus using protoplast transformation, for example as described in Example 1 (and described above).

[0158] F. Methods of Increasing panD, BAPAT, and HPDH Expression

[0159] In some examples, a native A. pseudoterreus or A. terreus fungi does not have or express panD, BAPAT, and/or HPDH nucleic acid sequences. Thus, in some examples, expression of these genes is increased by introducing panD, BAPAT, and/or HPDH nucleic acid coding sequences (such may be codon optimized) into the A. pseudoterreus or A. terreus fungi.

[0160] In some examples, a native A. pseudoterreus or A. terreus fungi does express native panD, BAPAT, and/or HPDH nucleic acid sequences. Thus, in some examples, expression of these genes is upregulated by introducing additional copies of panD, BAPAT, and/or HPDH nucleic acid coding sequences (such may be codon optimized) into the A. pseudoterreus or A. terreus fungi. As used herein, up-regulated gene means that expression of the gene or gene product (e.g., protein) has been up-regulated, for example by introduction of additional copies of the appropriate gene or coding sequence into the fungus (or other molecular biology methods), such that the introduced nucleic acid sequence is expressed, resulting in increased expression or biological activity of the encoded gene product. In some embodiments, introduction of one or more transgenes including panD, BAPAT, and/or HPDH coding sequences into a native A. pseudoterreus or A. terreus fungi increases expression of panD, BAPAT, and/or HPDH by at least 20%, at least 40%, at least 50%, at least 100%, at least 150%, at least 200%, at least 300%, or at least 500%, for example relative to the parental fungal strain without the introduced panD, BAPAT, and/or HPDH coding sequences. The term increased or up-regulated as used herein with respect to a cell and a particular gene or protein activity refers to a higher level of activity than that measured in a comparable cell of the same species. For example, a particular fungi having increased or up-regulated panD, BAPAT, and/or HPDH activity has increased panD, BAPAT, and/or HPDH activity if a comparable fungi having native panD, BAPAT, and/or HPDH activity has less detectable panD, BAPAT, and/or HPDH activity (for example as measured by gene or protein expression).

[0161] In one example, a strain of Aspergillus is transformed with a vector which has the effect of up-regulating a panD, BAPAT, and/or HPDH gene (such as a native or non-native panD, BAPAT, and/or HPDH gene). This can be done by introducing one or more panD, BAPAT, and/or HPDH coding sequences (such as a gene sequence), whose expression is controlled by elements such as promoters and the like which control gene expression, by introducing a nucleic acid sequence which itself (or its encoded protein) can increase panD, BAPAT, and/or HPDH protein activity in the fungus, or by introducing another molecule (such as a protein or antibody) increases panD, BAPAT, and/or HPDH protein activity in the fungus. For example, a panD, BAPAT, and/or HPDH gene can be up-regulated by introduction of a vector that includes one or more panD, BAPAT, and/or HPDH sequences (such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 panD, BAPAT, and/or HPDH sequences or copies of such sequences) into the desired fungus. In some examples, such panD, BAPAT, and/or HPDH sequences are from different fungal species, can be multiple copies from a single species, or combinations thereof, such as panD, BAPAT, and/or HPDH sequences from at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 different fungal species. In some examples, the panD, BAPAT, and/or HPDH sequence(s) introduced into the fungus is optimized for codon usage. Thus, the disclosure in some examples provides transformed fungi that include at least one exogenous nucleic acid molecule which includes a panD, BAPAT, and/or HPDH gene or coding sequence (such as a nucleic acid sequence encoding SEQ ID NO: 54, 56, or 58, respectively), for example in combination with cadA. In one example, such transformed cells produce more 3HP, for example relative to a comparable fungus with a native cadA.

[0162] In one example, the cre-lox system is used for site specific recombination of DNA (for example see Steiger et al., Appl. Environ. Microbiol. 77(1):114, 2011). Using recombination techniques, the targeted gene of interest (e.g., cadA) can be deleted in the Aspergillus genome and replaced with one or more copies of a non-native panD, BAPAT, and/or HPDH sequence (for example in A. terreus, replacing one or both A. terreus cadA sequences with panD, BAPAT, and/or HPDH sequences from A. nidulans or A. flavus) flanked by the lox sites. Transient expression (by electroporation of a suicide plasmid containing the cre gene under control of a promoter that functions in Aspergillus) of the cre recombinase should result in efficient elimination of the lox flanked marker. This process will produce a fungus containing the desired insertion mutation and one copy of the lox sequence.

[0163] In one example, a transgene is generated and expressed in the desired fungal cell, such as an cadA fungal cell, to increase panD, BAPAT, and HPDH expression. For example, one or more transgenes can include a panD, BAPAT, and HPDH genomic or cDNA sequence (such as one having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to any panD, BAPAT, and HPDH sequence provided herein), for example operably linked to one or more promoters, such as gpdA and enol. In one example, the promoter has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 74 and/or 77. In some examples, the transgene further includes a trpC transcriptional terminator sequence of A. nidulans, for example downstream of the panD, BAPAT, and/or HPDH sequence. As an alternative to trpC, other transcriptional terminators can be used, such as promoters which include a transcriptional terminators (e.g., ArsA7, Arsa-37, polyubiquitin (ubi4)). In one example, the trpC transcriptional terminator has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 83 or 86. In one example, the trpC transcriptional terminator comprises or consists of the sequence shown in SEQ ID NO: 83 or 86. In some examples, the transgene further includes a ptrA sequence, for example downstream of the trpC transcriptional terminator sequence. As an alternative to ptrA, the bleomycin gene or bar gene can be used. In one example, the ptrA sequence has at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 89. In one example, the ptrA sequence comprises or consists of the sequence shown in SEQ ID NO: 89

[0164] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 59, 62, 65, 68, 71, and/or 74. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 59, 62, 65, 68, 71, and/or 74.

[0165] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 77, 80, and/or 83. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 77, 80, and/or 83.

[0166] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 86, 89, and/or 92. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 86, 89, and/or 92.

[0167] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 89 and/or 92. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 89 and/or 92.

[0168] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 95 and/or 97. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 95 and/or 97.

[0169] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 59, 62, 65, 68, 71, 74, 77, 80, 83, 86, 89, and/or 92. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 59, 62, 65, 68, 71, 74, 77, 80, 83, 86, 89, and/or 92.

