Compounds for inducing anti-tumor immunity and methods thereof
10450566 ยท 2019-10-22
Assignee
Inventors
Cpc classification
A61K31/713
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
International classification
A61K31/713
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Described herein is a previously unknown function of XBP1 in controlling anti-tumor immunity. It is shown that inhibiting XBP1 in tumor-associated dendritic cells inhibits tumor growth and induces protective anti-tumor immune responses.
Claims
1. A method for treatment of cancer in a subject in need thereof, the method comprising: contacting antigen presenting cells (APCs) with a direct inhibitor of IRE-1, wherein the direct inhibitor of IRE1 is present in an amount sufficient to increase antigen presentation in the APCs; and administering the APCs contacted with the direct inhibitor of IRE-1, to a subject, wherein the subject has a solid cancer, and wherein the solid cancer comprises an epithelial cancer, a germ cell cancer, or a stromal tumor.
2. The method of claim 1, wherein the solid cancer is further characterized as an ovarian cancer.
3. The method of claim 1, wherein the epithelial cancer is a carcinoma or an adenocarcinoma.
4. The method of claim 1, wherein the APCs are dendritic cells.
5. The method of claim 4, wherein the dendritic cells are tumor-associated dendritic cells.
6. The method of claim 1, wherein the APCs provided are obtained from the subject.
7. The method of claim 1, wherein the direct inhibitor of IRE-1 is an IRE-1-specific antibody or a small molecule inhibitor of IRE-1.
8. The method of claim 1, wherein the direct inhibitor of IRE-1 reduces or eliminates IRE-1 mRNA expression in the APCs.
9. The method of claim 1, wherein the direct inhibitor of IRE-1 reduces or eliminates IRE-1 protein expression in the APCs.
10. The method of claim 1, wherein the direct inhibitor of IRE-1 is a nucleic acid molecule that is antisense to an IRE-1-encoding nucleic acid molecule, an IRE-1 shRNA, an IRE-1 siRNA, or a microRNA that targets IRE-1.
11. The method of claim 1, further comprising administering an additional therapeutic agent to the subject.
12. The method of claim 11, wherein the additional therapeutic agent is a chemotherapeutic agent or an antibody.
13. A method for treatment of ovarian cancer in a subject in need thereof, the method comprising: contacting antigen presenting cells (APCs) with a small molecule inhibitor of IRE-1, wherein the small molecule inhibitor of IRE1 is present in an amount sufficient to increase antigen presentation in the APCs; and administering the APCs contacted with the small molecule inhibitor of IRE-1 to a subject, wherein the subject has ovarian cancer.
14. The method of claim 13, wherein the APCs are dendritic cells.
15. The method of claim 13, wherein the APCs provided are obtained from the subject.
16. A method for treatment of ovarian cancer in a subject in need thereof, the method comprising: contacting antigen presenting cells (APCs) with an inhibitor of IRE-1, wherein the inhibitor of IRE1 is present in an amount sufficient to increase antigen presentation in the APCs, and wherein the inhibitor of IRE-1 reduces or eliminates IRE-1 mRNA expression in the APCs; and administering the APCs contacted with the inhibitor of IRE-1 to a subject, wherein the subject has ovarian cancer.
17. The method of claim 16, wherein the APCs are dendritic cells.
18. The method of claim 16, wherein the APCs provided are obtained from the subject.
19. The method of claim 16, wherein the inhibitor of IRE-1 is a nucleic acid molecule that is antisense to an IRE-1-encoding nucleic acid molecule, an IRE-1 shRNA, or an IRE-1 siRNA.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
(74)
(75)
(76)
(77)
(78)
(79)
(80)
(81)
(82)
(83)
(84)
(85)
DETAILED DESCRIPTION OF THE INVENTION
Definitions
(86) Terms used in the claims and specification are defined as set forth below unless otherwise specified.
(87) Polypeptide, peptide, and protein are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
(88) Nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081, 1991; Ohtsuka et al. Biol. Chem. 260:2605-2608, 1985); and Cassol et al, 1992; Rossolini et al, Mol. Cell. Probes 8:91-98, 1994). For arginine and leucine, modifications at the second base can also be conservative. The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene. Polynucleotides used herein can be composed of any polyribonucleotide or polydeoxribonucleotide, which can be unmodified RNA or DNA or modified RNA or DNA. For example, polynucleotides can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that can be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, the polynucleotide can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. A polynucleotide can also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. Modified bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, polynucleotide embraces chemically, enzymatically, or metabolically modified forms.
(89) As used herein, the term ER stress refers to a perturbation in ER function and dysregulation of ER homeostasis due to an internal or external cellular insult. ER stress elicits a signaling cascade (i.e., the unfolded protein response) to mitigate stress.
(90) The term Unfolded Protein Response (UPR) or the Unfolded Protein Response pathway refers to an adaptive response to the accumulation of unfolded proteins in the ER and includes the transcriptional activation of genes encoding chaperones and folding catalysts and protein degrading complexes as well as translational attenuation to limit further accumulation of unfolded proteins. Both surface and secreted proteins are synthesized in the endoplasmic reticulum (ER) where they need to fold and assemble prior to being transported.
(91) As used herein, the term dendritic cell refers to a type of specialized antigen presenting cell (APC) involved in innate and adaptive immunity. Also referred to as DC. Dendritic cells may be present in the tumor microenvironment and these are referred to as tumor-associated dendritic cells or tDCs.
(92) As used herein, the term anti-tumor immunity refers to an immune response induced upon recognition of cancer antigens by immune cells.
(93) As used herein, the term T cell activation refers to cellular activation of resting T cells manifesting a variety of responses (For example, T cell proliferation, cytokine secretion and/or effector function). T cell activation may be induced by stimulation of the T cell receptor (TCR) with antigen/MHC complex.
(94) As used herein, the term antigen presenting capacity refers to the ability of antigen presenting cells (APCs) to present antigen to T lymphocytes to elicit an immune response. In certain embodiments, the immune response is a type I immunity response. In certain embodiments, the antigen presenting capacity is determined by measuring infiltration and activation of T cells at tumor locations and/or secretion of IFN- and Granzyme B ex vivo by APCs (i.e., dendritic cells).
(95) As used herein, the term anti-tumor T cells refers to T lymphocytes that have been activated by APCs, wherein the antigen is a tumor-associated antigen. These T lymphocytes will subsequently induce the killing of malignant cells.
(96) As used herein, the term anti-tumor response refers to at least one of the following: tumor necrosis, tumor regression, tumor inflammation, tumor infiltration by activated T lymphocytes, or activation of tumor infiltrating lymphocytes. In certain embodiments, activation of lymphocytes is due to presentation of a tumor-associated antigen by APCs.
(97) As used herein, the term extended survival refers to increasing overall or progression free survival in a treated subject relative to an untreated control.
(98) As used herein, the term test sample is a sample isolated, obtained or derived from a subject, e.g., a human subject. The term subject or host is intended to include living organisms, but preferred subjects or hosts are mammals, and in particular, humans or murines. The term subject or host also includes cells, such as prokaryotic or eukaryotic cells. In particularly preferred embodiments, the test sample is a sample isolated, obtained or derived from a subject, e.g., a female human.
(99) The term sufficient amount or amount sufficient to means an amount sufficient to produce a desired effect, e.g., an amount sufficient to reduce the size of a tumor.
(100) The term therapeutically effective amount is an amount that is effective to ameliorate a symptom of a disease. A therapeutically effective amount can be a prophylactically effective amount as prophylaxis can be considered therapy.
(101) As used herein, combination therapy embraces administration of each agent or therapy in a sequential manner in a regiment that will provide beneficial effects of the combination and co-administration of these agents or therapies in a substantially simultaneous manner. Combination therapy also includes combinations where individual elements may be administered at different times and/or by different routes but which act in combination to provide a beneficial effect by co-action or pharmacokinetic and pharmacodynamics effect of each agent or tumor treatment approaches of the combination therapy. For example, the agents or therapies may be administered simultaneously, sequentially, or in a treatment regimen in a predetermined order.
(102) As used herein, about will be understood by persons of ordinary skill and will vary to some extent depending on the context in which it is used. If there are uses of the term which are not clear to persons of ordinary skill given the context in which it is used, about will mean up to plus or minus 10% of the particular value.
(103) It must be noted that, as used in the specification and the appended claims, the singular forms a, an and the include plural referents unless the context clearly dictates otherwise.
(104) Various aspects described herein are described in further detail in the following subsections.
(105) ER Stress and UPR
(106) The Unfolded Protein Response (UPR) or the Unfolded Protein Response pathway is initiated when there is an accumulation of unfolded proteins in the ER. This results in the transcriptional activation of genes encoding chaperones, folding catalysts, and protein degrading complexes, as well as translational attenuation to limit further accumulation of unfolded proteins.
(107) Since the ER and the nucleus are located in separate compartments of the cell, the unfolded protein signal must be sensed in the lumen of the ER and transferred across the ER membrane and be received by the transcription machinery in the nucleus. The UPR performs this function for the cell. Activation of the UPR can be caused by treatment of cells with reducing agents like DTT, by inhibitors of core glycosylation like tunicamycin or by Ca-ionophores that deplete the ER calcium stores. First discovered in yeast, the UPR has now been described in C. elegans as well as in mammalian cells. In mammals, the UPR signal cascade is mediated by three ER transmembrane proteins: the protein-kinase and site-specific endoribonuclease IRE-1 alpha; the eukaryotic translation initiation factor 2 kinase, PERK/PEK; and the transcriptional activator ATF6. If the UPR cannot adapt to the presence of unfolded proteins in the ER, an apoptotic response is initiated leading to the activation of JNK protein kinase and caspases 7, 12, and 3. The most proximal signal from the lumen of the ER is received by a transmembrane endoribonuclease and kinase called IRE-1. Following ER stress, IRE-1 is essential for survival because it initiates splicing of the XBP1 mRNA, the spliced version of which activates the UPR.
(108) The unfolded protein response (UPR) is a major cellular stress response pathway activated in tumors that allows them to adapt to the stresses of the tumor microenvironment. Similarly, the ER stress response has been shown to operate in malignant cells to support tumor growth. The present invention provides the novel discovery that constitutive activation of the ER stress sensor, XBP1, in cancer-associated DCs drives cancer progression (e.g., ovarian cancer progression). In certain embodiments, the ER stress response is dysregulated in cells present in the tumor microenvironment. In certain embodiments, the ER stress response is activated through signaling of the IRE-1/XBP1 pathway. In certain embodiments, the IRE-1/XBP1 pathway is constitutively active in cells present in the tumor microenvironment.
(109) Accordingly, in one aspect, the invention pertains to a method for treating or reducing the progression of ovarian cancer in a subject, the method comprising administering to the subject a direct or indirect inhibitor of XBP1 or a direct or indirect inhibitor of IRE-1 such that progression of the ovarian cancer in the subject is inhibited. Non-limiting examples of direct inhibitors of XBP1 include a nucleic acid molecule that is antisense to an XBP1-encoding nucleic acid molecule, an XBP1 shRNA, an XBP siRNA, a nanoparticle-encapsulated XBP1 siRNA (e.g., polyethylenimine (PEI)-based nanoparticles encapsulating siRNA), a microRNA that targets XBP1, a dominant negative XBP1 molecule, an XBP1-specific antibody and small molecule inhibitors of XBP1. Non-limiting examples of indirect inhibitors of XBP1 include agents that target IRE-1, an endonuclease essential for proper splicing and activation of XBP1, such that inhibition of IRE-1 leads to inhibition of the production of the spliced, active form of XBP1. Non-limiting examples of IRE-1 inhibitors include a nucleic acid molecule that is antisense to an IRE-1-encoding nucleic acid molecule, an IRE-1 shRNA, an IRE-1 siRNA, a nanoparticle-encapsulated IRE-1 siRNA, a microRNA that targets IRE-1, a dominant negative IRE-1 molecule, an IRE-1-specific antibody and small molecule inhibitors of IRE-1.
(110) XBP1
(111) X-box binding protein-1 (XBP1) is a transcription factor that acts as an ER stress sensor by promoting the expression of ER chaperones and regulating distinct sets of target genes in a cell type-specific manner (Acosta-Alvear et al., 2007; Lee et al., 2003; Yoshida et al., 2001). In certain embodiments, XBP1 is spliced via IRE-1 activation. In certain embodiments, spliced XBP1 enhances transcription of ER chaperones.
(112) The X-box binding human protein (XBP1) is a DNA binding protein and has an amino acid sequence as described in, for example, Liou, H. C., et. al. 1990. Science 247, 1581-1584 and Yoshimura, T., et al. 1990. EMBO J. 9, 2537-2542, and other mammalian homologs thereof, such as described in Kishimoto T., et al. 1996. Biochem. Biophys. Res. Commun. 223, 746-751 (rat homologue). Exemplary proteins intended to be encompassed by the term XBP1 include those having amino acid sequences disclosed in GenBank with accession numbers A36299 [gi: 105867], NP_005071 [gi:4827058], P17861 [gi: 139787], CAA39149 [gi:287645], and BAA82600 [gi:5596360] or e.g., encoded by nucleic acid molecules such as those disclosed in GenBank with accession numbers AF027963 [gi:13752783]; NM_013842 [gi: 13775155]; or M31627 [gi: 184485]. XBP1 is also referred to in the art as TREB5 or HTF (Yoshimura, T., et al. 1990. EMBO Journal. 9, 2537; Matsuzaki, Y., et al. 1995. J. Biochem. 117, 303). Like other members of the b-zip family, XBP1 has a basic region that mediates DNA-binding and an adjacent leucine zipper structure that mediates protein dimerization.
(113) There are two forms of XBP-1 protein, unspliced and spliced, which differ in their sequence and activity. Unless the form is referred to explicitly herein, the term XBP1 as used herein includes both the spliced and unspliced forms. Spliced XBP1 (XBP1s) directly controls the activation of the UPR, while unspliced XBP1 functions to negatively regulate spliced XBP1.
(114) Spliced XBP1 (XBP1s) refers to the spliced, processed form of the mammalian XBP1 mRNA or the corresponding protein. Human and murine XBP1 mRNA contain an open reading frame (ORF1) encoding bZIP proteins of 261 and 267 amino acids, respectively. Both mRNA's also contain another ORF, ORF2, partially overlapping but not in frame with ORF1. ORF2 encodes 222 amino acids in both human and murine cells. Human and murine ORF1 and ORF2 in the XBP1 mRNA share 75% and 89% identity respectively. In response to ER stress, XBP1 mRNA is processed by the ER transmembrane endoribonuclease and kinase IRE-1 which excises an intron from XBP1 mRNA. In murine and human cells, a 26 nucleotide intron is excised. The boundaries of the excised introns are encompassed in an RNA structure that includes two loops of seven residues held in place by short stems. The RNA sequences 5 to 3 to the boundaries of the excised introns form extensive base-pair interactions. Splicing out of 26 nucleotides in murine and human cells results in a frame shift at amino acid 165 (the numbering of XBP1 amino acids herein is based on GenBank accession number NM.sub.-013842 [gi:13775155] and one of skill in the art can determine corresponding amino acid numbers for XBP1 from other organisms, e.g., by performing a simple alignment). This causes removal of the C-terminal 97 amino acids from the first open reading frame (ORF1) and addition of the 212 amino from ORF2 to the N-terminal 164 amino acids of ORF1 containing the b-ZIP domain. In mammalian cells, this splicing event results in the conversion of a 267 amino acid unspliced XBP1 protein to a 371 amino acid spliced XBP1 protein. The spliced XBP1 then translocates into the nucleus where it binds to its target sequences to induce their transcription.
(115) Unspliced XBP1 (XBP1u) refers to the unprocessed XBP1 mRNA or the corresponding protein. As set forth above, unspliced murine XBP1 is 267 amino acids in length and spliced murine XBP1 is 371 amino acids in length. The sequence of unspliced XBP1 is known in the art and can be found, e.g., Liou, H. C., et. al. 1990. Science 247, 1581-1584 and Yoshimura, T., et al. 1990. EMBO J. 9, 2537-2542, or at GenBank accession numbers NM_005080 [gi: 14110394] or NM_013842 [gi: 13775155].
(116) As used herein, the term functional XBP1 refers to the spliced form of XBP1, which acts as a transcription factor to activate the UPR.
(117) As used herein, the term ratio of spliced to unspliced XBP1 refers to the amount of spliced XBP1 present in a cell or a cell-free system, relative to the amount or of unspliced XBP1 present in the cell or cell-free system. The ratio of unspliced to spliced XBP1 refers to the amount of unspliced XBP1 compared to the amount of unspliced XBP1. Increasing the ratio of spliced XBP1 to unspliced XBP1 encompasses increasing the amount of spliced XBP1 or decreasing the amount of unspliced XBP1 by, for example, promoting the degradation of unspliced XBP1. Increasing the ratio of unspliced XBP1 to spliced XBP1 can be accomplished, e.g., by decreasing the amount of spliced XBP1 or by increasing the amount of unspliced XBP1. Levels of spliced and unspliced XBP1 an be determined as described herein, e.g., by comparing amounts of each of the proteins which can be distinguished on the basis of their molecular weights or on the basis of their ability to be recognized by an antibody. In another embodiment described in more detail below, PCR can be performed employing primers which span the splice junction to identify unspliced XBP1 and spliced XBP1 and the ratio of these levels can be readily calculated.
(118) The present invention pertains to the novel discovery that XBP1 is constitutively active in cancer-associated DCs, such as ovarian cancer-asssociated DCs. In one embodiment, the present invention is directed to the novel discovery that anti-tumor immunity is enhanced or increased in a subject by directly or indirectly inhibiting XBP1. In another embodiment, the present invention is directed to the discovery that ovarian cancer can be treated or reduced in a subject by administering an effective amount of a direct or indirect inhibitor of XBP1 to the subject.
(119) IRE-1
(120) The term IRE-1 or IRE-1 refers to an ER transmembrane endoribonuclease and kinase called Serine/threonine-protein kinase/endoribonuclease, or alternatively, Inositol-requiring protein 1, which oligomerizes and is activated by autophosphorylation upon sensing the presence of unfolded proteins, see, e.g., Shamu et al., (1996) EMBO J. 15: 3028-3039. In Saccharomyces cerevisiae, the UPR is controlled by IREp. In the mammalian genome, there are two homologs of IRE-1, IRE-1 and IRE-1. IRE-1 is expressed in all cells and tissue whereas IRE-1 is primarily expressed in intestinal tissue. The endoribonucleases of either IRE-1 and IRE-1 are sufficient to activate the UPR. Accordingly, as used herein, the term IRE-1 includes, e.g., IRE-1, IRE-1 and IREp. In a preferred embodiment, IRE-1 refers to IRE-1.
(121) IRE-1 is a large protein having a transmembrane segment anchoring the protein to the ER membrane. A segment of the IRE-1 protein has homology to protein kinases and the C-terminal has some homology to RNAses. Over-expression of the IRE-1 gene leads to constitutive activation of the UPR. Phosphorylation of the IRE-1 protein occurs at specific serine or threonine residues in the protein.
