COMPOSITION COMPRISING ORGANOSELENIUM COMPOUND FOR TREATMENT OF SKELETAL MUSCLE ATROPHY
20230210818 · 2023-07-06
Inventors
- Darren Reece WILLIAMS (Gwangju, KR)
- Da-Woon Jung (Gwangju, KR)
- Ji-Hyung LEE (Yongin-si, KR)
- Hyun-Jun KIM (Jeonju-si, KR)
- Seon-Wook KIM (Incheon, KR)
Cpc classification
A61K31/661
HUMAN NECESSITIES
A61K31/675
HUMAN NECESSITIES
International classification
A61K31/41
HUMAN NECESSITIES
Abstract
This application relates to a composition for preventing, treating, and improving skeletal muscle atrophy, the composition including an organoselenium compound. The composition recovered the thickness of muscle fiber reduced by dexamethasone treatment. In addition, the treatment of mice in a muscle loss model showed that the composition had an effect of reducing damaged muscle and of restoring muscle mass. Therefore, it is expected that the composition can be effectively used for the treatment, prevention, or improvement of muscle atrophy.
Claims
1. A pharmaceutical composition for preventing or treating skeletal muscle atrophy, the composition comprising a compound represented by Formula 1, a stereoisomer thereof, or a pharmaceutically approved salt thereof, as an active ingredient: ##STR00008## In Formula 1, R.sub.1 is selected from the group consisting of hydrogen, halogen, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 hydroxyalkyl, C.sub.1-C.sub.4 cyanoalkyl, C.sub.1-C.sub.4 haloalkyl, hydroxy, cyano, and halogen, R.sub.2 is C.sub.1-C.sub.4 alkyl or a single bond, and R.sub.3 is C.sub.5-C.sub.7 aryl or heteroaryl, wherein at least one hydrogen atom (H) of the aryl or heteroaryl may be substituted with C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 haloalkyl, C.sub.1-C.sub.4 hydroxyalkyl, C.sub.1-C.sub.4 cyanoalkyl, hydroxy, cyano, or halogen.
2. The pharmaceutical composition of claim 1, wherein R.sub.1 is hydrogen or C.sub.1-C.sub.4 alkyl, R.sub.2 is a single bond, and R.sub.3 is C.sub.6 aryl or heteroaryl, wherein at least one hydrogen atom (H) of the aryl or heteroaryl is substitutable with C.sub.1-C.sub.4 alkyl.
3. The pharmaceutical composition of claim 1, wherein R.sub.1 is hydrogen or C.sub.1-C.sub.4 alkyl, R.sub.2 is a single bond, and R.sub.3 is phenyl, wherein at least one hydrogen atom (H) of the phenyl is substitutable with C.sub.1-C.sub.4 alkyl.
4. The phosphorous compound of claim 1, wherein the compound of Formula 1 is represented by Formula 2: ##STR00009## .
5. A food composition for preventing or improving skeletal muscle atrophy, the composition including a compound represented by Formula 1, a stereoisomer, or a salt thereof, as an active ingredient: ##STR00010## In Formula 1, R.sub.1 is selected from the group consisting of hydrogen, halogen, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 hydroxyalkyl, C.sub.1-C.sub.4 cyanoalkyl, C.sub.1-C.sub.4 haloalkyl, hydroxy, cyano, and halogen, R.sub.2 is C.sub.1-C.sub.4 alkyl or a single bond, and R.sub.3 is C.sub.5-C.sub.7 aryl or heteroaryl, wherein at least one hydrogen atom (H) of the aryl or heteroaryl may be substituted with C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 haloalkyl, C.sub.1-C.sub.4 hydroxyalkyl, C.sub.1-C.sub.4 cyanoalkyl, hydroxy, cyano, or halogen.
6. The food composition of claim 5, wherein R.sub.1 is hydrogen or C.sub.1-C.sub.4 alkyl, R.sub.2 is a single bond, and R.sub.3 is C.sub.6 aryl or heteroaryl, wherein at least one hydrogen atom (H) of the aryl or heteroaryl is substitutable with C.sub.1-C.sub.4 alkyl.
7. The food composition of claim 5, wherein R.sub.1 is hydrogen or C.sub.1-C.sub.4 alkyl, R.sub.2 is a single bond, and R.sub.3 is phenyl, wherein at least one hydrogen atom (H) of the phenyl is substitutable with C.sub.1-C.sub.4 alkyl.
8. The food compound of claim 5, wherein the compound of Formula 1 is represented by Formula 2: ##STR00011## .
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0013] The above and other objectives, features, and other advantages of the present disclosure will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which:
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
DETAILED DESCRIPTION
[0080] Representative types of skeletal muscle atrophy include sarcopenia and disease-related muscle wasting. When patients suffer from the disease, a gradual loss in muscle function and muscle mass occurs because the normal muscle regeneration cannot be performed after muscle function reduction. At present, only symptomatic therapy and exercise therapy are available for the disease, and there are no other effective treatments. In particular, although sarcopenia was given an FDA disease code in 2016, there is still no effective drug for the treatment of sarcopenia. Therefore, a discovery for drugs for the treatment of sarcopenia is urgently needed.
[0081] An objective of the present disclosure is to provide a pharmaceutical composition for preventing or treating skeletal muscle atrophy, the composition including a compound represented by Formula 1 as an active ingredient.