[0170] In one example, the transgene comprises a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 59, 62, 65, 68, 71, 74, 77, 80, 83, 89, and/or 92. In one example, the transgene comprises or consists of the sequence shown in SEQ ID NO: 59, 62, 65, 68, 71, 74, 77, 80, 83, 89, and/or 92.

[0171] G. Measuring Gene Expression

[0172] A cadA fungus expressing panD, BAPAT, and/or HPDH can be identified using known methods. For example, PCR and nucleic acid hybridization techniques, such as Northern, RT-PCR, and Southern analysis, can be used to confirm that a fungus expresses panD, BAPAT, and/or HPDH such as an increase in the panD, BAPAT, and/or HPDH copy number. Immunohisto-chemical and biochemical techniques can also be used to determine if a cell expresses panD, BAPAT, and/or HPDH by detecting the expression of the panD, BAPAT, and/or HPDH peptide encoded by panD, BAPAT, and/or HPDH. For example, an antibody having specificity for panD, BAPAT, and/or HPDH can be used to determine whether or not a particular fungus has increased panD, BAPAT, and/or HPDH protein expression, respectively. Further, biochemical techniques can be used to determine if a cell has increased panD, BAPAT, and/or HPDH expression by detecting a product produced as a result of the expression of the peptide. For example, production of 3-HP by cadA A. terreus or A. pseudoterreus can indicate that such a fungus expresses panD, BAPAT, and HPDH.

[0173] H. Measuring 3-HP Production

[0174] Methods of determining whether a genetic inactivation of cadA in combination with expression of panD, BAPAT, and HPDH in Aspergillus increases 3-HP production, for example relative to the same strain with a native cadA sequence, (such as a parental strain) include HPLC.

Methods of Producing Aconitic Acid

[0175] The recombinant cadA fungi can be used to produce aconitic acid (for example for as a building block for other materials, such as polymers). Such fungi can be from any Aspergillus species, such as Aspergillus terreus or pseudoterreus. For example, the disclosure provides methods of making aconitic acid (such as cis-aconitic acid, trans-aconitic acid, or both), which can include culturing cadA fungi under conditions that permit the fungus to make aconitic acid, for example in Riscaldati medium.

[0176] In some examples, the fungi are cultured at room temperature (e.g., 20-35 C.) at normal atmospheric pressure (e.g., 1 atm). In some examples, the method includes purifying or isolating the aconitic acid, for example from the culture media or from the cultured fungus. In some examples, the aconitic acid is isolated at least 2 days, at least 3 days, at least 5 days, at least 8 days or at least 10 days after the start of culturing, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days after the start of culturing.

[0177] Methods of making aconitic acid include culturing cadA fungi under conditions that permit the fungus to make aconitic acid. In general, the culture media and/or culture conditions can be such that the fungi grow to an adequate density and produce aconitic acid efficiently. In one example the cadA fungi are cultured or grown in an acidic liquid medium, such as Riscaldati medium (100 g Glucose, 0.11 g KH.sub.2PO.sub.4, 2.36 g (NH.sub.4).sub.2SO.sub.4, 2.08 g MgSO.sub.4*7H.sub.2O, 0.074 g NaCl, 0.13 g CaCl.sub.2*2H.sub.2O, 1 ml of 1000 trace elements in 1000 ml DI water, adjust pH to 3.4 with H2SO.sub.4, 1000 trace elements contains 1.3 g/L ZnSO.sub.4*7H.sub.2O, 5.5 g/L FeSO.sub.4*7H.sub.2O, 0.2 g/L CuSO.sub.4*5H.sub.2O, 0.7 g/L MnCl.sub.2*4H.sub.2O). In one example the cadA fungi are cultured or grown in a liquid medium having an initial pH of less than 4, such as less than 3.5, for example about pH 3 to 4, 3.5 to 4, 3.3 to 3.5, for example pH 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9 or 4. In some examples the cadA fungi are cultured or grown in a liquid Riscaldati medium at about 20 to 35 C. (such as 20 C. to 30 C., 25 C. to 30 C., 28 to 32 C., or 30 C.) with rotation (such as at least 100 rpm, at least 120 rpm, such as 150 rpm) at normal pressure.

[0178] In one example, the fungi are grown in culture containers (such as baffled flasks, and in some examples are silanized (5% solution of dichlorodimethylsilane in heptane (Sigma, St. Louis, Mo.)). Each culture container is inoculated with spores (such as at least 10.sup.6 spores/ml [agree?]) and incubated for at least 3 days, at least 4 days, at least 5 days, or at least 10 days at 30 C. and 100 to 200 rpm to obtain aconitic acid.

[0179] In one example, the cadA fungi produce more aconitic acid than a corresponding fungus with wild-type cadA. In specific examples, the cadA fungi produce at least 1 g/l of total aconitic acid after 4 days, for example at least 2 g/l, at least 3 g/l, at least 4 g/l, at least 5 g/l, at least 6 g/l, at least 7 g/l, at least 8 g/l, at least 9 g/l or at least 10 g/l after at least 5 days, at least 6 days, at least 7 days, at least 8 days, or at least 10 days, such as after 4 to 6 days, 8 to 10 days, or 4 to 5 days) when grown in Riscaldati medium at 30 C. with 150 rpm shaking. In specific examples, the cadA fungi produce at least 1 g/l of cis-aconitic acid after 4 days, for example at least 2 g/l after at least 5 days, at least 6 days, at least 7 days, at least 8 days, or at least 10 days, such as after 4 to 6 days, 8 to 10 days, or 4 to 5 days when grown in Riscaldati medium at 30 C. with 150 rpm shaking. In specific examples, the cadA fungi produce at least 1 g/l of trans-aconitic acid after 6 days, for example at least 2 g/l, at least 3 g/l, at least 4 g/l, at least 5 g/l, at least 6 g/l, at least 7 g/l, at least 8 g/l, at least 9 g/l or at least 10 g/l after at least 7 days, at least 8 days, or at least 10 days, such as after 6 to 12 days, 5 to 10 days, or 6 to 10 days) when grown in Riscaldati medium at 30 C. with 150 rpm shaking.

[0180] In some examples, the method further includes isolating the aconitic acid made by the cadA fungi. Once produced, any method can be used to isolate the aconitic acid. For example, separation techniques (such as filtration) can be used to remove the fungal biomass from the culture medium, and isolation procedures (e.g., filtration, distillation, precipitation, electrodialysis, and ion-exchange procedures) can be used to obtain the aconitic acid from the broth (such as a fungi-free broth). In addition, the aconitic acid can be isolated from the culture medium after the aconitic acid production phase has been terminated.