(122) IRE-1 senses the overabundance of unfolded proteins in the lumen of the ER. The oligomerization of this kinase leads to the activation of a C-terminal endoribonuclease by trans-autophosphorylation of its cytoplasmic domains. IRE-1 uses its endoribonuclease activity to excise an intron from XBP1 mRNA. Cleavage and removal of a small intron is followed by re-ligation of the 5 and 3 fragments to produce a processed mRNA that is translated more efficiently and encodes a more stable protein (Calfon et al. (2002) Nature 415(3): 92-95). The nucleotide specificity of the cleavage reaction for splicing XBP1 is well documented and closely resembles that for IRE-p mediated cleavage of HAC1 mRNA (Yoshida et al. (2001) Cell 107:881-891). In particular, IRE-1 mediated cleavage of murine XBP1 cDNA occurs at nucleotides 506 and 532 and results in the excision of a 26 base pair fragment. IRE-1 mediated cleavage of XBP1 derived from other species, including humans, occurs at nucleotides corresponding to nucleotides 506 and 532 of murine XBP1 cDNA, for example, between nucleotides 502 and 503 and 528 and 529 of human XBP1.
(123) As used interchangeably herein, IRE-1 activity, biological activity of IRE-1 or functional activity IRE-1, includes an activity exerted by IRE-1 on an IRE-1 responsive target or substrate, as determined in vivo, or in vitro, according to standard techniques (Tirasophon et al. 2000. Genes and Development Genes Dev. 2000 14: 2725-2736), IRE-1 activity can be a direct activity, such as a phosphorylation of a substrate (e.g., autokinase activity) or endoribonuclease activity on a substrate e.g., XBP1 mRNA. In another embodiment, IRE-1 activity is an indirect activity, such as a downstream event brought about by interaction of the IRE-1 protein with a IRE-1 target or substrate. As IRE-1 is in a signal transduction pathway involving XBP1, modulation of IRE-1 modulates a molecule in a signal transduction pathway involving XBP1. Modulators which modulate an XBP1 biological activity indirectly modulate expression and/or activity of a molecule in a signal transduction pathway involving XBP1, e.g., IRE-1, PERK, eIF2, or ATF6.
(124) The present invention provides the novel discovery that targeting the IRE-1/XBP1 branch of the ER stress response in tumor-associated DCs induces protective immune responses against cancer (e.g., ovarian cancer). In some embodiment, the invention provides that inhibiting IRE-1 in tumor-associated DCs extends host survival by enhancing anti-tumor immunity.
(125) Anti-Tumor Immunity
(126) The immune system plays a critical role in protecting the host from cancer. Notably, the tumor microenvironment is an important aspect of cancer biology that contributes to tumor initiation, tumor progression, and responses to therapy. Cells and molecules of the immune system are a fundamental component of the tumor microenvironment.
(127) Since tumor tissue is characterized by a variety of antigens not typically found in normal tissue, the immune system may mount a protective response. In certain embodiments, these antigens are referred to as tumor-associated antigens (TAAs). Innate immunity against the tumor is invoked very quickly. Macrophages, which are programmed to attack and destroy tumor cells in the similar fashion that they eliminate invading pathogens, are drawn to the tumor (Mantovani et al., Nature Reviews Immunology 2011; 11, 519-531). With time, adaptive anti-tumor immune responses develop. Dendritic cells migrate to the tumor as part of the innate immune response and serve as a link between innate and adaptive immunity. In certain embodiments, dendritic cells process tumor antigens and then directly interact with T and B cells, subsequently stimulating specific immune responses. The initial response of the immune system to a tumor is to recruit lymphocytes in an attempt to clear the tumor. Tumor-infiltrating lymphocytes (TILs) include cytotoxic T lymphocytes (CTLs), helper T cells, and natural killer (NK) cells. Proteins associated with tumorigenesis or malignant growth may also stimulate humoral immunity (Suckow, The Veterinary Journal 2013; 198, 28-33).
(128) Coordination of the anti-tumor immune response requires communication between cells of the immune system, mostly carried out by cytokines (Dranoff, Nature Reviews Cancer 2004; 4, 11-22). For example, interleukin (IL)-6 produced by T lymphocytes and macrophages enhances the proliferation of both T and B lymphocytes. Likewise, interferon-gamma (IFN) is produced by NK cells, T lymphocytes, macrophages, and B lymphocytes and enhances tumor antigen presentation along with cell-mediated cytotoxicity.
(129) The predominant cell type within tumor stroma is the fibroblast. Cancer-associated fibroblasts produce a variety of factors that promote proliferation and progression of cancer, including osteonectin, vascular endothelial growth factor (VEGF), and matrix metalloproteinases (MMPs). Many of these factors are widely produced by normal cells and therefore the immune system restricts itself from attacking these targets (Rasanen and Vaheri, Experimental Cell Research 2010; 316, 2713-2722).
(130) In certain embodiments, the presence of a tumor serves as evidence that cancerous cells have successfully avoided immune elimination. This may occur due to immune selection pressure that favors growth of tumors that are less immunogenic (Dunn et. al, Nature Immunology 2002; 3, 991-998). Tumors may also escape through the expression of anti-apoptotic molecules (Reed, Current Opinion in Oncology 1999; 11, 68-75). Factors such as VEGF, soluble Fas, and transforming growth factor (TGF)-, which are produced by tumor cells and tumor stroma, can suppress anti-tumor immune response (Ben-Baruch, Seminars in Cancer Biology 2006; 16, 38-52; Whiteside, Seminars in Cancer Biology 2006; 16, 3-15). Tumor stromal cells create an environment in which cancerous cells are exposed to growth factors while avoiding immune recognition. For example, thrombospondin-1 is produced by stromal cells and leads to immune suppression via activation of TGF-3 (Silze et. al, International Journal of Cancer 2004; 108, 173-180).
(131) Harnessing the inherent ability of T cells to eliminate tumor cells represents the most promising anti-cancer strategy since the development of chemotherapy, as demonstrated most recently by the dramatic shrinkage of melanoma in response to checkpoint blockers anti-CTLA4 and anti-PD 1. In addition, recent reports demonstrate that adoptively transferred anti-tumor T cells (expanded from resected tumor specimens or genetically manipulated) can elicit robust and long-lasting anti-tumor responses (Bollard et al., 2007; Dudley et al., 2002; Leen et al., 2006; Morgan et al., 2006). However, in most cases, the optimal cytotoxic activity of such tumor-reactive T cells is drastically reduced because cancer-associated DCs are unable to support T cell function. (Barnett et al., 2005; Conejo-Garcia et al., 2004; Cubillos-Ruiz et al., 2009; Curiel et al., 2003; Huarte et al., 2008). The present invention reveals for the first time that DC-specific deletion of XBP1 can extend host survival by converting immunosuppressive tDCs into potent activators of Type 1 immunity in ovarian cancer-infiltrating T cells. Indeed, therapeutic silencing of XBP1 in tDCs using siRNA-encapsulating nanocarriers reversed their immunosuppressive phenotype and significantly prolonged host survival by inducing protective anti-tumor immune responses. Novel and more effective therapeutic strategies are needed to improve the dismal prognosis of metastatic ovarian cancer patients. The present invention demonstrates for the first time the feasibility and significant immunotherapeutic potential of targeting ER stress-driven XBP1 in tDCs using a safe and effective nanotechnology-based system that may slow or prevent the usually inevitable recurrence observed in metastatic ovarian cancer patients who have been optimally debulked. The present invention also provides that targeting the aberrant ER stress response in innate immune cells of the tumor microenvironment may also represent a viable therapeutic strategy to confront other lethal cancers that normally co-opt the immune response to promote malignant progression. Hence, the present invention provides for the first time that targeting the IRE-1/XBP1 arm of the ER stress response in cancer-bearing hosts could be used to inhibit tumor growth while simultaneously inducing robust anti-tumor immunity.
(132) In one embodiment, the present invention is directed to the novel discovery that constitutive activation of XBP1 in tumor-associated dendritic cells allows tumors to manipulate DC function and elude immune control. In another embodiment, the present invention is directed to the discovery that ablaiting XBP1 expression in tumor-associated dendritic cells enhances or induces anti-tumor immunity and extends host survival. In certain embodiments, inhibition of XBP1 enhances infiltration of activated T cells at tumor locations. In certain embodiments, inhibition of XBP1 enhances the capacity of infiltrating T cells to respond to tumor antigens.
(133) Dendritic Cells
(134) Dendritic cells (DC) are key regulators of both innate and adaptive immunity, and the array of immunoregulatory functions exhibited by these cells is dictated by their differentiation, maturation, and activation status. A major role of these cells is the induction of immunity to pathogens; however, recent data demonstrates that DCs are also critical regulators of anti-tumor immune responses. In certain embodiments, the generation of protective anti-tumor immunity depends on the presentation of tumor antigens by DCs to T cells. The control of DC survival plays an important role in regulating T cell activation and function.
(135) DCs initiate an immune response by presenting a captured antigen, in the form of peptide-major histocompatability complex (MHC) molecule complexes, to nave T cells in lymphoid tissues. Upon interaction with DCs, nave CD4+ and CD8+ T cells can differentiate into antigen-specific effector cells. DCs also play a direct role in humoral immunity by interacting with B cells and indirectly by inducing the expansion and differentiation of CD4+ helper T cells.
(136) Presentation of antigens to mount an immune response is one of the primary functions of dendritic cells. Tumor-associated DCs have the same function but the antigens are typically tumor-associated (TAA). Tumors can prevent antigen presentation and the establishment of tumor-specific immune responses through a variety of mechanisms. For example, tumors switch the differentiation of monocytes into macrophages and not DCs, or prevent the priming of tumor-specific T cells by DCs, through the mediation of IL-2 and macrophage colony-stimulating factor. In certain embodiments, tumors can interfere with DC maturation. For example, tumor cells can secrete IL-10 which leads to antigen-specific anergy of DCs. In certain embodiments, DCs are tumor-associated DCs (tDCs). These tDCs are present in the tumor microenvironment. The present invention, provides the novel discovery that tumors rely on DC-intrinsic XBP1 to elude immune control. The present invention also provides the novel discovery that inhibiting XBP1 in tumor-associated DCs extends host survival by enhancing anti-tumor immunity.
(137) In one embodiment, the present invention is directed to the novel discovery that the ER stress sensor XBP1 is constitutively active in cancer-associated DCs, such as ovarian cancer-associated DCs. In another embodiment, the present invention pertains to the discovery that the lipid peroxidation byproduct 4-HNE triggers ER stress and XBP1 activation in DCs. In another embodiment, the present invention pertains to the discovery that XBP1 regulates lipid metabolism and antigen presentation by tumor-associated DCs.
(138) XBP1 and Dendritic Cells
(139) XBP1 is a transcription factor expressed in dendritic cells and activated by IRE-1, an ER transmembrane kinase and endoribonuclease. XBP1 functions to regulate the ER stress response by maintaining ER homeostasis and preventing activation of cell death pathways caused by sustained ER stress. The ER stress response, or unfolded protein response (UPR) is activated when unfolded proteins accumulate in the ER and functions to regulate the balance between homeostasis and apoptosis. In certain embodiments, XBP1 plays a role in DC differentiation and survival. For example, XBP1-deficient cells are more sensitive to apoptosis (Iwakoshi 2007).
(140) The instant inventors have discovered that XBP1 is constitutively active in tumor-associated dendritic cells.
(141) In one embodiment, the present invention provides the novel discovery that XBP1 is a driver of dendritic cell dysfunction in the tumor microenvironment. In another embodiment, the present invention provides that XBP1 is constitutively active in cancer-associated dendritic cells, such as ovarian cancer-associated dendritic cells. In certain embodiments, XBP1-deficient tDCs demonstrate enhanced antigen-presenting capacity. In certain embodiments, silencing or inhibiting XBP1 improves host survival and induces anti-tumor immunity. In certain embodiments, the induction of anti-tumor immunity is carried out by activated infiltrating T cells that respond to tumor antigens.
(142) XBP1 and Ovarian Cancer
(143) During tumor development and progression, cancer cells encounter cytotoxic conditions such as hypoxia, nutrient deprivation, and low pH due to inadequate vascularization (Hanahan, D., et al. 2011. Cell 144, 646-74). To maintain survival and growth in the face of these physiologic stressors, a set of adaptive response pathways are induced. One adaptive pathway well studied in other contexts is the unfolded protein response (UPR), which is induced by factors affecting the endoplasmic reticulum (ER) such as changes in glycosylation, redox status, glucose availability, calcium homeostasis or the accumulation of unfolded or misfolded proteins (Hetz, C, et al. 2011. Physiol Rev 91, 1219-43). Notably, features of the tumor microenvironment, such as hypoxia and nutrient deprivation, can disrupt ER homeostasis by the perturbation of aerobic processes such as oligosaccharide modification, disulphide bond formation, isomerization, and protein quality control and export (Wouters, B. G., et al. 2008. Nat Rev Cancer 8, 851-64). In mammalian cells, the UPR is mediated by three ER-localized transmembrane protein sensors: Inositol-requiring transmembrane kinase/endonuclease-1 (IRE-1), PKR-like ER kinase (PERK) and activating transcription factor 6 (ATF6) (Walter, P., et al. 2011. Science 334, 1081-6). Of these, IRE-1 is the most evolutionarily conserved branch. An increase in the load of folding proteins in the ER activates IRE-1, an ER-resident kinase and endoribonuclease that acts as an ER-stress sensor. Activated IRE-1 removes a 26 bp intron from XBP1 mRNA and results in a frame shift in the coding sequence, with the spliced form encoding a 226 amino acid transcriptional activation domain (Calfon, M., et al. 2002. Nature 415, 92-6; Yoshida, H., et al. 2001. Cell 107, 881-91). In contrast to the unspliced XBP1 (XBP1u), which is unstable and quickly degraded, spliced XBP1 (XBP1s) is stable and is a potent inducer of target genes that orchestrate the cellular response to ER stress (Hetz, C, et al. 2011. Physiol Rev 91, 1219-43).
(144) As described in detail above, the UPR is a major cellular stress response pathway activated in tumors that allows them to adapt to the stresses of the tumor microenvironment. Several studies have reported on the activation of the UPR in various human tumors and its relevance to combinatorial therapy (Carrasco, D. R., et al. 2007. Cancer Cell 11, 349-36; De Raedt, T., et al. 2011. Cancer Cell 20, 400-413; Healy, S. J., et al. 2009. Eur J Pharmacol 625, 234-246; Ma, Y., et al. 2004. Nat Rev Cancer 4, 966-977; Mahoney, D. J., et al. 2011. Cancer Cell 20, 443-456). However, the role of the UPR and XBP1 in anti-tumor immunity is largely unknown. Here, the instant inventors have identified a previously unknown function of XBP1 in anti-tumor immunity and ovarian cancer. Here, it is demonstrated that constitutive activation of XBP1, a key component of the most evolutionarily conserved branch of the UPR, allows tumors to evade immune control by crippling normal DC function. Furthermore, XBP1 deletion and/or silencing inhibits tumor growth and/or progression and induces robust anti-tumor immunity.
(145) Tumors progress when the host fails to provide an effective anti-tumor immune response. Prior to the discovery of the present invention, the role of XBP1 in anti-tumor immunity was unknown. Herein the instant inventors have identified a role for XBP1 in eluding immune control and therefore inducing the progression of tumor development, such as ovarian tumor development. In certain embodiments, the present invention provides that XBP1 is constitutively active in tumor-associated dendritic cells present in ovarian tumors compared to normal dendritic cells. In certain embodiments, the present invention provides that constitutive activation of XBP1 is critical for the initiation and rapid progression of ovarian tumors. Notably, XBP1 deficient tDCs fail to initiate or progress tumor development (e.g., ovarian tumors). In certain embodiments, the rapid progression of ovarian tumors is a result of constitutively active XBP1 in tumor-associated dendritic cells. In certain embodiments, the present invention provides that tumor progression and/or tumor burden is reduced in XBP1-deficient tDCs, indicating an important role for XBP1 in the development and progression of ovarian tumors.
(146) Lipid Metabolism and Peroxidation
(147) Cancer-associated DCs accumulate substantial amounts of oxidized lipids, and this abnormal process negatively regulates their antigen-presenting capacity (Herber et al., 2010; Ramakrishnan et al., 2014). As provided by the instant invention, transcriptional and functional analyses of tDCs devoid of XBP1 suggest that this conserved ER stress sensor facilitates the aberrant lipid accumulation commonly observed in dysfunctional cancer-associated DCs.
(148) Lipid oxidation by reactive oxygen species (ROS) generates reactive byproducts such as the unsaturated aldehyde 4-hydroxy-trans-2-nonenal (4-HNE), which has been shown to induce protein-folding stress by forming stable adducts with ER-resident chaperones (Vladykovskaya et al., 2012). For the first time, the present invention provides that 4-HNE, a lipid peroxidation byproduct available in the human and mouse ovarian cancer microenvironment, can rapidly trigger robust ER stress and XBP1 activation in nave DCs. Interestingly, 4-HNE has been demonstrated to induce the unfolded protein response in endothelial cells by forming covalent adducts with ER resident chaperones, a process that promotes vascular inflammation (Vladykovskaya et al., 2012). The ER stress response has been linked to lipid biosynthesis (Lee et al., 2008; Sriburi et al., 2004). However, the present invention indicates that enhanced intracellular lipid accumulation by tDCs required ROS generation and IRE-1/XBP1 activation. Interestingly, exposure to XBP1-activating 4-HNE has been shown to promote fat accumulation in worms and mice (Singh et al., 2008; Singh et al., 2009). Thus, in some embodiments, the present invention provides that reactive metabolic byproducts in the tumor microenvironment, like 4-HNE, can perpetuate ER stress in infiltrating immune cells such as tDCs. Constitutive activation of the IRE-1/XBP1 arm through this process subsequently promotes abnormal intracellular lipid accumulation in tDCs via upregulation of lipid biosynthetic genes, which ultimately inhibits their natural capacity to support T cell-mediated anti-tumor responses.
(149) In one embodiment, the present invention provides that XBP1-deficient tDCs display marked downregulation of genes involved in lipid metabolic pathways. These lipid biosynthetic genes are rapidly upregulated in nave DCs exposed to 4-HNE, an XBP1-activation lipid peroxidation byproduct. This aberrant lipid accumulation by tDCs obstructs their normal antigen processing and presentation capacity (Herber et al., 2010; Ramakrisnan et al., 2014).
(150) In one embodiment, the present invention provides that the lipid peroxidation byproduct 4-HNE triggers ER stress and XBP1 activation in DCs. In another embodiment, the present invention provides that XBP1 regulates lipid metabolism and antigen presentation by tumor-associated DCs. In one embodiment, the present invention provides that XBP1 deficient tDCs have reduced intracellular lipid accumulation and improved antigen presenting capacity, leading to enhanced intra-tumoral T cell activation and increased host survival.
(151) Therapeutic Targeting of the UPR
(152) In the present invention, an unexpected role for the ER stress sensor XBP1 as a central driver of DC malfunction in the tumor microenvironment has been discovered. These findings unveil a new mechanistic paradigm whereby a lethal cancer exploits the most conserved arm of the ER stress response in tumor-resident DCs to disrupt their lipid homeostasis, alter their local antigen-presenting capacity and ultimately evade T cell-mediated immune control. While the ER stress response, and especially XBP1 activation, has been previously shown to operate in cancer cells to promote tumorigenesis, the present invention now reveals that this integrated cellular pathway further supports malignant progression by inhibiting the development of protective anti-tumor immunity via manipulation of normal DC function.