##STR00004##
In Formula 1, R.sub.1 is selected from the group consisting of hydrogen, halogen, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 hydroxyalkyl, C.sub.1-C.sub.4 cyanoalkyl, C.sub.1-C.sub.4 haloalkyl, hydroxy, cyano, and halogen, R.sub.2 is C.sub.1-C.sub.4 alkyl or a single bond, and R.sub.3 is C.sub.5-C.sub.7 aryl or heteroaryl, wherein at least one hydrogen atom (H) of the aryl or heteroaryl may be substituted with C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 haloalkyl, C.sub.1-C.sub.4 hydroxyalkyl, C.sub.1-C.sub.4 cyanoalkyl, hydroxy, cyano, or halogen.
[0082] In one embodiment of the present disclosure, R.sub.1 may be hydrogen or C.sub.1-C.sub.4 alkyl, R.sub.2 may be a single bond, and R.sub.3 may be C.sub.6 aryl or heteroaryl {wherein at least one hydrogen atom (H) of the aryl or heteroaryl may be substituted with C.sub.1-C.sub.4 alkyl}.
[0083] In one embodiment of the present disclosure, R.sub.1 may be hydrogen or C.sub.1-C.sub.4 alkyl, R.sub.2 may be a single bond, and R.sub.3 may be phenyl, {wherein at least one hydrogen atom (H) of the phenyl may be substituted with C.sub.1-C.sub.4 alkyl}.
[0084] In one embodiment of the present disclosure the compound of Formula 1 may be a compound represented by Formula 2 shown below.
##STR00005##
[0085] The compound represented by Formula 2 is ebselen, and although it has been approved by the FDA to have antifungal efficacy, the treatment effect on muscle atrophy is not known yet.
[0086] In the present disclosure, L-690,330 is [1-(4-hydroxyphenoxy)-1-phosphonoethyl]phosphonic acid and has a structure as shown in Formula 3 below, and L-690,330 or a salt thereof has an effect of preventing, improving, or treating skeletal muscle atrophy.
##STR00006##
[0087] Throughout the specification, when defining the compound of Formula 1, the concepts defined as follows are used. The following definitions also apply to terms used individually or as part of a larger group throughout this specification, unless specifically indicated otherwise.
[0088] The term “alkyl”, when used alone or in combination with heteroalkyl, means a straight-chain, branched-chain or cyclic hydrocarbon radical, wherein each carbon atom can be substituted with one or more groups selected from among cyano, hydroxy, alkoxy, oxo, halogen, carbonyl , sulfonyl, cyanyl, and the like.
[0089] The term “alkoxy” refers to —O—alkyl, wherein the term “alkyl” is as defined above.
[0090] The term “heteroalkyl” refers to an alkyl containing at least one hetero atom selected from among N, O, and S.
[0091] The term “aryl” refers to an aromatic group, including phenyl, naphthyl, and the like, and may be optionally substituted with one or more alkyl, alkoxy, halogen, hydroxy, carbonyl, sulfonyl, cyanyl, and the like.
[0092] The term “heteroaryl” refers to a 5- to 7-membered aromatic monocyclic ring, 8- to 12-membered bicyclic ring, or 11- to 14-membered tricyclic ring, wherein: the 5- to 7-membered aromatic monocyclic ring contains one or more, for example, 1 to 4, or in some embodiments, 1 to 3, heteroatoms selected from among N, O, and S, and contains carbon atoms as the remaining ring atoms; the 8- to 12-membered bicyclic ring contains one or more, for example 1 to 4, or, in some embodiments, 1 to 3, heteroatoms selected from among N, O, and S and contains carbon atoms as the remaining ring atoms, in which at least one ring is an aromatic ring and at least one heteroatom is present in the aromatic ring; and the 11- to 14-membered tricyclic ring contains one or more, for example 1 to 4, or in some embodiments 1 to 3, heteroatoms selected from among N, O, and S and contains carbon atoms as the remaining ring atoms, in which at least one ring is an aromatic ring and at least one heteroatom is present in the aromatic ring. Examples of the heteroaryl group include pyridyl, pyrazinyl, 2,4-pyrimidinyl, 3,5-pyrimidinyl, 2,4-imidazolyl, isoxazolyl, oxazolyl, thiazolyl, thiadiazolyl, tetrazolyl, thienyl, benzothienyl, furyl, benzofuryl, benzoimidazolyl, indolyl, indolinyl, pyrrolyl, thiophenyl, pyridizinyl, triazolyl, quinolinyl, pyrazolyl, pyrrolopyridinyl , pyrazolopyridinyl, benzoxazolyl, and benzothiazolyl.
[0093] Examples of the heteroaryl group further include zolyl and 5,6,7,8-tetrahydroisoquinoline but are not limited thereto.
[0094] The term “heterocycloalkyl” refers to a saturated or partially saturated or aromatic form that contains 1 to 4 heteroatoms selected from among N, O, S and which may optionally be fused with benzo or cyclo alkyl. Examples of suitable heterocycloalkyl include, but are not limited to, piperidinyl, piperazinyl, tetrahydrofuranyl, pyrrolidinyl, pyranyl, and the like.
[0095] The term “halo(gen)” refers to a substituent selected from among fluoro, chloro, bromo, and iodo.
[0096] In the present disclosure, the expression that R.sub.2 is a single bond means that a nitrogen atom and R.sub.3 are directly joined.