Methods of Producing 3-HP

[0181] The recombinant cadA fungi that also express panD, BAPAT, and HPDH can be used to produce 3-HP

##STR00002##

[0182] (for example for as a building block for other materials, such as acrylonitrile, acrylic acid by dehydration, malonic acid by oxidation, esters by esterification reactions with alcohols, and reduction to 1,3 propanediol). Such fungi can be from any Aspergillus species, such as Aspergillus terreus or pseudoterreus. For example, the disclosure provides methods of making 3-HP, which can include culturing cadA fungi that also express panD, BAPAT, and HPDH under conditions that permit the fungus to make 3-HP, for example in Riscaldati medium (such as modified Riscaldati medium with 20 trace elements).

[0183] In some examples, the cadA fungi that also express panD, BAPAT, and HPDH are cultured at room temperature (e.g., 20-35 C.) at normal atmospheric pressure (e.g., 1 atm). In some examples, the method includes purifying or isolating the 3-HP, for example from the culture media or from the cultured fungus. In some examples, the 3-HP is isolated at least 2 days, at least 3 days, at least 5 days, at least 7 days, at least 8 days or at least 10 days after the start of culturing, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 days after the start of culturing.

[0184] Methods of making 3-HP include culturing cadA fungi that also express panD, BAPAT, and HPDH under conditions that permit the fungus to make 3-HP. In general, the culture media and/or culture conditions can be such that the fungi grow to an adequate density and produce 3-HP efficiently. In one example the cadA fungi that also express panD, BAPAT, and HPDH are cultured or grown in an acidic liquid medium, such as Riscaldati medium (100 g Glucose, 0.11 g KH.sub.2PO.sub.4, 2.36 g (NH.sub.4).sub.2SO.sub.4, 2.08 g MgSO.sub.4*7H.sub.2O, 0.074 g NaCl, 0.13 g CaCl.sub.2*2H.sub.2O, 1 ml of 1000 trace elements in 1000 ml DI water, adjust pH to 3.4 with H2SO.sub.4, 1000 trace elements contains 1.3 g/L ZnSO.sub.4*7H.sub.2O, 5.5 g/L FeSO.sub.4*7H.sub.2O, 0.2 g/L CuSO.sub.4*5H.sub.2O, 0.7 g/L MnCl.sub.2*4H.sub.2O, which may include 20 trace elements). In one example the cadA fungi are cultured or grown in a liquid medium having an initial pH of less than 4, such as less than 3.5, for example about pH 3 to 4, 3.5 to 4, 3.3 to 3.5, for example pH 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9 or 4. In some examples the cadA fungi that also express panD, BAPAT, and HPDH are cultured or grown in a liquid modified Riscaldati medium with 20 trace elements at about 20 to 35 C. (such as 20 C. to 30 C., 25 C. to 30 C., 28 to 32 C., or 30 C.) with rotation (such as at least 100 rpm, at least 120 rpm, such as 150 or 200 rpm) at normal pressure.

[0185] In one example, the fungi are grown in culture containers (such as baffled flasks, and in some examples are silanized (5% solution of dichlorodimethylsilane in heptane (Sigma, St. Louis, Mo.)). Each culture container is inoculated with spores (such as at least 10.sup.6 spores/ml) and incubated for at least 3 days, at least 4 days, at least 5 days, or at least 10 days at 30 C. and 100 to 300 rpm (such as 150 or 200 rpm) to obtain 3-HP.

[0186] In one example, the cadA fungi that also express panD, BAPAT, and HPDH produce more 3-HP than a corresponding fungus with wild-type cadA (either with or without panD, BAPAT, and HPDH expression). In specific examples, the cadA fungi that also express panD, BAPAT, and HPDH produce at least 0.1 g/l of 3-HP after at least 4 days, for example at least 0.2 g/1, at least 0.25 g/1, at least 0.3 g/1, at least 0.4 g/1, at least 0.5 g/1, at least 0.6 g/1, at least 0.7 g/1, at least 0.8 g/1, at least 0.9 g/1, at least 1.1 g/1, at least 1.2 g/1, at least 1.5 g/1, or at least 1.6 g/l after at least 5 days, at least 6 days, at least 7 days, at least 8 days, or at least 10 days, such as after 4 to 6 days, 8 to 10 days, or 4 to 5 days, when grown in Riscaldati medium (such as modified Riscaldati medium with 20 trace elements) at 30 C. with 150 rpm shaking.

[0187] In some examples, the method further includes isolating the 3-HP made by the cadA fungi. Once produced, any method can be used to isolate the 3-HP. For example, separation techniques (such as filtration) can be used to remove the fungal biomass from the culture medium, and isolation procedures (e.g., filtration, distillation, precipitation, electrodialysis, and ion-exchange procedures) can be used to obtain the 3-HP from the broth (such as a fungi-free broth). In addition, the 3-HP can be isolated from the culture medium after the 3-HP production phase has been terminated.

Compositions and Kits

[0188] Also provided by the present disclosure are compositions that include isolated cadA fungi (which in some examples also express panD, BAPAT, and HPDH, such as exogenous panD, BAPAT, and HPDH proteins), such as a medium for culturing, storing, or growing the fungus. In some examples, the cadA fungi and cadA fungi which express panD, BAPAT, and HPDH in the composition are freeze dried or lyophilized.

[0189] Also provided by the present disclosure are kits that include isolated cadA fungi (which in some examples also express panD, BAPAT, and HPDH, such as exogenous panD, BAPAT, and HPDH proteins), such as a kit that includes a medium for culturing, storing, or growing the fungus. In some examples, the cadA fungi and cadA fungi which express panD, BAPAT, and HPDH in the kit are freeze dried or lyophilized.