(153) The upstream kinase and endoribonuclease IRE-1, which drives the splicing of XBP1 mRNA, is a viable drug target. Recently, two groups have identified specific IRE-1 endoribonuclease inhibitors (Papandreou, I., et al. 2011. Blood 117, 1311-1314; Volkmann, K., et al. 2011. J Biol Chem 286, 12743-12755). Intriguingly, these compounds efficiently inhibit XBP1 splicing in vivo and dramatically impair tumor growth in a xenograft model (Mahoney, D. J., et al. 2011. Cancer Cell 20, 443-456; Papandreou, I., et al. 2011. Blood 117, 1311-1314; Volkmann, K., et al. 2011. J Biol Chem 286, 12743-12755). While large-scale small molecule screens have provided potentially promising candidates that target the IRE-1/XBP1 pathway, attention needs to be paid to the specificity and cytotoxity of these compounds in vivo. Recent advances in solving the crystal structure of IRE-1 (Korennykh, A. V., et al. 2009. Nature 457, 687-693; Lee, K. P., et al. 2008. Cell 132, 89-100; Zhou, J., et al. 2006. Proc Natl Acad Sci USA 103, 14343-14348) should accelerate the design of more potent and specific IRE-1 inhibitors. The use of UPR inhibitors in combination with standard chemotherapy may greatly enhance the effectiveness of anti-tumor therapies.
(154) The methods of the invention using inhibitory compounds which inhibit the expression, processing, post-translational modification, or activity of XBP1 or a molecule in a biological pathway involving XBP1, such as IRE-1, can be used to induce anti-tumor immunity or in the treatment of cancer (e.g., ovarian cancer). In one embodiment of the invention, an inhibitory compound can be used to inhibit (e.g., specifically inhibit) the expression, processing, post-translational modification, or activity of spliced XBP1. In another embodiment, an inhibitory compound can be used to inhibit (e.g., specifically inhibit) the expression, processing, post-translational modification, or activity of unspliced XBP1.
(155) Inhibitory compounds of the invention can be, for example, intracellular binding molecules that act to directly or indirectly inhibit the expression, processing, post-translational modification, or activity of XBP1 or a molecule in a biological pathway involving XBP1, for example, IRE-1. As used herein, the term intracellular binding molecule is intended to include molecules that act intracellularly to inhibit the processing expression or activity of a protein by binding to the protein or to a nucleic acid (e.g., an mRNA molecule) that encodes the protein. Examples of intracellular binding molecules, described in further detail below, include antisense nucleic acids, intracellular antibodies, peptidic compounds that inhibit the interaction of XBP1 or a molecule in a biological pathway involving XBP1 (e.g., IRE-1) and a target molecule and chemical agents that specifically or directly inhibit XBP1 activity or the activity of a molecule in a biological pathway involving XBP1 (e.g., IRE-1).
(156) In one embodiment, an inhibitory compound of the invention is an antisense nucleic acid molecule that is complementary to a gene encoding XBP1 or a molecule in a signal transduction pathway involving XBP1, (e.g., IRE-1 or a molecule with which XBP1 interacts), or to a portion of said gene, or a recombinant expression vector encoding said antisense nucleic acid molecule. The use of antisense nucleic acids to downregulate the expression of a particular protein in a cell is well known in the art (see e.g., Weintraub, H. et al., Antisense RNA as a molecular tool for genetic analysis, ReviewsTrends in Genetics, Vol. 1(1) 1986; Askari, F. K. and McDonnell, W. M. (1996) N. Eng. J. Med. 334:316-318; Bennett, M. R. and Schwartz, S. M. (1995) Circulation 92:1981-1993; Mercola, D. and Cohen, J. S. (1995) Cancer Gene Ther. 2:47-59; Rossi, J. J. (1995) Br. Med. Bull. 51:217-225; Wagner, R. W. (1994) Nature 372:333-335). An antisense nucleic acid molecule comprises a nucleotide sequence that is complementary to the coding strand of another nucleic acid molecule (e.g., an mRNA sequence) and accordingly is capable of hydrogen bonding to the coding strand of the other nucleic acid molecule. Antisense sequences complementary to a sequence of an mRNA can be complementary to a sequence found in the coding region of the mRNA, the 5 or 3 untranslated region of the mRNA or a region bridging the coding region and an untranslated region (e.g., at the junction of the 5 untranslated region and the coding region). Furthermore, an antisense nucleic acid can be complementary in sequence to a regulatory region of the gene encoding the mRNA, for instance a transcription initiation sequence or regulatory element. Preferably, an antisense nucleic acid is designed so as to be complementary to a region preceding or spanning the initiation codon on the coding strand or in the 3 untranslated region of an mRNA. Given the known nucleotide sequence for the coding strand of the XBP1 gene and thus the known sequence of the XBP1 mRNA, antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick base pairing. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of an XBP1. An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. Similarly, antisense nucleic acids targeting IRE-1 can also be designed according to the rules of Watson and Crick base pairing. An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. To inhibit expression in cells, one or more antisense oligonucleotides can be used.
(157) Alternatively, an antisense nucleic acid can be produced biologically using an expression vector into which all or a portion of a cDNA has been subcloned in an antisense orientation (i.e., nucleic acid transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest). The antisense expression vector can be in the form of, for example, a recombinant plasmid, phagemid or attenuated virus. The antisense expression vector can be introduced into cells using a standard transfection technique.
(158) The antisense nucleic acid molecules of the invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a protein to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation. An example of a route of administration of an antisense nucleic acid molecule of the invention includes direct injection at a tissue site (e.g. a tumor site). Alternatively, an antisense nucleic acid molecule can be modified to target selected cells (for example, tumor-associated dendritic cells) and then administered systemically. For example, for systemic administration, an antisense molecule can be modified such that it specifically binds to a receptor or an antigen expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecule to a peptide or an antibody which binds to a cell surface receptor or antigen. The antisense nucleic acid molecule can also be delivered to cells using the vectors described herein.
(159) In yet another embodiment, an antisense nucleic acid molecule of the invention is an -anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual -units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids. Res. 15:6625-6641). The antisense nucleic acid molecule can also comprise a 2-o-methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215:327-330).
(160) In certain embodiments, an antisense nucleic acid molecule of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334:585-591)) can be used to catalytically cleave mRNA transcripts to thereby inhibit translation mRNAs. Alternatively, gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of a gene (e.g., an XBP1 promoter and/or enhancer) to form triple helical structures that prevent transcription of a gene in target cells. See generally, Helene, C. (1991) Anticancer Drug Des. 6(6):569-84; Helene, C. et al. (1992) Ann. N.Y. Acad. Sci. 660:27-36; and Maher, L. J. (1992) Bioassays 14(12):807-15.
(161) In another embodiment, a compound that promotes RNAi can be used to inhibit expression of XBP1 or a molecule in a biological pathway involving XBP1. The term RNA interference or RNAi, as used herein, refers generally to a sequence-specific or selective process by which a target molecule (e.g., a target gene, protein or RNA) is downregulated. In certain embodiments, the process of RNA interference or RNAi features degradation of RNA molecules, e.g., RNA molecules within a cell, said degradation being triggered by an RNA agent. Degradation is catalyzed by an enzymatic, RNA-induced silencing complex (RISC). RNAi occurs in cells naturally to remove foreign RNAs (e.g., viral RNAs). Natural RNAi proceeds via fragments cleaved from free dsRNA which direct the degradative mechanism to other similar RNA sequences. Alternatively, RNAi can be initiated by the hand of man, for example, to silence the expression of target genes. RNA interference (RNAi) is a post-transcriptional, targeted gene-silencing technique that uses double-stranded RNA (dsRNA) to degrade messenger RNA (mRNA) containing the same sequence as the dsRNA (Sharp, P. A. and Zamore, P. D. 287, 2431-2432 (2000); Zamore, P. D., et al. Cell 101, 25-33 (2000). Tuschl, T. et al. Genes Dev. 13, 3191-3197 (1999); Cottrell T R, and Doering T L. 2003. Trends Microbiol. 11:37-43; Bushman F. 2003. Mol Therapy. 7:9-10; McManus M T and Sharp P A. 2002. Nat Rev Genet. 3:737-47). The process occurs when an endogenous ribonuclease cleaves the longer dsRNA into shorter, e.g., 21-23-nucleotide-long RNAs, termed small interfering RNAs or siRNAs. As used herein, the term small interfering RNA (siRNA) (also referred to in the art as short interfering RNAs) refers to an RNA agent, preferably a double-stranded agent, of about 10-50 nucleotides in length (the term nucleotides including nucleotide analogs), preferably between about 15-25 nucleotides in length, more preferably about 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides in length, the strands optionally having overhanging ends comprising, for example 1, 2 or 3 overhanging nucleotides (or nucleotide analogs), which is capable of directing or mediating RNA interference. Naturally-occurring siRNAs are generated from longer dsRNA molecules (e.g., >25 nucleotides in length) by a cell's RNAi machinery (e.g., Dicer or a homolog thereof). The smaller RNA segments then mediate the degradation of the target mRNA. Nanoparticle-encapsulated siRNA can also be used to downregulate a target molecule. Kits for synthesis of RNAi are commercially available from, e.g. New England Biolabs or Ambion. In one embodiment one or more of the chemistries described above for use in antisense RNA can be employed in molecules that mediate RNAi.
(162) Alternatively, a compound that promotes RNAi can be expressed in a cell, e.g., a cell in a subject, to inhibit expression of XBP1 or a molecule in a biological pathway involving XBP1, such as IRE-1. In contrast to siRNAs, shRNAs mimic the natural precursors of micro RNAs (miRNAs) and enter at the top of the gene silencing pathway. For this reason, shRNAs are believed to mediate gene silencing more efficiently by being fed through the entire natural gene silencing pathway. The term shRNA, as used herein, refers to an RNA agent having a stem-loop structure, comprising a first and second region of complementary sequence, the degree of complementarity and orientation of the regions being sufficient such that base pairing occurs between the regions, the first and second regions being joined by a loop region, the loop resulting from a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. shRNAs may be substrates for the enzyme Dicer, and the products of Dicer cleavage may participate in RNAi. shRNAs may be derived from transcription of an endogenous gene encoding a shRNA, or may be derived from transcription of an exogenous gene introduced into a cell or organism on a vector, e.g., a plasmid vector or a viral vector. An exogenous gene encoding an shRNA can additionally be introduced into a cell or organism using other methods known in the art, e.g., lipofection, nucleofection, etc.
(163) The requisite elements of a shRNA molecule include a first portion and a second portion, having sufficient complementarity to anneal or hybridize to form a duplex or double-stranded stem portion. The two portions need not be fully or perfectly complementary. The first and second stem portions are connected by a portion having a sequence that has insufficient sequence complementarity to anneal or hybridize to other portions of the shRNA. This latter portion is referred to as a loop portion in the shRNA molecule. The shRNA molecules are processed to generate siRNAs. shRNAs can also include one or more bulges, i.e., extra nucleotides that create a small nucleotide loop in a portion of the stem, for example a one-, two- or three-nucleotide loop. The stem portions can be the same length, or one portion can include an overhang of, for example, 1-5 nucleotides.
(164) In certain embodiments, shRNAs of the invention include the sequences of a desired siRNA molecule described supra. In such embodiments, shRNA precursors include in the duplex stem the 21-23 or so nucleotide sequences of the siRNA, desired to be produced in vivo.
(165) Another type of inhibitory compound that can be used to inhibit the expression and/or activity of XBP1 or a molecule in a biological pathway involving XBP1 (for example, IRE-1) is an intracellular antibody specific for said protein. The use of intracellular antibodies to inhibit protein function in a cell is known in the art (see e.g., Carlson, J. R. (1988) Mol. Cell. Biol. 8:2638-2646; Biocca, S. et al. (1990) EMBO J. 9:101-108; Werge, T. M. et al. (1990) FEBS Letters 274:193-198; Carlson, J. R. (1993) Proc. Natl. Acad. Sci. USA 90:7427-7428; Marasco, W. A. et al. (1993) Proc. Natl. Acad. Sci. USA 90:7889-7893; Biocca, S. et al. (1994) Bio/Technology 12:396-399; Chen, S-Y. et al. (1994) Human Gene Therapy 5:595-601; Duan, L et al. (1994) Proc. Natl. Acad. Sci. USA 91:5075-5079; Chen, S-Y. et al. (1994) Proc. Natl. Acad. Sci. USA 91:5932-5936; Beerli, R. R. et al. (1994) J. Biol. Chem. 269:23931-23936; Beerli, R. R. et al. (1994) Biochem. Biophys. Res. Commun. 204:666-672; Mhashilkar, A. M. et al. (1995) EMBO J. 14:1542-1551; Richardson, J. H. et al. (1995) Proc. Natl. Acad. Sci. USA 92:3137-3141; PCT Publication No. WO 94/02610 by Marasco et al.; and PCT Publication No. WO 95/03832 by Duan et al.).
(166) To inhibit protein activity using an intracellular antibody, a recombinant expression vector is prepared which encodes the antibody chains in a form such that, upon introduction of the vector into a cell, the antibody chains are expressed as a functional antibody in an intracellular compartment of the cell.
(167) In another embodiment, an inhibitory compound of the invention is a peptidic compound derived from the XBP1 amino acid sequence or the amino acid sequence of a molecule in a biologicalon pathway involving XBP1.
(168) The peptidic compounds of the invention can be made intracellularly in cells by introducing into the cells an expression vector encoding the peptide. Such expression vectors can be made by standard techniques using oligonucleotides that encode the amino acid sequence of the peptidic compound. The peptide can be expressed in intracellularly as a fusion with another protein or peptide (e.g., a GST fusion). Alternative to recombinant synthesis of the peptides in the cells, the peptides can be made by chemical synthesis using standard peptide synthesis techniques. Synthesized peptides can then be introduced into cells by a variety of means known in the art for introducing peptides into cells (e.g., liposome and the like).
(169) In addition, dominant negative proteins (e.g., of XBP1 or IRE-1) can be made which include XBP1 or IRE-1 (e.g., portions or variants thereof) that compete with native (i.e., wild-type) molecules, but which do not have the same biological activity. Such molecules effectively decrease, e.g., XBP1 IRE-1 activity in a cell.
(170) Other inhibitory agents that can be used to specifically inhibit the activity of XBP1 or a molecule in a biological pathway involving XBP1 (e.g., IRE-1) are chemical compounds that directly inhibit expression, processing, post-translational modification, and/or activity of XBP1. Such compounds can be identified using screening assays that select for such compounds, as described in detail above as well as using other art recognized techniques.
(171) In certain embodiments, targeting XBP1 inhibits tumor growth. In certain embodiments, targeting XBP1 inhibits ovarian tumor growth.
(172) The present invention provides that constitutive activation of the UPR in dendritic cells prevents a proper anti-tumor immune response. In certain embodiments, targeting XBP1 results in an anti-tumor immune response. In certain embodiments, the anti-tumor immune response is the proliferation and infiltration of T cells targeted for a specific tumor-associated antigen.
(173) Screening Assays
(174) In one aspect, the invention features methods for identifying compounds useful in enhancing or inducing anti-tumor immunity in a subject, such compounds have the potential for therapeutic use in the treatment of cancer, such as ovarian cancer. In other aspects, the invention features methods for identifying compounds useful in inhibiting the growth of ovarian cancer cells, such compounds having potential therapeutic use in the treatment of ovarian cancer. As described herein, the instant invention is based, at least in part, on the discovery of a previously unknown role for XBP1 in anti-tumor immunity and ovarian cancer, such a role being linked to anti-tumor immunity directed by tumor-associated dendritic cells. In exemplary aspects the invention features methods for identifying compounds useful for inducing or enhancing anti-tumor immunity and inhibiting the growth of ovarian cancer cells, the methods featuring screening or assaying for compounds that modulate, e.g., activate or increase, or inhibit or decrease, the activation of IRE-1/XBP1. In exemplary aspects, the methods comprise: providing an indicator composition comprising XBP1, or biologically active portions thereof; contacting the indicator composition with each member of a library of test compounds; selecting from the library of test compounds a compound of interest that interacts with XBP1, or biologically active portions thereof; and contacting ovarian cancer cells with the compound of interest, wherein the ability of the compound to enhance or induce anti-tumor immunity in the subject is indicated by the ability of the compound to inhibit growth of ovarian cancer cells as compared to the growth of ovarian cancer cells in the absence of the compound.
(175) In another exemplary aspect, the methods comprise: providing an indicator composition comprising XBP1, or biologically active portions thereof; contacting the indicator composition with each member of a library of test compounds; and selecting from the library of test compounds a compound of interest that decreases the activity of XBP1, or biologically active portions thereof, wherein the ability of a compound to induce anti-tumor immunity or inhibit growth of ovarian cancer cells is indicated by a decrease in the activation as compared to the amount of activation in the absence of the compound.
(176) As used herein, the term contacting (i.e., contacting a cell e.g. a cell, with a compound) includes incubating the compound and the cell together in vitro (e.g., adding the compound to cells in culture) as well as administering the compound to a subject such that the compound and cells of the subject are contacted in vivo. The term contacting does not include exposure of cells to an XBP1 modulator that may occur naturally in a subject (i.e., exposure that may occur as a result of a natural physiological process).
(177) As used herein, the term test compound refers to a compound that has not previously been identified as, or recognized to be, a modulator of the activity being tested. The term library of test compounds refers to a panel comprising a multiplicity of test compounds.
(178) As used herein, the term indicator composition refers to a composition that includes a protein of interest (e.g., XBP1 or a molecule in a biological pathway involving XBP1, such as IRE-1), for example, a cell that naturally expresses the protein, a cell that has been engineered to express the protein by introducing one or more of expression vectors encoding the protein(s) into the cell, or a cell free composition that contains the protein(s) (e.g., purified naturally-occurring protein or recombinantly-engineered protein(s)).
(179) As used herein, the term cell includes prokaryotic and eukaryotic cells. In one embodiment, a cell of the invention is a bacterial cell. In another embodiment, a cell of the invention is a fungal cell, such as a yeast cell. In another embodiment, a cell of the invention is a vertebrate cell, e.g., an avian or mammalian cell. In a preferred embodiment, a cell of the invention is a murine or human cell. As used herein, the term engineered (as in an engineered cell) refers to a cell into which a nucleic acid molecule e.g., encoding an XBP1 protein (e.g., a spliced and/or unspliced form of XBP1) has been introduced.
(180) As used herein, the term cell free composition refers to an isolated composition, which does not contain intact cells. Examples of cell free compositions include cell extracts and compositions containing isolated proteins.
(181) The cells used in the instant assays can be eukaryotic or prokaryotic in origin. For example, in one embodiment, the cell is a bacterial cell. In another embodiment, the cell is a fungal cell, e.g., a yeast cell. In another embodiment, the cell is a vertebrate cell, e.g., an avian or a mammalian cell. In a preferred embodiment, the cell is a human cell. The cells of the invention can express endogenous XBP1 or can be engineered to do so. For example, a cell that has been engineered to express the XBP1 protein can be produced by introducing into the cell an expression vector encoding the protein. Recombinant expression vectors can be used for expression of XBP1.
(182) In another embodiment, the indicator composition is a cell free composition. XBP1 expressed by recombinant methods in a host cells or culture medium can be isolated from the host cells, or cell culture medium using standard methods for protein purification. For example, ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies can be used to produce a purified or semi-purified protein that can be used in a cell free composition. Alternatively, a lysate or an extract of cells expressing the protein of interest can be prepared for use as cell-free composition.
(183) Pharmaceutical Compositions and Modes of Administration
(184) Pharmaceutical compositions of the invention can be administered in combination therapy, i.e., combined with other agents. Agents include, but are not limited to, in vitro synthetically prepared chemical compositions, antibodies, antigen-binding regions, and combinations and conjugates thereof. In certain embodiments, an agent can act as an agonist, antagonist, allosteric modulator, or toxin.