[0097] In addition, terms and abbreviations used herein have their original meanings unless otherwise defined.
[0098] On the other hand, the compounds according to the present disclosure may have asymmetric carbon atoms and may exist as R or S isomers, racemates, diastereomeric mixtures, and individual diastereomers, and all these isomers and mixtures fall within the scope of the present disclosure. That is, when asymmetric carbon atoms are included in the structure of Formula 1, it should be understood that all stereoisomers are included unless the direction is otherwise described.
[0099] In the present disclosure, the term “skeletal muscle atrophy” refers to diseases that cause the loss of skeletal muscle mass and muscle weakness due to extrinsic factors such as metabolic disorders, hormonal imbalance, and aging, unlike spinal muscle atrophy which causes muscle weakness due to functional impairment of motor neurons.
[0100] In the present disclosure, the expression “a thing is pharmaceutically acceptable” means that it is physiologically acceptable, and that it does not normally cause allergic reactions such as gastrointestinal disorders, dizziness, or similar reactions when administered to humans, and that the ordinarily skilled in the art can commonly use it for manufacture of pharmaceutical formulations.
[0101] In the present disclosure, a pharmaceutically acceptable salt refers to a salt prepared from a non-toxic metal salt or organic base.
[0102] As used herein, the term “salt” may be an acid addition salt formed from a pharmaceutically acceptable free acid. The acid addition salts include: salts of inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, nitrous acid, and phosphorous acid, include aliphatic; mono- and di-carboxylates; phenyl-substituted alkanoates; hydroxy alkanoates; alkanedioates; and salts obtained from non-toxic organic acids such as aromatic acids, aliphatic sulfonic acids, and aromatic sulfonic acids. Examples of the pharmaceutically non-toxic salts include sulfate, pyrosulfate, bisulfate, sulfide, bisulfide, nitrate, phosphate, monohydrogen phosphate, dihydrogen phosphate, methaphosphate, pyrophosphate chloride, bromide, iodide, fluoride, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyne-1,4-dionate, hexane-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, terephthalate, benzenesulfonate, toluenesulfonate, chlorobenzene sulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, β-hydroxybutyrate, glycolate, malate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, or mandelate, but are not limited thereto.
[0103] The acid addition salt according to the present disclosure may be prepared by a general method. For example, the acid addition salt may be prepared by dissolving the compound represented by Formula 1 in a large amount of an acidic aqueous solution and precipitating a salt with a water-miscible organic solvent such as methanol, ethanol, acetone, or acetonitrile. Alternatively, the acid addition salt may be prepared by evaporating the solvent or excess acid from the mixture, and then drying the mixture or by suction-filtering the precipitated salt.
[0104] In addition, a pharmaceutically acceptable metal salt may be prepared using a base. An alkaline metal or alkaline earth metal salt may be prepared, for example, by dissolving the compound in an excessive alkaline metal hydroxide or alkaline earth metal hydroxide solution, filtering non-soluble compound salt, and evaporating and drying the filtrate. In this case, as the metal salt, it is pharmaceutically suitable to prepare a sodium, potassium, or calcium salt. In addition, a silver salt may be obtained by reacting the alkaline metal or alkaline earth metal salt with a suitable anionic salt (for example, silver nitrate).
[0105] As used herein, the term “prophylaxis” or “prevention” refers to any action that suppresses the progress of skeletal muscular dystrophy or delays the onset of skeletal muscle atrophy by administration of the pharmaceutical composition according to the present disclosure.
[0106] As used herein, the term “treatment” refers to any action in which the symptoms of skeletal muscle atrophy are improved or beneficially changed by administration of the pharmaceutical composition according to the present disclosure.
[0107] The pharmaceutical composition according to the present disclosure includes the compound represented by Formula 1 as an active ingredient and may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier is a carrier commonly used in formulations, and examples thereof include, but are not limited to, saline, sterile water, Ringer’s solution, buffered saline, cyclodextrin, dextrose solution, maltodextrin solution, glycerol, ethanol, liposome, and the like. If necessary, other conventional additives such as antioxidants and buffers may be added thereto if necessary. In addition, diluents, dispersants, surfactants, binders, lubricants and the like may be additionally added to make the composition of the present disclosure as injectable formulations such as an aqueous solution, suspension, and emulsion, or make the composition of the present disclosure as pills, capsules, granules, or tablets. Regarding suitable pharmaceutically acceptable carriers and formulations, formulations can be preferably made according to each component using the method disclosed in Remington’s literature. The pharmaceutical composition of the present disclosure is not particularly limited in formulations but may be preferably formulated as injections or oral medications.
[0108] The pharmaceutical composition of the present disclosure may be administered orally or administered parenterally (for example, intravenously or subcutaneously) as desired, and the dosage may vary depending on the patient’s condition and weight, the severity of disease, drug form, the route and time of administration, and may be appropriately selected by those skilled in the art.
[0109] The composition according to the present disclosure is administered in a pharmaceutically effective dosage. In the present disclosure, the pharmaceutically effective dosage means an amount that is sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dosage depends on various factors including the type and severity of a disease, drug activity on the disease, patient’s sensitivity to drug, administration time, administration route, excretion rate, treatment period, and co-used drugs and other factors well known in the medical field. The composition according to the present disclosure may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents. When administered in combination, the composition and other therapeutic agents may be administered sequentially or simultaneously. The composition may be administered as a single dose or multiple doses. In consideration of all of the above factors, it is important to administer a dosage that can obtain the maximum efficacy with a minimum amount without side effects, and the dose can be easily determined by those skilled in the art.
