MEANS FOR MODULATING GENE EXPRESSION

20190314398 ยท 2019-10-17

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention provides vectors for delivering to a cell, or expressing in a cell, a therapeutic RNA that is capable of reducing expression of a target gene. Compositions comprising the vectors and comprising the therapeutic RNAs are also provided, as are methods for their use.

    Claims

    1. A vector for delivering to a cell, or expressing in a cell, a therapeutic RNA, wherein the therapeutic RNA is capable of reducing expression of a target gene, wherein the therapeutic RNA comprises one or more nucleotide sequences that correspond with an antisense long non-coding RNA (AS-lncRNA), wherein the AS-lncRNA comprises a MIR domain in inverse orientation and wherein the AS-lncRNA is encoded by a genomic DNA sequence that is antisense to the target gene, and wherein the therapeutic RNA comprises a sequence that corresponds with the MIR domain.

    2. The vector according to claim 1, wherein the genomic sequence encoding the AS-lncRNA comprises an exon at the 5 end of the AS-lncRNA that overlaps with the target gene and wherein the therapeutic RNA comprises a nucleotide sequence that corresponds with the exon at the 5 end of the AS-lncRNA.

    3. The vector according to claim 2, wherein the exon at the 5 end of the AS-lncRNA overlaps at least partially with the 5 UTR of the target gene.

    4. The vector according to claim 2 or claim 3, wherein the exon at the 5 end of the AS-lncRNA overlaps at least partially with an intron of the target gene.

    5. The vector according to any preceding claim, wherein the sequence of the therapeutic RNA that corresponds with the MIR domain comprises a nucleotide sequence having at least 70% identity to a portion of the MIR domain of any one of SEQ ID NOs: 1-8 that is able to drive repression of target gene expression, wherein sequence identity is determined across the full length of the portion.

    6. The vector according to any preceding claim, wherein the sequence of the therapeutic RNA that corresponds with the MIR domain comprises a CACCCAC and/or a CTGAGGC motif.

    7. The vector according to any preceding claim, wherein the target gene encodes tau protein.

    8. A vector for delivering to a cell, or expressing in a cell, a therapeutic RNA, wherein the therapeutic RNA is capable of enhancing expression of a target gene, wherein the therapeutic RNA comprises one or more nucleotide sequences that correspond with an antisense long non-coding RNA (AS-lncRNA), wherein the AS-lncRNA comprises a MIR domain in direct orientation and wherein the AS-lncRNA is encoded by a genomic DNA sequence that is antisense to the target gene, and wherein the therapeutic RNA comprises a sequence that corresponds with the MIR domain.

    9. The vector according to claim 8, wherein the genomic sequence encoding the AS-lncRNA comprises an exon at the 5 end of the AS-lncRNA that overlaps with the target gene and wherein the therapeutic RNA comprises a nucleotide sequence that corresponds with the exon at the 5 end of the AS-lncRNA.

    10. The vector according to claim 9, wherein the exon at the 5 end of the AS-lncRNA overlaps at least partially with the 5 UTR of the target gene.

    11. The vector according to claim 10, wherein the exon at the 5 end of the AS-lncRNA overlaps at least partially with an intron of the target gene.

    12. The vector according to any one of claims 8-11, wherein the sequence of the therapeutic RNA that corresponds with the MIR domain comprises a nucleotide sequence having at least 70% identity to a portion of the MIR domain of SEQ ID NO: 9 or 10 that is able to drive enhancement of expression of the target gene, wherein sequence identity is determined across the full length of the portion.

    13. The vector according to any preceding claim, wherein the sequence of the therapeutic RNA that corresponds with the MIR domain comprises a CACCCAC and/or a CUGAGGC motif.

    14. The vector according to any preceding claim, wherein the target gene is selected from the group consisting of the target genes listed in Table 1.

    15. The vector according to any preceding claim, wherein the vector comprises a cDNA which encodes the therapeutic RNA.

    16. The vector according to claim 15, wherein the vector is a plasmid vector.

    17. The vector according to claim 15, wherein the vector is an AAV vector.

    18. The vector according to any one of claims 1-14, wherein the vector comprises the therapeutic RNA.

    19. The vector according claim 18, wherein the vector is a nanoparticle, a dendrimer, a polyplex, a liposome, a micelle or a lipoplex.

    20. The vector according claim 16, wherein the plasmid vector is associated with a nanoparticle, a dendrimer, a polyplex, a liposome, a micelle or a lipoplex.

    21. The vector according to any preceding claim for use in a method of treating the human or animal body by therapy.

    22. The vector according to any preceding claim for use in a method of treating a neurodegenerative condition in a subject, the method comprising the administration of the vector to the subject.

    23. The vector for the use according to claim 22, wherein the neurodegenerative condition is a tauopathy.

    24. The vector for the use according to claim 23, wherein the tauopathy is Alzheimer's disease.

    25. The vector for the use according to claim 22 or claim 23, wherein the neurodegenerative condition is Parkinson's disease.

    26. A therapeutic RNA, wherein the therapeutic RNA is capable of reducing expression of a target gene, wherein the therapeutic RNA comprises one or more nucleotide sequences that correspond with an antisense long non-coding RNA (AS-lncRNA), wherein the AS-lncRNA comprises a MIR domain in inverse orientation and wherein the AS-lncRNA is encoded by a genomic DNA sequence that is antisense to the target gene, and wherein the therapeutic RNA comprises a sequence that corresponds with the MIR domain.

    27. The therapeutic RNA according to claim 26, wherein the target gene encodes tau protein.

    28. A therapeutic RNA, wherein the therapeutic RNA is capable of enhancing expression of a target gene, wherein the therapeutic RNA comprises one or more nucleotide sequences that correspond with an antisense long non-coding RNA (AS-lncRNA), wherein the AS-lncRNA comprises a MIR domain in direct orientation and wherein the AS-lncRNA is encoded by a genomic DNA sequence that is antisense to the target gene, and wherein the therapeutic RNA comprises a sequence that corresponds with the MIR domain.

    29. The therapeutic RNA according to any one of claims 26-28, wherein the genomic sequence encoding the AS-lncRNA comprises an exon at the 5 end of the AS-lncRNA that overlaps with the target gene and wherein the therapeutic RNA comprises a nucleotide sequence that corresponds with the exon at the 5 end of the AS-lncRNA.

    30. The therapeutic RNA according to claim 29, wherein the exon at the 5 end of the AS-lncRNA overlaps at least partially with the 5 UTR of the target gene.

    31. The therapeutic RNA according to claim 29 or claim 30, wherein the exon at the 5 end of the AS-lncRNA overlaps at least partially with an intron of the target gene.

    32. The therapeutic RNA according to any one of claims 26-31, wherein the therapeutic RNA comprises a nucleotide sequence having at least 70% identity to a portion of the MIR domain of any one of SEQ ID NOs: 1-10 that is able to drive modulation of expression of the target gene, wherein sequence identity is determined across the full length of the portion.

    33. The therapeutic RNA according to any one of claims 26-32, wherein the sequence of the therapeutic RNA that corresponds with the MIR domain comprises a CACCCAC and/or a CUGAGGC motif.

    34. The therapeutic RNA according to any one of claims 26-33 for use in a method of treating the human or animal body by therapy.

    35. The therapeutic RNA according to any one of claims 26-33 for use in a method of treating a neurodegenerative condition in a subject, the method comprising the administration of the vector to the subject.

    36. The therapeutic RNA for the use according to claim 35, wherein the neurodegenerative condition is a tauopathy.

    37. The therapeutic RNA for the use according to claim 36, wherein the tauopathy is Alzheimer's disease.

    38. The therapeutic RNA for the use according to claim 35 or claim 36, wherein the neurodegenerative condition is Parkinson's disease.

    39. A method of producing a genetically engineered organism, the method comprising introducing the MAPT-AS1 gene into one or more cells of an organism to produce the genetically engineered organism.

    40. A genetically engineered organism that has one or more additional copies of the MAPT-AS1 gene, compared with an equivalent organism that is not genetically engineered to have one or more additional copies of the MAPT-AS1 gene.

    41. The genetically engineered organism according to claim 28, wherein the equivalent organism that is not genetically engineered to have additional copies of the MAPT-AS1 gene does not have an endogenous copy of the MAPT-AS1 gene.

    42. A method of producing a lncRNA that is capable of modulating the expression of a protein-coding gene, the method comprising; (a) identifying a population of genes that encode a lncRNA, wherein each member of the population comprises a sequence that overlaps a 5 untranslated region (UTR), an intron, a coding sequence (CDS), and/or a 3 UTR of a protein-coding gene, and wherein each member of the population is in antisense orientation with respect to the respective protein-coding gene, (b) identifying members of the population of genes that encode a lncRNA identified in step (a) that further comprise a MIR domain, (c) selecting a gene from the population identified in (b), and (d) causing or allowing a transcript of the selected gene to be expressed, which transcript is the produced lncRNA.

    43. The method of claim 42, wherein said modulation is suppression of expression of the respective protein-coding gene that overlaps the gene that encodes the lncRNA if the MIR domain of the lncRNA is in inverse orientation, or wherein said modulation is enhancement of expression of the respective protein-coding gene that overlaps the gene that encodes the lncRNA if the MIR domain of the lncRNA is in direct orientation.

    44. The method of claim 42 or claim 43, further comprising the step of isolating the produced lncRNA.

    45. A method of selecting a target gene, the method comprising the method of steps (a) and (b) of claim 42, and then (c) selecting the target gene from a population of protein coding genes that comprises a 5 untranslated region (UTR), an intron, a coding sequence (CDS), and/or a 3 UTR that overlaps with a member of the population of genes that encode a lncRNA and comprise a MIR domain, identified in step (b) of claim 42.

    46. The method of claim 45, wherein expression of the target gene is identified as being susceptible to being suppressed by a therapeutic RNA if the MIR domain of the overlapping lncRNA gene is in inverse orientation, or wherein the expression of the target gene is identified as being susceptible to being enhanced by a therapeutic RNA if the MIR domain of the overlapping lncRNA gene is in direct orientation.

    47. The method of claim 45 or claim 46, wherein any one or more of steps (a)-(c) are be performed in silico.

    48. The method of any one of claims 45-47, further comprising the step of providing a therapeutic RNA molecule comprising one or more sequences that correspond with one or more sequences of the overlapping lncRNA.

    49. The method of claim 48, wherein the method further comprises a step of modulating the expression of the target gene by contacting a cell that comprises the target gene with the therapeutic RNA.

    Description

    BRIEF DESCRIPTION OF THE FIGURES

    [0087] FIG. 1MAPT-AS1 is a brain-enriched antisense lncRNA expressed during neuronal differentiation

    [0088] a, human MAPT-AS1 and MAPT genomic region (hg19).

    [0089] MAPT constitutive exons are in black; alternatively spliced exons are in grey; 3 and 5 UTRs are in white; antisense MAPT exons are in white; repetitive elements are in red (MIR), which are seen as the small rectangles within the exons at the left-hand side of FIG. 1a. Introns are represented as lines.

    [0090] b, Sashimi plot of RNA-Seq peaks from human brain (log.sub.10RPKM); numbers over connecting lines represent counts associated to each splice junction.

    [0091] c, Quantitative expression of MAPT and MAPT-AS1 in twenty human tissues by qRT-PCR (2.sup.Ct/2.sup.Ct.sub.max) d, Quantitative expression of MAPT and MAPT-AS1 in human iPSC differentiated into cortical neurons (from 0 to 80 days in culture) measured by qRT-PCR (Ct/Ct.sub.max).

    [0092] e, MAPT-AS1 (green) and MAPT (grey) transcripts are expressed in the nucleus stained by DAPI (blue) and cytoplasm of SH-SY5Y neuroblastoma cells. Scale bars represent 10 m.

    [0093] FIG. 2MAPT-AS1 controls MAPT translation through an embedded inverted MIR element

    [0094] a, Quantitative expression of human MAPT-AS1 and MAPT transcripts as measured by qRT-PCR (2.sup.Ct) in SH-SY5Y cells after cellular fractionation.

    [0095] b, Full-length MAPT-AS1-transfected SH-SY5Y cells (t-NAT1-FL) show decreased levels of endogenous tau protein (green) normalized to -actin (red). Cells transfected with MAPT-AS1 deleted of the 5exon (t-NAT1-5) do not show any significant change of endogenous tau levels, whereas deletion of the 3-exon (t-NAT1-3) is associated with a significant increase in endogenous tau level. Data in a and b indicate means.d., n3.

    [0096] c, Quantitative expression of human MAPT-AS1 and MAPT transcripts as measured by qRT-PCR (2.sup.Ct) in independent clones stably expressing each type of construct (empty vector, t-NAT1 full-length, t-NAT21 full-length).

    [0097] d, siRNAs targeting three different exons of MAPT-AS1, as shown in the scheme, cause an increase of endogenous tau protein in SH-SY5Y cells (means.d., n3)

    [0098] e, f, Full-length (FL) t-NAT1 and t-NAT21 are required for regulating endogenous tau (cells stably expressing t-NAT1, left panel and cells stably expressing t-NAT21, right panel). e, f, Inverted MIR is sufficient to control endogenous tau protein levels in stably expressing SH-SY5Y cells. Scheme of mutants is shown in 5 to 3 orientation: 5, deletion of 5exon; 3, deletion of 3-exons; non, nonoverlapping region; over, 5UTR overlapping region; flip, overlapping region flipped; M1, partial deletion of MIR; M2 and AM, full deletion of MIR. Units for numbers along the left of gels in b, d, e and f indicate kDa.

    [0099] FIG. 3MAPT-AS1 selectively represses tau protein synthesis preventing IRES-mediated translation

    [0100] a, Schematic representation of constructs used; full-length MAPT 5-UTR (322 nt) was cloned between Renilla luciferase (Rluc) and Firefly luciferase (Fluc) ORFs into the previously characterized pRF bicistronic vector, resulting into the pRTF construct. Deletion of the 93 nt spanning MAPT-AS1-overlapping region resulted into pRTF; the same t-NAT1-overlapping region was cloned separately to give rise to pRTFover construct. A mutated 5-TOP motif (CCTCCCCT to AATAAAAT) at positions 243 to 232, relative to the +1 AUG starting codon, resulted into pRTFmTOP construct. A plasmid containing the hepatitis C virus IRES (pRhcvF) was used as a positive control.

    [0101] b, SH-SY5Y cells stably expressing either an empty vector, t-NAT1 or t-NAT21, were transfected with constructs depicted in (a) and cap-independent translation (Fluc to Rluc ratio) was measured for each reporter. Cells expressing empty vector pcDNA3.1 transfected with pRTF showed a 15-fold increase of the Fluc/Rluc ratio over the negative control pRF vector, and a 3.7-fold increase over pRhcvF, providing a basal level of tau IRES activity. In cells expressing either full-length t-NAT1 or t-NAT21, tau IRES activity showed to be significantly reduced (** p<0.01, * p<0.05, one way ANOVA, Dunnett's test n=3). Cells transfected with pRTF or pRTFmTOP showed a reduction in tau IRES activity, but no further decrease with t-NAT expression. In cells transfected with pRTFover, tau IRES activity was similar to the pRF control vector, indicating that the first 229 nt of the 5-UTR are necessary for tau IRES function.

    [0102] c, Secondary structure of the MAPT 5-UTR (from 242 to 1 relative to the AUG) as reported by Veo and Krushel.sup.22. Domains I and II of tau IRES are indicated and a blue line indicates t-NAT1 overlapping sequence (5-exon position 88-163), as previously shown in FIG. 2e. 5-TOP motif is reported (green).

    [0103] d, pRTF or pRF construct with either pcDNA3.1 empty vector, t-NAT1 full-length (FL) or a mutant deleted of the inverted MIR repeat (t-NAT1-M) were co-transfected into SH-SY5Y cells, and relative luciferase levels were measured after 48 hours. A significant reduction of tau IRES activity (Fluc/Rluc ratio) was detected in cells expressing t-NAT1-FL, but not t-NAT1-M, which resulted in a significant increase in tau IRES-mediated cap-independent translation.

    [0104] e, Similarly t-NAT21-FL showed to repress tau IRES activity, whereas t-NAT21-AM, devoid of the inverted MIR repeat, showed to have no such effect. Data in d and e represent means.d., n3 (** p<0.01, *p<0.05, one-way ANOVA and Dunnett's test)

    [0105] f, 13 polysomal fractions, separated on sucrose gradient, were obtained from two independent clones for each cell stably expressing the indicated constructs, and were repeated in two independent experiments. Total RNA was extracted and equal volumes were converted into cDNA, and subjected to qRT-PCR and the percentage of MAPT mRNA in each fraction was calculated (see methods). Bar plot represents relative abundance of MAPT mRNA in pools of fractions corresponding to 40-60S, 80S monosomes, light polysomes, medium weight polysomes and heavy polysomes respectively. Both full-length t-NAT1 and t-NAT21 expressing cells exhibited a significant decrease in the percentage of MAPT mRNA associated to actively translating heavy polysomes. Deletion of the inverted MIR repeat is sufficient to shift tau mRNA into active heavy polysomes, resulting in a net increase in MAPT translation (n=4 for each construct; ** p<0.01, *p<0.05; one-way ANOVA, Dunnett's test). From left to right, the bars represent Empty, t-NAT1-FL, t-NAT1-M, t-NAT2-FL and t-NAT2-M.

    [0106] g, Relative abundance of MAPT-AS1 lncRNA, MAPT and -actin mRNAs in each polysomal fraction. Absorbance profiles (OD at 254 nm) are represented in the background of each plot.