(185) In certain embodiments, the invention provides for pharmaceutical comnpositions comprising an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) with a pharmaceutically acceptable diluent, carrier, solubilizer, emulsifier, preservative and/or adjuvant. In certain embodiments, acceptable formulation materials preferably are nontoxic to recipients at the dosages and concentrations employed. In certain embodiments, the formulation material(s) are for s.c. and/or I.V. administration. In certain embodiments, the pharmaceutical composition can contain formulation materials for modifying, maintaining or preserving, for example, the pH, osmolality, viscosity, clarity, color, isotonicity, odor, sterility, stability, rate of dissolution or release, adsorption or penetration of the composition. In certain embodiments, suitable formulation materials include, but are not limited to, amino acids (such as glycine, glutamine, asparagine, arginine or lysine); antimicrobials; antioxidants (such as ascorbic acid, sodium sulfite or sodium hydrogen-sulfite); buffers (such as borate, bicarbonate, Tris-IHCl, citrates, phosphates or other organic acids); bulking agents (such as mannitol or glycine); chelating agents (such as ethylenediamine tetraacetic acid (EDTA)); complexing agents (such as caffeine, polyvinylpyrrolidone, beta-cyclodextrin or hydroxypropyl-beta-cyciodextrin); fillers; monosaccharides; disaccharides; and other carbohydrates (such as glucose, mannose or dextrins); proteins (such as serum albumin, gelatin or inmunoglobulins); coloring, flavoring and diluting agents; emulsifying agents; hydrophilic polymers (such as polyvinylpyrrolidone); low molecular weight polypeptides; salt-forming counterions (such as sodium); preservatives (such as benzalkonium chloride, benzoic acid, salicylic acid, thimerosal, phenethyl alcohol, methylparaben, propylparaben, chiorhexidine, sorbic acid or hydrogen peroxide); solvents (such as glycerin, propylene glycol or polyethylene glycol); sugar alcohols (such as mannitol or sorbitol); suspending agents; surfactants or wetting agents (such as pluronics, PEG, sorbitan esters, polysorbates such as polysorbate 20, polysorbate 80, triton, tromethamine, lecithin, cholesterol, tyloxapal); stability enhancing agents (such as sucrose or sorbitol); tonicity enhancing agents (such as alkali metal halides, preferably sodium or potassium chloride, mannitol sorbitol); delivery vehicles; diluents; excipients and/or pharmaceutical adjuvants. (Remington's Pharmaceutical Sciences, 18th Edition, A. R. Gennaro, ed., Mack Publishing Company (1995). In certain embodiments, the formulation comprises PBS; 20 mM NaOAC, pH 5.2, 50 mM NaCl; and/or 10 mM NAOAC, pH 5.2, 9% Sucrose. In certain embodiments, the optimal pharmaceutical composition will be determined by one skilled in the art depending upon, for example, the intended route of administration, delivery format and desired dosage. See, for example, Remington's Pharmaceutical Sciences, supra. In certain embodiments, such compositions may influence the physical state, stability, rate of in vivo release and rate of in vivo clearance of an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1).
(186) In certain embodiments, the primary vehicle or carrier in a pharmaceutical composition can be either aqueous or non-aqueous in nature. For example, in certain embodiments, a suitable vehicle or carrier can be water for injection, physiological saline solution or artificial cerebrospinal fluid, possibly supplemented with other materials common in compositions for parenteral administration. In certain embodiments, the saline comprises isotonic phosphate-buffered saline. In certain embodiments, neutral buffered saline or saline mixed with serum albumin are further exemplary vehicles. In certain embodiments, pharmaceutical compositions comprise Tris buffer of about pH 7.0-8.5, or acetate buffer of about pH 4.0-5.5, which can further include sorbitol or a suitable substitute therefore. In certain embodiments, a composition comprising an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) can be prepared for storage by mixing the selected composition having the desired degree of purity with optional formulation agents (Remington's Pharmaceutical Sciences, supra) in the form of a lyophilized cake or an aqueous solution. Further, in certain embodiments, a composition comprising an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) can be formulated as a lyophilizate using appropriate excipients such as sucrose.
(187) In certain embodiments, the pharmaceutical composition can be selected for parenteral delivery. In certain embodiments, the compositions can be selected for inhalation or for delivery through the digestive tract, such as orally. The preparation of such pharmaceutically acceptable compositions is within the ability of one skilled in the art.
(188) In certain embodiments, the formulation components are present in concentrations that are acceptable to the site of administration. In certain embodiments, buffers are used to maintain the composition at physiological pH or at a slightly lower pH, typically within a pH range of from about 5 to about 8.
(189) In certain embodiments, when parenteral administration is contemplated, a therapeutic composition can be in the form of a pyrogen-free, parenterally acceptable aqueous solution comprising a desired XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) in a pharmaceutically acceptable vehicle. In certain embodiments, a vehicle for parenteral injection is sterile distilled water in which an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) is formulated as a sterile, isotonic solution, properly preserved. In certain embodiments, the preparation can involve the formulation of the desired molecule with an agent, such as injectable microspheres, bio-erodible particles, polymeric compounds (such as polylactic acid or polyglycolic acid), beads or liposomes, that can provide for the controlled or sustained release of the product which can then be delivered via a depot injection. In certain embodiments, hyaluronic acid can also be used, and can have the effect of promoting sustained duration in the circulation. In certain embodiments, implantable drug delivery devices can be used to introduce the desired molecule.
(190) In certain embodiments, a pharmaceutical composition can be formulated for inhalation. In certain embodiments, an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) can be formulated as a dry powder for inhalation. In certain embodiments, an inhalation solution comprising an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) can be formulated with a propellant for aerosol delivery. In certain embodiments, solutions can be nebulized. Pulmonary administration is further described in PCT application No. PCT/US94/001875, which describes pulmonary delivery of chemically modified proteins.
(191) In certain embodiments, it is contemplated that formulations can be administered orally. In certain embodiments, an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) that is administered in this fashion can be formulated with or without those carriers customarily used in the compounding of solid dosage forms such as tablets and capsules. In certain embodiments, a capsule can be designed to release the active portion of the formulation at the point in the gastrointestinal tract when bioavailability is maximized and pre-systemic degradation is minimized. In certain embodiments, at least one additional agent can be included to facilitate absorption of an XBP1 inhibitor or absorption of an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1). In certain embodiments, diluents, flavorings, low melting point waxes, vegetable oils. lubricants, suspending agents, tablet disintegrating agents, and binders can also be employed.
(192) In certain embodiments, a pharmaceutical composition can involve an effective quantity of an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) in a mixture with non-toxic excipients, which are suitable for the manufacture of tablets. In certain embodiments, by dissolving the tablets in sterile water, or another appropriate vehicle, solutions can be prepared in unit-dose form. In certain embodiments, suitable excipients include, but are not limited to, inert diluents, such as calcium carbonate, sodium carbonate or bicarbonate, lactose, or calcium phosphate; or binding agents, such as starch, gelatin, or acacia; or lubricating agents such as magnesium stearate, stearic acid, or talc.
(193) Additional pharmaceutical compositions will be evident to those skilled in the art, including formulations involving an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) in sustained- or controlled-delivery formulations. In certain embodiments, techniques for formulating a variety of other sustained- or controlled-delivery means, such as liposome carriers, bio-erodible microparticles or porous beads and depot injections, are also known to those skilled in the art. See for example, PCT Application No. PCT/US93/00829, which describes the controlled release of porous polymeric microparticles for the delivery of pharmaceutical compositions. In certain embodiments, sustained-release preparations can include semipermeable polymer matrices in the form of shaped articles, e.g. films, or microcapsules. Sustained release matrices can include polyesters, hydrogels, polylactides (U.S. Pat. No. 3,773,919 and EP 058,481), copolymers of L-glutamic acid and gamma ethyl-L-glutamate (Sidman et al., Biopolymers, 22:547-556 (1983)), poly (2-hydroxyethyl-methacrylate) (Langer et al., J. Biomed. Mater. Res., 15: 167-277 (1981) and Langer, Chem. Tech., 12:98-105 (1982)), ethylene vinyl acetate (Langer et al., supra) or poly-D()-3-hydroxybutyric acid (EP 133,988). In certain embodiments, sustained release compositions can also include liposomes, which can be prepared by any of several methods known in the art. See, e.g., Eppstein et al, Proc. Natl. Acad. Sci. USA, 82:3688-3692 (1985); EP 036,676; EP 088,046 and EP 143,949.
(194) The pharmaceutical composition to be used for in vivo administration typically is sterile. In certain embodiments, this can be accomplished by filtration through sterile filtration membranes. In certain embodiments, where the composition is lyophilized, sterilization using this method can be conducted either prior to or following lyophilization and reconstitution. In certain embodiments, the composition for parenteral administration can be stored in lyophilized form or in a solution. In certain embodiments, parenteral compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
(195) In certain embodiments, once the pharmaceutical composition has been formulated, it can be stored in sterile vials as a solution, suspension, gel, emulsion, solid, or as a dehydrated or lyophilized powder. In certain embodiments, such formulations can be stored either in a ready-to-use form or in a form (e.g., lyophilized) that is reconstituted prior to administration.
(196) In certain embodiments, kits are provided for producing a single-dose administration unit. In certain embodiments, the kit can contain both a first container having a dried protein and a second container having an aqueous formulation. In certain embodiments, kits containing single and multi-chambered pre-filled syringes (e.g., liquid syringes and lyosyringes) are included.
(197) In certain embodiments, the effective amount of a pharmaceutical cornposition comprising an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1), to be employed therapeutically will depend, for example, upon the therapeutic context and objectives. One skilled in the art will appreciate that the appropriate dosage levels for treatment, according to certain embodiments, will thus vary depending, in part, upon the molecule delivered, the indication for which an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) is being used, the route of administration, and the size (body weight, body surface or organ size) and/or condition (the age and general health) of the patient. In certain embodiments, the clinician can titer the dosage and modify the route of administration to obtain the optimal therapeutic effect.
(198) In certain embodiments, the frequency of dosing will take into account the pharmacokinetic parameters of an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) in the formulation used. In certain embodiments, a clinician will administer the composition until a dosage is reached that achieves the desired effect. In certain embodiments, the composition can therefore be administered as a single dose, or as two or more doses (which may or may not contain the same amount of the desired molecule) over time, or as a continuous infu sion via an implantation device or catheter. Further refinement of the appropriate dosage is routinely made by those of ordinary skill in the art and is within the ambit of tasks routinely performed by them. In certain embodiments, appropropriate dosages can be ascertained through use of appropriate dose-response data.
(199) In certain embodiments, the route of administration of the pharmaceutical composition is in accord with known methods, e.g. orally, systemically, locally, through injection by intravenous, intraperitoneal, intracerebral (intra-parenchymal), intracerebroventricular, intratumoral, intramuscular, subcutaneously, intra-ocular, intraarterial, intraportal, or intralesional routes; by sustained release systems or by implantation devices. In certain embodiments, the compositions can be administered by bolus injection or continuously by infusion, or by implantation device. In certain embodiments, individual elements of the combination therapy may be administered by different routes.
(200) In certain embodiments, the composition can be administered locally via implantation of a membrane, sponge or another appropriate material onto which the desired molecule has been absorbed or encapsulated. In certain embodiments, where an implantation device is used, the device can be implanted into any suitable tissue or organ, and delivery of the desired molecule can be via diffusion, timed-release bolus, or continuous administration. In certain embodiments, it can be desirable to use a pharmaceutical composition comprising an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) in an ex vivo manner. In such instances, cells, tissues and/or organs that have been removed from the patient are exposed to a pharmaceutical composition comprising an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1), after which the cells, tissues and/or organs are subsequently implanted back into the patient.
(201) In certain embodiments, an XBP1 inhibitor or an inhibitor of a molecule in a biological pathway involving XBP1 (e.g., IRE-1) can be delivered by implanting certain cells that have been genetically engineered, using methods such as those described herein, to express and secrete the polypeptides. In certain embodiments, such cells can be animal or human cells, and can be autologous, heterologous, or xenogeneic. In certain embodiments, the cells can be immortalized. In certain embodiments, in order to decrease the chance of an immunological response, the cells can be encapsulated to avoid infiltration of surrounding tissues. In certain embodiments, the encapsulation materials are typically biocompatible, semipermeable polymeric enclosures or membranes that allow the release of the protein product(s) but prevent the destruction of the cells by the patient's immune system or by other detrimental factors from the surrounding tissues.
(202) In other embodiments, ex vivo treatment of dendritic cells with an inhibitor of XBP1 (e.g., siRNA) can be used to activate, induce, enhance or promote the antigen presenting capacity of dendritic cells. The activated dendritic cells can then be administered to a subject. In some embodiments, the dendritic cells may be tumor-associated dendritic cells.
(203) This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patents, and published patent applications cited throughout this application, as well as the figures and the sequence listing, are hereby incorporated by reference.
EXAMPLES
Experimental Procedures
(204) Tissues, Mice and Cell Lines
(205) Stage III-IV human ovarian carcinoma specimens and malignant ascites samples were procured through Surgical Pathology at Weill Cornell Medical College/NewYork-Presbyterian Hospital under an approved protocol where research samples remained totally unidentified. Tumor single cell suspensions were generated as previously described (Conejo-Garcia et al., 2005). Malignant peritoneal ascites samples from patients with metastatic ovarian cancer were centrifuged for 10 min at 1300 rpm and red blood cells were lysed prior to FACS analysis. Mice were housed at the animal facilities of Harvard School of Public School, Weill Cornell Medical College, or The Wistar Institute. The Institutional Animal Care and Use Committee approved all animal experiments described in this study. XBP1.sup.f/f mice were generated as previously described (Lee et al., 2008) and have been backcrossed at least 15 generations onto C57BL/6 mice. Wild type, OT-1 transgenic, Itgax-Cre (CD11c-Cre) and Rag2-deficient mice, all in a full C57BL/6 background, were purchased from Jackson Laboratories (Bar Harbor, Me.).
(206) Double transgenic LSL-K-ras.sup.G12D/+p53.sup.loxp/loxp (p53/K-ras) mice were generated by obtaining LSL-K-ras.sup.tm4Tyj (Jackson et al., 2001) and Trp53.sup.tmlBrn (Jonkers et al., 2001) from the NCI mouse models of human cancer consortium and bred to a full C57BL/6 background as previously reported (Scarlett et al., 2012). p53/K-ras mice were irradiated two consecutive days with 650 rads followed by reconstitution with bone marrow from XBP1.sup.f/f or XBP1.sup.f/f CD11c-Cre mice. 8 weeks post bone-marrow reconstitution autochthonous ovarian tumors were initiated by delivery of adenovirus-expressing Cre recombinase (ADV-Cre) into the ovarian bursa as previously reported (Dinulescu et al., 2005; Flesken-Nikitin et al., 2003; Scarlett et al., 2012). Seven weeks after tumor initiation, mice were sacrificed. Tumors, approximately 2-3 cm in diameter, were resected under sterile conditions after euthanizing the mouse. Specimens were then minced into pieces <3 mm in diameter and digested for 1 hour at 37 C. in RPMI containing 2 mg/mL collagenase Type D and 1 mg/ml DNAse I. The digested tissue pieces were then pressed through a 70 m strainer to create a single cell suspension. Red blood cells were lysed using ACK lysis buffer and pellets from single-cell suspensions were resuspended to 50-10010.sup.6 cells/ml in freezing media (FBS containing 10% DMSO) and incubated on ice for 30 minutes. Tubes were then transferred to 80 C. for long-term storage.
(207) Parental ID8 or aggressive ID8-Defb29/Vegf-A intraperitoneal ovarian tumors were generated as previously described (Conejo-Garcia et al., 2004; Roby et al., 2000). Briefly, 1-210.sup.6 tumor cells were injected into wild type C57BL/6 mice or conditional XBP1-deficient mice. Implanted animals progressively developed multiple peritoneal masses and eventually massive ascites in 35 days (ID8-Defb29/Vegf-A) or in 2 months (parental ID8). Mice were weighted weekly to monitor malignant ascites accumulation and animals with severe abdominal distension were humanely euthanized.
(208) Isolation of Human and Mouse DCs
(209) Human patient ovarian cancer-associated DCs (CD45.sup.+CD3.sup.CD20.sup. CD11c.sup.+DEC205.sup.+) were sorted from tumor single cell suspensions or malignant ascites using flow cytometry, following the gating strategy described in
(210) Reagents and In Vitro Cellular Treatments
(211) Murine recombinant cytokines were purchased from Peprotech. Cobalt chloride, Tunicamycin (used at 1 g/ml), Tiron (used at 100-500 M) and Vitamin E (-tocopherol, used at 50-100 M) were from Sigma. DCFDA staining was utilized for intracellular ROS detection (Abcam). Purified 4-HNE was obtained from Cayman Chemical and 4-HNE-protein adducts in ascites samples and DCs were detected and quantified through competitive ELISA (Cell Biolabs). TOFA (Cayman Chemical) was used at a final concentration of 5 g/ml to inhibit fatty acid synthesis in DCs by blocking the synthesis of malonyl-CoA by acetyl-CoA carboxylase. The IRE-1-specific inhibitor 48c (Millipore) was used at a final concentration of 10 M.
(212) Conventional and Quantitative RT-PCR
(213) Total RNA from human samples was isolated using the miRVANA miRNA isolation Kit (Life Technologies). RNA from mouse samples was isolated using the Qiazol reagent (Qiagen). 0.1-1 tg of RNA were used to generate cDNA using the High Capacity cDNA Reverse Transcription Kit (Life Technologies). Human and mouse Xbp1 splicing assays were performed as described (Lee et al., 2003a; Martinon et al., 2010) using conventional Reverse Transcription PCR (RT-PCR) and primers shown in Table 1. Gene expression analysis was done via Reverse Transcription quantitative PCR (RT-qPCR) using a Stratagene Mx3005 instrument and SYBR green I (Life Technologies). Murine XBP1s transcript expression was determined using a probe that spans the spliced-out version as previously demonstrated (Reimold et al., 2001). All primers used in this study are described in Table 1.
(214) Western Blot
(215) 510.sup.6 sDC or tDC were washed twice in 1 cold PBS and nuclear proteins were purified using the Nuclear Extraction Kit (Life Technologies). Proteins were quantified using the BCA method (Pierce) and 15-20 g of nuclear proteins were separated via SDS-PAGE and transferred onto nitrocellulose membranes following standard procedures. Anti-mouse XBP1s (GL Biochem) was raised in rabbit using a peptide corresponding to the XBP1s C-terminus, and was used at a 1:500 dilution for immunoblotting. Goat anti-mouse Lamin B (Santa Cruz) was used at 1:2000. HRP-conjugated secondary antibodies to rabbit and mouse (Santa Cruz) were used at a 1:2000 dilution. SuperSignal West Femto (Pirce) was used as Chemiluminescent Substrate and blots were imaged using a FluorChemE instrument (ProteinSimple).