[0110] Specifically, the effective amount of the composition according to the present disclosure may vary depending on the age, sex, and weight of the patient and may be increased or decreased depending on the administration route, the severity of the disease, and the sex, weight, age, and the like of the patient.
[0111] The present disclosure provides a food composition for preventing or improving skeletal muscle atrophy, the composition including a compound represented by Formula 1 shown below, a stereoisomer, or a salt thereof, as an active ingredient.
##STR00007##
In Formula 1, R.sub.1 is selected from the group consisting of hydrogen, halogen, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 hydroxyalkyl, C.sub.1-C.sub.4 cyanoalkyl, C.sub.1-C.sub.4 haloalkyl, hydroxy, cyano, and halogen, R.sub.2 is C.sub.1-C.sub.4 alkyl or a single bond, and R.sub.3 is C.sub.5-C.sub.7 aryl or heteroaryl, wherein at least one hydrogen atom (H) of the aryl or heteroaryl may be substituted with C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 haloalkyl, C.sub.1-C.sub.4 hydroxyalkyl, C.sub.1-C.sub.4 cyanoalkyl, hydroxy, cyano, or halogen..
[0112] The description of the compound of Formula 1, the salt, and the like are the same as described above.
[0113] The food composition includes a health functional food composition.
[0114] As used herein, the term “improvement” refers to any action that reduces at least one parameter related to a condition to be treated, for example, the degree of a symptom.
[0115] In the food composition of the present disclosure, the active ingredient may be added to food as it is or may be used together with other food or food ingredients. That is, the active ingredient may be appropriately used according to a conventional method. The mixing ratio of the active ingredient may be appropriately determined depending on the purpose of its use (for prevention or improvement). In general, for the production of food or beverage, the composition of the present disclosure is added in an amount of 15% by weight or less, preferably 10% by weight or less, based on the amount of the raw material. However, in the case of long-term ingestion for health and hygiene or health control, the amount may be less than or equal to the above range.
[0116] The health functional food composition of the present disclosure is not particularly limited in other ingredients except for the active ingredient being included as an essential ingredient in the indicated ratio described above, and may contain various flavoring agents or natural carbohydrates as additional ingredients as in conventional beverages. Examples of the natural carbohydrate include: monosaccharides such as glucose, fructose and the like; disaccharides such as maltose, sucrose, and the like; and polysaccharides such as conventional sugars (for example, dextrin and cyclodextrin) and sugar alcohols such as xylitol, sorbitol, and erythritol. Aside from those ingredients, as flavoring agents, natural flavoring agents (taumatin, stevia extract (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) may be advantageously used. The ratio of the natural carbohydrate may be appropriately determined by those skilled in the art.
[0117] Aside from the ingredients described above, the health functional food composition of the present disclosure may include various nutrients, vitamins, minerals (electrolytes), flavoring agents including synthetic flavoring agents and natural flavoring agents, coloring agents, taste and flavor enhancers (cheese, chocolate, etc.), pectic acid and salts thereof, alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonation agents used in carbonated beverages, and the like. These components may be used solely or in combination. The proportion of these additives may also be appropriately selected by those skilled in the art.
[0118] The present disclosure provides a method for preventing or treating skeletal muscle atrophy, the method including a step of administering to a subject a pharmaceutical composition including a compound represented by Formula 1.
[0119] The term “subject” used in the present disclosure refers to an animal and may be a mammal capable of exhibiting beneficial effects when treated with the composition of the present disclosure. Preferred examples of the subject may include primates such as humans. In addition, examples of the subject may include all subjects exhibiting symptoms of muscle atrophy or at risk of muscle atrophy.
[0120] The present disclosure provides a use of a pharmaceutical composition containing a compound represented by Formula 1 as an active ingredient, the use being to prevent or treat skeletal muscle atrophy.
[0121] The descriptions related to the compound, composition, treatment method, and therapeutic use may be applied in the same manner as long as they do not contradict each other.
[0122] Hereinbelow, examples will be described to aid in understanding the present disclosure. However, the examples described below are provided only to facilitate the understanding of the present disclosure and thus the details in the examples should not be construed to limit the scope of the present disclosure.
Example 1: Raw Material and Test Method
Example 1-1: Reagent
[0123] Dexamethasone and L-690,330 were purchased from Santa Cruz Biotechnology, and ebselen was purchased from Tokyo Chemical Industry Co. Ltd. (in Japan) . MitoTracker Red CMX-Ros was purchased from Invitrogen (in USA), and LiCl was purchased from Sigma-Aldrich. 6-Bromoindirubin-3-oxime (BIO) was provided by Professor Yong-Chul Kim from Gwangju Institute of Science and Technology (in Korea), and myo-inositol was purchased from MP Biomedicals. Puromycin was purchased from Abcam, and glycerol was purchased from Wako Chemicals. Antibodies were purchased against myosin heavy chain 2 (sc-53095, Santa Cruz Biotechnology, USA; dilution=1:1000), forkhead box 0-3 (FoxO3a) (12829S, Cell Signaling Technology, USA; immunoblotting dilution=1:1000, immunocytochemistry dilution=1 :400), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (sc-365062, Santa Cruz Biotechnology; dilution=1:1000), IMPase 1 (ab202131, Abeam; dilution=1:1000), and puromycin (MABE343, Millipore, USA; dilution) =1:25000).