[0190] Exemplary mediums include that can be in the disclosed compositions and kits include solid medium (such as those containing agar, for example complete medium (CM) or minimal medium (MM)) and liquid media (such as a fermentation broth, such as CM, MM, or CAP medium). In one example, the kit or composition includes Riscaldati medium (100 g Glucose, 0.11 g KH.sub.2PO.sub.4, 2.36 g (NH.sub.4).sub.2SO.sub.4, 2.08 g MgSO.sub.4*7H.sub.2O, 0.074 g NaCl, 0.13 g CaCl.sub.2*2H.sub.2O, 1 ml of 1000 trace elements in 1000 ml DI water, adjust pH to 3.4 with H2SO.sub.4, 1000 trace elements contains 1.3 g/L ZnSO.sub.4*7H.sub.2O, 5.5 g/L FeSO.sub.4*7H.sub.2O, 0.2 g/L CuSO.sub.4*5H.sub.2O, 0.7 g/L MnCl.sub.2*4H.sub.2O), for example

TABLE-US-00001 Conc. (g/L) Amount Notes Glucose 100 100 g KH.sub.2PO.sub.4 0.11 0.11 g (NH.sub.4).sub.2SO.sub.4 2.36 2.36 g MgSO.sub.4 * 7H.sub.2O 2.08 2.08 g NaCl 0.074 0.074 g CaCl.sub.2 * 2H2O 0.13 0.13 g ZnSO.sub.4 * 7H.sub.2O 0.0013 0.0013 g Use 1000 X soln. FeSO.sub.4 * 7H.sub.2O 0.0055 0.0055 g CuSO.sub.4 * 5H2O 0.0002 0.0002 g MnCl.sub.2 * 4H.sub.2O 0.0007 0.0007 g DI Water (L) 1 L Autoclave Time 15 min for small flasks 30 min for large flasks 30-60 for fermenter Comments: Adjust to pH = 3.4 with H.sub.2SO.sub.4

[0191] In one example, the kit or composition includes a modified Riscaldati medium with 20 trace elements, for example 20 times of the following

TABLE-US-00002 ZnSO.sub.4 * 7H.sub.2O 0.0013 0.0013 g Use 1000 X soln. FeSO.sub.4 * 7H.sub.2O 0.0055 0.0055 g CuSO.sub.4 * 5H2O 0.0002 0.0002 g MnCl.sub.2 * 4H.sub.2O 0.0007 0.0007 g

Example 1

Materials and Methods

[0192] This example describes methods used in the experiments described in Examples 2-6 below.

[0193] Strains and Vector.

[0194] The parental wild type A. pseudoterreus strain ATCC 32359 was from ATCC. The hygromycin phosphotransferase (hph) marker cassette was amplified from vector pCB1003.

[0195] Growth Conditions.

[0196] All strains were maintained on complete medium (CM) agar and conidia of spore were harvested from cultures grown for five days on complete medium (CM) plate (10 g Glucose, 2 g Triptase peptone, 1 g yeast extract, 1 g casamino acids, 50 ml 20NO.sub.3 Salts, 1 ml of 1000Trace elements, 1 ml of 1000 Vitamin stock, in 1000 ml DI water, pH to 6.5), 20NO.sub.3 Salts contains in g/1, Na.sub.2NO.sub.3, 120; KCL, 10.4 g; MgSO.sub.4.7H.sub.2O, 10.4 g; KH.sub.2PO.sub.4, 30.4 g. 1000 vitamin solution contains in per 100 ml H.sub.2O: Biotin, 0.01 gm; pyridoxinHCL, 0.01 gm; thiamineHCl, 0.01 gm; riboflavin, 0.01 gm; paba, 0.01 gm; nicotinic acid, 0.01 gm, filtered and stock at 4 C. 1000 trace element contains in per 100 ml H.sub.2O: ZnSO.sub.4.7H.sub.2O, 2.2 g; H3B03, 1.1 g; MnCl.sub.2.4H.sub.2O, 0.5 g; FeSO.sub.4.7H.sub.2O, 0.5 g; CoCl.sub.2.6H.sub.2O, 0.17 g; CuSO.sub.4.5H.sub.2O, 0.16 g ; Na.sub.2MoO.sub.4.2H.sub.2O, 0.15 g; Na.sub.2EDTA, 5 g, add the compounds in order, boil and cool to 60 C. Adjust pH to 6.5 with KOH. Cool to room temperature. Adjust volume to 100 ml with distilled water.

[0197] The transformants were selected for hygromycin resistance on minimum media (MM) (10 g Glucose, 50 ml 20NO.sub.3 Salts, 1 ml of 1000Trace elements, 1 ml of 1000 Vitamin stock, 1000 ml DI water, pH to 6.25-6.5, hygromycin 100 ug/ml). 0.510.sup.8 conidia were inoculated into 50 ml of production media for itaconic acid production (Riscaldati medium) as described previously (100 g Glucose, 0.11 g KH.sub.2PO.sub.4, 2.36 g (NH.sub.4).sub.2SO.sub.4, 2.08 g MgSO.sub.4.7H.sub.2O, 0.074 g NaCl, 0.13 g CaCl.sub.2.2H.sub.2O, 1 ml of 1000 trace elements in 1000 ml DI water, adjust pH to 3.4 with H2504, 1000 trace elements contains 1.3 g/L ZnSO.sub.4.7H.sub.2O, 5.5 g/L FeSO.sub.4.7H.sub.2O, 0.2 g/L CuSO.sub.4.5H.sub.2O, 0.7 g/L MnCl.sub.2.4H.sub.2O). Cultivation was performed at 30 C. on a rotary shaker at 150 rpm. At intervals during the incubation period, three single flasks were harvested for HPLC analysis, biomass measurement and RNA extraction. All experiments were replicated three times, and the standard deviation of the itaconic acid concentrations or dry weight was always less than 10% of the mean. For collecting samples for EST analysis, A. pseudoterreus was grown in 20 liter stirred tank bioreactor.

[0198] Construction of Deletion Mutants.

[0199] The deletion mutants were constructed by homologous double crossover with fusion PCR products. Synthetic oligos used for each construct are described in Table 1. Oligonucleotides were from IDT (Coraville, Iowa). Ex Taq polymerase (TaKaRa, Japan) was used to generate DNA constructs for making gene knockouts. Briefly, the 5 flanking region (1.5 kb) of the target gene was amplified by primer pair F1 and R3. The 3 flanking region (1.5 kb) of the target genes was amplified by primer pair F4 and R6. R3 and F4 carried 20-25 bases complementary to 5 and 3 ends of the hph cassette, respectively. The hph marker cassette was amplified from pCB1003 with the hphF and hphR primers that carried 30 bases complementary to the 3 end of the 5 flanking region and the 5 of the 3 flanking region, respectively. The three fragments, including the 5 flanking region, the hph marker cassette and the 3 flanking region were mixed in 1:3:1 molar ratio and combined by overlap PCR during the second round PCR. In the third round of PCR, the fusion PCR product was amplified with a nested primer pair (F2 and R5). This final PCR product carried a hygromycin marker cassette flanked by sequences homologous to the upstream and downstream regions of the target gene. 1-2 ug of the final product was used to transform strain A. pseudoterreus strain ATCC 32359.