(216) RNA-Seq and DC Transcriptional Profile
(217) tDCs were sorted from peritoneal wash samples of XBP1.sup.f/f or XBP1.sup.f/f CD11c-Cre female mice (n=3/group) bearing aggressive ID8-Defb29/Vegf-A ovarian tumors for 3 weeks. Total RNA was isolated using the miRVANA miRNA isolation Kit (Life Technologies) and further concentrated via RNeasy MinElute columns (Qiagen). RNA quality and integrity was confirmed in an Agilent Bioanalyzer 2100. In all cases RINs were 9.50 or higher. mRNA libraries were generated and sequenced at the Epigenomics Facility of Weill Cornell Medical College. Reads produced from 5 lbp single end sequencing run were aligned against mouse genome (mm9) using Bowtie v0.12.8 (Langmead et al., 2009) algorithm. Mouse mm9 transcriptome information was obtained from UCSC Genome Browser and RSEM algorithm (Li and Dewey, 2011) was used to calculate number of aligned tags for each gene. Differential expression between two groups were tested by EdgeR (Robinson and Oshlack, 2010) and significance was defined using a False Discovery Rate (FDR) cutoff of 0.15. The most up-to-date gene information (official symbol and description) was obtained from NCBI Entrez information on May 15, 2014. Normalized expression RPKM values (Reads Per Kilobase of transcript per Million mapped reads) values were generated by EdgeR and used to demonstrate gene expression across samples as color-coded fold change of expression in a sample versus average expression across all samples. Functional enrichment analysis was done using QIAGEN's Ingenuity Pathway Analysis (IPA, QIAGEN Redwood City, www.qiagen.com/ingenuity). For IPA upstream analysis, only regulators significant at p<10.sup.6 with predicted activation/inhibition states (Z-score>2) were considered. Significantly affected biological processes were tested by using NCBI DAVID (Huang da et al., 2009) software using level 3 of GO biological processes and considering only FDR<0.15 results that showed at least 20 genes that constitute at least of all involved in the process genes specifically up or down-regulated.
(218) Flow Cytometry and Lipid Staining
(219) Intracellular lipid content in DCs was evaluated via flow cytometry using 4,4-Difluoro-1,3,5,7,8-Pentamethyl-4-Bora-3a,4a-Diaza-s-Indacene (BODIPY 493/503, Life Technologies) as previously reported (Herber et al., 2010). Briefly, 510.sup.6 cells from total spleen single cell suspensions or malignant peritoneal wash samples were conventionally stained for surface markers using fluorescently-labeled antibodies that do not overlap with BODIPY 493/503, namely CD11c-APC, CD45-APC-Cy7 and CD11b-Pacific Blue. Cells were washed twice with 1PBS and stained with 500 l of BODIPY 493/503 at 0.5 mg/ml in PBS for 15 min at room temperature in the dark. Cells were washed twice and analyzed by flow cytometry. BODIPY 493/503 staining was detected in the PE channel. For intracellular cytokine staining, 510.sup.6 cells isolated from malignant peritoneal wash samples of ovarian cancer-bearing mice were stimulated for 6h in 10% FBS complete RPMI containing PMA (Calbiochem), lonomycin (Calbiochem) and Brefeldin A (BioLegend). Cells were collected and stained for surface markers and intracellular cytokines following the FoxP3/Transcription Factor Staining buffer set (eBioscience). All antibodies were from BioLegend. Flow cytometry was performed on a LSRII instrument (BD Biosciences). Cell populations were sorted from peritoneal washes (10 ml 1PBS) of ovarian carcinoma-bearing mice or from human ascites or tumor single-cell suspensions using a FACSAria sorter (BD Biosciences). Flow cytometry data was analyzed using FlowJo version 9 or 10.
(220) Transmission Electron Microscopy and Lipidomics
(221) tDC were sorted from the peritoneal cavity of XBP1.sup.f/f or XBP.sup.f/f CD11c-Cre female mice bearing ID8-Defb29/Vegf-A ovarian tumors for 3 to 4 weeks as shown in
(222) Antigen Processing and Presentation
(223) For in vitro antigen presentation experiments, tDC or sDC were sorted from the peritoneal cavity or spleen of XBP1.sup.f/f or XBP1.sup.f/f CD11c-Cre female mice bearing ID8-Defb29/Vegf-A ovarian tumors for 4 weeks (
(224) For in vivo antigen presentation experiments, wild type C57BL/6 female mice bearing ID8-Defb29/Vegf-A ovarian tumors for three weeks were intraperitoneally injected with 0.6 mg of full length endotoxin-free OVA (SIGMA, grade VII) and 3 hours later, mice were left untreated or injected with siRNA-PEI nanoparticles (see below). 18 hours later, mice were transferred intraperitoneally with 210.sup.6 CFSE-labeled T cells negatively purified from OT-1 transgenic mice. Peritoneal wash samples (10 mL) were collected after 72 hours and analyzed for CFSE dilution via FACS. Data were analyzed using FlowJo version 10. Division Index determines the average number of cell divisions that a cell in the original population has undergone. Proliferation Index shows the total number of divisions of only responding (proliferating) cells. Replication Index is the fold-expansion of the responding cells, thus indicating the expansion capability of the replicating cells.
(225) Preparation of siRNA-PEI Nanoparticles and Therapeutic In Vivo Silencing
(226) Endotoxin-free rhodamine-labeled and unconjugated polyethylenimine (PEI) for in vivo experiments in vivo-jetPEI was purchased from PolyPlus Transfection. To generate siRNA-PEI nanocomplexes, 50 g of siRNA were complexed with in vivo-jetPEI at N/P ratio of 6, following the recommendations of the manufacturer and previously optimized conditions (Cubillos-Ruiz et al., 2009). All siRNA oligonucleotides were from IDT and included 2-OMe modified nucleotides and specific phosphorothioate linkages, as previously reported (Piret et al., 2002). Sequences for the sense and antisense strands are as follows: siLuc sense: 5-CuUACgcUGAguaCUUcGAdTsdT-3 (SEQ ID NO: 1), siLuc antisense: 5-UCgAAGUACUCAGCgUAAGdTdsT-3 (SEQ ID NO: 2), siXBP1 sense: 5-cAcccuGAAuucAuuGucudTsdT-3 (SEQ ID NO: 3), siXBP1 antisense: 5-AGAcAAUGAAUUcAGGGUGdTsdT-3 (SEQ ID NO: 4). silREla sense: 5-AuGccGAAGuucAGAuGGAdTsdT-3 (SEQ ID NO: 5), silREla antisense: 5-UCcAUCUGAACUUCGGcAUdTsdT-3 (SEQ ID NO: 6). 2-OMe modified nucleotides are in lower case. Phosphorothioate linkages are represented by s and d indicates DNA bases.
(227) For in vivo biodistribution, phenotypic and silencing experiments, mice bearing ID8-Defb29/Vegf-A tumors for 3-4 weeks were intraperitoneally injected with rhodamine-labeled siXBP1-PEI or siLuc-PEI nanoparticles (50 tg of siRNA complexed with rhodamine-labeled in vivo-jetPEI at N/P 6, per mouse). Rhodamine.sup.+CD45.sup.+CD11c.sup.+CD11b.sup.+MHC-II.sup.+ tDC were sorted after 3 days for downstream molecular biology analysis. For repeated siRNA treatments, wild-type C57BL/6 female mice were intraperitoneally injected with 110.sup.6 aggressive ID8-Defb29/Vegf-A ovarian carcinoma cells, and mice received nanocomplexes (50 g of siRNA complexed with in vivo-jetPEI at N/P 6, per mouse) at days 12, 16, 20, 24, 28 and 32 after tumor implantation.
(228) Anti-Tumor Immune Responses and ELISA
(229) Mice were intraperitoneally injected with ID8-Defb29/Vegf-A ovarian cancer cells and treated with siRNA-PEI nanoparticles (n=3/group) at days 8, 13, 18, and 23 after challenge. Total splenic T cells or Ficoll-enriched leukocytes (2-310.sup.5) from peritoneal wash samples were obtained 4 days after the last treatment (day 27) and cocultured in 10% FBS RPMI with 2-310.sup.4 bone marrow-derived DCs previously pulsed overnight with irradiated ID8-Defb29/Vegf-A ovarian cancer cells. Supernatants were collected after 48-72 h of stimulation. IFN- and Granzyme B secretion cells was determined by ELISA using the Ready-SET-Go Kit (eBioscience).
(230) Statistical Analysis
(231) Unless noted otherwise, all experiments were repeated at least two times and results were similar between repeats. The correlation between CHOP expression in tDC and human intra-tumoral T cell infiltration was analyzed using the Spearman's Rank coefficient. Animal experiments used between 3 and 6 mice per group. A P value <0.05 was considered to be statistically significant. All statistical analyses were done using Graph Pad Prism 5.0. Differences between the means of experimental groups were calculated using a two-tailed unpaired Student's t test. Error bars represent standard error of the mean from independent samples assayed within the represented experiments. Survival rates were compared using the Log-Rank test. All survival experiments used at least 6 mice/group. This number provides a 5% significance level and 95% power to detect differences in survival of 20% or greater.
Example 1: Constitutive XBP1 Activation in Ovarian Cancer-Associated DCs
(232) Innate myeloid cells with phenotypic and functional attributes of regulatory DCs commonly infiltrate ovarian tumors (Conejo-Garcia et al., 2004; Huarte et al., 2008; Scarlett et al., 2012). Rather than inducing anti-cancer immunity, these dysfunctional DCs facilitate malignant progression by preventing the activation and expansion of tumor-reactive T cells (Cubillos-Ruiz et al., 2010). To analyze XBP1 activation in human and mouse ovarian cancer-associated DCs, CD45.sup.+CD3.sup.CD20.sup. CD11.sup.+DEC205.sup.+ tDCs were isolated via FACS from human patient ovarian tumors or metastatic ovarian cancer ascites samples. Murine CD45.sup.+CD11c.sup.+MHC-II.sup.+ CD11b.sup.+CD8.sup. tDCs were isolated from advanced p53/K-ras-driven ovarian tumors or from malignant ascites of mice bearing aggressive ID8-Defb29/Vegf-A ovarian carcinoma for 4-5 weeks and their identity as bonafide classical DCs was confirmed by quantifying Clec9A/DNGR-1 and Zbtb46 expression (
(233) Malignant peritoneal fluid samples from patients with metastatic ovarian cancer were centrifuged for 10 min at 1300 rpm and total cells were used for FACS analysis. Solid primary or metastatic ovarian tumors were mechanically dissociated as described above. In both cases, CD45.sup.+CD3.sup.CD20.sup.CD11c.sup.+DEC205.sup.+ tDCs were sorted via FACS for RNA extraction and gene expression quantification via RT-qPCR. The percentage of CD45.sup.+CD3.sup.+ T cells present in each sample was correlated with CHOP mRNA expression levels in sorted tDCs from the same specimen (
(234) Notably, tumor-associated DCs (tDCs) isolated from multiple human patient ovarian cancer specimens (
(235) Expression of the indicated transcripts was determined by RT-qPCR (
(236) Western blot analysis was used to assay the spliced form of XBP1 (XBP1s) protein expression in nuclear extracts obtained from the indicated DCs. Consistently, tDCs exhibited augmented XBP1 protein levels in the nucleus compared with control DCs obtained from non-tumor sites (
(237) The expression of CHOP in tDCs sorted from human patient ovarian cancer specimens was determined using RT-qPCR. Interestingly, CHOP expression levels in tDCs negatively correlated with T cell infiltration in several human ovarian cancer specimens analyzed, suggesting a potential role for ER-stressed tDCs in regulating anti-tumor immune responses (
Example 2: Byproducts of Lipid Peroxidation Trigger ER Stress in DCs
(238) One goal of the present invention was to investigate how the tumor microenvironment influences the functional status of XBP1 in DCs. In particular, one aim of the present invention was to investigate whether cancer-derived factors could participate in triggering ER stress and XBP1 activation in tumor-infiltrating DCs, and determine whether this process could impact the detrimental function of these innate immune cells in hosts with ovarian cancer. Interestingly, neither tumorigenic/immunosuppressive cytokines commonly enriched at tumor sites nor hypoxia-mimicking conditions caused robust XBP1 activation in DCs (
(239) Recent reports demonstrate that abnormal intracellular accumulation of peroxided lipids is a common feature of dysfunctional DCs infiltrating multiple human and mouse cancers (Herber et al., 2010; Ramakrishnan et al., 2014). Importantly, lipid oxidation by reactive oxygen species (ROS) generates reactive byproducts such as the unsaturated aldehyde 4-hydroxy-trans-2-nonenal (4-HNE), which has been shown to induce protein-folding stress by forming stable adducts with ER-resident chaperones (Vladykovskaya et al., 2012). Whether these reactive aldehyde byproducts could trigger ER stress in DCs was investigated. Ovarian cancer-associated DCs demonstrated significantly higher amounts of intracellular lipids and augmented ROS levels in comparison with control non-malignant sDCs isolated from the same host or from nave mice (
Example 3: DC-Intrinsic XBP1 is Necessary for Optimal Ovarian Cancer Progression
(240) To determine how sustained XBP1 activity in tDCs might influence malignant progression, aggressive orthotopic ovarian tumors in conditional knockout female mice lacking functional XBP1 in DCs were developed (
(241) tDCs were sorted from the peritoneal cavity of mice bearing metastatic ID8-VegfA-Def29b ovarian tumors for 4-5 weeks as described in
(242) It had been previously been reported that overall DC survival was compromised upon extensive ablation of XBP1 in early hematopoietic precursors (Iwakoshi et al., 2007). In contrast, conditional deletion of XBP1 through CD11c-controlled Cre expression solely affected the proportion and number of splenic CD8.sup.+ DCs (
(243) Since the vast majority of ovarian cancers are diagnosed at advanced stages, when the disease has spread throughout the peritoneal cavity, the next goal was to define how DC-derived XBP1 impacts the progression of orthotropic tumors that closely recapitulate the physiopathology of human metastatic ovarian cancer (Conejo-Garcia et al., 2004). Notably, ovarian cancer-bearing female mice lacking functional XBP1 in DCs demonstrated reduced peritoneal tumor burden (
Example 4: XBP1 Activation Disrupts Lipid Homeostasis in DCs
(244) To elucidate how XBP1 confers pro-tumorigenic activity in ovarian cancer-associated DCs, a comparison of the transcriptional profile of wild type vs. XBP1-deficient DCs residing in malignant ovarian cancer ascites was performed. 416 genes that were significantly downregulated were identified, while 237 genes showed significantly higher expression due to XBP1 deficiency (Table 2). Significantly altered gene subsets were analyzed to identify transcriptional regulators that may explain the observed mRNA changes. Several predicted affected regulators were identified (
Example 5: XBP1-Deficient tDCs Support T Cell Activation
(245) Aberrant lipid accumulation by cancer-associated DCs has been demonstrated to obstruct their normal antigen processing and presentation capacity (Herber et al., 2010; Ramakrishnan et al., 2014). Whether XBP1-deficient tDCs with reduced levels of intracellular lipids might support rather than repress T cell activation and function at tumor sites was investigated. While surface expression of MHC molecules and CD80 remained unaltered, tDCs devoid of XBP1 demonstrated higher levels of costimulatory receptors CD40, CD83 and CD86 (
Example 6: Therapeutic XBP1 Silencing in tDCs Extends Host Survival by Inducing Anti-Tumor Immunity
(246) T cells are the only immune population known to exert significant pressure against ovarian cancer progression (Callahan et al., 2008; Curiel et al., 2003; Hamanishi et al., 2007; Han et al., 2008; Sato et al., 2005; Zhang et al., 2003). Indeed, it has been demonstrated that the magnitude of intra-tumoral T cell infiltration strongly correlates with a better outcome in ovarian cancer patients (Zhang et al., 2003). To investigate whether targeting XBP1 function in vivo and in situ could be used to restore the immunogenic attributes of ovarian cancer-associated DCs and hence, promote the function of anti-tumor T cells, polyethylenimine (PEI)-based nanoparticles encapsulating siRNA were utilized (Cubillos-Ruiz et al., 2012; Cubillos-Ruiz et al., 2009). Wild type C57BL/6 female mice were injected with 1-210{circumflex over ()}6 ID8-Defb29/Vegf-A ovarian cancer cells and mice received a single injection of control (luciferase-specific) or XBP1-targeting siRNA encapsulated in rhodamine-labeled PEI-based nanocomplexes 3-4 weeks later (