    [0107] FIG. 4MIR-lncRNAs form S-AS pairs within a network of interacting protein-coding genes, enriched for neurodegenerative-associated loci

    [0108] a, MIR repeats of all subfamilies (MIR, MIR3, MIRb, MIRc) constitute a larger fraction of the lncRNAs length than different regions of protein-coding mRNAs (5-UTR, 3-UTR, CDS).

    [0109] b, 1496 lncRNAs annotated in GENCODE v19 contain at least one embedded MIR repeat and form S-AS pairs with 1045 unique protein-coding (PC) genes. Of these S-AS pairs, 40.69% overlap 5-UTR, 32.50% overlap CDS and 26.81% overlap 3-UTR.

    [0110] c, Enriched Gene Ontology (GO)-terms for cellular components and associated diseases as calculated by Enrichr.sup.27, are shown for each group of S-AS pairs sorted by the type of exonic overlap (3-UTR-overlapping, red; 5-UTR-overlapping, green; CDS-overlapping, blue). PC genes overlapping in 5-UTR with MIR-lncRNAs are significantly enriched for loci associated to dementia, Parkinson's disease and Amyothrophic lateral sclerosis (** p<0.01, * p<0.05, Benjamini-Hochberg FDR).

    [0111] d, schematic representation of the human PLCG1 gene overlapping along its first 5-exon with a MIR-lncRNA (PLCG1-AS) on the opposite strand.

    [0112] e, Western blot of SH-SY5Y cells stably expressing either an empty vector (Empty), a full-length PLCG1-AS (FL) or its mutant deleted of the MIR repeat (M). PLCG1 protein level is reduced in cells expressing FL-but not M-PLCG1-AS.

    [0113] f, MIR-lncRNA antisense target genes form an extensive network of interacting proteins (PPI interactions were computed by NetworkAnalyst as a zero-degree interaction network starting from the InnateDB PPI dataset, with 392 seed proteins). Many proteins in this network are encoded by genes associated with neurodegenerative diseases (p=1.6310.sup.8, Benjamini-Hochberg FDR, WebGestalt).

    [0114] g, PC genes overlapping with MIR-lncRNAs along their 5-UTR are more expressed in human brain as detected by RNA-seq FPKM) when compared to PC genes overlapping in 3-UTR or CDS (** p<0.01, *** p<0.0001, one way ANOVA across all brain regions).

    [0115] FIG. 5Linkage disequilibrium analysis of MAPT-AS1 region

    [0116] a, SNPs within MAPT-AS1 genomic region (+/5 kb) that are linked (R.sup.20.5) to tagging SNPs from the NHGRI GWAS catalog are reported. The specific trait associated to each tagging SNP together with the P-value from the GWAS study are reported as from cited PubMed publications (references). All P-values 510.sup.8 were considered to be significant. Linkage correlations (R.sup.2) were calculated using LDlink1.1 (PMID 26139635) for different populations. ASW: Americans of African Ancestry in SW USA; CEU: Utah Residents (CEPH) with Northern and Western European Ancestry; CHB: Han Chinese in Beijing, China; CHD: Chinese in Metropolitan Denver, Colo.; GIH: Gujarati Indians in Houston, Tex.; JPT: Japanese in Tokyo, Japan; LWK: Luhya in Webuye, Kenya; MXL: Mexican ancestry in Los Angeles, Calif.; MKK: Maasai in Kinyawa, Kenya; TSI: Toscani in Italia; YRI: Yoruba in Ibadan, Nigeria b, For each linked SNP listed in (a), the minor allele frequency (MAF) from the 1000 Genomes Project is reported, together with the exonic/intronic location. c, Pairwise linkage disequilibrium heatmap created using the LDmatrix webserver. Red squares of increasing hue indicate increasing linkage between SNPs. A physical map of the genomic region is reported together with annotated RefSeq transcripts for each gene. d, Enlarged view of the MAPT-AS1 3-exon (in grey) containing the inverted MIRc element (in green), with two exonic linked SNPs downstream (r517690326, r517763596).

    [0117] FIG. 6Evolutionary conservation of t-NAT1 isoform and MAPT-AS1 promoter region across Primates

    [0118] a, Scheme of the human t-NAT1 transcript isoform composed of two exons (grey), with the MAPT overlapping region (blue) and the inverted MIR element in 3-end (red). b, Multiple sequence alignment of the human t-NAT1 transcript to the genomic sequence of 10 nonhuman Primates (Baboon, Bonobo, Chimp, Gibbon, Gorilla, Marmoset, Mouse Lemur, Orangutan, Rhesus, Squirrel Monkey). Sequences were aligned using MUSCLE 3.8, and graphically displayed using Jalview 2. Pyrimidines are in cyan and purines in magenta; the splice junction is highlighted in yellow. A consensus sequence is reported at the base of the multi-alignment with a bar plot representing percentage of sequence identity c, Phylogenetic tree associated to t-NAT1 multi-alignment represented in (b), obtained with the neighbor joining method using Jalview 2. Numbers reported on each connecting line in the tree represent Jaccard distances based on pairwise sequence similarity. d, t-NAT1 has a low protein-coding potential as shown by the negative PhyloCSF score. The plot represents the distribution of scores for each codon in each frame within t-NAT1 isoform, across 29 mammals. e, Multi-alignment showing sequence similarity between human t-NAT1 3-end (388-449) and consensus MIR elements of different subfamilies (MIR3, MIR, MIRb, MIRc) shown as inverted-complement sequences, thus denoted (-), as annotated by RepeatMasker. The homology region of 62 nt map to the CORE-SINE, a 65 nt evolutionary conserved domain at the center of each MIR repeat element, as schematically represented here and originally described by Labuda et al. f, Evolutionary conservation of MAPT-AS1 promoter region across 6 evolutionary distant species (Homo sapiens, Rhesus macaque, Mus musculus, Rattus norvegicus, Canis familiaris, Bos Taurus) was computed using the ECR browser. Exonic regions are in yellow, intronic regions are in orange and repeat elements are in green. Peaks represent identity percentage to the human sequence. On the bottom, CAGE tag clusters from FANTOM4 and FANTOM5 datasets retrieved from the ZENBU genome browser, are mapped to the MAPT-AS1 promoter region, either on the sense (blue) or antisense strand (red). Values on the y-axis represent CAGE counts normalized per million tags (tpm).

    [0119] FIG. 7Evolutionary conservation of t-NAT21 isoform across Primates

    [0120] a, Scheme of the human t-NAT21 transcript isoform composed of four exons (grey) with the inverted MIR element in 3-end (red). b, Multiple sequence alignment of the human t-NAT21 transcript to the genomic sequence of 9 nonhuman Primates (Baboon, Bonobo, Chimp, Gibbon, Gorilla, Marmoset, Orangutan, Rhesus, Squirrel Monkey). Sequences were aligned using MUSCLE 3.8, and graphically displayed using Jalview 2. Pyrimidines are in cyan and purines in magenta; splice junctions are highlighted in yellow. A consensus sequence is reported at the base of the multi-alignment with a barplot representing percentage of sequence identity c, Phylogenetic tree associated to t-NAT21 multi-alignment represented in (b), obtained with the neighbor joining method using Jalview 2. Numbers reported on each connecting line in the tree represent Jaccard distances based on pairwise sequence similarity. d, t-NAT21 has a low protein-coding potential as shown by the negative PhyloCSF score. The plot represents the distribution of scores for each codon in each frame within t-NAT21 isoform, across 29 mammals. e, Multi-alignment showing sequence conservation between human t-NAT21 3-end (510-554) and consensus MIR elements of different subfamilies (MIR3, MIR, MIRb, MIRc), shown as inverted-complement sequences, thus denoted (-) as retrieved through RepeatMasker. The homology region of 45 nt (red dashed line) is shared with the CORE-SINE, a 65 nt evolutionary conserved domain at the center of each MIR repeat element, as schematically represented here and originally described by Labuda et al.

    [0121] FIG. 8RNA-seq read distribution across MAPT and MAPT-AS1 genes in different brain regions

    [0122] a, RNA-seq read counts for the MAPT mRNA and MAPT-AS1 lncRNA transcripts (t-NAT2s, t-NAT1, t-NAT21) across 12 different regions of four independent human brains. Values represent mean counts+/s.d. Brain regions are as follows: CBRL, Cerebellum; FCTX, frontal cortex; HIPP, hippocampus; HYPO, hypothalamus; MEDU, medulla; OCTX, occipital cortex; PUTM, putamen; SNIG, substantia nigra; SPCO, spinal cord; TCTX temporal cortex; THAL, thalamus; WHMT white matter.

    [0123] FIG. 9Characterization of human induced pluripotent stem cells-derived cortical neurons

    [0124] a, Control iPSCs were differentiated into cortical neurons using a protocol of dual SMAD inhibition followed by a period of in vitro corticogenesis that generates both deep- and upper-layer cortical excitatory neurons. Neural precursor rosettes at day 20 were positive for primary cortical progenitor markers PAX6 and OTX2, the proliferation marker ki67 and neuronal III-tubulin (TUJ1). At this stage, early born neurons started appearing at the periphery of rosettes expressing deep-layer marker TBR1. By day 100, mature neurons had adopted a neuronal morphology, as highlighted by neuronal III-tubulin staining, and later-born neurons positive for upper-layer markers SATB2 and BRN2 had developed. Scale bars represent 20 m. b, Quantitative expression of MAPT and MAPT-AS1 (t-NAT1, t-NAT2s, t-NAT21) in 3 independent inductions of human iPSC differentiated into cortical neurons (from 0 to 100 days in culture) measured by qRT-PCR (Ct/Ctmax).

    [0125] FIG. 10Expression and nucleo-cytoplasmic localization of endogenous MAPT mRNA are not altered in cells stably expressing MAPT-AS1

    [0126] a, Normalized MAPT and MAPT-AS1 RNA levels as detected by qRT-PCR from SH-SY5Y cells stably expressing different deletion mutants of MAPT-AS1: t-NAT1 flipped overlapping region (Flip), t-NAT1 non-overlapping region (Non), t-NAT1 overlapping region (Over), tNAT1 deleted of the 5-exon (t-NAT15), tNAT1 deleted of the 3-exon (t-NAT13), tNAT21 deleted of the 5-exon (t-NAT25), tNAT21 deleted of the 3-exon (t-NAT23). Values are normalized to cells stably expressing an empty vector (Empty). Data represent 3 independent biological replicates, with two technical replicas (n=6, means.d.). b, Both full-length (FL) and mutants deleted of the inverted MIR element (M) of MAPT-AS1 isoforms (t-NAT1 and t-NAT2) localise to both cytosol and nucleus without altering the nucleo-cytoplasmic distribution of MAPT mRNA as detected by qRT-PCR. (n3, means.d.). c, Silencing MAPT-AS1 does not alter significantly MAPT mRNA level in SH-SY5Y cells transiently transfected with isoform-specific siRNAs (si-NAT1, si-NAT2) or an siRNA common to all isoforms (si-Ex4) targeting a shared exon in 3-end. Data represent relative gene expression detected by qRT-PCR and normalized to the control siRNA-treated cells (n=3, means.d.).

    [0127] FIG. 11Expression level of MAPT protein in cells stably expressing MAPT-AS1 with a flipped MIR element

    [0128] a-c, Western blots probed with anti-MAPT and anti--actin antibodies. Total protein lysates (20 g) from independent clones of SH-SY5Y cells stably expressing different isoforms of MAPT-AS1, either full-length (t-NAT1-FL, t-NAT2-FL), deleted of the inverted MIR element (t-NAT1-M, t-NAT2-M) or containing a flipped MIR repeat (t-NAT1-Mflip). Samples in a, b, c represent independent biological replicates. d, Total tau protein normalized to -actin levels, as quantified using ImageJ, is reported for each type of construct being expressed (* p<0.05, ** p<0.01, *** p<0.001; one-way ANOVA, Dunnett's test; n=6). Similarly to the deletion of the entire MIR repeat (t-NAT1-M), flipping direction of the MIR repeat within t-NAT1 lncRNA (t-NAT1-Mflip, indicated by the red lines) results in an increased tau protein level.

    [0129] FIG. 12MAPT-AS1 have no significant effect on MAPT 3-UTR

    [0130] a, Schematic representation of the luciferase constructs (pMIR-reporter) used to study MAPT-AS1 effects on MAPT 3-UTR following transfection in SH-SY5Y cells. Either the full-length (FL) or 3 partially overlapping fragments (Fr1, Fr2, Fr3) of MAPT 3-UTR were cloned downstream of the Firefly luciferase ORF. b, Firefly luciferase (Fluc) normalized to Renilla luciferase (Rluc) was quantified in SH-SY5Y cells co-transfected with either an empty pcDNA3.1 vector or different versions of t-NAT1 antisense-lncRNA, (n=6, 2 experiments). c, Fluc to Rluc ratio was quantified in SH-SY5Y cells co-transfected with either an empty pcDNA3.1 vector or different versions of t-NAT21 antisense-lncRNA. (n=6, 2 experiments). In all cases differences were not statistically significant.

    [0131] FIG. 13Brain RNA-seq co-expression analysis

    [0132] a, Co-expression heatmaps representing distribution of RNA-seq read counts for the top 100 most abundant MIR-lncRNA target protein-coding genes (on the left side) and the top 100 most abundant MIR-lncRNA genes (on the right side), both hierarchically clustered based on their expression level in 12 different regions of 4 independent post-mortem brains from healthy human donors. Genes are clustered on the y-axis. Brain regions, reported on the x-axis, are as follows: CBRL, Cerebellum; FCTX, frontal cortex; HIPP, hippocampus; HYPO, hypothalamus; MEDU, medulla; OCTX, occipital cortex; PUTM, putamen; SNIG, substantia nigra; SPCO, spinal cord; TCTX temporal cortex; THAL, thalamus; WHMT white matter. For each brain region, 4 independent brain samples are represented in each column. A color key with histogram relative to each heatmap, have z-values associated to each color on the x-axis and RNA-seq counts on the y-axis. The histogram represents distribution of the RNA-seq counts for each z-value. b, Similar co-expression heatmaps, as in (a), representing 1045 MIR-lncRNA target protein-coding genes (on the left side) and 1197 antisense MIR-lncRNA genes (on the right side). c, Pie chart showing the percentage of MIR-lncRNA S-AS pairs annotated in GENCODE v19 and overlapping in 5-UTR, sorted by their Pearson's correlation coefficient. The majority of S-AS pairs show a positive correlation. d, Histogram representing frequency of occurrence for 1197 MIR-lncRNA S-AS pairs in bins of Pearson's correlation (from 1 to +1 in bins of 0.05). All MIR-lncRNA S-AS are visualized together, irrespective of their pattern of overlapping. MAPT-AS1-MAPT correlation coefficient is indicated.

    [0133] FIG. 14Genes paired with antisense MIR-lncRNAs have significantly more structured 5- and 3-UTRs 3-UTR (a) or 5-UTR (b) minimum free energy (MFE), normalized by its length was computed using RNAfold 2.1.9 for each protein-coding gene in the human genome (hg19), and sorted based on their respective type of lncRNA overlap. Boxplot presents median, upper and lower quartile boundaries for each group of protein-coding (PC) genes. PC genes pairing with MIR-lncRNAs have both 3-UTR and 5-UTR significantly more structured that PC genes with no lncRNA overlap (***, p<0.0001 one-way ANOVA, Dunnett's test). PC genes groups are as follows: PC genes overlapping antisense MIR-lncRNA, PC-MIRlncRNA; PC genes overlapping any lncRNA without embedded MIR repeat, PC-lncRNA-NOMIR; all PC genes with any overlapping lncRNA, PC-lncRNA; MIR-lncRNAs, MIRlncRNA; PC genes without lncRNA overlap, PC-NO-lncRNA.

    [0134] FIG. 15Majority of genes targeted by antisense MIR-lncRNAs interact in a PPI network and are enriched for neurodegenerative disease-associated proteins

    [0135] a, Protein-protein interaction (PPI)-network obtained mapping literature-curated interactions data from the InnateDB database, using 392 seed proteins participating in S-AS pairs with MIR-lncRNAs. Genes encoding for proteins associated to neurodegenerative diseases, represented as red-filled circles, are significantly enriched into the network (p=1.6310.sup.8, Benjamini-Hochberg FDR using WebGestalt). Only primary interactions are represented in a zero-degree interaction network generated using the NetworkAnalyst tool. Self-interactions are not considered. b-e, Schematic structures of representative genes pairing with antisense MIR-lncRNAs and involved in different neurodegenerative diseases. GENCODE annotated isoforms of the human SNCA (b), APP (c), MBNL1 (d) and SLC12 (e) genes together with their respective overlapping antisense MIR-lncRNA. MIR elements (red) positions within each lncRNA are indicated.

    [0136] FIG. 16Majority of genes targeted by antisense MIR-lncRNAs interact in a PPI network and are enriched for immune system-associated genes

    [0137] a, Protein-protein interaction (PPI)-network obtained mapping literature-curated interactions data from the InnateDB database, using 392 seed proteins participating in S-AS pairs with MIR-lncRNAs. Genes encoding for proteins associated to either immune system (green) or innate immune system (purple), are significantly enriched into the network (respectively p=0.0041, p=0.0328, Benjamini-Hochberg FDR using NetworkAnalyst). Only primary interactions are represented in a zero-degree interaction network generated using the NetworkAnalyst tool. Self-interactions are not considered. b, Gene expression heatmap for 487 protein-coding genes overlapping along 5-UTR with antisense MIR-lncRNAs in 126 normal human tissues, from 557 publicly available microarray datasets, retrieved from the Enrichment Profiler Database (http://xavierlab2.mgh.harvard.edu/EnrichmentProfiler/index.html) Genes are clustered on the y-axis and tissues are clustered on the x-axis. The scale bar on the bottom indicates colors associated to each Z-score in the expression heatmap.