TABLE-US-00003 TABLE1 Primersformakingdeletionconstructs gene targeted primername primersequence(SEQIDNO) tf attff1 gagccatagccatgcaagcg(1) attff2 atagagtccttggatgagacg(2) attfr5 gtggatttcgaggttccttgc(3) attfr6 gaagtagaaccatgtggatcg(4) athphftfr3 tgacctccactagctccagcactactagataggcccgtttagagagtgcc(5) athphrtff4 aatagagtagatgccgaccggccgcttcgacgacagctctgcactctcc(6) attfr3hphf ggcactctctaaacgggcctatctagtagtgctggagctagtggaggtca(7) attftff4hphr ggagagtgcagagctgtcgtcgaagcggccggtcggcatctactctatt(8) mttA atmotf1 gctgcatactcggattacgc(9) atmotf2 Gaaaaggtactcggagtacg(10) atmotr5 cagaccaaggagctttcctg(11) atmotr6 cattaagccacaggcttgcg(12) athphfmotr3 tgacctccactagctccagcaatatggatgctgttcgttcgccgtgctgg(13) athphrmotf4 aatagagtagatgccgaccgtgacgaggatgtgctgagtccaaacaaagc(14) atmotr3hphf ccagcacggcgaacgaacagcatccatattgctggagctagtggaggtca(15) atmotf4hphr gctttgtttggactcagcacatcctcgtcacggtcggcatctactctatt(16) cadA atcadf1 ctccagtaacagaaccgacc(17) atcadf2 gaacttcactgccgcattgg(18) atcadr5 ggacactccaagaggataagg(19) atcadr6 gctcatcacattgtttgccg(20) athphfcadr3 tgacctccactagctccagcggtcaatttaagaggacgatcttcgctgcg(21) athphrcadf4 Aatagagtagatgccgaccgtcagcctggacaggctcaccgacattagcc(22) atcadr3hphf cgcagcgaagatcgtcctcttaaattgaccgctggagctagtggaggtca(23) atcadf4hphr ggctaatgtcggtgagcctgtccaggctgacggtcggcatctactctatt(24) mfsA mfsf1 tgatgagctgaattcgttgc(25) mfsf2 tatagccagcttttgctgtg(26) mfsr5 catagcgttcagagtgttg(27) mfsr6 ccatttcaatgctttgtgcg(28) mfsr3hphf ccataccacccttaccctcttggagtgtccgctggagctagtggaggtca(29) mfsf4hphr gctgtggcctcctggcgattacgcaatattcggtcggcatctactctatt(30) hphfmfsr3 tgacctccactagctccagcggacactccaagagggtaagggtggtatgg(31) hphrmfsf4 aatagagtagatgccgaccgaatattgcgtaatcgccaggaggccacagc(32) p450 p450f1 tctccaaatcatcgtcatcg(33) p450f2 cttcaatcgcaccgacatcc(34) p450r5 tcgtgtagacaagtccagtc(35) p450r6 ctataccactctagtgatgg(36) p450r3hphf cctctgctcaggttgttttcgaacaggagcgctggagctagtggaggtca(37) p450f4hphr cggaatgcagataggcatcacagtccagaacggtcggcatctactctatt(38) hphfp450r3 tgacctccactagctccagcgctcctgttcgaaaacaacctgagcagagg(39) hphrp450f4 aatagagtagatgccgaccgttctggactgtgatgcctatctgcattccg(40)

[0200] Transformation of A. pseudoterreus Protoplasts.

[0201] 10.sup.8 conidia of A. pseudoterreus ATCC 32359 were used to inoculate 300 ml Erlenmeyer baffle flasks containing 100 ml of complete media. The cultures were grown overnight (16-18 hrs) at 30 C. and 150 rpm. The mycelia were then harvested by filtering the culture through miracloth and rinsing the mycelia mat with sterile water. The protoplasts were prepared by treating mycelia (mass of approximately 1-2 beans) with 20 mg/ml lysing enzyme (L1412, Sigma) dissolved in 20 ml of osmotic wash buffer (0.5M KCl, 10 mM sodium phosphate, pH 5.8) for 2 h. Protoplasts were collected by filtering protoplasts through sterile miracloth into a 50 ml screw cap centrifuge tube and centrifuging at 1000 x g for 10 min at 4 C. Protoplasts were then washed twice with 20 ml Washing Solution (0.6M KCl, 0.1M Tris/HCl, pH 7.0) and once in 10 ml Conditioning Solution (0.6M KCl, 50 mM CaCl.sub.2, 10 mM Tris/HCl, pH 7.5). For transformation, 1-2 ug DNA was added to 210.sup.7 protoplasts in 0.1 ml Conditioning Solution. A control reaction without added DNA was performed at the same time. 25 l of PEG solution (25% PEG8000, 0.6M KCl, 50 mM CaCl.sub.2, 10 mM Tris/HCl, and pH 7.5) was added and the protoplasts were incubated for 20 min on ice. An additional 500 ul of the PEG was added using a wide bore pipette tip and carefully mixed with the protoplasts by gently pipetting up and down 1-2 times. The protoplast solution was then incubated for 5 min on ice. 1 ml of cold Conditioning Solution was added and mixed by gently inverting the tube several times. Then the protoplast suspension was mixed with 12 ml of 50 C. selection agar (Minimal media+0.6M KCl+1.5% Agar+100 ug/ml hygromycin) contained in a 15 ml screwcap centrifuge tube. The tubes were then mixed by inverting the tubes 3-4 times and poured directly onto the petri dish plates. The control reaction was divided into a positive control plate (no selection antibiotics in the top agar and bottom plates) and a negative control (with selection hygromycin in top and bottom agar). The solidified plates were inverted and incubated overnight at 30 C. The next day, the plates were then overlaid with 15 ml of Minimal Medium (MM) containing 150 ug/ml hygromycin. Colonies should start to appear after 3-4 days. The transformants were excised and transferred to MM plate containing 100 ug/ml hygromycin. Correct transformants on the hygromycin plate were confirmed by PCR approaches and southern blot.

[0202] Dry Mass Measurement.