(247) To determine whether selective abrogation of the IRE-1/XBP1 pathway in tDCs had significant therapeutic effects, mice bearing aggressive orthotopic ovarian tumors were i.p. treated with saline, non-targeting or gene-specific siRNA-PEI nanocomplexes. Treatments started 12 days after tumor implantation and injections were administered every 4 days for a period of 3 weeks. Strikingly, wild type mice treated with either XBP1- or IRE-1-silencing nanoparticles demonstrated a remarkable increase in survival compared with control groups (
(248) TABLE-US-00001 TABLE1 Primers Species Gene Oligoname Sequence5-3 Purpose HUMAN ACTB hAct-F GCGAGAAGATGACCCAGATC RT-qPCR (SEQIDNO:7) hAct-R CCAGTGGTACGGCCAGAGG (SEQIDNO:8) HUMAN DDIT3/ hCHOP-F CTGCTTCTCTGGCTTGGCTG RT-qPCR (SEQIDNO:9) CHOP hCHOP-R GCTCTGGGAGGTGCTTGTGA (SEQIDNO:10) HUMAN XBP1 hXBP1-SA-F CCTGGTTGCTGAAGAGGAGG Splicing (SEQIDNO:11) hXBP1-SA-R CCATGGGGAGTTCTGGAG Assay (SEQIDNO:12) Mouse Xbp1 Xbp1-SA-F ACACGTTTGGGAATGGACAC Splicing (SEQIDNO:13) Xbp1-SA-F CCATGGGAAGATGTTCTGGG Assay (SEQIDNO:14) Mouse Actb actb1083 CTCAGGAGGAGCAATGATCTTGAT RT-qPCR (SEQIDNO:15) actb987 TACCACCATGTACCCAGGCA (SEQIDNO:16) Mouse Xbp1 Xbp1.total-F GACAGAGAGTCAAACTAACGTGG RT-qPCR (SEQIDNO:17) Xbp1.total-R GTCCAGCAGGCAAGAAGGT (SEQIDNO:18) Mouse Xbp1s XBPsA406F AAGAACACGCTTGGGAATGG RT-qPCR (SEQIDNO:19) XBPsAa518R CTGCACCTGCTGCGGAC (SEQIDNO:20) Mouse Xbp1 XBP1WT205-F CCTGAGCCCGGAGGAGAA RT-qPCR (SEQIDNO:21) (doesnot (exon2) XBP1WT272-R CTCGAGCAGTCTGCGCTG amplify (SEQIDNO:22) deleted exon2) Mouse Dnajb9/ ERdj4-F TAAAAGCCCTGATGCTGAAGC RT-qPCR (SEQIDNO:23) Erdj4 ERdj4-R TCCGACTATTGGCATCCGA (SEQIDNO:24) Mouse Sec61a1 Sec61a1-F CTATTTCCAGGGCTTCCGAGT RT-qPCR (SEQIDNO:25) Sec61a1-R AGGTGTTGTACTGGCCTCGGT (SEQIDNO:26) Mouse Hspa5/ Grp78-F TCATCGGACGCACTTGGAA RT-qPCR (SEQIDNO:27) PiP Grp78-R CAACCACCTTGAATGGCAAGA (SEQIDNO:28) Mouse Ddit3/ CHOP-F GTCCCTAGCTTGGCTGACAGA RT-qPCR (SEQIDNO:29) CHOP CHOP-R TGGAGAGCGAGGGCTTTG (SEQIDNO:30) Mouse Agpat6 Agpat6-F AGCTTGATTGTCAACCTCCTG RT-qPCR (SEQIDNO:31) Agpat6-R CCGTTGGTGTAGGGCTTGT (SEQIDNO:32) Mouse Scd2 Scd2-F GCATTTGGGAGCCTTGTACG RT-qPCR (SEQIDNO:33) Scd2-R AGCCGTGCCTTGTATGTTCTG (SEQIDNO:34) Mouse Fasn Fasn-F GGAGGTGGTGATAGCCGGTAT RT-qPCR (SEQIDNO:35) Fasn-R TGGGTAATCCATAGAGCCCAG (SEQIDNO:36) Mouse Lpar1 Lpar1.F GACCTAGCAGGCTTACAGTTCC RT-qPCR (SEQIDNO:37) Lpar1.R GCTGTAGTTTGGGGCGATGA (SEQIDNO:38) Mouse Clec9a Clec9a.F GAGCATGGTGTGTTGTGACG RT-qPCR (SEQIDNO:39) Clec9a.R TACCTGGAAGAACTTGATGCCC (SEQIDNO:40) Mouse Zbtb46 Zbtb46.F CTCACATACTGGAGAGCGGC RT-qPCR (SEQIDNO:41) Zbtb46.R TGCTGTGGACCAGAGTATGTC (SEQIDNO:42)
(249) TABLE-US-00002 TABLE 2 KO/WT Symbol Description fold Fut7 fucosyltransferase 7 2.32 Slc5a3 solute carrier family 5 (inositol 2.22 transporters), member 3 Gm2a GM2 ganglioside activator protein 1.99 Stt3a STT3, subunit of the 1.94 oligosaccharyltransferase complex, homolog A (S. cerevisiae) Uggt1 UDP-glucose glycoprotein 1.81 glucosyltransferase 1 Gfpt1 glutamine fructose-6-phosphate 1.77 transaminase 1 Mlec malectin 1.73 Glce glucuronyl C5-epimerase 1.68 Hk1 hexokinase 1 1.59 Aldoc aldolase C, fructose-bisphosphate 1.58 Rpn1 ribophorin I 1.58 Mgat1 mannoside acetylglucosaminyltransferase 1 1.56 Pfkp phosphofructokinase, platelet 1.56 Gaa glucosidase, alpha, acid 1.55 Phkb phosphorylase kinase beta 1.55 Ogdh oxoglutarate (alpha-ketoglutarate) 1.52 dehydrogenase (lipoamide) Ptafr platelet-activating factor receptor 1.52 Pgm3 phosphoglucomutase 3 1.52 Pygb brain glycogen phosphorylase 1.51 Idua iduronidase, alpha-L- 1.49 Acly ATP citrate lyase 1.48 Ppip5k2 diphosphoinositol pentakisphosphate 1.47 kinase 2 Cpt1a carnitine palmitoyltransferase 1a, liver 1.47 Pkm pyruvate kinase, muscle 1.46 St3gal4 ST3 beta-galactoside alpha-2,3- 1.45 sialyltransferase 4 Ganab alpha glucosidase 2 alpha neutral subunit 1.45 Man2b1 mannosidase 2, alpha B1 1.43 Rpn2 ribophorin II 1.40 Tram2 translocating chain-associating 6.39 membrane protein 2 Zfp781 zinc finger protein 781 4.18 Apol9b apolipoprotein L 9b 4.08 Tlr12 toll-like receptor 12 4.06 Zfp791 zinc finger protein 791 3.93 9530036M11Rik RIKEN cDNA 9530036M11 gene 3.71 Leprel1 leprecan-like 1 3.29 Il12b interleukin 12b 3.12 Scn4b sodium channel, type IV, beta 3.08 Tuba1c tubulin, alpha 1C 3.00 Dkk3 dickkopf homolog 3 (Xenopus laevis) 2.98 Sardh sarcosine dehydrogenase 2.96 Cd226 CD226 antigen 2.90 Synpo2 synaptopodin 2 2.87 Fbxo10 F-box protein 10 2.79 Rtkn rhotekin 2.75 Fam13c family with sequence similarity 13, 2.72 member C Itgb2 integrin beta 2 2.62 Ptgir prostaglandin I receptor (IP) 2.61 Bcorl1 BCL6 co-repressor-like 1 2.54 Rnase2a #N/A 2.53 Fcrls Fc receptor-like S, scavenger receptor 2.47 Hyou1 hypoxia up-regulated 1 2.47 Pdia5 protein disulfide isomerase associated 5 2.45 Sdc1 syndecan 1 2.42 Tmem25 transmembrane protein 25 2.40 Ctnna2 catenin (cadherin associated protein), 2.39 alpha 2 F7 coagulation factor VII 2.37 Itgae integrin alpha E, epithelial-associated 2.35 Extl1 exostoses (multiple)-like 1 2.28 Spryd3 SPRY domain containing 3 2.26 Rps6kc1 ribosomal protein S6 kinase polypeptide 1 2.26 Ear2 eosinophil-associated, ribonuclease A 2.24 family, member 2 Fn1 fibronectin 1 2.23 Tenm4 teneurin transmembrane protein 4 2.22 Gfra2 glial cell line derived neurotrophic factor 2.21 family receptor alpha 2 Plekhn1 pleckstrin homology domain containing, 2.21 family N member 1 Lrrc18 leucine rich repeat containing 18 2.20 Nucb2 nucleobindin 2 2.20 Cacna1d calcium channel, voltage-dependent, L 2.16 type, alpha 1D subunit Kctd12b potassium channel tetramerisation 2.16 domain containing 12b Hspa14 heat shock protein 14 2.16 Galnt9 UDP-N-acetyl-alpha-D- 2.13 galactosamine:polypeptide N- acetylgalactosaminyltransferase 9 Hdlbp high density lipoprotein (HDL) binding 2.11 protein Snx22 sorting nexin 22 2.10 Dnmbp dynamin binding protein 2.05 Gm8221 apolipoprotein L 7c pseudogene 2.04 Lpar1 lysophosphatidic acid receptor 1 2.04 Sec61a1 Sec61 alpha 1 subunit (S. cerevisiae) 2.03 Nlrx1 NLR family member X1 2.03 Capn5 calpain 5 2.03 Retnla resistin like alpha 2.02 Sec24d Sec24 related gene family, member D (S. cerevisiae) 2.02 Atg9b autophagy related 9B 2.00 Mpzl2 myelin protein zero-like 2 1.97 Slc13a3 solute carrier family 13 (sodium- 1.97 dependent dicarboxylate transporter), member 3 Plce1 phospholipase C, epsilon 1 1.97 Otof otoferlin 1.96 F10 coagulation factor X 1.96 Unc45b unc-45 homolog B (C. elegans) 1.96 Hspa13 heat shock protein 70 family, member 13 1.93 Madd MAP-kinase activating death domain 1.92 Nbas neuroblastoma amplified sequence 1.92 Sec24c Sec24 related gene family, member C (S. cerevisiae) 1.91 Ercc6l excision repair cross-complementing 1.90 rodent repair deficiency complementation group 6 like 1700021K19Rik RIKEN cDNA 1700021K19 gene 1.88 Abca3 ATP-binding cassette, sub-family A 1.88 (ABC1), member 3 Kctd11 potassium channel tetramerisation 1.88 domain containing 11 Agpat4 1-acylglycerol-3-phosphate O- 1.87 acyltransferase 4 (lysophosphatidic acid acyltransferase, delta) Ambra1 autophagy/beclin 1 regulator 1 1.87 Xdh xanthine dehydrogenase 1.86 Surf4 surfeit gene 4 1.86 Pltp phospholipid transfer protein 1.86 Itgam integrin alpha M 1.86 Cldn1 claudin 1 1.85 Atg13 autophagy related 13 1.84 Xbp1 X-box binding protein 1 1.83 P4hb prolyl 4-hydroxylase, beta polypeptide 1.83 Cdk5rap3 CDK5 regulatory subunit associated 1.83 protein 3 Gmppb GDP-mannose pyrophosphorylase B 1.83 Zfp872 zinc finger protein 872 1.82 Zfp949 zinc finger protein 949 1.82 Psd4 pleckstrin and Sec7 domain containing 4 1.81 Pidd1 #N/A 1.80 Dock2 dedicator of cyto-kinesis 2 1.80 Sidt2 SID1 transmembrane family, member 2 1.80 4931406H21Rik RIKEN cDNA 4931406H21 gene 1.79 Abca9 ATP-binding cassette, sub-family A 1.79 (ABC1), member 9 Ppm1f protein phosphatase 1F (PP2C domain 1.79 containing) Abcg3 ATP-binding cassette, sub-family G 1.79 (WHITE), member 3 Crat carnitine acetyltransferase 1.78 Gpr56 G protein-coupled receptor 56 1.78 Bub1b budding uninhibited by benzimidazoles 1 1.77 homolog, beta (S. cerevisiae) Ticam1 toll-like receptor adaptor molecule 1 1.77 Il27ra interleukin 27 receptor, alpha 1.77 Fam129a family with sequence similarity 129, 1.77 member A Dnase1l3 deoxyribonuclease 1-like 3 1.76 Ptger2 prostaglandin E receptor 2 (subtype EP2) 1.75 Gm1966 predicted gene 1966 1.75 Tmem167b transmembrane protein 167B 1.75 Nup188 nucleoporin 188 1.75 Tyk2 tyrosine kinase 2 1.75 Asb4 ankyrin repeat and SOCS box-containing 4 1.74 Tom1l2 target of myb1-like 2 (chicken) 1.74 Ascc2 activating signal cointegrator 1 complex 1.74 subunit 2 Clec4a2 C-type lectin domain family 4, member a2 1.73 Polr3b polymerase (RNA) III (DNA directed) 1.73 polypeptide B Igj immunoglobulin joining chain 1.73 Acot11 acyl-CoA thioesterase 11 1.73 Ankrd23 ankyrin repeat domain 23 1.73 Mis12 MIS12 homolog (yeast) 1.73 Rfwd3 ring finger and WD repeat domain 3 1.73 Ccpg1 cell cycle progression 1 1.72 F2rl2 coagulation factor II (thrombin) receptor- 1.71 like 2 Arfgap3 ADP-ribosylation factor GTPase 1.71 activating protein 3 Mmp25 matrix metallopeptidase 25 1.71 Ap1g1 adaptor protein complex AP-1, gamma 1 1.70 subunit Cenpi centromere protein I 1.70 Tlr8 toll-like receptor 8 1.70 Pdcd1 programmed cell death 1 1.69 Tmem127 transmembrane protein 127 1.69 Plau plasminogen activator, urokinase 1.69 Tut1 terminal uridylyl transferase 1, U6 1.69 snRNA-specific Mical1 microtubule associated monooxygenase, 1.69 calponin and LIM domain containing 1 Mrc1 mannose receptor, C type 1 1.69 Pdia4 protein disulfide isomerase associated 4 1.69 Zfp738 zinc finger protein 738 1.69 Kat6a K(lysine) acetyltransferase 6A 1.69 Mela melanoma antigen 1.69 Mettl14 methyltransferase like 14 1.68 Copg1 coatomer protein complex, subunit 1.68 gamma 1 Rassf4 Ras association (RaIGDS/AF-6) domain 1.68 family member 4 Klhl18 kelch-like 18 1.68 Gorab golgin, RAB6-interacting 1.68 Rab8b RAB8B, member RAS oncogene family 1.67 Spcs3 signal peptidase complex subunit 3 1.67 homolog (S. cerevisiae) Btd biotinidase 1.67 Pias3 protein inhibitor of activated STAT 3 1.67 Lysmd3 LysM, putative peptidoglycan-binding, 1.67 domain containing 3 Vps8 vacuolar protein sorting 8 homolog (S. cerevisiae) 1.67 Calu calumenin 1.67 Sdccag8 serologically defined colon cancer antigen 8 1.66 Gpr68 G protein-coupled receptor 68 1.66 Kcnab2 potassium voltage-gated channel, shaker- 1.66 related subfamily, beta member 2 Tlr11 toll-like receptor 11 1.66 Slc39a7 solute carrier family 39 (zinc transporter), 1.66 member 7 Fasn fatty acid synthase 1.65 E2f1 E2F transcription factor 1 1.65 Zc3h12c zinc finger CCCH type containing 12C 1.65 Fosl2 fos-like antigen 2 1.65 Mcph1 microcephaly, primary autosomal 1.64 recessive 1 Tgoln2 trans-golgi network protein 2 1.64 Dpp7 dipeptidylpeptidase 7 1.64 Golga3 golgi autoantigen, golgin subfamily a, 3 1.63 Far1 fatty acyl CoA reductase 1 1.63 Pank4 pantothenate kinase 4 1.63 Ncapd3 non-SMC condensin II complex, subunit 1.63 D3 Ddb1 damage specific DNA binding protein 1 1.62 Map3k14 mitogen-activated protein kinase kinase 1.62 kinase 14 Surf6 surfeit gene 6 1.62 Sulf1 sulfatase 1 1.62 Samd9l sterile alpha motif domain containing 9- 1.62 like Slc41a2 solute carrier family 41, member 2 1.62 Tnip2 TNFAIP3 interacting protein 2 1.62 Klhl28 kelch-like 28 1.62 Lclat1 lysocardiolipin acyltransferase 1 1.62 Peg13 paternally expressed 13 1.61 Crem cAMP responsive element modulator 1.61 Mmp19 matrix metallopeptidase 19 1.61 Copa coatomer protein complex subunit alpha 1.61 Rin3 Ras and Rab interactor 3 1.61 Ldlr low density lipoprotein receptor 1.61 Nxpe4 neurexophilin and PC-esterase domain 1.61 family, member 4 Dock10 dedicator of cytokinesis 10 1.61 Leprot leptin receptor overlapping transcript 1.61 Sept9 septin 9 1.61 Fbxo38 F-box protein 38 1.61 Myo1f myosin IF 1.60 Znfx1 zinc finger, NFX1-type containing 1 1.60 Ddi2 DNA-damage inducible protein 2 1.60 Anpep alanyl (membrane) aminopeptidase 1.60 Lifr leukemia inhibitory factor receptor 1.60 Utp20 UTP20, small subunit (SSU) processome 1.60 component, homolog (yeast) Lpin1 lipin 1 1.60 Eps8 epidermal growth factor receptor pathway 1.60 substrate 8 Zfyve16 zinc finger, FYVE domain containing 16 1.60 Arhgap18 Rho GTPase activating protein 18 1.60 Elmo2 engulfment and cell motility 2 1.60 Daglb diacylglycerol lipase, beta 1.59 Elmod2 ELMO/CED-12 domain containing 2 1.59 Abcd1 ATP-binding cassette, sub-family D 1.59 (ALD), member 1 Alpk1 alpha-kinase 1 1.59 Ncs1 neuronal calcium sensor 1 1.59 Ticam2 toll-like receptor adaptor molecule 2 1.59 Clasp1 CLIP associating protein 1 1.59 Atxn3 ataxin 3 1.59 Depdc5 DEP domain containing 5 1.58 Cnnm4 cyclin M4 1.58 Steap3 STEAP family member 3 1.58 Kit kit oncogene 1.58 1110037F02Rik RIKEN cDNA 1110037F02 gene 1.58 Supt5 suppressor of Ty 5 1.58 Socs6 suppressor of cytokine signaling 6 1.58 Gm5431 predicted gene 5431 1.57 Nup160 nucleoporin 160 1.57 Atf6 activating transcription factor 6 1.57 Net1 neuroepithelial cell transforming gene 1 1.57 Dhdh dihydrodiol dehydrogenase (dimeric) 1.57 Dapk1 death associated protein kinase 1 1.57 Taf1 TAF1 RNA polymerase II, TATA box 1.57 binding protein (TBP)-associated factor Arhgap11a Rho GTPase activating protein 11A 1.57 Supt16 suppressor of Ty 16 1.57 Dnajc3 DnaJ (Hsp40) homolog, subfamily C, 1.57 member 3 Ddx10 DEAD (Asp-Glu-Ala-Asp) box polypeptide 1.56 10 Gm8995 predicted gene 8995 1.56 Bsdc1 BSD domain containing 1 1.56 Gpr108 G protein-coupled receptor 108 1.56 Inpp5d inositol polyphosphate-5-phosphatase D 1.56 Snrnp200 small nuclear ribonucleoprotein 200 (U5) 1.56 Asb6 ankyrin repeat and SOCS box-containing 6 1.56 Mfn2 mitofusin 2 1.56 Ccr2 chemokine (C-C motif) receptor 2 1.56 Cbl Casitas B-lineage lymphoma 1.56 Mrvi1 MRV integration site 1 1.56 Tap2 transporter 2, ATP-binding cassette, sub- 1.56 family B (MDR/TAP) Mcm3 minichromosome maintenance deficient 3 1.56 (S. cerevisiae) Nol8 nucleolar protein 8 1.56 Gltpd1 glycolipid transfer protein domain 1.56 containing 1 Plekho2 pleckstrin homology domain containing, 1.56 family O member 2 Il1rl1 interleukin 1 receptor-like 1 1.56 Ankfy1 ankyrin repeat and FYVE domain 1.56 containing 1 Gpatch8 G patch domain containing 8 1.55 Nap1l4 nucleosome assembly protein 1-like 4 1.55 Tmed9 transmembrane emp24 protein transport 1.55 domain containing 9 Arhgap26 Rho GTPase activating protein 26 1.55 Uspl1 ubiquitin specific peptidase like 1 1.55 Pdia6 protein disulfide isomerase associated 6 1.55 Arrb1 arrestin, beta 1 1.55 Mkl1 MKL (megakaryoblastic 1.55 leukemia)/myocardin-like 1 Zfml zinc finger, matrin-like 1.55 Fchsd2 FCH and double SH3 domains 2 1.54 Cnr2 cannabinoid receptor 2 (macrophage) 1.54 Ccdc47 coiled-coil domain containing 47 1.54 Dok2 docking protein 2 1.54 Taok3 TAO kinase 3 1.54 Tti1 TELO2 interacting protein 1 1.54 Smc5 structural maintenance of chromosomes 5 1.54 Pbxip1 pre B cell leukemia transcription factor 1.54 interacting protein 1 Prr5l proline rich 5 like 1.54 Stat6 signal transducer and activator of 1.54 transcription 6 Hepacam2 HEPACAM family member 2 1.54 2700049A03Rik RIKEN cDNA 2700049A03 gene 1.54 Pkd1 polycystic kidney disease 1 homolog 1.54 Lrrk1 leucine-rich repeat kinase 1 1.54 Pan2 PAN2 polyA specific ribonuclease subunit 1.54 homolog (S. cerevisiae) Magt1 magnesium transporter 1 1.53 Armcx3 armadillo repeat containing, X-linked 3 1.53 Cd1d1 CD1d1 antigen 1.53 Plekhb2 pleckstrin homology domain containing, 1.53 family B (evectins) member 2 Bcl2l14 BCL2-like 14 (apoptosis facilitator) 1.53 Lmf2 lipase maturation factor 2 1.53 Nhsl2 NHS-like 2 1.53 Timp3 tissue inhibitor of metalloproteinase 3 1.53 Casp3 caspase 3 1.53 Naaa N-acylethanolamine acid amidase 1.52 Nfam1 Nfat activating molecule with ITAM motif 1 1.52 Dcp1a DCP1 decapping enzyme homolog A (S. cerevisiae) 1.52 Eif3a eukaryotic translation initiation factor 3, 1.52 subunit A Mtmr6 myotubularin related protein 6 1.52 Top2a topoisomerase (DNA) II alpha 1.52 Dnajc14 DnaJ (Hsp40) homolog, subfamily C, 1.52 member 14 Pde4dip phosphodiesterase 4D interacting protein 1.52 (myomegalin) Evi2a ecotropic viral integration site 2a 1.52 Npat nuclear