    [0138] FIG. 17Distribution of 7-mer MIR-complementary motifs along the human 18S rRNA secondary structure

    [0139] The human 18S ribosomal RNA secondary structure as retrieved from (http://apollo.chemistry.gatech.edu/RibosomeGallery/) is divided into an active region (red) and an inactive region (grey). As described in Weingarten-Gabbay S. et al. 2016.sup.(25), the active region is enriched for motifs able to mediate 40S ribosome recruitment through direct RNA-RNA interactions with 5-UTRs of about 10% of human genes. Here the 18S rRNA secondary structure is superimposed to 7-mers of complementary motifs (black dots) contained within each MIR element embedded in MIR-lncRNAs overlapping in 5-UTR with PC genes. Only 7-mers complementary to the 18S active region are shown. The 7-mer motifs represented here map to both the MIR elements within antisense MIR-lncRNAs and the 5-UTRs of the respective target genes, as reported in detail in Table 1.

    [0140] FIG. 18Model for inverted MIR-mediated repression of internal initiation

    [0141] a, Contour line representing the human 18S rRNA secondary structure with the active region (red) and the inactive region (black), and two 7-mer motifs complementary to positions 53-59 and 102-108 within MAPT IRES, mapping respectively to stem 21es6d and at the basis of helix 33. b, In absence of MAPT-AS1 lncRNA, MAPT IRES is active and able to actively recruit the ribosome, potentially through a direct RNA-RNA interaction mediated by two 7-mer motifs complementary to a bulge region within domain 1 (red, 53-59 nt) and to a single strand loop connecting domain 1 to domain 2 (blue, 102-108 nt). Furthermore nucleotides 59-65 and 19-25 (black dots) are complementary to each other and their spatial proximity through a kissing-hairpin interaction, has been reported to be crucial for tau IRES activity. This may lead the tau IRES to assume a complex tertiary conformation and bringing rRNA-complementary regions in close vicinity, it might favor interaction of the 40S ribosome with the AUG starting codon. c, In the presence of MAPT-AS1, MAPT IRES is repressed, and this requires the presence of both a 5-region complementary to the domain 2 (blue line) and the MIR element in 3-end (purple thick line) of MAPT-AS1. The inverted MIR element embedded within MAPT-AS1 contains at least two conserved 7-mers, one (CACCCAC, blue) complementary to the same rRNA site at the basis of helix 33 (grey lines), and the other (CTGAGGC, red) identical to the 18S rRNA motif in stem 21esd6, which can mediate IRES repression due to a direct competition for pairing with the rRNA. The same strategy may explain a more widespread mode of action of embedded MIR elements within other antisense MIR-lncRNAs onto their target genes. Conversely the presence of a MAPT-AS1 deleted of the MIR element, leaves the 5-region the only domain of the lncRNA able to pair with domain 2 of tau IRES (b, blue line), potentially stabilizing it in a more open conformation, favoring its interaction with rRNA.

    [0142] FIG. 19Expression of tNAT1, tNAT2 and IT1 in brain and in human neuroblastoma cell lines

    [0143] a, The overlap of tNAT1, tNAT2 and IT1 with the MAPT promoter, particularly with the core promoter, is shown. Genomic region represented shows the MAPT 5 promoter domain from core promoter at exon 0 (red arrow box, lower line, centre-left) to first coding exon 1 (blue box, labelled MAPT exon 1) and conserved downstream repressor domain (green oval, lower line, besides exon 1) containing rs242557. IMP5 gene is upstream to MAPT promoter. Non-coding RNA genes are shown above bold line. Relative distances (in kilobases are indicated, top. b, c, Reduction of tau levels with transient expression of MAPT-associated lncNRAs. Arrows indicate reduced tau protein levels. Deletion variants of t-NAT1 (NT1D5 and NT1D3) do not reduce tau levels.

    [0144] FIG. 20Reduction of tau protein levels with stable t-NAT expression

    [0145] The effects of three independent clones overexpressing tNAT1 (NT1-1, NT1-2 and NT1-3) whereby tau protein levels are almost completely eliminated compared to empty vector clones (V5) and clones expressing variants of tNAT1 with deletions or rearrangements of the 5 exon of the tNAT1 that overlaps with the MAPT promoter or the distal 3 region of tNAT1.

    [0146] a, Reduction of tau protein levels with stable t-NAT2. Arrows indicate reduced tau protein levels in independent clones expressing wild-type t-NAT1 compared to empty vector (V5) and deletion variants.

    [0147] b, Reduction of tau protein levels with stable t-NAT1 and t-NAT2. Arrows indicate reduced tau protein levels in independent clones expressing wild-type t-NAT1 compared to empty vector (V5) and deletion variants. Variants with deletion of regions overlapping the MAPT promoter lose tau expression suppression activity, showing the importance of this overlap.

    [0148] FIG. 21Model of translational repression of MAPT mRNA by t-NAT1: a, schematic representation of the MAPT mRNA with its 5-UTR secondary structure, as experimentally determined by Veo and Krushel, 2012. In the absence of MAPT-AS1, the MAPT IRES can recruit efficiently the 40S ribosomal subunits (green ovals), potentially by direct pairing with the 18S rRNA at two 7-mer complementary sites (red, 53-59 nt; blue, 102-108 nt; thick lines). Furthermore, nucleotides 59-65 and 19-25 (black dots) are complementary to each other and their spatial proximity through a kissing-hairpin interaction, has been reported to be crucial for tau IRES activity (Veo and Krushel [22]).

    [0149] b, In the presence of MAPT-AS1 (t-NAT1), MAPT IRES is repressed, and this requires the presence of both a 5-region complementary to the domain 2 (blue line) and the MIR element in 3-end (purple thick line) of MAPT-AS1. The inverted MIR element embedded within MAPT-AS1 contains at least two conserved 7-mers, one (CACCCAC, motif 1) complementary to the same rRNA site at the basis of helix 34, and the other (CTGAGGC, motif 2) identical to the 18S rRNA motif in stem 21esd6, which can mediate IRES repression due to a direct competition for pairing with the rRNA.

    [0150] FIG. 22Functional features of t-NAT1: The t-NAT1 transcript (449 bp) contains two essential sequences, the 5 region of antisense overlap with MAPT 5UTR (AS; blue box, towards the left-hand side of the lower-left panel) and the MIR domain (red boxes at the right-hand side of the lower-left panel). The conserved MIR domain contains three 7-mer motifs (black boxes, Motif 1, Motif 2 and Motif 3, numbered in small black boxes both in the top panel and within the red boxes in the lower left panel) that mediate MAPT mRNA ribosomal interaction and translation. Western blots for tau protein (lower right panels) in cell lines overexpressing MAPT or -actin (control) sequences confirm that, full-length t-NAT1 represses tau protein levels whereas deletion of Motif 1 and Motif 2 (but not of Motif 3), reduces this repression. Sequence of conserved MIR domain with the three motifs are shown at top of figure. The bottom bar depicts the MiniNAT that contains only the region of overlap (AS) and the MIR. Western blot (left) of stably overexpressed MiniNAT shows significantly reduced tau protein. MAPT knockdown is most pronounced in the bottom two bars and in the first bar below the empty vector control.

    DETAILED DESCRIPTION

    [0151] The following applications of the present invention are provided by way of example and not limitation.

    MAPT-AS1

    [0152] The present inventors have characterised MAPT-AS1, as a 5 antisense long non-coding RNA (lncRNA) gene with head-to-head orientation overlapping with MAPT 5-UTR. MAPT-AS1 extends for 52 kilobases upstream from MAPT (FIG. 1a) and resides within the extended region of linkage disequilibrium (LD) that defines the H1 and H2 haplotypes.sup.14 (Extended Data, FIG. 1a, 1b).

    [0153] The inventors found an inverted MIR element within MAPT-AS1, which is required for its repressive activity, and they found that deletion or inversion of the MIR element converts MAPT-AS1 into an enhancer of tau translation. Complementarity between MAPT-AS1 and the internal ribosome entry site (IRES), within the 5-untranslated region (5-UTR) of MAPT mRNA was also found to lead to correlate with translationally repressive activity.

    MAPT-AS1 Transcripts (NATs)

    [0154] The inventors identified three alternative splicing isoforms, referred to as tau-Natural Antisense Transcripts t-NAT1, t-NAT2s, t-NAT21. These tau-Natural Antisense Transcripts are associated with two alternative transcription start sites (TSS), with t-NAT2s and t-NAT21 each being associated with a TSS located in intron 1 of MAPT, with t-NAT1 being associated with a TSS that overlaps the 5-untranslated region (5-UTR), of MAPT (FIG. 1a).

    TABLE-US-00008 MAPT-AS1transcriptsequences t-NAT1[449bases] [SEQIDNO:11] 1020304050 [00001]embedded image 60708090100 [00002]embedded image 110120130140150 CGACAGAGGCGAGGACGGGAGAGGACAGCGGAGGAGGAGAAGGUGGCUGU 160170180190200 GGUGGCGGCGGCAGAAGGAGUCAGAACAAGGACGGGCCUGUGAUGUGUCU 210220230240250 GUCUAUGACGAGGAGGACAAUGUCCUAAGGAAUGGAGAGGAAGAAAGUGA 260270280290300 AGGGAACCAGGUCCCUGGAUUCCAUGUGGAACAGUAGCCCAGGAUGUGCA 310320330340350 CUAUGGACUGUUACAAGAGAGAGACAUGAUCUUCCUUAAGGCAUUGAUUU 360370380390400 [00003]embedded image 410420430440 [00004]embedded image [00005]embedded image [0155] tau-NAT1 exon 1: 1-167 [0156] tau-NAT1 exon 4: 168-449

    TABLE-US-00009 t-NAT2L[544bases] [SEQIDNO:12] 1020304050 [00006]embedded image 60708090100 CAGCACAGGGGCCCUGGAAUGUGGACUGUCUCAGUGGAUUCUUGUUUAUA 110120130140150 GGAAUUAGAGGAAGGUGGAAGAAGCUCAUUCCAGAGUGCAAUCAAUAACA 160170180190200 GUGGAAAGAAGUCCCUGGAGCCCAGUGCAGUGGCUUGAACUGAGAAUGCA 210220230240250 CUCACUGGCUGUUGCAGCCAAGACUCCAGUUCUCGCCUCUCUUUCCCUGA 260270280290300 CUCCCCUGUGCCCACCUUUCCCCUGCAGGAGUCAGAACAAGGACGGGCCU 310320330340350 GUGAUGUGUCUGUCUAUGACGAGGAGGACAAUGUCCUAAGGAAUGGAGAG 360370380390400 GAAGAAAGUGAAGGGAACCAGGUCCCUGGAUUCCAUGUGGAACAGUAGCC 410420430440450 CAGGAUGUGCACUAUGGACUGUUACAAGAGAGAGACAUGAUCUUCCUUAA 460470480490500 [00007]embedded image 510520530540 [00008]embedded image [00009]embedded image [0157] tau-NAT2L exon 1: 1-34 [0158] tau-NAT2L exon 2: 35-134 [0159] tau-NAT2L exon 3: 135-278 [0160] tau-NAT2L exon 4: 279-544

    TABLE-US-00010 t-Nat2S[924bases] [SEQIDNO:13] 1020304050 [00010]embedded image 60708090100 [00011]embedded image 110120130140150 [00012]embedded image 160170180190200 UCUGUCUAUGACGAGGAGGACAAUGUCCUAAGGAAUGGAGAGGAAGAAAG 210220230240250 UGAAGGGAACCAGGUCCCUGGAUUCCAUGUGGAACAGUAGCCCAGGAUGU 260270280290300 GCACUAUGGACUGUUACAAGAGAGAGACAUGAUCUUCCUUAAGGCAUUGA 310320330340350 [00013]embedded image 360370380390400 [00014]embedded image 410420430440450 [00015]embedded image 460470480490500 CAAAUGUUUUCAUGCUGGAUUCUGAGCCACUCUCCUGGCUGCAACUCUGA 510520530540550 GGCCGGGCAGACUUUCCGCUGGAAAGAGAACUCAAAUACUGGUGAGAGGU 560570580590600 GGAUUUGAAGCCAGGAGCCCCAGGUUUUGGCUCUGCAGGUUUGCACCCAG 610620630640650 CUCUGUGGUGUAUGCCCUCACAGGUCACCCAGGACCUCCUGUCCAGGCUU 660670680690700 CUUCAGGCCACCCAUGAUGGAGUAGAUUUGAGGAAUGAGGUUUUCAAAGC 710720730740750 AGUUAGUGUGCGGGAGAGUAACCCUGGGGCCUCCGGAACCAGAAGGGAGG 760770780790800 GAUUUGGGGGCUGGAGCUUGGCAGUCCAGGUUCCAUUGUCCUCAUGUUCU 810820830840850 CCCCACUGGCCUGGCCUGUCACUCCAGUCUCUGCAUAGGUUGUCACAUGG 860870880890900 CAUUCUCCCUGUGUGUCUCUGUGUCUCUUCUCUUCUUUAUAAAGACAUAG 910920 UUAUAAUGGAUUAGGGCCCACCCU [00016]embedded image [0161] tau-NAT2s exon 1: 1-120 [0162] tau-NAT2s exon 4: 121-924

    [0163] A schematic showing the position of the exons of t-NAT1, t-NAT2s and t-NAT21 in relation to MAPT is shown in FIG. 19a.

    [0164] The portion of the DNA encoding the 5 exon of t-NAT1 that overlaps with MAPT intron 1:

    TABLE-US-00011 [SEQ ID NO: 15] GCCCCAGTCT GCGGAGAGGG AGGGCGAGGG GCGGCGGCGC AGGGGTGCAC AGAGGCGGAC GGCGAGGCAG ATTTCGGAGC CGCGGCGCTT AC

    [0165] The portion of the DNA encoding the 5 exon of t-NAT1 that overlaps with MAPT non-coding exon (1) (MAPT 5-UTR):

    TABLE-US-00012 [SEQ ID NO: 14] CTGATAGTCG ACAGAGGCGA GGACGGGAGA GGACAGCGGA GGAGGAGAAG GTGGCTGTGG TGGCGGCGGC AGAAG

    [0166] The portion of the DNA encoding 5 exon of t-NAT21 that overlaps with MAPT intron (1)

    TABLE-US-00013 [SEQ ID NO: 16] GCGGCCGCCG AGTCCGTCCA CATCGCCAGG CCAG

    [0167] The portion of the DNA encoding 5 exon of t-NAT2s that overlaps with MAPT intron (1)

    TABLE-US-00014 [SEQ ID NO: 17] AGAAAGAAAT CCGCCCCGAG ATGCACCTGC AGCCCCGCGC CCATCCGTGC GTGGCTGCGG CTGTGCGTGC CCGCGAACGG GGACCAGCGG CCGCCGAGTC CGTCCACATC GCCAGGCCAG

    Other MIR-lncRNAs

    [0168] The inventors also found that AS-lncRNAs (besides MAPT-AS1) containing the MIR element (MIR-lncRNAs) often have reciprocal expression in central nervous system and immune cells, and often overlap with genes implicated in neurodegenerative disorders and encoding interacting proteins. To demonstrate that the embedded MIR repeats within AS-lncRNAs (besides MAPT-AS1) can repress translation of other proteins (besides tau), the inventors experimentally validated an MIR-lncRNA overlapping with the first 5-exon of the human gene encoding for phospholipase c gamma 1 (PLCG1) (FIG. 4d). Cells expressing the antisense MIR-lncRNA (PLCG1-AS FL) showed robust reduction of PLCG1 protein (FIG. 4e).

    Genomic Location of MIR-lncRNAs

    [0169] As described herein, the therapeutic RNAs of the invention comprise one or more sequences that correspond with a MIR-lncRNA. The MIR-lncRNA gene is antisense to a target gene (e.g., a protein-coding target gene). Hence, the MIR-lncRNA gene can be denoted AS-MIR-lncRNA or MIR-AS-lncRNA. Designation as AS-lncRNA comprising a MIR domain, or similar, can also be used.

    [0170] The AS-MIR-lncRNA either overlaps with the target gene or the AS-MIR-lncRNA is positioned in the genomic region immediately adjacent to the target gene. Where the AS-MIR-lncRNA overlaps with the target gene, the AS-MIR-lncRNA may comprise an exon at the 5 end of the AS-MIR-lncRNA gene that overlaps with an untranslated region of the target gene, or an intron of the target gene or a coding sequence of the target gene.

    [0171] An overlapping sequence in the context of an AS sequence is complementary to whatever sequence that it overlaps with. The term overlap refers to any degree of overlap. For readability, the words at least partial overlap or similar may also be used, without any change in the meaning of overlap being implied where this term is used without a qualifier.

    [0172] In some embodiments the AS-MIR-lncRNA overlaps with an untranslated region of the target gene. In some embodiments the AS-MIR-lncRNA overlaps with an intron of the target gene. In some embodiments the AS-MIR-lncRNA overlaps with a coding sequence of the target gene. In any of these three embodiments, it may be the 5 exon of the AS-MIR-lncRNA that overlaps with the recited part of the target gene.

    [0173] Where the AS-MIR-lncRNA is positioned in the genomic region immediately adjacent to the target gene, the distance between the transcriptional start site (TSS) of the AS-MIR-lncRNA and the TSS of the target gene may be less than 1000 kb, less than 800 kb, less than 500 kb, less than 300 kb, less than 200 kb, less than 100 kb, less than 80 kb, less than 50 kb, less than 30 kb, less than 20 kb, less than 10 kb, less than 8 kb, less than 5 kb, less than 3 kb, less than 2 kb or less than 1 kb.