Example 1-2: Cell Cultivation
[0124] C2C12 mouse skeletal muscle progenitor cells (myoblasts) were grown in a growth medium including Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 50 units/mL if penicillin, and 50 mg/mL of streptomycin (PenStrep).
[0125] Then, the myoblasts were treated with a differentiation medium (DMEM supplemented with 2% horse serum and PenStrep) for 72 hours so that the myoblasts were induced to differentiate into myotubes.
Example 1-3: Differentiation of Myoblast and Treatment of Myotube
[0126] C2C12 myoblasts were seeded onto 6-well plates in a growth medium (GM). After reaching confluence, the cultures were treated with DM for 72 hours, and myotube atrophy was induced with DM containing 10 .Math.M dexamethasone for 24 hours in the presence or absence of the drug of interest. Myotubes were visualized using hematoxylin and eosin staining according to a previously published protocol, and imaged with an optical microscope (Olympus CKX41, Japan). A myotube distribution was calculated by dividing the number of myotubes in each group by the total number of myotubes per image.
Example 1-4: MTT Assay
[0127] Cell proliferation was evaluated through MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay as described above. Myoblasts were seeded 3 times into 96-well plates at a density of 2 x 10.sup.3 cells per well. A compound to be tested was added, followed by 48 hours of incubation, the medium was changed to an MTT solution (0.5 mg/mL, final concentration), and the plate was incubated in an incubator at 37° C., 5%, CO.sub.2 conditions. After 60 minutes of incubation, 50 .Math.L of DMSO was added. Optical density in each well was measured at 570 nm using a microplate reader (VersaMax, Molecular Devices, USA). For myotube analysis, myoblasts were differentiated for 96 hours, the medium was supplemented with the compound of interest, 48 hours of incubation was additionally performed, and the cultures were assayed.
Example 1-5: IMPase Activity Assay
[0128] IMPase activity in cells and tissues was measured using a myo-inositol assay kit (Megazyme, Ireland) according to the manufacturer’s instructions. The cell supernatant was sonicated in PBS for 90 seconds with a 30-second on and 15-second off cycle (Vibra-Cell, USA) as described above, and then centrifuged at 13,000 × g for 15 minutes as described above. Thus, the supernatant was prepared.
Example 1-6: SiRNA-Mediated Gene Knockdown
[0129] siRNA-mediated knockdown of gene expression was performed in a 6-well plate format (Thermo Fischer Scientific, Waltham, USA) according to the manufacturer’s protocol. Lipofectamine 3000 formulation (Thermo Fisher Scientific, Waltham, USA) was used in the transfection step.
Example 1-7: Real-Time Quantitative PCR
[0130] The transcription level of the gene was measured using a StepOnePlus Real Time PCR System (manufactured by Applied Biosystems, UK). cDNA was reverse transcribed from total RNA using an AccuPower RT PreMix (manufactured by Bioneer, USA) . Real-time PCR was performed by modifying the manufacturer’s instructions as follows.
[0131] PCR was performed three times using a total of 20 .Math.L of 2X Power SYBR Green PCR Master Mix containing 200 nM of specific primers and 1 .Math.L of cDNA. 10 minutes of incubation was performed at 95° C. prior to PCR amplification. The amplification consisted of 40 cycles of denaturation (for 15 seconds at 95° C.), annealing (for 1 minute at 60° C.), and extension (for 20 seconds at 72° C.). Extension and fluorescence detection were performed at 72° C. after each cycle. After the final cycle, melting point analysis was performed using continuous fluorescence detection on samples at a temperature in a range of 60° C. to 95° C. Specific cDNA samples were included in each run and used as a reference for comparison between runs. Expression levels of GAPDH were used for normalization and expression levels of all other genes were calculated. Details of the primer are shown in Table 1 below.
TABLE-US-00001 Gene Accession number Direction Sequence Mus musculus myogenic factor 5 (Myf5) NM_008656 Forward AGCTGGGCAGAATACGTGCTT (SEQ ID NO: 1) Reverse AGAACAGGCAGAGGAGAATCCA (SEQ ID NO: 2) Mus musculus paired box 7 (Pax7) NM_011039 Forward CCCTTTCAAAGACCAAATGCA (SEQ ID NO: 3) Reverse CCCTCACGGGCAGATCATTA (SEQ ID NO: 4) Mus musculus myogenin (Myog) NM_031189 Forward AGCGCAGGCTCAAGAAAGTG (SEQ ID NO: 5) Reverse CCGCCTCTGTAGCGGAGAT (SEQ ID NO: 6) Mus musculus glyceraldehyde-3-phosphate dehydrogenase (Gapdh) NM_001289726 Forward CTCCACTCACGGCAAATTCA (SEQ ID NO: 7) Reverse GCCTCACCCCATTTGATGTT (SEQ ID NO: 8) Mus musculus myosin, heavy polypeptide 2, skeletal muscle, adult (Myh2) NM_001039545 Forward GATCACCACGAACCCATATGATT (SEQ ID NO: 9) Reverse TTCATGTTCCCATAATGCATCAC (SEQ ID NO: 10) Mus musculus forkhead box 03 (Foxo3) NM_019740 Forward TGGAGTCCATCATCCGTAGTGA (SEQ ID NO: 11) Reverse CTGGTACCCAGCTTTGAGATGAG (SEQ ID NO: 12) Mus musculus inositol (myo)-1 (or 4)-monophosphatase 1 (Impa1) NM_018864 Forward AGCTGTTTCAATTGGCTTCCTT (SEQ ID NO: 13) Reverse GCCGGTGTACATCTTATCTTCCA (SEQ ID NO: 14) Mus musculus inositol (myo)-1 (or 4)-monophosphatase 2 (Impa2) NM_053261 Forward TCCCCACTGTGGCAGTTAGC (SEQ ID NO: 15) Reverse CCCTCCTGCCGGTGTACA (SEQ ID NO: 16)
Example 1-8: MitoTracker Red CMX-Ros Staining of Early Myotubes
[0132] In differentiation cultures, myotubes were visualized by treatment with 50 nM MitoTracker Red CMX-Ros and 1 mM DAPI in a differentiation medium at 37° C. for 30 minutes and imaged using a fluorescence microscope (Leica DMI3000B, Germany) as described above.