protein in the AT region 1.51 Sil1 endoplasmic reticulum chaperone SIL1 1.51 homolog (S. cerevisiae) Hltf helicase-like transcription factor 1.51 Stim2 stromal interaction molecule 2 1.51 Baz2a bromodomain adjacent to zinc finger 1.51 domain, 2A EII elongation factor RNA polymerase II 1.51 R3hcc1l R3H domain and coiled-coil containing 1 1.51 like Mybbp1a MYB binding protein (P160) 1a 1.51 Myo1c myosin IC 1.50 Zfp260 zinc finger protein 260 1.50 Adam19 a disintegrin and metallopeptidase 1.50 domain 19 (meltrin beta) Tkt transketolase 1.50 Exoc2 exocyst complex component 2 1.50 Sft2d2 SFT2 domain containing 2 1.50 Tuba1a tubulin, alpha 1A 1.50 Oat ornithine aminotransferase 1.50 Baz2b bromodomain adjacent to zinc finger 1.50 domain, 2B Ltn1 listerin E3 ubiquitin protein ligase 1 1.50 Copb2 coatomer protein complex, subunit beta 2 1.50 (beta prime) Cyp51 cytochrome P450, family 51 1.50 Acin1 apoptotic chromatin condensation inducer 1 1.50 Hivep2 human immunodeficiency virus type I 1.50 enhancer binding protein 2 Tmem170b transmembrane protein 170B 1.49 Stom stomatin 1.49 Sec16a SEC16 homolog A (S. cerevisiae) 1.49 Krt80 keratin 80 1.49 Malat1 metastasis associated lung 1.49 adenocarcinoma transcript 1 (non-coding RNA) Rabgap1 RAB GTPase activating protein 1 1.49 Pja2 praja 2, RING-H2 motif containing 1.49 Slamf8 SLAM family member 8 1.49 Tnpo3 transportin 3 1.48 Tmx3 thioredoxin-related transmembrane 1.48 protein 3 Rbbp6 retinoblastoma binding protein 6 1.48 Ilf3 interleukin enhancer binding factor 3 1.48 Ctr9 Ctr9, Paf1/RNA polymerase II complex 1.48 component, homolog (S. cerevisiae) Anapc1 anaphase promoting complex subunit 1 1.48 Svil supervillin 1.48 Ptrf polymerase I and transcript release factor 1.48 Tox4 TOX high mobility group box family 1.48 member 4 Abi2 abl-interactor 2 1.48 Atp7a ATPase, Cu++ transporting, alpha 1.48 polypeptide Cnppd1 cyclin Pas1/PHO80 domain containing 1 1.48 Zc3h7a zinc finger CCCH type containing 7 A 1.48 Zfp263 zinc finger protein 263 1.48 Ipo5 importin 5 1.48 Pggt1b protein geranylgeranyltransferase type I, 1.48 beta subunit Ptplad2 protein tyrosine phosphatase-like A 1.48 domain containing 2 Usp8 ubiquitin specific peptidase 8 1.48 Coro7 coronin 7 1.47 Sept3 septin 3 1.47 Spop speckle-type POZ protein 1.47 Aco1 aconitase 1 1.47 Nucb1 nucleobindin 1 1.47 Prpf6 PRP6 pre-mRNA splicing factor 6 1.47 homolog (yeast) Mavs mitochondrial antiviral signaling protein 1.47 Cd209c CD209c antigen 1.47 Atp8b4 ATPase, class I, type 8B, member 4 1.47 Myof myoferlin 1.47 Sec23b SEC23B (S. cerevisiae) 1.46 Nckap1l NCK associated protein 1 like 1.46 Pum1 pumilio RNA-binding family member 1 1.46 Fgl2 fibrinogen-like protein 2 1.46 Sec31a Sec31 homolog A (S. cerevisiae) 1.46 Txndc16 thioredoxin domain containing 16 1.46 Pdxk pyridoxal (pyridoxine, vitamin B6) kinase 1.46 Gga3 golgi associated, gamma adaptin ear 1.46 containing, ARF binding protein 3 Kitl kit ligand 1.46 Tmcc3 transmembrane and coiled coil domains 3 1.46 Gmppa GDP-mannose pyrophosphorylase A 1.46 Ppp1r21 protein phosphatase 1, regulatory subunit 1.46 21 Os9 amplified in osteosarcoma 1.46 4930506M07Rik RIKEN cDNA 4930506M07 gene 1.45 Smc1a structural maintenance of chromosomes 1.45 1A Kansl3 KAT8 regulatory NSL complex subunit 3 1.45 2900097C17Rik RIKEN cDNA 2900097C17 gene 1.45 Tmem181b-ps transmembrane protein 181B, 1.45 pseudogene Nup210 nucleoporin 210 1.45 Entpd7 ectonucleoside triphosphate 1.45 diphosphohydrolase 7 Stag2 stromal antigen 2 1.45 Narf nuclear prelamin A recognition factor 1.45 Tmem39a transmembrane protein 39a 1.45 Rnf41 ring finger protein 41 1.45 Agpat6 1-acylglycerol-3-phosphate O- 1.44 acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta) Zfp445 zinc finger protein 445 1.44 Ikbkg inhibitor of kappaB kinase gamma 1.44 Gripap1 GRIP1 associated protein 1 1.44 Chd2 chromodomain helicase DNA binding 1.44 protein 2 Ankrd27 ankyrin repeat domain 27 (VPS9 domain) 1.44 Ppp1r15b protein phosphatase 1, regulatory 1.44 (inhibitor) subunit 15b Golgb1 golgi autoantigen, golgin subfamily b, 1.44 macrogolgin 1 Tmed3 transmembrane emp24 domain 1.44 containing 3 Psap prosaposin 1.44 Ctnna1 catenin (cadherin associated protein), 1.44 alpha 1 Ptbp1 polypyrimidine tract binding protein 1 1.43 Csf2rb colony stimulating factor 2 receptor, beta, 1.43 low-affinity (granulocyte-macrophage) Ssrp1 structure specific recognition protein 1 1.43 Cyth4 cytohesin 4 1.43 Tug1 taurine upregulated gene 1 1.43 Scd2 stearoyl-Coenzyme A desaturase 2 1.43 Arhgef6 Rac/Cdc42 guanine nucleotide exchange 1.43 factor (GEF) 6 Tbc1d15 TBC1 domain family, member 15 1.42 Mbnl1 muscleblind-like 1 (Drosophila) 1.42 Eif4g2 eukaryotic translation initiation factor 4, 1.42 gamma 2 Rp2h retinitis pigmentosa 2 homolog (human) 1.42 Adam8 a disintegrin and metallopeptidase 1.41 domain 8 Neat1 nuclear paraspeckle assembly transcript 1.41 1 (non-protein coding) Themis2 thymocyte selection associated family 1.41 member 2 Gosr2 golgi SNAP receptor complex member 2 1.40 Idi1 isopentenyl-diphosphate delta isomerase 1.40 Psmd2 proteasome (prosome, macropain) 26S 1.40 subunit, non-ATPase, 2 Hmgcr 3-hydroxy-3-methylglutaryl-Coenzyme A 1.40 reductase Eef2 eukaryotic translation elongation factor 2 1.40 Myo1g myosin IG 1.40 Msn moesin 1.39 Cfh complement component factor h 1.38 C1qc complement component 1, q 1.42 subcomponent, C chain A630089N07Rik RIKEN cDNA A630089N07 gene 1.43 Traf5 TNF receptor-associated factor 5 1.44 Zfp353-ps zinc finger protein 352 1.45 Fam110b family with sequence similarity 110, 1.48 member B Wfdc17 WAP four-disulfide core domain 17 1.48 Fam213b family with sequence similarity 213, 1.48 member B Trem2 triggering receptor expressed on myeloid 1.50 cells 2 Snx18 sorting nexin 18 1.51 1500012F01Rik RIKEN cDNA 1500012F01 gene 1.51 Tctex1d2 Tctex1 domain containing 2 1.52 Icam2 intercellular adhesion molecule 2 1.53 Gngt2 guanine nucleotide binding protein (G 1.53 protein), gamma transducing activity polypeptide 2 Lst1 leukocyte specific transcript 1 1.54 Itsn1 intersectin 1 (SH3 domain protein 1A) 1.54 Ltbp1 latent transforming growth factor beta 1.55 binding protein 1 Blvrb biliverdin reductase B (flavin reductase 1.57 (NADPH)) Hscb HscB iron-sulfur cluster co-chaperone 1.57 homolog (E. coli) Acot2 acyl-CoA thioesterase 2 1.57 Gimap8 GTPase, IMAP family member 8 1.59 Sept1 septin 1 1.60 C5ar2 complement component 5a receptor 2 1.60 Itga6 integrin alpha 6 1.61 Dcxr dicarbonyl L-xylulose reductase 1.61 Mmp12 matrix metallopeptidase 12 1.61 Tmem243 transmembrane protein 243, 1.63 mitochondrial Pou2f2 POU domain, class 2, transcription factor 2 1.63 Ly6c2 lymphocyte antigen 6 complex, locus C2 1.63 Hnmt histamine N-methyltransferase 1.64 Asns asparagine synthetase 1.64 Emp1 epithelial membrane protein 1 1.65 Ets1 E26 avian leukemia oncogene 1, 5 1.65 domain Cirbp cold inducible RNA binding protein 1.65 Cbr2 carbonyl reductase 2 1.68 Serpinb10 serine (or cysteine) peptidase inhibitor, 1.68 clade B (ovalbumin), member 10 Vsig4 V-set and immunoglobulin domain 1.69 containing 4 Fam20c family with sequence similarity 20, 1.69 member C Irf2bpl interferon regulatory factor 2 binding 1.71 protein-like Cd93 CD93 antigen 1.71 Med17 mediator complex subunit 17 1.71 Apoe apolipoprotein E 1.72 Cd28 CD28 antigen 1.72 Ms4a1 membrane-spanning 4-domains, 1.73 subfamily A, member 1 Lpcat2 lysophosphatidylcholine acyltransferase 2 1.73 Plac8 placenta-specific 8 1.73 Rab28 RAB28, member RAS oncogene family 1.74 Mzb1 marginal zone B and B1 cell-specific 1.74 protein 1 Dok3 docking protein 3 1.75 Arg1 arginase, liver 1.76 Cd19 CD19 antigen 1.76 Fcna ficolin A 1.77 Cd79b CD79B antigen 1.77 Tspan4 tetraspanin 4 1.78 Mmp9 matrix metallopeptidase 9 1.80 Itk IL2 inducible T cell kinase 1.81 Dppa3 developmental pluripotency-associated 3 1.81 Ninj1 ninjurin 1 1.81 Cxcr5 chemokine (CXC motif) receptor 5 1.82 Spry2 sprouty homolog 2 (Drosophila) 1.82 Prtn3 proteinase 3 1.82 Snx24 sorting nexing 24 1.83 Ccl3 chemokine (C-C motif) ligand 3 1.83 Gdf3 growth differentiation factor 3 1.86 Ly6d lymphocyte antigen 6 complex, locus D 1.86 Cd69 CD69 antigen 1.86 Selp selectin, platelet 1.86 Apoc2 apolipoprotein C-II 1.86 Gimap3 GTPase, IMAP family member 3 1.88 Speer7-ps1 spermatogenesis associated glutamate 1.89 (E)-rich protein 7, pseudogene 1 Dusp1 dual specificity phosphatase 1 1.89 Clec4d C-type lectin domain family 4, member d 1.90 Cd27 CD27 antigen 1.90 Sh2d2a SH2 domain protein 2A 1.91 Ly6a lymphocyte antigen 6 complex, locus A 1.92 Nt5e 5 nucleotidase, ecto 1.94 Txk TXK tyrosine kinase 1.96 Saa3 serum amyloid A 3 1.96 Gimap9 GTPase, IMAP family member 9 1.98 Ndufb2 NADH dehydrogenase (ubiquinone) 1 1.99 beta subcomplex, 2 Tfec transcription factor EC 2.02 Cxcl13 chemokine (CXC motif) ligand 13 2.03 Igfbp4 insulin-like growth factor binding protein 4 2.04 Asb1 ankyrin repeat and SOCS box-containing 1 2.07 Pf4 platelet factor 4 2.07 Xkrx X Kell blood group precursor related X 2.09 linked Ypel3 yippee-like 3 (Drosophila) 2.09 Ppp3cc protein phosphatase 3, catalytic subunit, 2.10 gamma isoform Fam101b family with sequence similarity 101, 2.10 member B Slc40a1 solute carrier family 40 (iron-regulated 2.10 transporter), member 1 Samd3 sterile alpha motif domain containing 3 2.11 Il2rb interleukin 2 receptor, beta chain 2.12 Fam169b family with sequence similarity 169, 2.12 member B Mri1 methylthioribose-1-phosphate isomerase 2.15 homolog (S. cerevisiae) Gimap6 GTPase, IMAP family member 6 2.15 Alox15 arachidonate 15-lipoxygenase 2.17 Tpsb2 tryptase beta 2 2.18 Lef1 lymphoid enhancer binding factor 1 2.18 Tcf7 transcription factor 7, T cell specific 2.21 Skap1 src family associated phosphoprotein 1 2.22 Tmprss13 transmembrane protease, serine 13 2.22 Marco macrophage receptor with collagenous 2.23 structure Cd79a CD79A antigen (immunoglobulin- 2.26 associated alpha) Apoc1 apolipoprotein C-I 2.26 Ikzf3 IKAROS family zinc finger 3 2.27 Cd3d CD3 antigen, delta polypeptide 2.29 Id1 inhibitor of DNA binding 1 2.29 Gzmb granzyme B 2.29 Satb1 special AT-rich sequence binding protein 1 2.29 Lax1 lymphocyte transmembrane adaptor 1 2.32 Gimap4 GTPase, IMAP family member 4 2.34 Cpa3 carboxypeptidase A3, mast cell 2.36 Ccr3 chemokine (C-C motif) receptor 3 2.37 Fam189b family with sequence similarity 189, 2.38 member B Wnt2 wingless-related MMTV integration site 2 2.38 Vmn2r26 vomeronasal 2, receptor 26 2.39 Ppbp pro-platelet basic protein 2.40 Pou2af1 POU domain, class 2, associating factor 1 2.41 Lck lymphocyte protein tyrosine kinase 2.42 Gm11346 X-linked lymphocyte-regulated 5 2.42 pseudogene Cma1 chymase 1, mast cell 2.42 Ctsw cathepsin W 2.43 Gm684 predicted gene 684 2.45 Serpinb2 serine (or cysteine) peptidase inhibitor, 2.47 clade B, member 2 Trav3n-3 T cell receptor alpha variable 3N-3 2.48 Prg4 proteoglycan 4 (megakaryocyte 2.48 stimulating factor, articular superficial zone protein) Slpi secretory leukocyte peptidase inhibitor 2.49 Tmem51os1 Tmem51 opposite strand 1 2.50 Ccl4 chemokine (C-C motif) ligand 4 2.50 Klre1 killer cell lectin-like receptor family E 2.51 member 1 Pear1 platelet endothelial aggregation receptor 1 2.52 Lat linker for activation of T cells 2.53 Ptchd4 patched domain containing 4 2.53 Pard6g par-6 family cell polarity regulator gamma 2.55 Prf1 perforin 1 (pore forming protein) 2.57 Stc1 stanniocalcin 1 2.59 Scn1a sodium channel, voltage-gated, type I, 2.60 alpha Plcb4 phospholipase C, beta 4 2.63 Cd3g CD3 antigen, gamma polypeptide 2.67 Gpr174 G protein-coupled receptor 174 2.69 Pik3c2b phosphoinositide-3-kinase, class 2, beta 2.71 polypeptide Crtam cytotoxic and regulatory T cell molecule 2.71 Eomes eomesodermin homolog (Xenopus laevis) 2.72 Ebf1 early B cell factor 1 2.72 Tnfsf15 tumor necrosis factor (ligand) 2.77 superfamily, member 15 Gimap7 GTPase, IMAP family member 7 2.81 Ifitm10 interferon induced transmembrane 2.82 protein 10 Trem3 triggering receptor expressed on myeloid 2.83 cells 3 Fasl Fas ligand (TNF superfamily, member 6) 2.83 Epha2 Eph receptor A2 2.83 Sh2d1a SH2 domain protein 1A 2.85 Tdgf1 teratocarcinoma-derived growth factor 1 2.86 Ncr1 natural cytotoxicity triggering receptor 1 2.88 Fbxl21 F-box and leucine-rich repeat protein 21 2.88 Zdhhc15 zinc finger, DHHC domain containing 15 2.89 Gimap5 GTPase, IMAP family member 5 2.91 Gzma granzyme A 2.94 A630023P12Rik RIKEN cDNA A630023P12 gene 2.96 Ms4a4b membrane-spanning 4-domains, 2.99 subfamily A, member 4B Mgst2 microsomal glutathione S-transferase 2 2.99 Thy1 thymus cell antigen 1, theta 2.99 2900011O08Rik RIKEN cDNA 2900011O08 gene 3.01 Cd3e CD3 antigen, epsilon polypeptide 3.02 A730060N03Rik RIKEN cDNA A730060N03 gene 3.03 Klrc2 killer cell lectin-like receptor subfamily C, 3.04 member 2 Phactr3 phosphatase and actin regulator 3 3.10 Retnlg resistin like gamma 3.11 Tsix X (inactive)-specific transcript, opposite 3.12 strand Rgcc regulator of cell cycle 3.13 Dapl1 death associated protein-like 1 3.14 Slitrk4 SLIT and NTRK-like family, member 4 3.20 Cyp26a1 cytochrome P450, family 26, subfamily a, 3.20 polypeptide 1 Cd96 CD96 antigen 3.21 Mrgpra2b MAS-related GPR, member A2B 3.25 Lynx1 Ly6/neurotoxin 1 3.25 Pou1f1 POU domain, class 1, transcription factor 1 3.25 Klrg1 killer cell lectin-like receptor subfamily G, 3.25 member 1 S100a9 S100 calcium binding protein A9 3.25 (calgranulin B) Tlr5 toll-like receptor 5 3.26 Klra21 killer cell lectin-like receptor subfamily A, 3.27 member 21 Mrgpra2a MAS-related GPR, member A2A 3.28 Ptprcap protein tyrosine phosphatase, receptor 3.29 type, C polypeptide-associated protein I830127L07Rik RIKEN cDNA I830127L07 gene 3.30 9530053A07Rik RIKEN cDNA 9530053A07 gene 3.31 Olfr288 olfactory receptor 288 3.37 Ly6c1 lymphocyte antigen 6 complex, locus C1 3.40 Nkg7 natural killer cell group 7 sequence 3.41 Folr4 folate receptor 4 (delta) 3.44 Ctsk cathepsin K 3.46 Gpr83 G protein-coupled receptor 83 3.47 Unc5cl unc-5 homolog C (C. elegans)-like 3.47 Fcer1a Fc receptor, IgE, high affinity I, alpha 3.58 polypeptide Klra7 killer cell lectin-like receptor, subfamily A, 3.60 member 7 1810041L15Rik RIKEN cDNA 1810041L15 gene 3.62 Nsg2 neuron specific gene family member 2 3.62 G0s2 G0/G1 switch gene 2 3.68 Sall3 sal-like 3 (Drosophila) 3.68 S100a8 S100 calcium binding protein A8 3.70 (calgranulin A) Klrc1 killer cell lectin-like receptor subfamily C, 3.71 member 1 Gm13363 predicted gene 13363 3.77 Slc2a13 solute carrier family 2 (facilitated glucose 3.77 transporter), member 13 Upp1 uridine phosphorylase 1 3.78 Tnik TRAF2 and NCK interacting kinase 3.82 Klra1 killer cell lectin-like receptor, subfamily A, 3.85 member 1 Tcrd-V1 T cell receptor delta, variable 1 3.86 Lrrn4 leucine rich repeat neuronal 4 3.89 Mycn v-myc myelocytomatosis viral related 3.92 oncogene, neuroblastoma derived (avian) Fam155a family with sequence similarity 155, 3.93 member A Myo16 myosin XVI 3.96 Xcl1 chemokine (C motif) ligand 1 4.01 Lcn2 lipocalin 2 4.10 Gzmk granzyme K 4.11 A530013C23Rik RIKEN cDNA A530013C23 gene 4.20 Krt75 keratin 75 4.23 1100001G20Rik RIKEN cDNA 1100001G20 gene 4.24 Efna2 ephrin A2 4.24 C330013E15Rik RIKEN cDNA C330013E15 gene 4.27 Hecw2 HECT, C2 and WW domain containing E3 4.31 ubiquitin protein ligase 2 March11 membrane-associated ring finger 4.35 (C3HC4) 11 4930588J15Rik RIKEN cDNA 4930588J15 gene 4.37 Sucnr1 succinate receptor 1 4.64 Smok4a sperm motility kinase 4A 4.85 I730030J21Rik RIKEN cDNA I730030J21 gene 5.14 Slc15a2 solute carrier family 15 (H+/peptide 5.21 transporter), member 2 Penk preproenkephalin 5.25 1700034I23Rik FUN14 domain containing 2 pseudogene 5.30 Tnfsf18 tumor necrosis factor (ligand) 5.64 superfamily, member 18 Cox6a2 cytochrome c oxidase subunit VIa 5.68 polypeptide 2 Csf2 colony stimulating factor 2 (granulocyte- 5.81 macrophage) Actg1 actin, gamma, cytoplasmic 1 5.85 Apold1 apolipoprotein L domain containing 1 6.06 Ip6k2 inositol hexaphosphate kinase 2 7.27 Baiap3 BAI1-associated protein 3 7.29 Hsd3b1 hydroxy-delta-5-steroid dehydrogenase, 3 9.34 beta- and steroid delta-isomerase 1 Sec14l4 SEC14-like 4 (S. cerevisiae) 10.28 Itgad integrin, alpha D 10.29
EQUIVALENTS
(250) Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.