    [0174] The location of MAPT-AS1 relative to MAPT is shown in FIG. 1A. MAPT-AS1 overlaps with MAPT. The t-NAT1 transcript has a 5 exon that overlaps with the 5 UTR of MAPT and with the first intron of MAPT. The t-NAT21 and t-NAT2s transcript each have a 5 exon that overlaps with the first intron of MAPT.

    Use of the Therapeutic RNA of the Invention

    [0175] The therapeutic RNA of the invention can be used in methods of treatment of the human or animal body by therapy. Methods of treatment by administration of a vector of the invention, or administration of the therapeutic RNA of the invention are hereby disclosed. The method of treatment may include administration of the therapeutic RNA of the invention to a subject. The subject may be a mammalian subject. The subject may be a human. The subject may be suffering from a disease, e.g. a neurodegenerative disease. The subject may be suffering from a tauopathy such as Alzheimer's disease (A.D.).

    [0176] The therapeutic RNA of the invention may be administered to a subject, e.g. by intravenous administration, intracranial administration, by injection into the CSF, by transdermal administration or by oral administration. The skilled person will appreciate that the vectors that deliver or express the therapeutic RNA of the invention can similarly be administered by these or other routes (e.g. intramuscular administration or by administering a sub-dermal dose).

    [0177] The therapeutic RNA of the invention may be administered as a pharmaceutical preparation (e.g. as a tablet). The pharmaceutical preparation will typically include one or more pharmaceutically acceptable excipients.

    [0178] The therapeutic RNA of the invention may be administered in combination with one or more other therapies. For example, where the therapeutic RNA of the invention is used in the treatment of tauopathies, the therapeutic RNA may be administered together with one or more other therapeutic agents that reduce tau aggregation.

    [0179] Where the therapeutic RNA of the invention is used in the treatment of Alzheimer's disease, it may be used in combination with cognitive, behavioral or psychosocial therapies and/or in conjunction with one or more agents used to alleviate the symptoms of Alzheimer's disease.

    [0180] The therapeutic RNA of the invention may be used prophylactically to modulate the gene expression levels of subjects at risk of developing a condition. For example, the therapeutic RNA of the invention may be administered prophylactically to patients at risk of contracting one or more neurodegenerative diseases for example a tauopathy such as Alzheimer's disease.

    [0181] The therapeutic RNA of the invention finds uses in any application in which the expression of a target gene is to be modulated. For example, the therapeutic RNA of the invention may be used clinically, or in industrial or academic research.

    Introduction of MAPT-AS1 into Genetically Engineered Organisms

    [0182] Recent advances in genetic engineering techniques, e.g. those made available by CRISPR/Cas9 technology, allow the MAPT-AS1 gene to be inserted into model organisms that do not have an endogenous copy. The skilled person understands that genetically engineered cells comprising additional copies of the MAPT-AS1 gene can be readily produced. The skilled person also understands that non-human animal models can be readily produced, in which the genetically engineered non-human animal has extra copies of the MAPT-AS1 gene. Such genetically engineered cells and non-human animals form a part of this invention.

    [0183] Similarly, the skilled person will understand that the methods of the invention can be used to specifically express particular transcripts of the MAPT-AS1 gene in genetically engineered cells and genetically engineered non-human animals. For instance, CRISPR/Cas9 technology or integrating viral vectors (e.g. lentiviral vectors) can be used to introduce cDNA that expresses any one of t-NAT1, t-NAT2S or t-NAT2L into the genome of a cell.

    [0184] The skilled person will appreciate that the genetically engineered cell can be used to produce genetically engineered non-human animals that express any one of t-NAT1, t-NAT2S or t-NAT2L.

    [0185] Such genetically engineered cells and non-human animals allow the study of tau biology and enable further characterisation of the therapeutic effects of MAPT-AS1 overexpression.

    [0186] Section Headings

    [0187] The section headings used throughout this disclosure are for the sole purpose of aiding readability and are not to be construed as limiting in any way.

    Definitions

    Therapeutic RNA

    [0188] The therapeutic RNA of the invention may be chemically-produced or may be expressed (transcribed) from another nucleic acid. Where the therapeutic RNA of the invention is expressed from another nucleic acid, this may occur in a producer cell or it may occur within the target cell. Where the therapeutic RNA of the invention is produced outside the target cell (i.e. where it is chemically-produced or where it is expressed by a producer cell), the therapeutic RNA of the invention may be chemically-modified following its extraction/purification and prior to its use in the methods of the invention. For instance, the therapeutic RNA of the invention may be labeled and/or chemically-modified to enhance half-life and/or pharmacokinetic properties. In some embodiments, the therapeutic RNA of the invention is chemically-produced using modified nucleotides.

    [0189] The skilled reader will appreciate that the word therapeutic does not limit the use of the therapeutic RNA of the invention. The therapeutic RNAs of the invention find utility in the modulation of gene expression in all types of research, clinical and industrial applications. It is intended that any RNA molecule conforming to the structural and functional definitions of the claims can be considered to be a therapeutic RNA of the invention even when not directly used in therapeutic applications.

    Modulation of Gene Expression

    [0190] The present invention uses therapeutic RNA to modulate gene expression. Gene expression can be repressed or enhanced. The therapeutic RNA of the present invention modulates gene expression at the translational level. The skilled person will therefore understand that modulation of gene expression according to the present invention means that translation is modulated without a substantial corresponding modulation of gene transcription. Hence the present invention can be used to repress gene translation without substantially repressing gene transcription. Alternatively, the present invention can be used to enhance gene translation without substantially enhancing gene transcription.

    Other Nucleic Acid Molecules of the Invention

    [0191] As described herein, this invention can be practiced by delivering into cells nucleic acid molecules other than RNA (such as DNA, modified nucleic acids or nucleic acid analogues) that lead to the expression of the therapeutic RNA of the invention in the cell. Expression of the therapeutic RNA of the invention by other nucleic acid molecules of the invention may be under the control of a tissue-specific promotor or a promoter that can be activated or switched off by application of external stimuli.

    Overlap

    [0192] An overlapping sequence in the context of an AS sequence is a sequence that is complementary to whatever sequence that is stated to overlaps with it. The term overlap refers to any degree of overlap. Therefore, an AS-lncRNA gene overlaps a protein-coding gene if at least one base of the AS-lncRNA gene is complementary with at least one base of the protein-coding gene in situ in the genome. For readability, the words at least partial overlap or similar may also be used, without any change in the meaning of overlap being implied where this term is used without a qualifier.

    Vectors

    [0193] This disclosure provides vectors for delivering to cells, or for expressing in cells, the therapeutic RNA of the invention. The term vector is to be interpreted broadly, to include viral vectors and nonviral vectors. Nonviral vectors include plasmid vectors. The skilled person will appreciate that any means of delivering a therapeutic RNA of the invention to a target cell can be used as a vector.

    [0194] The skilled person will appreciate that (i) RNA vectors can be used to transfect or transduce the RNA of the invention directly into a target cell, or (ii) DNA vectors can be used to transfect or transduce another nucleic acid (e.g. a DNA molecule, a modified DNA or DNA analogue), which expresses the RNA of the invention in the target cell. The skilled person will appreciate that transduction usually refers to the use of a viral vector while transfection usually refers to the use of a nonviral vector.

    [0195] A wide range of vectors are known in the art, which can be used to deliver the RNA of the invention to a target cell as described above, either (i) directly or (ii) by delivering a nucleic acid that encodes the RNA of the invention and expresses it in the target cell.

    [0196] Methods for Gene Transfer to the Central Nervous System is the subject of reference.sup.33, which is herein incorporated by reference in its entirety.

    [0197] The following vector types are discussed as non-limiting examples of vectors that may be used to apply the present invention. The skilled person will appreciate that other vectors capable of delivering the therapeutic RNA of the invention to a target cell may also be used.

    [0198] Adeno-associated virus (AAV) vectors deliver DNA to a transduced cell. Hence, AAV vectors can be used to deliver into cells a DNA molecule that expresses the therapeutic RNA of the invention. AAV has been the predominant choice for central nervous system-focused clinical trials.sup.34. The AAV vector may be integrating or non-integrating. The AAV vector may be pseudotyped to increase transduction efficiency and/or to increase target cell specificity. The aav vector may be targeted to particular cell types, such as neurones. The AAV vector may be based on AAV9.

    [0199] Adenoviral vectors deliver DNA to a transduced cell. Hence, adenoviral vectors can be used to deliver into cells a DNA molecule that expresses the therapeutic RNA of the invention. Typically, adenoviral vectors are non-integrating. The adenoviral vector may be pseudotyped to increase transduction efficiency and/or to increase target cell specificity. The adenoviral vector may be targeted to particular cell types, such as neurones.

    [0200] Retroviral vectors are based on RNA viruses and can be used to deliver into cells the therapeutic RNA of the invention directly, or a nucleic acid molecule that expresses the therapeutic RNA of the invention. Most commonly, retroviral vectors are used to deliver an RNA molecule that expresses the therapeutic RNA of the invention in the target cell, following a process of reverse transcription.

    [0201] Retroviral vectors include lentiviral vectors. Lentiviral vectors, e.g. HIV-based vectors, may be integrating or non-integrating. The retroviral vector may be pseudotyped to increase transduction efficiency and/or to increase target cell specificity. The retroviral vector may be targeted to particular cell types, such as neurones.

    [0202] Herpes simplex virus (HSV) delivers DNA to infected cells. Hence, HSV-based vectors can be used to deliver into cells a DNA molecule that expresses the therapeutic RNA of the invention. The HSV-based vector may be integrating or non-integrating. HSV has a natural tropism for neuronal cells. HSV-based vectors can be pseudotyped to increase transduction efficiency and/or to increase target cell specificity. The HSV-based vector may be targeted to particular cell types, such as neurones.

    [0203] Naked DNA/plasmid vectors can be used to deliver DNA encoding the therapeutic RNA of the invention into a target cell. The naked DNA/plasmid vector comprises a DNA sequence encoding the therapeutic RNA of the invention, operably linked to a promoter that can be functional in the target cell. The therapeutic RNA of the invention is thereby expressed by the naked DNA/plasmid vector in the target cell. The skilled person will appreciate that plasmid vectors are circular DNA molecules and may be themselves considered as naked DNA vectors if they are not associated with another chemical entity that assists cell entry. However, plasmid vectors can be linearised prior to transfection (this can enhance genomic integration of the plasmid). Other naked DNA vectors besides plasmids (linear DNA molecules, cosmids, etc) are also well-known.

    [0204] Delivery of naked DNA/plasmid vectors into cells can be achieved by well-known means such as electroporation, sonoporation or by delivering gold nanoparticles coated the a with a plasmid vector into the cell e.g. using a gene gun. Plasmid vectors can also be associated/complexed with chemical entities such as antibodies, saccharide moieties and/or lipids to enhance cell entry. The association can be via covalent bonds or via non-covalent interactions. In this way, plasmid vectors can be targeted to particular cell types, such as neurones.

    [0205] Nanoparticle vectors can be used to deliver into cells the therapeutic RNA of the invention directly, or a nucleic acid molecule that expresses the therapeutic RNA of the invention. Nanoparticle vectors include gold nanoparticles, silica nanoparticles, carbon nanoparticles, calcium phosphates, lipid nanoparticles and quantum dots. Lipid nanoparticles designed to deliver the therapeutic RNA directly to specific cells such as neurones may be used. Multi-layered nanoparticles, in which components intended to protect the therapeutic nucleic acid and/or target the nanoparticle to the cell may also be used with this invention. Nanoparticles may be functionalised with further components to enhance cell targeting and/or may deliver further therapeutic agents to the cell in addition to the therapeutic nucleic acid of the invention. Nanoparticles may be targeted to particular cell types, such as neurones.

    [0206] Dendrimers can be used as vectors to deliver into cells the therapeutic RNA of the invention directly, or a nucleic acid molecule that expresses the therapeutic RNA of the invention. Dendrimers are highly branched macromolecules with an (approximately) spherical shape, which can be functionalised with the therapeutic RNA of the invention and/or another nucleic acid molecule expressing the therapeutic RNA of the invention. Dendrimers are taken into the target cell by endocytosis and may be targeted to particular cell types, such as neurones. The dendrimer may also be functionalised with further components to enhance cell targeting and/or to deliver further therapeutic agents to the cell.

    [0207] Polyplexes can be used as vectors to deliver into cells the therapeutic RNA of the invention directly, or a nucleic acid molecule that expresses the therapeutic RNA of the invention. Polyplexes are complexes of (typically cationic) polymers with nucleic acids. The nucleic acid is usually a DNA molecule encoding a therapeutic RNA of the invention although RNA polyplexes (e.g. nanomicelles) can also be used. The polyplex may be functionalised with further components to enhance cell targeting and/or may deliver further therapeutic agents to the cell. Polyplexes may be targeted to particular cell types, such as neurones.

    [0208] Liposomes can be used as vectors to deliver into cells the therapeutic RNA of the invention directly, or a nucleic acid molecule that expresses the therapeutic RNA of the invention. Liposomes may be targeted to particular cell types, such as neurones. Liposomes are spherical vesicles, having at least one lipid bilayer, which can be used for drug delivery. The liposome may be multilamellar or unilamellar. Liposomes designed to deliver the therapeutic RNA directly to specific cells such as neurones may be used. The liposome may be functionalised with further components to enhance cell targeting and/or to deliver further therapeutic agents to the cell.

    [0209] Micelles or lipoplexes can be used as vectors to deliver into cells the therapeutic RNA of the invention directly, or a nucleic acid molecule that expresses the therapeutic RNA of the invention. Micelles are supramolecular assemblies of surfactant molecules, related to liposomes. However, the lipid layer of a micelle is a monolayer, not a lipid bilayer as in liposomes. Lipoplexes are supramolecular assemblies of cationic lipids and nucleic acids. Micelles or lipoplexes designed to deliver the therapeutic RNA directly to specific cells such as neurones may be used. The micelle or lipoplex may be functionalised with further components to enhance cell targeting and/or to deliver further therapeutic agents to the cell. The micelle or lipoplex may be targeted to particular cell types, such as neurones.

    [0210] Cell-penetrating peptides also known as peptide transduction domains efficiently pass through cell membranes. Cell-penetrating peptides (CPPs)/peptide transduction domains (PTDs) themselves can be used as vectors, by associating the CPP/PTD with the therapeutic RNA of the invention, or with a nucleic acid molecule that expresses the therapeutic RNA of the invention. Alternatively, CPPs/PTDs can be used to functionalise another vector (e.g. as disclosed herein) to enhance the efficiency of cell entry of the vector. The CPP/PTD may be targeted to particular cell types, such as neurones.

    [0211] Cell-based vectors may be used to deliver the therapeutic peptides of the invention. Cells may be taken from a donor (and the donor may be the subject of treatment with the cell-based vector comprising the vector of the invention). Cell-based vectors will comprise a nucleic acid molecule that expresses the therapeutic RNA of the invention. The cell-based vector will express the therapeutic RNA of the invention at the target site, e.g. in the brain. Expression of the therapeutic RNA of the invention by the cell-based vector may be under the control of a tissue-specific promotor or a promoter that can be activated or switched off by application of external stimuli.

    EXAMPLES

    [0212] The following examples are set forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to practise the invention, and are not intended to limit the scope of the invention.

    Identification and Characterisation of MIR-AS-lncRNAs that Repress Gene Translation

    Introduction

    [0213] The present inventors identified MAPT-AS1, a lncRNA antisense to the human MAPT gene that encodes the microtubule-associated protein tau, which is associated with a large class of neurodegenerative diseases collectively known as tauopathies. The inventors have found that MAPT-AS1 inhibits MAPT translation, as evident from a shift of MAPT mRNA from actively translating polysomes to sub-polysomal fractions.

    [0214] From human brain cDNA, the inventors cloned three alternative splicing isoforms (hereafter referred as tau-Natural Antisense Transcript t-NAT1, t-NAT2s, t-NAT21), associated with two alternative transcription start sites (TSS) (FIG. 1a) and supported by RNA-sequencing (RNA-seq) data from multiple human brain regions (FIG. 1b, FIG. 8) and by multiple CAGE tag clusters.sup.15,16 (FIG. 6e).

    [0215] The inventors conclude that these MIR-lncRNAs may thus contribute to a new layer of translational regulation, with implications for homeostasis of neuronal proteins that are commonly disrupted in neurodegenerative diseases.

    MAPT-AS1 Transcript Identification and Characterisation

    [0216] All MAPT-AS1 isoforms identified herein lack open reading frames (ORF) and are predicted to be bona-fide lncRNAs as denoted by their negative PhyloCSF scorer.sup.17 (FIGS. 6c, 7c). t-NAT1 starts at a proximal TSS and overlaps by 89 nucleotides with the MAPT 5-UTR, upstream to the AUG start codon (FIG. 1a). t-NAT2s and t-NAT21 isoforms both start at a more downstream TSS, in an evolutionary conserved region spanning a large CpG island (FIG. 5e). The distal MAPT-AS1 3-exon is shared by all isoforms and contains an embedded repetitive element of the mammalian-wide interspersed repeat (MIR) family, subclass MIRc, in inverse orientation (as defined by www.repeatmasker.org).

    [0217] Alignment of each MAPT-AS1 isoform revealed a striking conservation of the lncRNA anatomy in non-human primates. t-NAT1 has perfect conservation of the splice junction in all primates (FIG. 6a, 6b). t-NAT21 alternative exons 1, 2 and 3 are highly conserved among great apes and Old World primates but not in New World primates (FIG. 7a, 7b), suggesting that t-NAT21 splicing pattern was only acquired after divergence of the New World monkeys from the other primate lineage, approximately 32-36 million years ago.sup.18. Notably, a highly conserved region of 62 nucleotides at the 3-end of both isoforms of MAPT-AS1 is present in all primates, and shows homology to the CORE-SINE common to all MIR repeats.sup.19 (FIG. 6d, 7d), suggesting that this region likely represents a functional domain.