Example 1-9: Morphological Analysis of Myotubes
[0133] To evaluate myotube formation and atrophy, five microscopic fields of H&E-stained or MitoTracker Red CMX-Ros-stained cultures were randomly captured, and multinuclear myotube formation and diameters were calculated. Myotubes were designated as multinucleated cells containing three or more nuclei, and the diameters of myotubes were calculated using ImageJ 1.48 software (National Institutes of Health, Bethesda, MD, USA).
Example 1-10: Western Blot
[0134] Protein concentrations in cell lysates were quantified using a Bradford reagent (Bio-Rad, USA, CA). After electrophoresis, the separated proteins were transferred to PVDF membranes, blocked with 5% nonfat dry milk in TBST (0.02% Tween 20 in TBS) and 5% bovine serum albumin in TBST (0.02% Tween 20 in TBS), followed by overnight incubation with a primary antibody at 4° C.
[0135] A secondary antibody was used in a dilution ratio of 1:10000 and incubated for 35 minutes at room temperature. Densitometry analysis of gel bands was performed using ImageJ 1.48 software (National Institutes of Health).
Example 1-11: Immunocytochemistry
[0136] Myoblasts were differentiated into myotubes in 6 well plates. The myotubes were then immunostained for FoxO3a (Cell Signaling Technology, dilution of 1:400). Alexa Fluor 488 goat anti-mouse IgG was used as a secondary antibody (manufactured by Invitrogen). Nuclei were stained using DAPI solution (1 .Math.M dissolved in third distilled water). Staining was visualized by fluorescence microscopy (Leica DMI3000 B).
Example 1-12: In Vitro SUnSET Assay of Protein Synthesis
[0137] Surface sensing translation (SUnSET) assay was performed as described above. Briefly, 1 ug/mL puromycin was added to the culture and the harvest was lysed after 10 minutes. For immunoblotting, the myotube extract was treated with anti-puromycin 12D10 antibody (MABE343; Millipore).
Example 1-13: Animal Testing
[0138] The study was conducted according to the Guideline for Laboratory Animal Research for the Care and Use of Laboratory Animals and was approved by the Gwangju Science and Technology Animal Care and Use Committee (Study Approval No. GIST-2019-042). Mice were supplied by Damool Science, Korea.
Example 1-14: Skeletal Muscle Atrophy Dexamethasone Model
[0139] 13-week-old male C57BL/6J mice were treated with drugs as follows: [0140] 1) Injection of vehicle (4% hydroxypropyl-β-cyclodextrin) alone; [0141] 2) 15 mg/kg of dexamethasone dissolved in vehicle; [0142] 3) 15 mg/kg of dexamethasone and 1 mg/kg of ebselen; and [0143] 4) Injection of 15 mg/kg dexamethasone and 3 mg/kg ebselen (n = 5 per group).
[0144] The muscle condition was evaluated after intraperitoneal injection daily for 14 days with the same drug as above.
Example 1-15: Skeletal Muscle Degenerative Glycerol Model
[0145] The glycerol infusion protocol was used to induce muscle degeneration. Male C57BL/6J mice were anesthetized with PBS containing ketamine (22 mg/kg; Yuhan, Republic of Korea) and xylazine (10 mg/kg; Bayer, Republic of Korea), 100 .Math.L glycerol (50% vol/vol) was injected into unilateral gastrocnemius muscle and splenic muscle.
[0146] The mice were treated with vehicle (0.5% methyl cellulose) or with vehicle + ebselen (30 mg/kg) via oral gavage every 24 hours (n = 6 per group) . A muscle fatigue test was performed after 5 days.
Example 1-16: Muscle Fatigue Test
[0147] Muscle fatigue was measured using a known protocol (Chiu, et al.). In summary, mice were trained prior to initiating the fatigue task using an accelerated Rotarod (Ugo Basile, Italy). Mice were trained with a Rotarod at a constant speed of 13 rpm for 15 minutes. After 15-minute recovery, mice were placed on a Rotarod adapted to accelerate to 13 to 25 rpm within 3 minutes, for 15 minutes. After 24 hours, the muscle fatigue test was performed with a ramping rate of 13 to 25 rpm within 3 minutes and held at 25 rpm for 30 minutes. For each mouse, a delay time falling from the Rotarod was measured. Mice being tiered were classified as falling 4 times within 1 minute and the test was stopped.