[0203] Dry mass at each time point was determined by harvesting the mycelium on miracloth by suction filtration and washed twice with 50 ml distilled water. Subsequently, the dry weight was determined by drying it overnight in pre-weighed tubes on lyophilizer.

[0204] HPLC.

[0205] The content of itaconic acid, aconitic acid, and glucose in each sample collected from filtration (0.22 um) was assayed by a high-pressure liquid chromatography (HPLC) on a Bio-Rad Aminex HPX-87H ion exclusion column (300 mm7.8 mm). Columns were eluted with Sulfuric acid (0.005 M) at a flow rate of 0.55 mL/min. The sample volume was 10-100 ul, and IA was detected at 210 nm with a Waters 2414 refractive index detector.

[0206] RNA Isolation and Transcript Analysis by Quantitative Real Time RT-PCR.

[0207] Wild type and tf deletion strains were grown in Riscaldati medium at 30 C. After 3 days growth, mycelia were harvested, pressed dry between paper towels and immediately flash frozen in liquid nitrogen. The entire sample was then ground in a mortar and pestle with liquid nitrogen. Approximately 100 mg samples (about 0.1 ml) were extracted using Trizol reagent (Chomczynski, BioTechniques 1993, 15(3):532-534, 536-537) and the resulting RNA was converted to cDNA using high capacity RNA-to-DNA kit (Applied Biosystems). Quantitative RT-PCR were performed in 50 ul reactions containing 25 ul of Power SYBR green PCR master mix (Applied Biosystems), 50 ng cDNA (from 50 ng RNA) and 0.2 uM forward and reverse primers. The RT-PCR primers used for analysis of the mttA, cadA, mfsA genes and benA (-tubulin) as endogenous control gene are listed in Table 3. There are two additional controls, one is a no RT (without adding RT enzyme mix) control to estimate contamination from genomic DNA, and the other is no-template controls for each primer pair to measure effect from primer dimer formation. Amplification was performed using 7900HT Fast Real-Time PCR system (Applied Biosystems) programmed to initially hold at 95 C. for 10 min and then to complete 45 cycles of 95 C. for 15 s, 60 C., for 60 s. The data were analyzed using the comparative C.sub.T method (e.g., see Schmittgen et al., Analytical biochemistry 2000, 285(2):194-204)

Example 2

Expression Profile of Itaconic Acid Gene Cluster in A. pseudoterreus

[0208] RNA samples were prepared from three different growth stages of A. pseudoterreus in the itaconic acid production process. The stages were 1) pre-production, before itaconic acid production begins, 2) production onset, the beginning of itaconic acid production correlated with phosphate depletion, and 3) production, early in the phase of maximum itaconic acid production rate (FIG. 2). EST data revealed four genes in the cluster having high expression frequency both in the onset phase and production phase, but not in the pre-production phase (Table 2). These genes were tf, mttA, cadA, and mfsA.

TABLE-US-00004 TABLE 2 Number of ESTs per gene at three stages of itaconic acid production Broad Institute Pre- Production Gene No. Gene Description Production Onset Production ATEG_09968.1 upstream flanking 0 0 0 gene; lovE ATEG_09969.1 tf 0 4 4 ATEG_09970.1 mttA 0 81 93 ATEG_09971.1 cadA 0 77 110 ATEG_09972.1 mfsA 0 6 7 ATEG_09973.1 p450 0 7 11 ATEG_09974.1 downstream 0 0 0 flanking gene ATEG_09817.1 control; gapdh 31 51 43

[0209] cadA has 77 ESTs at the beginning of itaconic acid (IA) production and 110 ESTs during the IA production, while mttA has 81 and 93 ESTs respectively in each stage. Both have no transcript detected before IA is produced. Transcription factor (tf) and mfsA, like cadA and mttA, did not show any expression before IA production, but had significant levels of transcription following the initiation of itaconic acid production (Table 2).

[0210] When genes upstream and downstream of tf, cadA, mttA and mfsA were examined, a similar expression pattern was not observed. No transcript was detected for either upstream or downstream genes in any stage of IA production except for p450. Control gene gpdh, which is far away from this region, showed high expression through the whole growth stage. This EST data clearly demonstrated that four genes tf, cadA, mttA and mfsA have the same expression pattern and are closely related to the IA production process. In addition, these four genes are in the same cluster. They are turned on strongly at the onset of IA production and persists through the production phase (FIG. 2).

Example 3

Effect of Tf, cadA, mttA and mfsA Deletion on Itaconic Acid Production in A. pseudoterreus

[0211] A transformation system was developed to allow for transformation of A. pseudoterreus (see Example 1). This system was used to generate recombinant knockout strains for each of the endogenous tf, cadA, mttA and mfsA genes. The KO mutant strains were confirmed by PCR and southern blot. The transformation protocol gave very high frequency of homologous deletion, 8 out 10 had the correct deletion. This high deletion frequency may be due to the presence of a ku gene mutation in the genome of wild-type A. pseudoterreus.

[0212] Biomass accumulation and itaconic acid (IA) production of each of the four knockout mutants and wild type A. pseudoterreus were measured at day 5. All strains, including wild type, had similar biomass accumulation (FIG. 3A). There is no significant difference in biomass among these five strains, indicating that deletion of these genes does not cause a noticeable growth defect.

[0213] However, the yield of IA was significantly lower in all four deletion strains (tf, cadA, mttA and mfsA) when compared to wild type A. pseudoterreus. After 5 days growth in the Riscardati medium, the tf strain had only generated 3 g/l IA, compared to the wild type strain, which generated 24 g/l of IA (about an 8-fold decrease). No detectable IA was produced by the cadA and mttA strains. mfsA produced around 16 g/L itaconic acid, about of wild type A. pseudoterreus.

[0214] These observations demonstrate that tf, mttA, cadA and mfsA genes play a role in itaconic acid production.

Example 4

Production Kinetics of Itaconic Acid in Wild Type and Tf Deletion Strain

[0215] To test the production kinetics in the deletion strains, tf and wild type A. pseudoterreus strain ATCC 32359 were tested for IA production during the growth on a rotary shaker for 7 days. IA was analyzed by HPLC for 2, 4, 6 and 7 day cultures.

[0216] As shown in FIG. 4, the IA yield plateaued at day 7 in both tf and wild type strains. Interestingly, the IA yield in tf (50) is much lower than that of wild type (35 g/1), a decrease of about 7-fold. Thus, the tf strain produces IA at slower rate with a lower maximum IA yield than the wild type strain.