    [0218] To characterize expression and localisation of MAPT-AS1 lncRNA, the inventors assessed the expression level of different splicing isoforms in a panel of 20 human tissues. All isoforms displayed a tissue-specific pattern of expression similar to MAPT, with highest levels in brain (FIG. 1c, FIG. 8). Analysis of RNA-Seq data from human post-mortem brain recently published.sup.20, showed a positive correlation between MAPT-AS1 levels and MAPT mRNA (Pearson's correlation coefficient 0.7004; FIGS. 8, 14). Both MAPT-AS1 and MAPT mRNA showed parallel increases in expression during cortical neuronal differentiation of human induced pluripotent stem cells (hiPSC) (FIG. 1d, FIG. 9b). The inventors then assessed the intracellular localisation of t-NAT transcripts by single-molecule fluorescence RNA in situ hybridization (sm-FISH), employing 48 tiling antisense DNA probes covering all MAPT-AS1 isoforms and 26 probes complementary to MAPT mRNA (Extended Data Table 2). Mature MAPT mRNA and MAPT-AS1 were observed mainly in the cytoplasm, with few discrete nuclear spots, likely corresponding to transcription sites (FIG. 1e). Localisation in both nuclear and cytoplasmic compartments was confirmed by qRT-PCR after cellular fractionation (FIG. 2a).

    [0219] Expression of neither t-NAT1 nor t-NAT21 isoforms of MAPT-AS1 in SH-SY5Y cells caused any significant change in endogenous MAPT mRNA (FIG. 2a, 2c, FIG. 10a). However, transient or stable expression of either t-NAT1 or t-NAT21 strongly and reproducibly reduced endogenous tau protein without affecting -actin, TDP-43 or the neighboring gene IMP5 (FIG. 2b, 2f, 2g, FIG. 11). Conversely, siRNA-mediated knockdown of the endogenous MAPT-AS1 increased total tau protein in SH-SY5Y cells (FIG. 2d). These data indicate that MAPT-AS1 controls tau expression at a post-transcriptional level. Analysis of dephosphorylated tau showed that the MAPT-AS1-mediated decrease of tau protein is independent of tau phosphorylation (FIG. 2e, 2f).

    Determination of Functional Domains

    [0220] To determine the MAPT-AS1 transcript regions required for tau repression, the inventors established several SH-SY5Y-derived cell lines stably overexpressing either full-length or targeted deletions of t-NAT1 and t-NAT21 isoforms. Full-length (FL) t-NAT1 or t-NAT21 transcripts consistently repressed tau protein levels when compared to empty-vector expressing control cells (Empty) (FIG. 2f, 2g). Deletion of the 5-terminal exons (5) or the 3-terminal exon (3) shared by t-NAT1 and t-NAT21 completely abolished this repression (FIG. 2e, 2f), suggesting that both 5 and 3 domains are necessary for MAPT-AS1 function.

    [0221] Stable expression of variants of t-NAT1 5-exon, with deletions either of the regions not overlapping with MAPT 5-UTR (non) or of the overlapping region (over), or with the overlapping region placed in antisense orientation (flip), failed to reduce tau protein level (FIG. 2e, 2f). These data indicate that formation of the RNA duplex between MAPT-AS1 and MAPT is not sufficient for translational repression.

    [0222] Surprisingly, cells stably expressing t-NAT1 or t-NAT21 lacking the MIR was unable to repress tau translation (M2 or M, FIG. 2f, 2g). In all cases no significant change in MAPT mRNA level was observed, demonstrating that MIR is critical for the translational repression by MAPT-AS1 (FIG. 9a). A partial deletion of the region spanning the MIR had no effect (M1, partially deleted MIR FIG. 2f). A mutant with a flipped MIR sequence was equally unable to repress tau translation, thus proving the orientation-dependent activity of the MIR element (FIG. 10).

    [0223] Tau translation is spatially and temporally controlled by the mTOR-p70S6K pathway via a 5-terminal oligopyrimidine (TOP) sequence. This results in axonal accumulation of tau protein.sup.21, which contributes to the establishment of neuronal polarity. The complex folding of the MAPT 5-UTR leads to two main domains that together function as an internal ribosome entry site (IRES).sup.22, providing the cis-acting signals for an alternative mode of translational regulation. Apart from cap-dependent regulation, about 30% of tau translation proceeds through the IRES-mediated pathway, and the full-length structure of MAPT 5-UTR (FIG. 3c) is necessary for maximal tau IRES activity.sup.22. It is not clear how tau switches between cap-dependent and cap-independent modes of translation, and which cellular factors are responsible for controlling tau IRES activity.

    [0224] t-NAT1 5-exon overlaps domain II of the MAPT IRES by 89 nucleotides where the 40S ribosomal subunit has been shown to bind.sup.22 (FIG. 3c). To test if MAPT-AS1 can affect tau translation through the IRES, the inventors cloned the full-length sequence of the human MAPT 5-UTR (322 nt) into pRF, a dicistronic luciferase reporter vector to generate pRTF (FIG. 3a). The dicistronic construct contains a Renilla luciferase (Rluc) ORF and a Firefly luciferase (Fluc) ORF, separated by the MAPT 5-UTR. Translation of Rluc occurs by a cap-dependent mechanism and is used to normalize for transfection efficiency. Translation of Fluc will not occur unless an IRES is present to initiate translation (pRF versus pRTF, FIG. 3b).

    [0225] To exclude a possible involvement of other cis-regulatory elements in MAPT-AS1-mediated repression, the inventors tested involvement of the 3-UTR. SH-SY5Y cells were co-transfected with a full-length or truncated MAPT 3-UTR inserted downstream to a Fluc ORF together with either a pcDNA3.1 empty vector or wild-type MAPT-AS1 lncRNAs. No significant change in luciferase level was observed in the presence of either wild-type or different deletion mutants of t-NAT1 and t-NAT21 (FIG. 11), showing that MAPT-AS1 function does not require tau 3-UTR.

    [0226] Noting the role played by the embedded inverted MIR repeat in regulating the steady-state level of endogenous tau protein, the inventors tested if the MIR is directly involved in MAPT-AS1-mediated effects on tau IRES. As expected, SH-SY5Y cells transiently co-transfected with pRTF in presence of either t-NAT1 or t-NAT21 showed a reduced IRES activity compared to cells transfected with an empty vector (FIG. 3d). Surprisingly, cells co-transfected with either t-NAT1 or t-NAT21 with the entire MIR repeat region deleted could not repress tau IRES (FIG. 3d).

    Inhibition of Translation

    [0227] To further validate that MAPT-AS1 inhibits tau translation, the inventors measured the enrichment of t-NAT isoforms, MAPT and -actin (ACTB) mRNAs in polysome gradient fractions. t-NAT1 and t-NAT21 co-localised mainly with monosomes (80S) and disomes (FIG. 3f, FIG. 3f). Stable expression of either wild-type t-NAT1 or t-NAT21 significantly shifted the MAPT mRNA from heavy to lighter polysome fractions, confirming their role in translational repression (FIG. 3e; FIG. 12). Conversely, MAPT-AS1 without the embedded MIR repeat lead to increased engagement of the MAPT message with polysomes, resulting in a strong increase in tau translation (FIG. 3e, 3f).

    [0228] These data indicate that the MIR repeat element modulates tau IRES activity, either by affecting its global RNA secondary/tertiary structure, or by preventing access of the 40S ribosomal subunit to the AUG starting codon. Alternatively the MIR repeat might mask short regions within domain I and II, which could potentially base-pair with 18S ribosomal RNA (rRNA).sup.22.

    [0229] Interestingly the inverted MIR element of MAPT-AS1 contains two close 7-mer motifs that are either complementary or identical to two conserved regions of the human 18S rRNA. As illustrated in FIG. 18 the first motif (CACCCAC, blue) is complementary to nucleotides 1318-1324 of the 18S rRNA at the basis of helix 33 (grey lines), and the other (CTGAGGC, red) is identical to nucleotides 905-911 in the stem 21esd6, which is part of the 18S rRNA expansion segment 6, only present in Eukaryotes. Both these MIR motifs could mediate MAPT IRES repression due to a direct competition for pairing with the 40S rRNA (FIG. 18). Interestingly as postulated on the basis of a large body of experimental observations, Vincent Mauro and Gerald Edelman proposed an interesting theory called the ribosome filter hypothesis, which predicts that the ribosome itself may act as a regulatory filter in determining translation rate for subsets of mRNAs, with which it can interact through direct rRNA-mRNA complementary sites, or mRNA-ribosomal protein interactions.sup.23. The widespread occurrence of short complementarity regions within 5-UTRs of human genes forming a well-defined tridimensional pattern on the 18S rRNA, that has been revealed for several distant species.sup.24, points towards a role for rRNA-mRNA interactions in modulating the whole translation process. Within this context MIR retroelements embedded within antisense-lncRNAs, may directly and dynamically modulate these weak and transient interactions with 40S ribosomes, controlling the rate of protein synthesis for subsets of cellular mRNAs.

    [0230] This is particularly relevant for all those mRNAs that are capable of an internal initiation mediated by IRES sequences, as most of these mRNAs are enriched for short motifs of complementarity to an active region (nt 812-1233) of the 18S rRNA in their 5-UTRs, as it was shown in a recent genome-wide screening of human 5-UTRs for their cap-independent translation activity.sup.25. Noticeably, our kmer-enrichment analysis on all antisense MIR-lncRNAs, revealed that MIR-lncRNAs target genes are enriched for 7-mer motifs in their 5-UTRs, matching the 18S rRNA active region as defined by Weingarten-Gabbay et al..sup.25 (See Table 1). Intriguingly 135 (27.7%) out of 487 human genes overlapping within their 5-UTR with antisense MIR-lncRNAs, possess one or more motifs (7-mers) of 18S complementarity which are also found in the MIR element of their paired MIR-lncRNA. Strikingly these motifs cluster in specific areas within the 18S rRNA active region (FIG. 17, Table 1).

    [0231] The 18S rRNA sequence is:

    TABLE-US-00015 [SEQ ID NO: 18] UACCUGGUUG AUCCUGCCAG UAGCAUAUGC UUGUCUCAAA GAUUAAGCCA UGCAUGUCUG AGUACGCACG GCCGGUACAG UGAAACUGCG AAUGGCUCAU UAAAUCAGUU AUGGUUCCUU UGGUCGCUCG CUCCUCUCCU ACUUGGAUAA CUGUGGUAAU UCUAGAGCUA AUACAUGCCG ACGGGCGCUG ACCCCCUUCG CGGGGGGGAU GCGUGCAUUU AUCAGAUCAA AACCAACCCG GUCAGCCCCU CUCCGGCCCC GGCCGGGGGG CGGGCGCCGG CGGCUUUGGU GACUCUAGAU AACCUCGGGC CGAUCGCACG CCCCCCGUGG CGGCGACGAC CCAUUCGAAC GUCUGCCCUA UCAACUUUCG AUGGUAGUCG CCGUGCCUAC CAUGGUGACC ACGGGUGACG GGGAAUCAGG GUUCGAUUCC GGAGAGGGAG CCUGAGAAAC GGCUACCACA UCCAAGGAAG GCAGCAGGCG CGCAAAUUAC CCACUCCCGA CCCGGGGAGG UAGUGACGAA AAAUAACAAU ACAGGACUCU UUCGAGGCCC UGUAAUUGGA AUGAGUCCAC UUUAAAUCCU UUAACGAGGA UCCAUUGGAG GGCAAGUCUG GUGCCAGCAG CCGCGGUAAU UCCAGCUCCA AUAGCGUAUA UUAAAGUUGC UGCAGUUAAA AAGCUCGUAG UUGGAUCUUG GGAGCGGGCG GGCGGUCCGC CGCGAGGCGA GCCACCGCCC GUCCCCGCCC CUUGCCUCUC GGCGCCCCCU CGAUGCUCUU AGCUGAGUGU CCCGCGGGGC CCGAAGCGUU UACUUUGAAA AAAUUAGAGUGUUCAAAGCAGGCCCGAGCC GCCUGGAUACCGCAGCUAGGAAUAAUGGAAUAGGACCGCG GUUCUAUUUUGUUGGUUUUCGGAACUGAGGCCAUGAUUAA GAGGGACGGCCGGGGGCAUUCGUAUUGCGCCGCUAGAGGU GAAAUUCUUGGACCGGCGCAAGACGGACCAGAGCGAAAGC AUUUGCCAAGAAUGUUUUCAUUAAUCAAGAACGAAAGUCG GAGGUUCGAAGACGAUCAGAUACCGUCGUAGUUCCGACCA UAAACGAUGCCGACCGGCGAUGCGGCGGCGUUAUUCCCAU GACCCGCCGGGCAGCUUCCGGGAAACCAAAGUCUUUGGGU UCCGGGGGGAGUAUGGUUGCAAAGCUGAAACUUAAAGGAA UUGACGGAAGGGCACCACCAGGAGUGGAGCCUGCGGCUUA AUUUGACUCA ACACGGGAAA CCUCACCCGG CCCGGACACG GACAGGAUUG ACAGAUUGAU AGCUCUUUCU CGAUUCCGUG GGUGGUGGUG CAUGGCCGUU CUUAGUUGGU GGAGCGAUUU GUCUGGUUAA UUCCGAUAAC GAACGAGACU CUGGCAUGCU AACUAGUUAC GCGACCCCCG AGCGGUCGGC GUCCCCCAAC UUCUUAGAGG GACAAGUGGC GUUCAGCCAC CCGAGAUUGA GCAAUAACAG GUCUGUGAUG CCCUUAGAUG UCCGGGGCUG CACGCGCGCU ACACUGACUG GCUCAGCGUG UGCCUACCCU ACGCCGGCAG GCGCGGGUAA CCCGUUGAAC CCCAUUCGUG AUGGGGAUCG GGGAUUGCAA UUAUUCCCCA UGAACGAGGA AUUCCCAGUA AGUGCGGGUC AUAAGCUUGC GUUGAUUAAG UCCCUGCCCU UUGUACACAC CGCCCGUCGC UACUACCGAU UGGAUGGUUU AGUGAGGCCC UCGGAUCGGC CCCGCCGGGG UCGGCCCACG GCCCUGGCGG AGCGCUGAGA AGACGGUCGA ACUUGACUAU CUAGAGGAAG UAAAAGUCGU AACAAGGUUU CCGUAGGUGA ACCUGCGGAAGGAUCAUUA

    [0232] The underlined part of the 18S rRNA sequence [SEQ ID NO: 19] corresponds with the active region as defined by Weingarten-Gabbay et al.sup.25 and by Petrov et al.sup.35.

    [0233] Plasmid-based expression of the non-coding RNAs, we observed a strong reduction of tau protein levels with tNAT1 (NT1 wt in FIG. 19b, top panel) that was absent in controls or the tNAT1 variants with targeted deletions of the overlapping region and or a downstream exon (NT1D5 and NT1D3). tNAT2 (NT2 wt) expression showed a more modest reduction. With multiple independent clones of SH-SY5Y cells overexpression tNAT1 (NT1) and tNAT2 (NT2), we observed a much more striking reduction in tau protein levels for both NATs (see FIG. 19c and FIGS. 20a and b). FIG. 19c and FIG. 20a (top panel) show the effects of three independent clones overexpressing tNAT1 (NT1-1, NT1-2 and NT1-3) whereby tau protein levels are almost completely eliminated compared to empty vector clones (V5) and clones expressing variants of tNAT1 with deletions or rearrangements of the 5 exon of the tNAT1 that overlaps with the MAPT promoter or the distal 3 region of tNAT1. This clearly demonstrates the role of tNAT1 as a strong repressor of MAPT gene expression at the translation level and the importance of the 5 region of both NATs that overlap with the MAPT core promoter region (FIG. 19a).

    Other AS-lncRNAs

    [0234] In order to find other AS-lncRNAs that could have a similar effect to the MAPT-AS1, we screened the GENCODE v19 annotations for transcripts containing a MIR. We calculated the MIR coverage within each transcript normalized to their lengths. All classes of MIR elements, present almost equally in both orientations, are enriched in lncRNAs as opposed to protein-coding mRNAs (FIG. 4a). This is in line with a more general enrichment of TE in lncRNAs as was recently reported.sup.26. The inventors then assessed whether other MIR-containing lncRNAs could post-transcriptionally regulate expression of their protein-coding targets.

    [0235] The GENCODE v19 annotations were bioinformatically screened for AS-lncRNAs containing one or more embedded MIR elements. Considering the high degree of conservation of the CORE-SINE in all MIR subclasses.sup.19, we included lncRNAs containing other MIR classes (MIR, MIR3, MIRb, MIRc). Having observed that flipping of the MIR element leads to an opposite effect on target gene regulation (Extended Data, FIG. 7), we included lncRNAs with embedded MIR elements in both orientations. 5.63% of AS-lncRNAs contain an embedded MIR-repeat. We identified 1197 such MIR-lncRNAs, 40.69% of which overlap with the 5-UTR, 32.50% overlap with the 3-UTR and 26.81% with coding sequences (CDS) (FIG. 4b).

    [0236] Interestingly, a Gene Ontology (GO)-term enrichment analysis using Enrichr.sup.27 revealed that the region of overlap is associated with genes enriched in different cellular components and disease-linked loci. MIR-lncRNAs with overlap in the 5-UTR are significantly enriched for genes expressed in the brain that are associated with dementia, Parkinson's disease or amyotrophic lateral sclerosis and localise mainly to axonal and neuronal projection membrane compartments (FIG. 4c, FIG. 4f).