REFERENCES
(251) Acosta-Alvear, D., Zhou, Y., Blais, A., Tsikitis, M., Lents, N. H., Arias, C., Lennon, C. J., Kluger, Y., and Dynlacht, B. D. (2007). XBP1 controls diverse cell type- and condition-specific transcriptional regulatory networks. Mol Cell 27, 53-66. Barnett, B., Kryczek, I., Cheng, P., Zou, W., and Curiel, T. J. (2005). Regulatory T cells in ovarian cancer: biology and therapeutic potential. Am J Reprod Immunol 54, 369-377. Bhowmick, N. A., Neilson, E. G., and Moses, H. L. (2004). Stromal fibroblasts in cancer initiation and progression. Nature 432, 332-337. Bollard, C. M., Gottschalk, S., Leen, A. M., Weiss, H., Straathof, K. C., Carrum, G., Khalil, M., Wu, M. F., Huls, M. H., Chang, C. C., et al. (2007). Complete responses of relapsed lymphoma following genetic modification of tumor-antigen presenting cells and T-lymphocyte transfer. Blood 110, 2838-2845. Callahan, M. J., Nagymanyoki, Z., Bonome, T., Johnson, M. E., Litkouhi, B., Sullivan, E. H., Hirsch, M. S., Matulonis, U. A., Liu, J., Birrer, M. J., et al. (2008). Increased HLA-DMB expression in the tumor epithelium is associated with increased CTL infiltration and improved prognosis in advanced-stage serous ovarian cancer. Clin Cancer Res 14, 7667-7673. Carrasco, D. R., Sukhdeo, K., Protopopova, M., Sinha, R., Enos, M., Carrasco, D. E., Zheng, M., Mani, M., Henderson, J., Pinkus, G. S., et al. (2007). The differentiation and stress response factor XBP-1 drives multiple myeloma pathogenesis. Cancer Cell 11, 349-360. Caton, M. L., Smith-Raska, M. R., and Reizis, B. (2007). Notch-RBP-J signaling controls the homeostasis of CD8 dendritic cells in the spleen. J Exp Med 204, 1653-1664. Chen, X., Iliopoulos, D., Zhang, Q., Tang, Q., Greenblatt, M. B., Hatziapostolou, M., Lim, E., Tam, W. L., Ni, M., Chen, Y., et al. (2014). XBP1 promotes triple-negative breast cancer by controlling the HIF1alpha pathway. Nature 508, 103-107. Conejo-Garcia, J. R., Benencia, F., Courreges, M. C., Kang, E., Mohamed-Hadley, A., Buckanovich, R. J., Holtz, D. O., Jenkins, A., Na, H., Zhang, L., et al. (2004). Tumor-infiltrating dendritic cell precursors recruited by a beta-defensin contribute to vasculogenesis under the influence of Vegf-A. Nat Med 10, 950-958. Conejo-Garcia, J. R., Buckanovich, R. J., Benencia, F., Courreges, M. C., Rubin, S. C., Carroll, R. G., and Coukos, G. (2005). Vascular leukocytes contribute to tumor vascularization. Blood 105, 679-681. Coussens, L. M., Tinkle, C. L., Hanahan, D., and Werb, Z. (2000). MMP-9 supplied by bone marrow-derived cells contributes to skin carcinogenesis. Cell 103, 481-490. Coussens, L. M., and Werb, Z. (2002). Inflammation and cancer. Nature 420, 860-867. Cubillos-Ruiz, J. R., Baird, J. R., Tesone, A. J., Rutkowski, M. R., Scarlett, U. K., Camposeco-Jacobs, A. L., Anadon-Arnillas, J., Harwood, N. M., Korc, M., Fiering, S. N., et al. (2012). Reprogramming tumor-associated dendritic cells in vivo using microRNA mimetics triggers protective immunity against ovarian cancer. Cancer Res (Published OnlineFirst February 3). Cubillos-Ruiz, J. R., Engle, X., Scarlett, U. K., Martinez, D., Barber, A., Elgueta, R., Wang, L., Nesbeth, Y., Durant, Y., Gewirtz, A. T., et al. (2009). Polyethylenimine-based siRNA nanocomplexes reprogram tumor-associated dendritic cells via TLR5 to elicit therapeutic antitumor immunity. J Clin Invest 119, 2231-2244. Cubillos-Ruiz, J. R., Rutkowski, M., and Conejo-Garcia, J. R. (2010). Blocking ovarian cancer progression by targeting tumor microenvironmental leukocytes. Cell Cycle 9, 260-268. Curiel, T. J., Wei, S., Dong, H., Alvarez, X., Cheng, P., Mottram, P., Krzysiek, R., Knutson, K. L., Daniel, B., Zimmermann, M. C., et al. (2003). Blockade of B7-H1 improves myeloid dendritic cell-mediated antitumor immunity. Nat Med 9, 562-567. De Palma, M., Murdoch, C., Venneri, M. A., Naldini, L., and Lewis, C. E. (2007). Tie2-expressing monocytes: regulation of tumor angiogenesis and therapeutic implications. Trends Immunol 28, 519-524. Dinulescu, D. M., Ince, T. A., Quade, B. J., Shafer, S. A., Crowley, D., and Jacks, T. (2005). Role of K-ras and Pten in the development of mouse models of endometriosis and endometrioid ovarian cancer. Nat Med 11, 63-70. Dudley, M. E., Wunderlich, J. R., Robbins, P. F., Yang, J. C., Hwu, P., Schwartzentruber, D. J., Topalian, S. L., Sherry, R., Restifo, N. P., Hubicki, A. M., et al. (2002). Cancer regression and autoimmunity in patients after clonal repopulation with antitumor lymphocytes. Science 298, 850-854. Flesken-Nikitin, A., Choi, K. C., Eng, J. P., Shmidt, E. N., and Nikitin, A. Y. (2003). Induction of carcinogenesis by concurrent inactivation of p53 and Rb1 in the mouse ovarian surface epithelium. Cancer Res 63, 3459-3463. Gomez, B. P., Riggins, R. B., Shajahan, A. N., Klimach, U., Wang, A., Crawford, A. C., Zhu, Y., Zwart, A., Wang, M., and Clarke, R. (2007). Human X-box binding protein-1 confers both estrogen independence and antiestrogen resistance in breast cancer cell lines. FASEB J 21, 4013-4027. Hamanishi, J., Mandai, M., Iwasaki, M., Okazaki, T., Tanaka, Y., Yamaguchi, K., Higuchi, T., Yagi, H., Takakura, K., Minato, N., et al. (2007). Programmed cell death 1 ligand 1 and tumor-infiltrating CD8+ T lymphocytes are prognostic factors of human ovarian cancer. Proc Natl Acad Sci USA 104, 3360-3365. Han, L. Y., Fletcher, M. S., Urbauer, D. L., Mueller, P., Landen, C. N., Kamat, A. A., Lin, Y. G., Merritt, W. M., Spannuth, W. A., Deavers, M. T., et al. (2008). HLA class I antigen processing machinery component expression and intratumoral T-Cell infiltrate as independent prognostic markers in ovarian carcinoma. Clin Cancer Res 14, 3372-3379. Herber, D. L., Cao, W., Nefedova, Y., Novitskiy, S. V., Nagaraj, S., Tyurin, V. A., Corzo, A., Cho, H. I., Celis, E., Lennox, B., et al. (2010). Lipid accumulation and dendritic cell dysfunction in cancer. Nat Med 16, 880-886. Hetz, C., Chevet, E., and Harding, H. P. (2013). Targeting the unfolded protein response in disease. Nature reviews Drug discovery 12, 703-719. Hollien, J., Lin, J. H., Li, H., Stevens, N., Walter, P., and Weissman, J. S. (2009). Regulated Irel-dependent decay of messenger RNAs in mammalian cells. J Cell Biol 186, 323-331. Huang da, W., Sherman, B. T., and Lempicki, R. A. (2009). Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature protocols 4, 44-57. Huarte, E., Cubillos-Ruiz, J. R., Nesbeth, Y. C., Scarlett, U. K., Martinez, D. G., Buckanovich, R. J., Benencia, F., Stan, R. V., Keler, T., Sarobe, P., et al. (2008). Depletion of dendritic cells delays ovarian cancer progression by boosting antitumor immunity. Cancer Res 68, 7684-7691. Iwakoshi, N. N., Pypaert, M., and Glimcher, L. H. (2007). The transcription factor XBP-1 is essential for the development and survival of dendritic cells. J Exp Med 204, 2267-2275. Jackson, E. L., Willis, N., Mercer, K., Bronson, R. T., Crowley, D., Montoya, R., Jacks, T., and Tuveson, D. A. (2001). Analysis of lung tumor initiation and progression using conditional expression of oncogenic K-ras. Genes Dev 15, 3243-3248. Jonkers, J., Meuwissen, R., van der Gulden, H., Peterse, H., van der Valk, M., and Berns, A. (2001). Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat Genet 29, 418-425. Langmead, B., Trapnell, C., Pop, M., and Salzberg, S. L. (2009). Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome biology 10, R25. Lee, A. H., Iwakoshi, N. N., Anderson, K. C., and Glimcher, L. H. (2003a). Proteasome inhibitors disrupt the unfolded protein response in myeloma cells. Proc Natl Acad Sci USA 100, 9946-9951. Lee, A. H., Iwakoshi, N. N., and Glimcher, L. H. (2003b). XBP-1 regulates a subset of endoplasmic reticulum resident chaperone genes in the unfolded protein response. Mol Cell Biol 23, 7448-7459. Lee, A. H., Scapa, E. F., Cohen, D. E., and Glimcher, L. H. (2008). Regulation of hepatic lipogenesis by the transcription factor XBP1. Science 320, 1492-1496. Leen, A. M., Myers, G. D., Sili, U., Huls, M. H., Weiss, H., Leung, K. S., Carrum, G., Krance, R. A., Chang, C. C., Molldrem, J. J., et al. (2006). Monoculture-derived T lymphocytes specific for multiple viruses expand and produce clinically relevant effects in immunocompromised individuals. Nat Med 12, 1160-1166. Li, B., and Dewey, C. N. (2011). RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC bioinformatics 12, 323. Mantovani, A., Allavena, P., Sica, A., and Balkwill, F. (2008). Cancer-related inflammation. Nature 454, 436-444. Martinon, F., Chen, X., Lee, A. H., and Glimcher, L. H. (2010). TLR activation of the transcription factor XBP1 regulates innate immune responses in macrophages. Nat Immunol 11, 411-418. Morgan, R. A., Dudley, M. E., Wunderlich, J. R., Hughes, M. S., Yang, J. C., Sherry, R. M., Royal, R. E., Topalian, S. L., Kammula, U. S., Restifo, N. P., et al. (2006). Cancer regression in patients after transfer of genetically engineered lymphocytes. Science 314, 126-129. Nesbeth, Y., Scarlett, U., Cubillos-Ruiz, J., Martinez, D., Engle, X., Turk, M. J., and Conejo-Garcia, J. R. (2009). CCL5-mediated endogenous antitumor immunity elicited by adoptively transferred lymphocytes and dendritic cell depletion. Cancer Res 69, 6331-6338. Nesbeth, Y. C., Martinez, D. G., Toraya, S., Scarlett, U. K., Cubillos-Ruiz, J. R., Rutkowski, M. R., and Conejo-Garcia, J. R. (2010). CD4+ T cells elicit host immune responses to MHC class II-negative ovarian cancer through CCL5 secretion and CD40-mediated licensing of dendritic cells. J Immunol 184, 5654-5662. Piret, J. P., Mottet, D., Raes, M., and Michiels, C. (2002). CoCl2, a chemical inducer of hypoxia-inducible factor-1, and hypoxia reduce apoptotic cell death in hepatoma cell line HepG2. Ann N Y Acad Sci 973, 443-447. Ramakrishnan, R., Tyurin, V. A., Veglia, F., Condamine, T., Amoscato, A., Mohammadyani, D., Johnson, J. J., Zhang, L. M., Klein-Seetharaman, J., Celis, E., et al. (2014). Oxidized lipids block antigen cross-presentation by dendritic cells in cancer. J Immunol 192, 2920-2931. Reimold, A. M., Iwakoshi, N. N., Manis, J., Vallabhajosyula, P., Szomolanyi-Tsuda, E., Gravallese, E. M., Friend, D., Grusby, M. J., Alt, F., and Glimcher, L. H. (2001). Plasma cell differentiation requires the transcription factor XBP-1. Nature 412, 300-307. Robinson, M. D., and Oshlack, A. (2010). A scaling normalization method for differential expression analysis of RNA-seq data. Genome biology 11, R25. Roby, K. F., Taylor, C. C., Sweetwood, J. P., Cheng, Y., Pace, J. L., Tawfik, O., Persons, D. L., Smith, P. G., and Terranova, P. F. (2000). Development of a syngeneic mouse model for events related to ovarian cancer. Carcinogenesis 21, 585-591. Sato, E., Olson, S. H., Ahn, J., Bundy, B., Nishikawa, H., Qian, F., Jungbluth, A. A., Frosina, D., Gnjatic, S., Ambrosone, C., et al. (2005). Intraepithelial CD8+ tumor-infiltrating lymphocytes and a high CD8+/regulatory T cell ratio are associated with favorable prognosis in ovarian cancer. Proc Natl Acad Sci USA 102, 18538-18543. Scarlett, U. K., Cubillos-Ruiz, J. R., Nesbeth, Y. C., Martinez, D. G., Engle, X., Gewirtz, A. T., Ahonen, C. L., and Conejo-Garcia, J. R. (2009). In situ stimulation of CD40 and Toll-like receptor 3 transforms ovarian cancer-infiltrating dendritic cells from immunosuppressive to immunostimulatory cells. Cancer Res 69, 7329-7337. Scarlett, U. K., Rutkowski, M. R., Rauwerdink, A. M., Fields, J., Escovar-Fadul, X., Baird, J., Cubillos-Ruiz, J. R., Jacobs, A. C., Gonzalez, J. L., Weaver, J., et al. (2012). Ovarian cancer progression is controlled by phenotypic changes in dendritic cells. J Exp Med. Singh, S. P., Niemczyk, M., Saini, D., Awasthi, Y. C., Zimniak, L., and Zimniak, P. (2008). Role of the electrophilic lipid peroxidation product 4-hydroxynonenal in the development and maintenance of obesity in mice. Biochemistry 47, 3900-3911. Singh, S. P., Niemczyk, M., Zimniak, L., and Zimniak, P. (2009). Fat accumulation in Caenorhabditis elegans triggered by the electrophilic lipid peroxidation product 4-hydroxynonenal (4-HNE). Aging 1, 68-80. So, J. S., Hur, K. Y., Tarrio, M., Ruda, V., Frank-Kamenetsky, M., Fitzgerald, K., Koteliansky, V., Lichtman, A. H., Iwawaki, T., Glimcher, L. H., et al. (2012). Silencing of lipid metabolism genes through IRE1alpha-mediated mRNA decay lowers plasma lipids in mice. Cell Metab 16, 487-499. Sriburi, R., Jackowski, S., Mori, K., and Brewer, J. W. (2004). XBP1: a link between the unfolded protein response, lipid biosynthesis, and biogenesis of the endoplasmic reticulum. J Cell Biol 167, 35-41. Vladykovskaya, E., Sithu, S. D., Haberzettl, P., Wickramasinghe, N. S., Merchant, M. L., Hill, B. G., McCracken, J., Agarwal, A., Dougherty, S., Gordon, S. A., et al. (2012). Lipid peroxidation product 4-hydroxy-trans-2-nonenal causes endothelial activation by inducing endoplasmic reticulum stress. J Biol Chem 287, 11398-11409. Whiteside, T. L. (2008). The tumor microenvironment and its role in promoting tumor growth. Oncogene 27, 5904-5912. Yoshida, H., Matsui, T., Yamamoto, A., Okada, T., and Mori, K. (2001). XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell 107, 881-891. Zhang, L., Conejo-Garcia, J. R., Katsaros, D., Gimotty, P. A., Massobrio, M., Regnani, G., Makrigiannakis, A., Gray, H., Schlienger, K., Liebman, M. N., et al. (2003). Intratumoral T cells, recurrence, and survival in epithelial ovarian cancer. N Engl J Med 348, 203-213. Zou, W. (2005). Immunosuppressive networks in the tumour environment and their therapeutic relevance. Nat Rev Cancer 5, 263-274. Meredith, M. M., Liu, K., Darrasse-Jeze, G., Kamphorst, A. O., Schreiber, H. A., Guermonprez, P., Idoyaga, J., Cheong, C., Yao, K. H., Niec, R. E., et al. (2012). Expression of the zinc finger transcription factor zDC (Zbtb46, Btbd4) defines the classical dendritic cell lineage. J Exp Med 209, 1153-1165. Piret, J. P., Mottet, D., Raes, M., and Michiels, C. (2002). CoCl2, a chemical inducer of hypoxia-inducible factor-1, and hypoxia reduce apoptotic cell death in hepatoma cell line HepG2. Ann N Y Acad Sci 973, 443-447. Satpathy, A. T., Kc, W., Albring, J. C., Edelson, B. T., Kretzer, N. M., Bhattacharya, D., Murphy, T. L., and Murphy, K. M. (2012). Zbtb46 expression distinguishes classical dendritic cells and their committed progenitors from other immune lineages. J Exp Med 209, 1135-1152. Schraml, B. U., van Blijswijk, J., Zelenay, S., Whitney, P. G., Filby, A., Acton, S. E., Rogers, N. C., Moncaut, N., Carvajal, J. J., and Reis e Sousa, C. (2013). Genetic tracing via DNGR-1 expression history defines dendritic cells as a hematopoietic lineage. Cell 154, 843-858.