Example 1-17: Grip Strength Test
[0148] A grip strength of each mouse was recorded using a BIO-GS3 (Bioseb, USA). To measure the grip strength, mice were placed on a metal grid to grip the metal grid with four paws and were gently pulled back until the mice were unable to continue holding the grid. Muscle strength was expressed using the maximum value obtained from three trials at 1-minute intervals.
Example 1-18: Evaluation of Muscle Endurance Through Limb Suspension Test
[0149] Mice were placed in the center of a grid, and it was made sure that the grid was gripped by the limbs of the mice. Next, the grid was turned over and hung at a height of 50 cm above a baseline, and the hanging time was measured up to 10 minutes.
Example 1-19: Muscle Sampling and Histological Analysis
[0150] Before sacrificing the mice, the mice were anesthetized by intraperitoneal injection of PBS containing ketamine (22 mg/kg; Yuhan Corporation, Korea) and xylazine (10 mg/kg; Bayer, Korea). After sacrificing the mice, the gastrocnemius and splenic muscles of the glycerol injury model were dissected and weighed. For histological analysis, the muscles were incubated overnight with 4% paraformaldehyde at 4° C., fixed, and embedded in paraffin. 5-.Math.m muscle sections were obtained and was stained with H&E using a kit according to the manufacturer’s instructions (Merck & Co., USA). Damaged areas and cross-sectional areas were measured using ImageJ 1.48 software (National Institutes of Health).
[0151] In the case of the dexamethasone-induced atrophy model, the quadriceps, gastrocnemius and splenic muscles were dissected and weighed. The quadriceps were stained with H&E according to the same protocol used for the glycerol test and used for histological analysis.
Example 1-20: Human Skeletal Myoblast Culture and Experiment
[0152] Human skeletal myoblasts were purchased from Thermo-Fisher Scientific. Myoblasts were thawed in a water bath, washed with 20 mL DM, and centrifuged at 180 g for 5 minutes at room temperature. Next, myoblasts were resuspended in DM and seeded in a 12-well plate at a density of 4.8 x 10.sup.4 cells/well. After 72 hours, the myoblasts were treated with a compound for 24 hours. The myotube diameter was measured by optical microscopy analysis of DIC captured images (Olympus CKX41) .
Example 1-21: Statistics
[0153] Student’s t-test was used to determine the statistical significance of the results of
Example 2: Confirmation of Myotube Atrophy Effect by Myo-Inositol
[0154] MTT assay was performed to evaluate the effect of myo-inositol on muscle cell viability. Differentiated C2C12 murine myotube cultures were observed while increasing the concentration of Myo-inositol for 48 hours. It was observed that myo-inositol concentrations below 250 mM did not significantly affect cell viability. However, at a concentration of 500 mM, significant cytotoxicity was observed (see
[0155] To evaluate the effect of myo-inositol on myotube atrophy, differentiated C2C12 cultures were treated with dexamethasone as described above (
[0156] Increased skeletal muscle atrophy was associated with increased expression of E3 ubiquitin ligase, atrogin-1 (F-box only protein 32/MAFbx) and MuRF-1 (TRIM63). It is regulated by the fork head box 03 (FoxO3a) which is a master transcription factor and is upregulated when muscular atrophy occurs. It was confirmed that dexamethasone treatment increased the expression of atrogin-1, MuRF-1 and FoxO3a in myotubes, and myo-inositol treatment further increased the effect of dexamethasone treatment on the expression of atrogin-1, MuRF-1 and FoxO3a (see
Example 3: Confirmation of Effect of Myo-Inositol on Myogenesis Progression and Myotube Morphology
[0157] Myo-inositol is produced by IMPase which is an enzyme and is expressed in two isoforms, IMPase-1 and IMPase-2. IMPase-1 and -2 were observed to be down-regulated during myoblast differentiation (see
[0158] The effect of an excessive myo-inositol concentration was evaluated by inducing C2C12 myoblasts to enter myogenesis in DM supplemented with myo-inositol. As a result, it was confirmed that myo-inositol reduced the number of immature myotubes (see
[0159] Myogenesis is associated with down-regulation of Pax7 which is a transcription factor and MyF5 which is a myogenic factor 5 and up-regulation of myogenin (MyoG/myogenic factor 4), a motor protein, and myosin heavy chain II (Myh2). Myo-inositol increased the expression of Pax7 and Myf5 and reduced the expression of MyoG and Myh2 in myoblasts cultured in a differentiation medium (see
[0160] The effect of myo-inositol on myotube morphology was investigated with H&E-stained C2C12 differentiated cultures (see
Example 4: Confirmation of Effect of IMPase-1 Gene Knockdown on Myotube Atrophy
[0161] Measurement of IMPase activity in myotubes undergoing atrophy showed that the activity was significantly increased after dexamethasone treatment (see
[0162] The role of IMPase in muscle atrophy was investigated through gene knockdown of IMPase-1. Western blot and qPCR assay showed that IMPase-1 siRNA treatment reduced IMPase-1 expression in C2C12 myoblasts (see
[0163] The gene knockdown of IMPase-1, which is attributable to siRNA treatment, was confirmed through the qPCR assay (see
Example 5: Confirmation of Effect of IMPase Inhibitor on Myogenesis and Myotube
[0164] To determine the effect of IMPase-targeting compounds on myogenesis, ebselen, L-690,330 and LiCl were used. First, the viability of myoblasts and myotubes was evaluated to determine appropriate treatment concentrations.