    Experimental Validation in Other Genes

    [0237] To further confirm that embedded MIR repeats within AS-lncRNAs may similarly repress translation of other protein-coding genes, we experimentally validated one such MIR-lncRNA overlapping with the first 5-exon of the human gene encoding for phospholipase c gamma 1 (PLCG1) (FIG. 4d). SH-SY5Y cells expressing a full-length antisense MIR-lncRNA (PLCG1-AS FL) show a robust reduction of PLCG1 protein (FIG. 4e). Conversely cells expressing an antisense-lncRNA deleted of the inverted MIR repeat express a normal level of endogenous PLCG1 protein (FIG. 4e). Surprisingly, protein-coding genes paired with antisense MIR-lncRNAs have significantly more structured 5-UTRs and 3-UTRs (FIG. 15a, 15b). Finally, using the NetworkAnalyst tool.sup.28, we observed that the majority of antisense MIR-lncRNA target coding genes belongs to a wide protein-protein interaction network, significantly enriched for genes linked to neurodegenerative diseases (adjusted P value 1.6310.sup.8, FIG. 4f; FIG. 15) and genes expressed in immune system (FIG. 16).

    [0238] Furthermore genes overlapping in 5-UTR with antisense MIR-lncRNAs are significantly more expressed in brain than genes overlapping along 3-UTR or CDS as shown by the RNA-seq data from human post-mortem brains (FIG. 4g). These data uncover a novel role for an entire class of transposable elements (TE)-derived lcnRNAs, and suggest that MIR repeat elements might represent a widespread cis-regulatory signal employed by lncRNAs to orchestrate translational regulation of many genes involved in neuronal proteins homeostasis, frequently affected in neurodegenerative diseases. This novel function for MIR repeats in the cytoplasm adds to their previously documented function as transcriptional enhancers or insulators in the nucleus.sup.29,30.

    Materials and Methods

    Plasmids

    [0239] cDNA sequence of human antisense t-NAT1 and t-NAT21 were amplified from a sample of human brain total RNA (Clontech, 636530) with the primers NT1-5F, NT1-3R and TOPO2-F, TOPO2-R respectively:

    TABLE-US-00016 NT1 5F (BamHI) GGCggatccGCCCCAGTCTGCGGAGAGG NT1 3R (XhoI) GGCctcgagGCTGTGTCAATGTGGGCTTC TOPO2-F (EcoRV) GGCgatatcCCATGAAGTGGGTGTATT TOPO2-R (BamHI) GGCggatccCGAGTCCGTCCACATCGCCA

    [0240] The antisense t-NAT1 5deletion mutant (5) was generated by PCR using the oligonucleotides forward NT15-BamHI and reverse NT15-XhoI. PCR fragment was cloned directionally in the unique BamHI and XhoI sites in pcDNA3.1V5 (Invitrogen). Similarly the antisense t-NAT21 5 deletion mutant (5) was generated by PCR using the forward NT245-BamHI and reverse NT245-XhoI primers and cloned in the same sites in pcDNA3.1V5.

    [0241] The antisense t-NAT1 3 deletion mutant (3) was generated by PCR using the forward NT13-BamHI and reverse NT13-XhoI primers and cloned in the unique BamHI and XhoI sites in pcDNA3.1V5. Similarly the antisense t-NAT21 3 deletion mutant (3) was generated by PCR using the forward NT23-BamHI and reverse NT23-XhoI primers and cloned in the same sites in pcDNA3.1V5.

    [0242] The antisense t-NAT1 (4M1) (partial Mir, 386-433) mutant was obtained by cloning of a PCR fragment amplified using the primers (NT13-BamHI and NT1mir1-XhoI) into the BamHI-XhoI sites of pcDNA3.1V5.

    [0243] The antisense t-NAT1 (4M2) (total Mir, 386-449) mutant was obtained by cloning of a PCR fragment amplified using the primers (NT13-BamHI and NT1mir2-XhoI) into the BamHI-XhoI sites of pcDNA3.1V5.

    [0244] The antisense t-NAT21 (M) (Mir, 498-532) mutant was obtained by cloning of a PCR fragment amplified using the primers (NT23-BamHI and NT2mir-XhoI) into the BamHI-XhoI sites of pcDNA3.1V5.

    [0245] The antisense t-NAT1 (over) (S/AS overlapping region, 93-168) fragment was generated by direct ligation of in vitro annealed oligonucleotides, with reconstituted 5-end overhangs, forward NT1overS and reverse NT1overAS (75 nt) onto BamHI and XhoI sites of pcDNA3.1V5. Similarly the antisense t-NAT1 (Flip) (S/AS overlapping region in a Flipped orientation, 168-93) fragment was generated by direct ligation of in vitro annealed oligonucleotides forward NT1overFlipS and reverse NT1overFlipAS (75 nt) onto BamHI and XhoI sites of pcDNA3.1V5.

    [0246] The antisense t-NAT1 (non) (non-overlapping region, 4-93) mutant was obtained with a similar strategy to antisense t-NAT1 (over). Oligonucleotides forward NT1nonoverS and reverse NT1nonoverAS were annealed in vitro and directionally ligated onto BamHI and XhoI sites of pcDNA3.1V5.

    [0247] The antisense t-NAT1 (Mflip) (MIR repeat flipped) mutant was obtained as a gene synthesis construct (GENEWIZ) and subcloned into pcDNA3.1V5 using BamHI and XhoI restriction sites.

    [0248] Full-length antisense-PLCG1 lncRNA (ENST00000454626.1, 1,459 nt) was designed as a gene synthetic construct (GENEWIZ) and subcloned into pcDNA3.1V5 using BamHI and EcoRVrestriction enzymes. Similarly an antisense-PLCG1 lncRNA deleted of the inverted MIRb repeat in its third exon (antisense-PLCG1M, 1333 nt) was also generated by gene synthesis (GENEWIZ) subcloned into pcDNA3.1V5 using BamHI and EcoRV restriction enzymes.

    TABLE-US-00017 B1b-MluI-F GTCacgcgtGAGTGCGCGCGTG B1b-MluI-F GTCacgcgtGAGTGCGCGCGTG B2-F-NheI agtGCTAGCTGCCGCTGTTCGCCATCAG B2-R-EcoRV tagccGATATCACCCTCAGAATAAAAGCCAG B1F-NruI cctTCGCGACAAATGCTCTGCGATGTGTT B1R-HindIII cctAAGCTTGGACAGCGGATTTCAGATTC NT15-BamHI GAAggatccGAGTCAGAACAAGGACGG NT15-XhoI GAActcgagTTGCTGTGTCAATGTGGG NT13-BamHI GAAggatccAGTCTGCGGAGAGGGAG NT13-XhoI GAActcgagCTTCTGCCGCCGCCA NT1overS: gatccCTTCTGCCGCCGCCACCACAGCCACCTTCTCCTCCTCCGCTGTCC TCTCCCGTCCTCGCCTCTGTCGACTATCAGc NT1overAS: gGAAGACGGCGGCGGTGGTGTCGGTGGAAGAGGAGGAGGCGACAGGA GAGGGCAGGAGCGGAGACAGCTGATAGTCgagct NT1overFlipS: gatccCTGATAGTCGACAGAGGCGAGGACGGGAGAGGACAGCGGAGGA GGAGAAGGTGGCTGTGGTGGCGGCGGCAGAAGc NT1overFlipAS: gGACTATCAGCTGTCTCCGCTCCTGCCCTCTCCTGTCGCCTCCTCCTC TTCCACCGACACCACCGCCGCCGTCTTCgagct NT1nonoverS: gatccAGTCTGCGGAGAGGGAGGGCGAGGGGCGGCGGCGCAGGGGTGC ACAGAGGCGGACGGCGAGGCAGATTTCGGAGCCGCGGCGCTTACc NT1nonoverAS: gTCAGACGCCTCTCCCTCCCGCTCCCCGCCGCCGCGTCCCCACGTGTC TCCGCCTGCCGCTCCGTCTAAAGCCTCGGCGCCGCGAATGgagct NT25F-BamHI GAAggatccGAGTCAGAACAAGGACGG NT25R-XhoI GAActcgagCCATGAAGTGGGTGTATTAAGG NT23F-BamHI GAAggatccCCGAGTCCGTCCACAT NT23R-XhoI GAActcgagCTGCAGGGGAAAGGTG NT1mir1-XhoI GAActcgagTTGCTGTGTCAATGTGGGGGTAACGTTAAGTGGCTATA NT1mir2-XhoI GAActcgagGGTAACGTTAAGTGGCTATA NT2mirR-XhoI GAActcgagGGTAACGTTAAGTGGCTATAACAAAGAGACTC B1LucF-BamHI GAAggatccCTTGGCAATCCGGTACTGTT B1LucR-HindIII GAAaagcttCCGTCTTCGAGTGGGTAGAA B1LucF-HindIII GAAaagcttCTTGGCAATCCGGTACTGTT B1LucR-BamHI GAAggatccCCGTCTTCGAGTGGGTAGAA CP-F GAGCTCCAAATGCTCTGCGATGTGTT CP-R GCTAGCGGACAGCGGATTTCAGATTC NP-F gaGCTAGCTGCCGCTGTTCGCCATCAG NP-R gtGCTAGCACCCTCAGAATAAAAGCCAG Fr1-F GAGGTCCCTGGGGCGGTCAATAA Fr1-R AAGCTTAGGCAGTGATTGGGCTCTC Fr2-F GAGCTCGTAGGGGGCTGAGTTGAG Fr2-R AAGCTTACCAGAAGTGGCAGAATTGG Fr3-F GAGCTCCAGACTGGGTTCCTCTCCAA Fr3-R AAGCTTGCCAGCATCACAAAGAAG RVp3-F TAGCAAAATAGGCTGTCCCC Luc-R ATGTGCGTCGGTAAAGGCG pRTF-EcoRI GGTTTgaattcGGACGGCCGAGCGGCA pRTF-NcoI TAAccatggCCTGGTTCAAAGTTCACCTGATAGTCGACAGAGGCGAG pRTFDover-EcoRI GGTTTgaattcCCTTCTGCCGCCGCCAC pRTFDover-NcoI TAAccatggTGGGCGGTGGCAGCG pRTF-mTOP CCGCGCTGCCCGCCCaaTaaaaTGGGGAGGCTCGCGTTCC pRTFDover-PvuII GGTTTcagctgCCTTCTGCCGCCGCCAC pRFseq-F GAAGGTGCCAAGAAGTTTCCTAA

    Cells

    [0249] SH-SY5Y and SK-N-F1 human neuroblastoma cells were obtained from ATCC. Cells were seeded in 75-cm.sup.2 flasks in complete medium containing 44% Minimum Essential Medium Eagle (MEME), 44% Ham's nutrient mixture (F12), 10% fetal bovine serum (Sigma) supplemented with 1% non essential aminoacids (Sigma), 1% L-glutamine (Sigma), 0.1% Amphotericin B (Gibco), penicillin (50 units ml.sup.1) and streptomycin (50units ml.sup.1), and maintained at 37 C. with 5% CO.sub.2. For experiments, 60% confluent cells were plated in 6-well plates (VWR), grown overnight before transfection and harvested 48 hours post-transfection. Transient transfections were done with TransFast (Promega).

    [0250] For establishing the stable cell lines (Empty pcDNA 3.1, t-NAT1 FL, t-NAT15, t-NAT13, t-NAT1over, t-NAT1Flip, t-NAT1non, t-NAT1M2, t-NAT2 FL, t-NAT25, t-NAT23, t-NAT2M), SH-SY5Y cells were seeded in 10-cm Petri dishes and transfected with TransFast (Promega) and 7.5 g plasmid DNA according to the manufacturer's instruction. Stable clones were selected by 500 M G418 sulfate (345810, Millipore). For each type of stable cell line, at least 6 independent clones were isolated using glass cloning cylinders (C1059, Sigma), expanded in 6-well plates and screened individually by Western Blot and qRT-PCR.

    Induced Pluripotent Stem Cells (iPSC) and Cortical Neuron Cultures

    [0251] The control induced pluripotent stem cells (iPSCs) used in this study have been previously generated by retroviral expression of c-Myc, Oct4, Klf4 and Sox2.sup.31. IPSCs were grown under feeder-free conditions on Geltrex-coated plates in Essential 8 medium (Thermo Scientific). The medium was replaced daily and iPSCs were passaged every 5-6 days with 0.5 mM EDTA (Thermo Scientific).

    [0252] iPSCs were subsequently differentiated into cortical neurons, as previously described (Sposito et al. 2015), using dual SMAD inhibition followed by in vitro neurogenesis. Briefly, iPSCs were plated at 100% confluency and the media was switched to neural induction media (1:1 mixture of N-2 and B-27-containing media supplemented with the SMAD inhibitors Dorsomorphin and SB431452 (Tocris). N-2 medium consists of DMEM/F-12 GlutaMAX, 1N.sup.1 insulin, 1 mM 1-amino acids, -mercaptoethanol, 50 U ml.sup.1 penicillin and 50 mg ml.sup.1 streptomycin. B-27 medium consists of Neurobasal, 1B-27, 200 mM 1-glutamine, 50 U ml.sup.1 penicillin and 50 mg ml.sup.1 streptomycin) (Thermo Scientific). At the end of the 10-day induction period, the converted neuroepithelium was replated onto laminin-coated plates using dispase (Thermo Scientific) and maintained in a 1:1 mix of the described N-2 and B-27 media which was replaced every 2-3 days. During the stage of neurogenesis around days 25-35, neuronal precursors were passaged further with accutase (Thermo Scientific) and plated for the final time at day 35 onto poly-ornithine and laminin coated plates (Sigma).

    Double Immunofluorescence

    [0253] Neurons were fixed in 4% PFA for 25 minutes at room temperature, followed by 10 min permeabilisation in 0.25% Triton-X100/PBS and 30 min blocking in 3% BSA and 0.1% Triton-X100/PBS. Neurons were incubated with primary antibody overnight at 4 C. (Table). The following primary antibodies were used: anti-PAX6 (Covance, Rabbit, 1:500); anti-OTX2 (Millipore, Rabbit, 1:500); anti-Ki67 (BD, Mouse, 1:500); anti-TBR1 (Abcam, Rabbit, 1:300); anti-SATB2 (Abcam, Mouse, 1:100); anti-BRN2 (SantaCruz, Goat, 1:400); anti-Tujl (III-tubulin) (Covance, Mouse and Rabbbit, 1:2000). Incubation with secondary Alexa Fluor 488 and 568-conjugated secondary antibodies, (Thermo Scientific) both diluted 1:200 in 3% BSA in 0.1% Triton-X100/PBS, was performed for 1 h at room temperature. Nuclei were stained using DAPI and cells were mounted on slides with Prolong Gold Antifade Reagent (Thermo Scientific). Images were obtained using a Zeiss LSM 710 microscope.

    Splinkerette PCR

    [0254] Sites of integration of individual clones of stable cell lines were determined following the method described in Potter and Luo (2010).sup.32.

    RNA-Seq Library Preparation and Sequencing

    [0255] Brain samples for analysis were provided by the Medical Research Council Sudden Death Brain and Tissue Bank (Edinburgh, UK). All four individuals sampled were of European descent, neurologically normal during life and confirmed to be neuropathologically normal by a consultant neuropathologist using histology performed on sections prepared from paraffin-embedded tissue blocks.

    [0256] Twelve central nervous system regions were sampled from each individual. The regions studied were: cerebellar cortex, frontal cortex, temporal cortex, occipital cortex, hippocampus, the inferior olivary nucleus (sub-dissected from the medulla), putamen, substantia nigra, thalamus, hypothalamus, intralobular white matter and cervical spinal cord. RNA was extracted using Qiagen tissue kits (Qiagen, US), and quality controlled as detailed previously.sup.20. cDNA Libraries were prepared by the UK Brain Expression Consortium in conjunction with AROS Applied Biotechnology A/S (Aarhus, Denmark).

    [0257] Reverse transcription in this protocol is carried out using both oligo dT and random primers. This allowed total RNA profile patterns to be assessed with the latter and locations of splicing to be inferred.

    qRT-PCR

    [0258] Total RNA was extracted from cells and human post-mortem brain tissue samples (temporal cortex, occipital cortex, caudate) using Trizol reagent (Invitrogen) according to the manufacturer's instruction. A panel of RNA from 20 different normal human tissues (each consisting of pools of three tissue donors with full documentation on age, sex, race, cause of death) was obtained from Ambion (AM6000). The amplified transcripts were quantified using the comparative Ct method and the differences in gene expression were presented as normalized fold expression (Ct). All of the experiments were performed in duplicate. A heat map graphical representation of rescaled normalized fold expression (Ct/Ct.sub.max) was obtained by using Matrix2png (http://www.chibi.ubc.ca/matrix2png/).