Example 5

Tf Regulation

[0217] The effects of tf gene deletion on the transcription level of other genes in the cluster were investigated by real-time reverse transcription PCR (RT-PCR). In the both tf and wild type strains, expression level of each gene was analyzed by RT-PCR by measuring mttA, cadA, mfsA mRNA levels using primers specific for those genes (Table 3).

TABLE-US-00005 TABLE3 primersforreal-timeRT-PCRanalysisofcluster genetranscriptlevel Gene targeted Primername Primersequence(SEQIDNO:) mttA mttF Gctttcaatgtggttcctac(41) mttR ctccatcacctaccctttc(42) cadA cadF gaagtgtgggatctggc(43) cadR gggttcggtatttgtgaag(44) mfsA mfsF caagaacagtttggcctgag(45) mfsR gcggacatcatacaatctgg(46) benA -tubulinF ttgtcgatgttgttcgtcgc(47) -tubulinR tggcgttgtaaggctcaacc(48)

[0218] As shown in FIG. 5, in tf strains, mRNA level of mttA decreased 57 fold, cadA mRNA level decreased 37 fold, and mfsA decreased 23 fold, as compared to their expression in wild type A. pseudoterreus 32359. Thus, inactivation of the tf gene dramatically reduced the level of mRNA of other genes in the cluster. Within the itaconic acid biosynthesis cluster, the transcription factor potentially controls expression of other genes.

Example 6

cadA Deletion Creates a Novel Strain that Produces Aconitic Acid

[0219] In A. pseudoterreus, when cadA was deleted, itaconic acid production was completely abolished (FIG. 3B). However, 3.5 g per liter aconitic acid in the cadA strain was detected at day 5 (FIG. 6A). Aconitic acid was not produced by the wild type, mttA or mfsA strains (FIG. 6A). A time course analysis showed that aconitic acid started to appear in the supernatant at day 3, similar as IA in the wild type strain (FIG. 6B). At day 3, only cis-aconitic acid was detected in the supernatant. At day 4, both cis-aconitic acid and trans-aconitic acid were detected. From day 5 onward, cis-aconitic acid remained consistent at about 2 g/L, while trans-aconitic acid yield continued to increase (FIG. 6B). By day 10, 10 g/L trans-aconitic acid was detected in the supernatant from the cadA strain (FIG. 6B). FIG. 6C shows a comparison of total aconitic acid production between wild type and cadA fungi. Thus, cadA stains of A. pseudoterreus and A. terreus can be used to produce cis- and trans-aconitic acid.

Example 7

Materials and Methods

[0220] This example describes methods used in the experiments described in Example 8.

Transgene Expression Vector for 3-HP Production

[0221] Isolation of DNA Fragments:

[0222] Fragment 1: A. pseudoterreus 5-cadA gene, 987 bp (SEQ ID NO: 59) isolated by PCR with the oligo pair 1969 and 1970 (SEQ ID NOS: 60 and 61, respectively) and A. pseudoterreus genomic DNA;

[0223] Fragment 2: A. niger gpdA promoter, 813 bp (SEQ ID NO: 62) isolated by PCR with oligo pair of 1971 and 1972 (SEQ ID NOS: 63 and 64, respectively) and A. niger genomic DNA;

[0224] Fragment 3: aspartate 1-decarboxylase (panD) cDNA of Tribolium castaneum with codon optimization for A. pseudoterreus, 1617 bp (SEQ ID NO: 65) was isolated by PCR with the oligo pair of 1973 and 1974 (SEQ ID NOS: 66 and 67, respectively) and the plasmid DNA containing the synthesized panD cDNA;

[0225] Fragment 4: bidirectional terminator from A. niger elf3/multifunctional chaperone (SEQ ID NO: 68) was isolated by PCR with oligo pair of 1975 and 1976 (SEQ ID NOS: 69 and 70, respectively) and the genomic DNA of A. niger;

[0226] Fragment 5: codon optimized synthetic cDNA of -alanine-pyruvate aminotransferase (BAPAT) of Bacillus cereus, 1350 bp (SEQ ID NO: 71) was isolated by PCR with oligo pair of 1977 and 1978 (SEQ ID NOS: 72 and 73, respectively) and the plasmid DNA containing the synthesized BABAT cDNA; Fragment 6: A. niger enol promoter, 704 bp (SEQ ID NO: 74) isolated by PCR with oligo pair of 1979 and 1980 (SEQ ID NOS: 75 and 76, respectively) and A. niger genomic DNA;

[0227] Fragment 7: A. nidulans gpdA promoter, 885 bp (SEQ ID NO: 77) was isolated by PCR with the oligo pair of 2002 and 1982 (SEQ ID NOS: 78 and 79, respectively) and A. nidulans genomic DNA;

[0228] Fragment 8: the codon optimized synthetic cDNA of E. coli 3-hydroxypropionate dehydrogenase (HPDH), 741 bp (SEQ ID NO: 80) was isolated by PCR with oligo pair of 1983 and 1984 (SEQ ID NOS: 81 and 82, respectively) and the plasmid DNA containing the codon-optimized synthesized HPDH DNA of E. coli;

[0229] Fragment 9: trpC terminator of A. nidulans, 473 bp (SEQ ID NO: 83) isolated by PCR with oligo pair of 1985 and 2004 (SEQ ID NOS: 84 and 85, respectively) and plasmid DNA of pAN7.1;

[0230] Fragment 10: trpC terminator of A. nidulans, 473 bp (SEQ ID NO: 86) isolated by PCR with the oligo pair of 2005 and 1986 (SEQ ID NOS: 87 and 88, respectively) and plasmid DNA of pAN7.1;

[0231] Fragment 11: A. oryzae ptrA selection marker gene, 2005 bp; SEQ ID NO: 89) isolated by PCR with the oligo pair of 1987 and 1988 (SEQ ID NOS: 90 and 91, respectively) and A. oryzae genomic DNA;

[0232] Fragment 12: A. pseudoterreus 3-cadA gene, 908 bp (SEQ ID NO: 92) isolated by PCR with the oligo pair 1989 and 2003 (SEQ ID NOS: 93 and 94, respectively) and A. oryzae genomic DNA;

[0233] Fragment 13 (SEQ ID NO: 95): Combination of Fragments 7 to 9 (SEQ ID NOS: 77, 80, and 83, respectively), 2099 bp isolated by PCR with oligo pair of 1981 and 1986 (SEQ ID NOS: 96 and 88, respectively) and plasmid DNA of pZD-2; and

[0234] Fragment 14 (SEQ ID NO: 97): Combination of Fragments 11 to 12 (SEQ ID NOS: 89 and 92, respectively), 2913 bp was isolated by PCR with the oligo pair of 1987 and 1990 (SEQ ID NOS: 90 and 98, respectively) and plasmid DNA of pZD-3.