[0165] When treated with ebselen, cytotoxicity was not observed in myoblasts under a condition in which the concentration of ebselen was 10 .Math.M or lower, cytotoxicity was not observed in myotubes under a condition in which the concentration of ebselen was 50 .Math.M or lower (see
[0166] In myoblast differentiation, ebselen and LiCl treatments enhanced myotube formation and increased overall myotube diameters (see
[0167] Since LiCl is also widely used as a glycogen synthase kinase-3β (GSK-3β) inhibitor, to determine whether the enhancement of myotube formation by LiCl was due to GSK-3β inhibition, LiCl was compared with BIO, which is a GSK-3β inhibitor. As a result, it was observed that the BIO treatment had the opposite effect to the LiCl treatment and inhibited myotube formation ( see
[0168] Ebselen is a drug having a well-known pharmacological profile, being safe for use in humans, and being less toxic than LiCl. Accordingly, IMPase activity analysis was performed, and the result confirmed that ebselen was effective in inhibiting IMPase activity in myotubes treated with dexamethasone (see
[0169] To further confirm that the cause of the compound-induced IMPase inhibition was the anti-atrophic effect, myotubes were treated with dexamethasone alone or were co-treated with LiCl or L-690,330. As a result, the overall average diameter was increased and larger diameter myotubes were observed in cultures treated with LiCl or L-690,330 (see
Example 6: Confirmation of Effect of Ebselen on Down-Regulation of FoxO3a and on Increase of Total Protein Synthesis
[0170] Considering the up-regulation of FoxO3a by myo-inositol (see
[0171] In addition, it was confirmed through immunocytochemistry analysis that FoxO3a up-regulation caused by dexamethasone was inhibited by ebselen (see
[0172] Protein synthesis in myotubes treated with myo-inoistol, dexamethasone, and IMPase inhibitors was measured through the SUnSET assay. As a result, ebselen, which is an IMPase inhibitor, increased protein synthesis in dexamethasone-treated myotubes (see
[0173] Treatment with myo-inositol alone or co-treatment with dexamethasone decreased protein synthesis, and it was confirmed that ebselen was effective in increasing protein synthesis when myotubes were treated alone or in the presence of dexamethasone (see
Example 7: Confirmation of Inhibitory Effect of Ebselen on Skeletal Muscle Atrophy - in Vivo
[0174] The inhibitory effect of ebselen on IMPase activity was confirmed in a dexamethasone-treated mouse model. Co-treatment with dexamethasone and ebselen caused significant weight loss compared to untreated mice (see
[0175] Mice treated with dexamethasone showed a significant decrease in quadriceps mass, and it was confirmed that the reduced quadriceps mass was recovered by ebselen treatment (see
[0176] In addition, skeletal muscle performance was assessed using the inverted hanging and grip strength tests. The results of the tests showed that ebselen treatment significantly enhanced hanging time and grip strength compared to dexamethasone-treated mice (see
[0177] In addition, according to histological analysis of the quadriceps, ebselen increased the muscle fiber cross-sectional area and the ratio of larger fibers (see
[0178] The expression of Atrogin-1 and Murf-1 in the quadriceps was confirmed through qPCR assay. It was confirmed that the expression of Atrogin-1 and Murf-1 increased by dexamethasone treatment was effectively reduced by ebselen treatment (see
Example 8: Confirmation of Inhibitory Effect of Ebselen on Glycerol-Induced Skeletal Muscle Degeneration - in Vivo
[0179] The therapeutic effect of ebselen on muscle dystrophy was additionally investigated in a glycerol injury model. This model produces adipocyte deposition and fibrous tissue accumulation which are observed in the case of sarcopenia and are the major causes of muscle weakness. Since ebselen has been approved as an oral drug for humans, mice with glycerol-induced muscle degeneration were orally treated with ebselen.
[0180] As a result of treatment with glycerol in the presence or absence of ebselen, there was no significant difference in mouse body weight (see
[0181] Interestingly, glycerol injection into the splenic muscle significantly reduced the mass of the non-injected contralateral splenic muscle (
[0182] The accumulation of myo-inositol occurred in gastrocnemius muscle damaged by glycerol, and it was confirmed that the concentration of myo-inositol decreased by ebselen treatment (
[0183] On the other hand, the result of histological evaluation of the dissected abdominal muscles indicated that the ebselen treatment reduced a damaged area (
[0184] The gastrocnemius muscle damaged by glycerol injection increased the expression of Atrogin-1 and Murf-1, and it was confirmed through qPCR assay that the expression of Atrogin-1 and Murf-1 was effectively reduced by ebselen treatment (
Example 9: Confirmation of Effect of Ebselen on Atrophy in Human Myotube
[0185] To evaluate whether ebselen has potential as an anti-muscle-wasting compound in human skeletal myotubes, differentiating human primary myoblasts were treated with dexamethasone in the presence and absence of ebselen. As a result, it was confirmed that treatment with dexamethasone reduced both the myotube diameter and the proportion of large diameter myotubes but cotreatment with ebselen inhibited the effect of dexamethasone (