    Two-Colour Single-Molecule RNA Fluorescent In Situ Hybridization (sm-FISH)

    [0259] DNA tiling probes complementary to 3 alternative splicing isoforms of human t-NAT transcripts (t-NAT1, t-NAT2s, t-NAT21), designed by using Stellaris Probe designer, were labeled at 3-end with the fluorescent dye Quasar 670. Other DNA tiling probes complementary to the exons of human MAPT transcript (NM_005910) were labeled at the 3-end with the dye Quasar 570. All FISH probes were 19 to 20 bp long, designed with a stringency factor 2, checked using BLAST, and obtained from Biosearch technologies. Fluorescent in situ hybridization was performed as previously described.sup.4.

    siRNA Knockdown

    [0260] SH-SY5Y cells were seeded at 70% of confluence in 6-well plates, and after 24 h were transfected with 75 l of 2 M siRNAs, using RNAiMax (Invitrogen) transfection reagent following manufacturer's instructions. After 48 h cells were harvested for protein and RNA extraction. Three independent pools of siRNAs (Ambion) were used to target different MAPT-AS1 exons as follows:

    [0261] siNT1nover (S, CGGCGAGGCAGAUUUCGGAtt; AS, UCCGAAAUCUGCCUCGCCGtc); siNT2nover (S, GCCGCCGAGUCCGUCCACAtt; AS, UGUGGACGGACUCGGCGGCcg); siEx4-n268302 (S, AGGACAAUGUCCUAAGGAAtt; AS, UUCCUUAGGACAUUGUCCUcc); siEx4-n268298 (S, GAUUUGUCAUGAGUCUCUUtt; AS, AAGAGACUCAUGACAAAUCaa). A scrambled sequence #2 was used as negative control. Pre-designed and custom-designed were LNA-modified as Silencer Select siRNAs (Ambion).

    Western Blot

    [0262] Cells were lysed in RIPA lysis buffer supplemented with complete EDTA-free protease inhibitor cocktail (Roche). Protein lysate concentrations were measured by the BCA protein assay (Bio-Rad). Immunoblotting was performed with the following primary antibodies: anti-MAPT (T-1308-1, rPeptide, and A0024, and DAKO rabbit polyclonal), anti--actin (2228, Sigma), anti-IMP5 polyclonal antibody (12664-1-AP, Proteintech) and anti-TDP43 (10782-2-AP, Proteintech), anti-PLCG1 (D9H10, rabbit monoclonal, Cell Signaling). Secondary antibodies were as follows: IRDye-800CW or IRDye-680CW conjugated goat anti-rabbit, donkey anti-mouse, donkey anti-rabbit, goat anti-mouse or anti-goat IgG (Li-COR Bioscience). Signals were digitally acquired by using an Odyssey infrared scanner (Li-COR Bioscience) and quantified using Fiji version 2.0.0-rc-39/1.50d (http://fiji.sc/Fiji).

    Cellular Fractionation

    [0263] Nucleo-cytoplasmic fractionation was performed using Nucleo-Cytoplasmic separation kit (Norgen) according to the manufacturer's instruction. RNA was eluted and treated with DNase I (Roche). RNA concentrations were measured by NanoDrop spectrophotometer. The purity of the cytoplasmic fraction was confirmed by qRT-PCR on pre-ribosomal RNA.

    Luciferase Reporter Vectors

    [0264] Firefly luciferase reporter plasmids were constructed by inserting the human MAPT core promoter (CP, 1,342 bp) amplified using the primers (CP-F GAGCTCCAAATGCTCTGCGATGTGTT, CP-R GCTAGCGGACAGCGGATTTCAGATTC) between the SacI and NheI sites into pGL4.10 vector (Promega) to create pGL4-CP vector. A 901 bp fragment of genomic DNA spanning the t-NAT promoter (NP) was amplified using the primers (NP-F gaGCTAGCTGCCGCTGTTCGCCATCAG, NP-R gtGCTAGCACCCTCAGAATAAAAGCCAG) and inserted into NheI site either of pGL4-CP or pGL4.10 vectors to create pGL4-CNP and pGL4-NP respectively. The full-length 322 bp-long human MAPT 5-UTR was amplified with primers (pRTF-EcoRI, pRTF-NcoI) and ligated onto EcoRI and NcoI sites of the pRF vector (a kind gift from Prof. Anne Willis, Leicester University, UK) to create the pRTF vector. A fragment of MAPT 5UTR devoid of t-NAT overlapping region was amplified using the primers (pRTF-EcoRI, pRTFDover-NcoI) and inserted between same sites into pRF, to generate the pRTF-Delta vector. pRTFover vector was constructed in the same way using the primers (pRTF-Dover-EcoRI, pRTF-NcoI). A pRhcvF, used as a positive control viral IRES, was a kind gift of Prof. Anne E. Willis and was constructed as described previously.sup.5. Mutant reporter plasmids were created using the QuickChange lightning multi site-directed mutagenesis kit (Agilent) according to the manufacturer's instructions. The following mutagenic oligonucleotides (pRTF-mTOP) were annealed to the pRTF vector, extended by PCR, and the parental methylated plasmid DNA was digested with Dpnl enzyme to obtain the correspondent mutant dicistronic luciferase vector. The full-legth human MAPT 3UTR and 3 partially overlapping fragments were amplified from brain cDNA with the primers (Fr1-F, Fr1-R, Fr2-F, Fr2-R, Fr3-F, Fr3-R) and cloned individually into SacI and HindIII sites of pMIR-REPORT vector (Invitrogen).

    Dual Luciferase Reporter Assay

    [0265] SH-SY5Y cells or t-NAT-stably expressing cells were seeded in Greiner 96-well plates overnight and then co-transfected using TransFast (Promega) with the dicistronic reporter vector pRF, pRhcvF, pRTF or pRTF deletion mutants and either a pcDNA3.1 empty vector or each of the t-NAT expression vectors. 48 h after transfection cap-dependent translation (Renilla luciferase activity) and IRES-mediated translation (Firefly luciferase activity) were measured with the DualGlo Luciferase Assay kit (Promega) according to the manufacturer's instructions. Firefly to Renilla ratios were normalized to a common pMIR-Report vector used to account for transfection efficiency in each experiment and results are represented as means.d. Experiments were done in triplicate.

    Polysomal Fractionation

    [0266] 110.sup.6 cells were seeded in two 10 cm.sup.2 dishes and collected for polysomal fractionation after 48 h. All the experiments were run in biological triplicate. Cells were incubated for 4 min with 100 g/ml cycloheximide at 37 C. to block translational elongation. Cells were washed with PBS supplemented with 10 g/ml cycloheximide, scraped into 300 l lysis buffer (10 mM NaCl, 10 mM MgCl2, 10 mM Tris-HCl, pH 7.5, 1% Triton X-100, 1% sodium deoxycholate, 0.2 U/l RNase inhibitor [Fermentas Burlington, Calif.], 100 g/ml cycloheximide and 1 mM DTT) and transferred to a microfuge tube. Nuclei and cellular debris were removed by centrifugation at 13,000 g for 5 min at 4 C. The supernatant was layered on a linear sucrose gradient (15-50% sucrose (w/v) in 30 mM Tris-HCl at pH 7.5, 100 mM NaCl, 10 mM MgCl.sub.2) and centrifuged in a SW41Ti rotor (Beckman Coulter, Indianapolis, Ind.) at 180,000 g for 100 min at 4 C. Ultracentrifugation separates polysomes by the sedimentation coefficient of macromolecules: gradients are then fractionated and mRNAs in active translation (polysome-containing fractions) are separated from untranslated mRNAs (subpolysomal fractions). Fractions of 1 ml volume were collected with continuous absorbance monitoring at 254 nm. As controls, cell lysates were treated with 50 mM EDTA on ice for 10 min before gradient loading.

    qRT-PCR of Polysomal Fractions and Statistical Analysis

    [0267] Total RNA was extracted from each polysomal fraction using 1 ml of Trizol (Invitrogen) following manufacturer's instructions. After DNAse I treatment, equal volumes of RNA were retro-transcribed in the presence of an equimolar mixture of oligo dT and random hexamer, using Super Script III (Invitrogen). For the statistics of polysome fractionation qRT-PCR analyses, the raw Ct value for each of the individual fractions was transformed to 2.sup.Ct and normalized to the sum total for all fractions, generating a percentage of total transcript within each fraction. Each fraction's values were aggregated into different categories corresponding to different phases of polysome assembly on a total RNA absorbance curve. For qRT-PCR analysis we followed a previously published method (Matthew L. Kraushar et al. PNAS 2014). Briefly: fractions 1 and 2 were summed into 40S-60S; fractions 3 and 4 were summed into 80S; fractions 5-7 were summed into light; fractions 8-10 were summed into medium and fractions 11-13 were summed into heavy-corresponding to peaks on total RNA absorbance curves monitored during fractionation. For significance testing of qRT-PCR data, t tests were conducted between Empty vector and t-NAT-expressing cells in each category, with p<0.05 considered significant, s.d. is shown as error bars in figures.

    Bioinformatic Analysis

    [0268] Bedtools v2.2, Python 2.7.5 and R v.3.1.1 were used extensively during analysis. All plots were produced using R package ggplot2 and data processing was done using dplyr and tidyr.

    Combining all Transcript Exons into Single Gene Annotations

    [0269] For each gene a single non-overlapping list of exons was created, by merging exons from all transcripts. Each exon was defined as either 5UTR, 3UTR or CDS using GENCODE v19 comprehensive (hg19 build) annotations (http://www.gencodegenes.org/releases/19.html). All exons with multiple annotations were preferentially defined as either 5UTR or 3UTR. All further analysis utilized this annotation.

    Identifying Overlapping lncRNAProtein-Coding Gene S-AS Pairs and Defining Gene Groups

    [0270] For the identification of additional translational repressor candidates, we searched for GENCODE v19 transcripts that were non-coding RNAs and overlap the 5 UTR, CDS or 3 UTR of coding transcripts in a head-to-head configuration. All protein-coding genes were intersected with lncRNAs from GENCODE v19 and these lncRNAs were then checked for overlaps with MIR elements from RepeatMasker (repeatmasker.org). These intersections were used to create the following groups: [0271] All protein coding genes [0272] Protein coding genes without lncRNA overlap [0273] Protein coding genes with lncRNA overlap [0274] Protein coding genes that overlap lncRNA that include MIR elements [0275] Protein coding genes that overlap lncRNA that do not include MIR elements

    [0276] Various analyses were applied to these groups, namely:

    Calculating an Estimate of Gene Feature Length Relative to Exon Number

    [0277] From the non-overlapping exon annotation we were able to calculate a normalized number of exons per gene region (5UTR, 3UTR or CDS) by dividing the total number of exons within all gene transcripts by the sum of transcripts. This value was used to divide by the total length of gene region to estimate the length of feature compared to the number of exons. A one-way ANOVA followed by Dunnett's multiple comparison test was performed on the different gene groups to determine if the distributions between groups were significantly different.

    Predicting Secondary Structures for Protein-Coding Gene UTRs

    [0278] For each gene the longest 5UTR and 3UTR were selected as representative for the gene. RNAfold v2.1.9 from the ViennaRNA Package was used to predict the minimum free energy (mfe) of the secondary structure (kcal/mol). A one-way ANOVA followed by Dunnett's multiple comparison test was performed on the different gene groups to determine if the distributions between groups were significantly different.

    Calculating the MIR Element Nucleotide Overlap Per Transcript

    [0279] The non-overlapping length of each gene feature or lncRNA transcript was divided by the number of base pairs overlapping a RepeatMasker defined MIR repeat element. This provided an indication of relative abundance of MIR elements across the human transcriptome.

    Gene Expression Analysis of Postmortem Brain Tissue

    [0280] Post mortem, total RNA sequence data was aligned using the STAR aligner v2.3 with default settings and GENCODE annotations. Gene counts and FPKM values were calculated based on the non-overlapping annotation for each gene using Bedtools v2.2 and custom python scripts. All regions were merged into a single mean value to describe whole brain expression of protein-coding genes.

    Statistical Analysis

    [0281] Statistical analyses were performed using GraphPad PRISM5. A paired two-tailed Student's t-test was performed when comparing two categories. When more than two groups were compared, one-way ANOVA followed by a Dunnett's multiple comparison test was used. Results are mean (n3) standard deviation (s.d.).

    [0282] Stable expression in cell lines can be used to characterize the effect of overexpression of the other MIR-lncRNAs, identified as described herein.

    Multialignment of MIR Elements

    [0283] Multialignment of MIR elements of different subfamilies, here shown in inverse orientation with the CORE-SINE underlined.

    [0284] CLUSTAL format alignment by MAFFT (v7.293)

    TABLE-US-00018 MIRc aataataataaccccttacatttgtatagcactttacagtttacaaagcgct-------- MIRb aat----aatagagctaccatttattgagcgc-ttactgtgtgccaggcactgtgctaag MIR --------taataaccaacatttattgagcgc-ttactatgtgccaggcactgttctaag MIR3 ------------------------------------------------------------t MIRc ---ttcacatacattatctcat------ttgatcctcacaacaaccctgtgaggtaggca MIRb cgctttacatgcattatctcat------ttaatcctcacaacaaccctgcgaggtagg-- MIR cgctttacatgtattaactcat------ttaatcctcacaacaaccctatgaggtaggta MIR3 ttttttagaatcatagaatcatagaatgttagagctggaagggaccttagagatcatcta **.* *.** .******..** . *. .***.*. ... .* MIRc gggcaggtattattatccccattttacagatgagg-aaactgaggctcagagaggttaag MIRb -------tattattatccccattttacagatgagg-aaactgaggctcagagaggttaag MIR ------ctattattatccccattttacagatgagg-aaactgaggcacagagaggttaag MIR3 -------gtccaacccnctcattttacagatgaggaaaactgaggcccagagaggtgaag ..* . . *.**************** ********** ********* *** MIRc tgacttgcccaaggtcacacagctagtaagtggcagagccaggactcgaacccaggtctt MIRb tgacttgcccaaggtcacacagctagtaagtggcagagccaggattcgaacccaggtctg MIR taacttgcccaaggtcacacagctagtaagtggcagagccgggattcgaacccaggca-g MIR3 tgacttgcccaaggtcacacagctagttagtggcagagctaggactagaacccaggtc-t *.************************* ***********..***.* *********. MIRc cctgactccaagtccag-tgctctt-tccactgcaccacactgcctcg---- MIRb cctgactccaaagcccg-tgctctt-tccactgcaccacgctgcccctctg- MIR tctggctccagagtccg-tgctcttaaccactatgctatactgt-------- MIR3 cctgactcctagtccagttgttctt-tccactataccatactgcttccagaa .***.**** .. .* * **.*********...*.*..***.