[0235] The oligonucleotide primers used are shown in Table 4.

TABLE-US-00006 TABLE4 Primersusedtogeneratevectorfor 3-HPproduction Name Sequence(SEQIDNO:) 1969cad1 ccctcgaggtcgacggtatcgataGATATCGGTTGTAGCA GCGTAAACAC(60) 1970cad2 tctttcatagtagCCTTGGTGAACATCTTGAGG(61) 1971gpdA1 atgttcaccaaggCTACTATGAAAGACCGCGATG(63) 1972gpdA2 cgccggtggcgggCATTGTTTAGATGTGTCTATGTG(64) 1973pan1 catctaaacaatgCCCGCCACCGGCGAGGACCA(66) 1974pan2 atccaacccatcaGAGGTCGGAGCCCAGGCGTTCG(67) 1975ter1 gggctccgacctcTGATGGGTTGGATGACGATG(69) 1976ter2 tctggcccagctcTGAGTCCTAGATGGGTGGTG(70) 1977bap1 catctaggactcaGAGCTGGGCCAGACATTCCTTC(72) 1978bap2 gtccatcaacatgGAACTGATGATCGTCCAGGTCAC(73) 1979eno1 cgatcatcagttcCATGTTGATGGACTGGAGGG(75) 1980eno2 gaactagtggatcccccgggctgcGttaaCTCGAGCTTAC AAGAAGTAGCC(76) 1981gpdA1 acaggctacttcttgtaagctcgagttTCTGTACAGTGAC CGGTGAC(96) 1982gpdA2 tgaccagcacgatCATGGTGATGTCTGCTCAAG(79) 1983hpd1 agacatcaccatgATCGTGCTGGTCACGGGCGC(81) 1984hpd2 gccatcggtcctaTTGGCGGTGGACGTTCAGGC(82) 1985trp1 cgtccaccgccaaTAGGACCGATGGCTGTGTAG(84) 1986trp2 cccgtctgtcagaGAGCGGATTCCTCAGTCTCG(88) 1987ptrA1 gaggaatccgctcTCTGACAGACGGGCAATTGATTAC(90) 1988ptrA2 gaatgttgctgagGAGCCGCTCTTGCATCTTTG(91) 1989cad3 gcaagagcggctcCTCAGCAACATTCGCCATGTTC(93) 1990cad4 actaaagggaacaaaagctggagctCAGCTCCACTGCTCAT AGTCTTTG(98) 2002gpdA5 ccctcgaggtcgacggtatcgataGTTAACTCTGTACAGTG ACCGGTGAC(78) 2003cad3 gaactagtggatcccccgggctgcaCAGCTCCACTGCTCAT AGTCTTTG(94) 2004trpR gaactagtggatcccccgggctgcaGAGCGGATTCCTCAGT CTCG(85) 2005trpF ccctcgaggtcgacggtatcgataTAGGACCGATGGCTGTG TAG(87)

[0236] An overview of the arrangement of the Fragments is shown in FIG. 7. Fragments 1 to 6 (SEQ ID NOS: 59, 62, 65, 68, 71 and 74, respectively) were assembled into the plasmid DNA pBlueScript SK () linearized with HindIII and PstI via Gibson Assembly master kit to form plasmid pZD-1. A restriction enzyme site HpaI was introduced at the end of the fragment 6 for further cloning.

[0237] Fragments 7 to 9 (SEQ ID NOS: 77, 80, and 83, respectively) were assembled into the plasmid DNA pBlueScript SK () linearized with HindIII and PstI via Gibson Assembly master kit to form plasmid DNA pZD-2.

[0238] Fragments 10 to 12 (SEQ ID NOS: 86, 89, and 92, respectively) were assembled into the pBlueScript SK() vector linearized with restriction enzyme HindIII and PstI by Gibson assembly to form the plasmid vector ZD-3. (Only fragments 11 and 12 were used in the next step; SEQ ID NOS: 89 and 92).

[0239] Fragments 13 and 14 (SEQ ID NOS: 95 and 97) were assembled together into the plasmid DNA vector ZD-1 linearized with restriction enzyme HpaI/SacI via Gibson Assembly master kit to form pZD-4.

[0240] Genomic DNA isolation and Southern blotting analysis were performed as described in Example 1 (and see Dai et al., 2017, Appl Microbiol Biotechnol 101:6099-6110).

Detection of 3-HP

[0241] The extracellular 3-HP in the culture supernatants was quantified with HPLC method as described in Example 1.

Example 8

Production of 3-HP

[0242] The constructs generated in Example 7 (FIG. 7) were transformed into wild type A. pseudoterreus strain ATCC 32359 using the methods describe in Example 1, thereby inactivating/disrupting the cadA gene in some examples.

[0243] As shown in FIG. 8, restriction fragment length polymorphism of selected transgenic strains show that the transgene expression cassette was inserted into the cadA locus in strain-2 (with one copy) and strain-6 (two copies), while the strain-4 and strain-5 carry the transgene expression cassette with random integration. No integration of transgene expression cassette was observed in strain-1 and strain-3.

[0244] 3-HP production was measured in several transformants. As shown in FIG. 9A, the cadA strain did not produce 3-HP, while insertion of the transgene expression cassette that allowed for expression of panD, BAPAT, and HPDH, into the cadA locus with one copy or two copies and resulted in 0.9 or 1.7 g/13-HP accumulation in the strains 3HP-2 or 3HP-6. In contrast, when the transgene expression cassette was randomly inserted into the chromosome, 3HP production was substantially lower (Strains 3HP-4 and 3HP-5). FIG. 9B shows 3-HP production over 8 days in Strains 3HP-2 and 3HP-6 (strains 2 and 6, respectively). Thus, genetically inactivating cadA can increase 3-HP production.

[0245] In view of the many possible embodiments to which the principles of the disclosure may be applied, it should be recognized that the illustrated embodiments are only examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.