    TABLE-US-00019 TABLE 1 Antisense orientation MIR-lncRNA genes Kmer kmer Known Orientation from kmer in in kmer Known motif target exon of MIR- UTR UTR kmer 18s kmer 18s 18s motif Adjusted lnc target_gene gene name type repeat lncRNA posn orientatn posn status orientatn pvalue pval LENSG00000234775.1 ENSG00000163485 ADORA1 5P Anti TTCCTTT [551, [F, [114, [I, [F, 2.32E80 9.53E78 201] R] 1193] A] R] LENSG00000234775.1 ENSG00000163485 ADORA1 5P Anti ATTCCTT [202] [R] [1194] [A] [R] 3.15E43 4.31E41 LENSG00000234775.1 ENSG00000163485 ADORA1 5P Anti TATTCCT [203] [R] [857] [A] [R] 5.34E43 5.49E41 LENSG00000244968.2 ENSG00000113594 LIFR 5P Anti TCTTAAT [177] [R] [915] [A] [R] 1.44E38 8.44E37 LENSG00000117543.15 ENSG00000269175 AC093157.1 5P Anti ATGCTTT [779, [F, [995] [A] [R] 1.12E35 5.13E34 204] R] LENSG00000257913.1 ENSG00000181929 PRKAG1 5P Same ATGCTTT [225, [F, [995] [A] [R] 1.12E35 5.13E34 249] R] LENSG00000177640.11 ENSG00000107560 RAB11FIP2 5P Anti TTTGGTT [539] [R] [1143] [A] [R] 8.19E31 2.81E29 LENSG00000271122.1 ENSG00000122557 HERPUD2 5P Same TTTGGTT [440] [R] [1143] [A] [R] 8.19E31 2.81E29 LENSG00000177640.11 ENSG00000107560 RAB11FIP2 5P Same TTTGGTT [539] [R] [1143] [A] [R] 8.19E31 2.81E29 LENSG00000267163.1 ENSG00000267680 ZNF224 5P Anti CTGCTTT [394] [F] [824] [A] [R] 1.88E30 5.95E29 LENSG00000267163.1 ENSG00000267680 ZNF224 5P Same CTGCTTT [394] [F] [824] [A] [R] 1.88E30 5.95E29 LENSG00000233251.3 ENSG00000055813 CCDC85A 5P Anti TTCCATT [190] [R] [863] [A] [R] 9.26E27 2.38E25 LENSG00000227218.3 ENSG00000136908 DPM2 5P Anti TTCCATT [778] [F] [863] [A] [R] 9.26E27 2.38E25 LENSG00000272405.1 ENSG00000132692 BCAN 5P Anti GTTTATG [2019] [F] [1078] [A] [R] 2.60E25 5.63E24 LENSG00000241764.3 ENSG00000105879 CBLL1 5P Same CCTCTTA [125] [F] [917] [A] [R] 1.86E24 3.82E23 LENSG00000231105.1 ENSG00000117298 ECE1 5P Anti TGCTTTG [87] [F] [823] [A] [R] 7.71E23 1.38E21 LENSG00000179988.9 ENSG00000119965 C10orf88 5P Anti TGCTTTG [132] [F] [823] [A] [R] 7.71E23 1.38E21 LENSG00000231105.1 ENSG00000117298 ECE1 5P Same TGCTTTG [87] [F] [823] [A] [R] 7.71E23 1.38E21 LENSG00000257913.1 ENSG00000181929 PRKAG1 5P Same TGCTTTG [226] [F] [823] [A] [R] 7.71E23 1.38E21 LENSG00000264177.1 ENSG00000214860 EVPLL 5P Same TGGTTTC [3739] [F] [1141] [A] [R] 2.94E17 3.78E16 LENSG00000244968.2 ENSG00000113594 LIFR 5P Anti CTCTTAA [178] [R] [916] [A] [R] 2.71E16 2.93E15 LENSG00000203808.6 ENSG00000112276 BVES 5P Anti TTAAGTT [48] [R] [1188] [A] [R] 9.76E16 1.00E14 LENSG00000177917.6 ENSG00000196504 PRPF40A 5P Anti TTTGAAC [206] [R] [820] [A] [R] 3.12E14 2.99E13 LENSG00000177406.4 ENSG00000171840 NINJ2 5P Anti CTTTGCA [131, [F, [1177] [A] [R] 7.96E14 7.44E13 199] R] LENSG00000177406.4 ENSG00000171840 NINJ2 5P Same CTTTGCA [131, [F, [1177] [A] [R] 7.96E14 7.44E13 199] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti CCTGCTT [696, [F, [825] [A] [R] 1.75E13 1.56E12 1227] F] LENSG00000240207.2 ENSG00000118849 PARRES1 5P Same CCTGCTT [307] [F] [825] [A] [R] 1.75E13 1.56E12 LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same CCTGCTT [696, [F, [825] [A] [R] 1.75E13 1.56E12 1227] F] LENSG00000161040.12 ENSG00000128606 LRRC17 5P Same CCTGCTT [302] [F] [825] [A] [R] 1.75E13 1.56E12 LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti TCCCTCT [280] [F] [432, [I, [R, 7.85E13 6.72E12 919, A, R, 1445] I] R] LENSG00000186615.6 ENSG00000126777 KTN1 5P Same TCCCTCT [280] [F] [432, [I, [R, 7.85E13 6.72E12 919, A, R, 1445] I] R] LENSG00000267757.1 ENSG00000125746 EML2 5P Same TCCCTCT [182] [R] [432, [I, [R, 7.85E13 6.72E12 919, A, R, 1445] I] R] LENSG00000255282.2 ENSG00000196611 MMP1 5P Anti TTTGCAA [15] [R] [1176] [A] [R] 1.94E12 1.57E11 LENSG00000255282.2 ENSG00000196611 MMP1 5P Same TTTGCAA [15] [R] [1176] [A] [R] 1.94E12 1.57E11 LENSG00000228384.3 ENSG00000144043 TEX261 5P Anti GTTCTTG [726] [F] [1025] [A] [R] 4.69E11 3.44E10 LENSG00000236295.1 ENSG00000223874 AC007557.1 5P Same TTAATCA [650] [R] [1020, [A, [F, 9.74E11 6.67E10 913, A, R, 1672] I] R] LENSG00000236364.2 ENSG00000143179 UCK2 5P Same CTTTGAA [647] [F] [802, [I, [F, 1.13E10 7.62E10 821] A] R] LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same CTTTGAA [360, [F, [802, [I, [F, 1.13E10 7.62E10 371] F] 821] A] R] LENSG00000225465.6 ENSG00000128250 RFPL1 5P Anti CTTTGGT [385] [F] [117, [I, [F, 1.47E10 9.75E10 283, I, F, 1144] A] R] LENSG00000259673.1 ENSG00000189227 C15orf61 5P Anti TTCTTGA [392] [R] [1024] [A] [R] 1.75E10 1.11E09 LENSG00000259673.1 ENSG00000189227 C15orf61 5P Same TTCTTGA [392] [R] [1024] [A] [R] 1.75E10 1.11E09 LENSG00000272578.1 ENSG00000159496 RGL4 5P Anti TCGTCTT [201] [R] [1048] [A] [R] 3.37E10 2.04E09 LENSG00000228315.7 ENSG00000159496 RGL4 5P Anti TCGTCTT [201] [R] [1048] [A] [R] 3.37E10 2.04E09 LENSG00000272578.1 ENSG00000159496 RGL4 5P Same TCGTCTT [201] [R] [1048] [A] [R] 3.37E10 2.04E09 LENSG00000228315.7 ENSG00000159496 RGL4 5P Same TCGTCTT [201] [R] [1048] [A] [R] 3.37E10 2.04E09 LENSG00000233175.2 ENSG00000184922 FMNL1 5P Anti ATTTCAC [423] [F] [958] [A] [R] 5.66E10 3.32E09 LENSG00000273485.1 ENSG00000138172 CALHM2 5P Anti TTCCTAG [780] [F] [855] [A] [R] 5.79E09 3.35E08 LENSG00000273485.1 ENSG00000138172 CALHM2 5P Same TTCCTAG [780] [F] [855] [A] [R] 5.79E09 3.35E08 LENSG00000059915.12 ENSG00000107872 FBXL15 5P Anti CACCTCT [272] [R] [954] [A] [R] 2.39E08 1.24E07 LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti AATTCCT [1330] [F] [1195, [A, [R, 5.34E08 2.68E07 1636] I] R] LENSG00000228384.3 ENSG00000144043 TEX261 5P Anti AATTCCT [1921] [R] [1195, [A, [R, 5.34E08 2.68E07 1636] I] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same AATTCCT [1330] [F] [1195, [A, [R, 5.34E08 2.68E07 1636] I] R] LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti CCATTAT [24] [R] [861] [A] [R] 8.13E08 4.03E07 LENSG00000186615.6 ENSG00000126777 KTN1 5P Same CCATTAT [24] [R] [861] [A] [R] 8.13E08 4.03E07 LENSG00000117543.15 ENSG00000269175 AC093157.1 5P Anti AATGCTT [778] [F] [996] [A] [R] 9.00E08 4.35E07 LENSG00000273485.1 ENSG00000138172 CALHM2 5P Anti AATGCTT [396] [R] [996] [A] [R] 9.00E08 4.35E07 LENSG00000272405.1 ENSG00000132692 BCAN 5P Anti AATGCTT [1979] [F] [996] [A] [R] 9.00E08 4.35E07 LENSG00000273485.1 ENSG00000138172 CALHM2 5P Same AATGCTT [396] [R] [996] [A] [R] 9.00E08 4.35E07 LENSG00000226482.1 ENSG00000181092 ADIPOQ 5P Same AATGCTT [2562] [F] [996] [A] [R] 9.00E08 4.35E07 LENSG00000126226.17 ENSG00000139842 CUL4A 5P Anti AGACTTT [237] [R] [1147] [A] [R] 1.04E07 4.98E07 LENSG00000245482.2 ENSG00000139133 ALG10 5P Anti AGACTTT [740] [F] [1147] [A] [R] 1.04E07 4.98E07 LENSG00000245482.2 ENSG00000139133 ALG10 5P Anti GAATTTC [654] [F] [960] [A] [R] 2.79E07 1.32E06 LENSG00000234327.3 ENSG00000167840 ZNF232 5P Anti GAATTTC [145] [F] [960] [A] [R] 2.79E07 1.32E06 LENSG00000272578.1 ENSG00000159496 RGL4 5P Anti TACTCCC [189] [R] [1166] [A] [R] 1.22E06 5.44E06 LENSG00000228315.7 ENSG00000159496 RGL4 5P Anti TACTCCC [189] [R] [1166] [A] [R] 1.22E06 5.44E06 LENSG00000272578.1 ENSG00000159496 RGL4 5P Same TACTCCC [189] [R] [1166] [A] [R] 1.22E06 5.44E06 LENSG00000228315.7 ENSG00000159496 RGL4 5P Same TACTCCC [189] [R] [1166] [A] [R] 1.22E06 5.44E06 LENSG00000231105.1 ENSG00000117298 ECE1 5P Anti TCACCTC [150] [R] [955] [A] [R] 3.88E06 1.64E05 LENSG00000231105.1 ENSG00000117298 ECE1 5P Same TCACCTC [150] [R] [955] [A] [R] 3.88E06 1.64E05 LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti AAGTTTC [431, [R, [1186] [A] [R] 6.73E06 2.80E05 1407] R] LENSG00000260852.1 ENSG00000099364 FBXL19 5P Anti CCCTTCC [131] [R] [1205] [A] [R] 6.73E06 2.80E05 LENSG00000259673.1 ENSG00000189227 C15orf61 5P Anti AAGTTTC [1136] [F] [1186] [A] [R] 6.73E06 2.80E05 LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same AAGTTTC [431, [R, [1186] [A] [R] 6.73E06 2.80E05 1407] R] LENSG00000259673.1 ENSG00000189227 C15orf61 5P Same AAGTTTC [1136] [F] [1186] [A] [R] 6.73E06 2.80E05 LENSG00000260852.1 ENSG00000099364 FBXL19 5P Same CCCTTCC [131] [R] [1205] [A] [R] 6.73E06 2.80E05 LENSG00000267757.1 ENSG00000125746 EML2 5P Same CCCTTCC [45] [R] [1205] [A] [R] 6.73E06 2.80E05 LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti TCCATTA [25, [R, [862] [A] [R] 1.29E05 5.23E05 68, R, 945] R] LENSG00000186615.6 ENSG00000126777 KTN1 5P Same TCCATTA [25, [R, [862] [A] [R] 1.29E05 5.23E05 68, R, 945] R] LENSG00000235703.1 ENSG00000197021 CXorf40B 5P Anti ACACTCT [372] [R] [815] [A] [R] 2.04E05 8.04E05 LENSG00000235703.1 ENSG00000197021 CXorf40B 5P Same ACACTCT [372] [R] [815] [A] [R] 2.04E05 8.04E05 LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same CACTCCT [306] [F] [1219] [A] [R] 3.83E05 0.000145853 LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti CTCAGTT [877, [F, [902] [A] [R] 4.11E05 0.000152089 1253, F, 942] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same CTCAGTT [877, [F, [902] [A] [R] 4.11E05 0.000152089 1253, F, 942] R] LENSG00000188735.8 ENSG00000139725 RHOF 5P Same CTCAGTT [59] [R] [902] [A] [R] 4.11E05 0.000152089 LENSG00000213904.4 ENSG00000079435 LIPE 5P Same CTCAGTT [17] [R] [902] [A] [R] 4.11E05 0.000152089 LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same CTCAGTT [272] [F] [902] [A] [R] 4.11E05 0.000152089 LENSG00000264177.1 ENSG00000214860 EVPLL 5P Same ATTAATG [3759, [F, [1018] [A] [R] 0.000166266 0.000560125 3758] R] LENSG00000272578.1 ENSG00000159496 RGL4 5P Anti CGTCTTC [200] [R] [1047, [A, [R, 0.000628772 0.0020674 1788] I] R] LENSG00000228315.7 ENSG00000159496 RGL4 5P Anti CGTCTTC [200] [R] [1047, [A, [R, 0.000628772 0.0020674 1788] I] R] LENSG00000272578.1 ENSG00000159496 RGL4 5P Same CGTCTTC [200] [R] [1047, [A, [R, 0.000628772 0.0020674 1788] I] R] LENSG00000228315.7 ENSG00000159496 RGL4 5P Same CGTCTTC [200] [R] [1047, [A, [R, 0.000628772 0.0020674 1788] I] R] LENSG00000225988.1 ENSG00000125869 LAMP5 5P Same TCAGCTT [133] [F] [1181] [A] [R] 0.000662996 0.00216263 LENSG00000233251.3 ENSG00000055813 CCDC85A 5P Anti ATTCCAT [191] [R] [864] [A] [R] 0.00168596 0.00528953 LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Anti ACTTTGG [436] [R] [1145] [A] [R] 0.00187758 0.00580216 LENSG00000181513.10 ENSG00000161714 PLCD3 5P Anti ACTCCTG [174] [F] [1218] [A] [R] 0.00187583 0.00580216 LENSG00000181513.10 ENSG00000161714 PLCD3 5P Same ACTCCTG [174] [F] [1218] [A] [R] 0.00187583 0.00580216 LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Same ACTTTGG [436] [R] [1145] [A] [R] 0.00187758 0.00580216 LENSG00000225855.2 ENSG00000160753 RUSC1 5P Same ACTCCCC [28] [R] [1165] [A] [R] 0.00214599 0.00658209 LENSG00000255808.1 ENSG00000186642 PDE2A 5P Anti CTCCCCC [297, [F, [1164] [A] [R] 0.00369813 0.0112588 437] F] LENSG00000255808.1 ENSG00000186642 PDE2A 5P Same CTCCCCC [297, [F, [1164] [A] [R] 0.00369813 0.0112588 437] F] LENSG00000233175.2 ENSG00000184922 FMNL1 5P Anti CCATACT [123] [F] [1169] [A] [R] 0.00389968 0.0117851 LENSG00000225465.6 ENSG00000128250 RFPL1 5P Anti ACTCTAA [557] [R] [813] [A] [R] 0.0105982 0.0313372 LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti TCTTCGA [1027] [F] [1045] [A] [R] 0.0108958 0.0319188 LENSG00000227375.1 ENSG00000075711 DLG1 5P Anti TCTTCGA [114] [R] [1045] [A] [R] 0.0108958 0.0319188 LENSG00000186615.6 ENSG00000126777 KTN1 5P Same TCTTCGA [1027] [F] [1045] [A] [R] 0.0108958 0.0319188 LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti GTCTTCG [1026] [F] [1046] [A] [R] 0.0148888 0.0424952 LENSG00000186615.6 ENSG00000126777 KTN1 5P Same GTCTTCG [1026] [F] [1046] [A] [R] 0.0148888 0.0424952 LENSG00000117543.15 ENSG00000269175 AC093157.1 5P Anti AAATGCT [777] [F] [997] [A] [R] 0.0172869 0.0489996 LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Anti AAATGCT [953] [F] [997] [A] [R] 0.0172869 0.0489996 LENSG00000273485.1 ENSG00000138172 CALHM2 5P Anti AAATGCT [397] [R] [997] [A] [R] 0.0172869 0.0489996 LENSG00000272405.1 ENSG00000132692 BCAN 5P Anti AAATGCT [1978] [F] [997] [A] [R] 0.0172869 0.0489996 LENSG00000273485.1 ENSG00000138172 CALHM2 5P Same AAATGCT [397] [R] [997] [A] [R] 0.0172869 0.0489996 LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Same AAATGCT [953] [F] [997] [A] [R] 0.0172869 0.0489996 LENSG00000261519.2 ENSG00000166548 TK2 5P Anti TTGAACA [43] [F] [819] [A] [R] 0.0242818 0.06789 LENSG00000141140.12 ENSG00000184886 PIGW 5P Anti CCACTCC [30] [F] [490, [I, [F, 0.0331242 0.0895662 1220] A] R] LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti CTCTGGT [315, [F, [986] [A] [R] 0.0346318 0.0930306 1866] R] LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same CTCTGGT [315, [F, [986] [A] [R] 0.0346318 0.0930306 1866] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti CCTCAGT [876, [F, [903] [A] [R] 0.0442964 0.11822 1252, F, 263, R, 943] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same CCTCAGT [876, [F, [903] [A] [R] 0.0442964 0.11822 1252, F, 263, R, 943] R] LENSG00000188735.8 ENSG00000139725 RHOF 5P Same CCTCAGT [60] [R] [903] [A] [R] 0.0442964 0.11822 LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same CCTCAGT [271, [F, [903] [A] [R] 0.0442964 0.11822 14] R] LENSG00000100911.9 ENSG00000092098 RNF31 5P Same GCCCTTC [291] [R] [1206] [A] [R] 0.0458354 0.121538 LENSG00000221817.5 ENSG00000166348 USP54 5P Anti AACCTCC [3410, [F, [1039] [A] [R] 0.143866 0.355053 4401, F, 1240] R] LENSG00000125967.12 ENSG00000149609 C20orf144 5P Same TCTGGTC [392] [R] [985] [A] [R] 0.143357 0.355053 LENSG00000258520.1 ENSG00000100626 GALNT16 5P Anti TAGCTGC [10] [R] [851] [A] [R] 0.156979 0.379521 LENSG00000160401.10 ENSG00000187024 PTRH1 5P Anti TGCCCCC [9] [R] [931] [A] [R] 0.315839 0.737556 LENSG00000198910.8 ENSG00000196987 LCA10 5P Anti TGCCCCC [481] [F] [931] [A] [R] 0.315839 0.737556 LENSG00000160401.10 ENSG00000187024 PTRH1 5P Same TGCCCCC [9] [R] [931] [A] [R] 0.315839 0.737556 LENSG00000267163.1 ENSG00000267680 ZNF224 5P Anti CAGTTCC [405] [R] [900] [A] [R] 0.353881 0.817107 LENSG00000267163.1 ENSG00000267680 ZNF224 5P Same CAGTTCC [405] [R] [900] [A] [R] 0.353881 0.817107 LENSG00000228322.1 ENSG00000107249 GLIS3 5P Same CAGTTCC [129] [F] [900] [A] [R] 0.353881 0.817107 LENSG00000261460.1 ENSG00000213614 HEXA 5P Anti GGAATAA [330] [R] [858, [A, [F, 0.991811 1 1110, A, R, 1620] I] R] LENSG00000272476.1 ENSG00000025796 SEC63 5P Anti GGAATAA [85] [R] [858, [A, [F, 0.991811 1 1110, A, R, 1620] I] R] LENSG00000261460.1 ENSG00000213614 HEXA 5P Same GGAATAA [330] [R] [858, [A, [F, 0.991811 1 1110, A, R, 1620] I] R] LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Anti CAAGAAT [1299] [R] [1006, [A, [F, 0.999998 1 963] A] R] LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Anti CCAAGAA [1194] [F] [1005, [A, [F, 1 1 964] A] R] LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Same CAAGAAT [1299] [R] [1006, [A, [F, 0.999998 1 963] A] R] LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Same CCAAGAA [1194] [F] [1005, [A, [F, 1 1 964] A] R] LENSG00000261460.1 ENSG00000213614 HEXA 5P Anti GGGAATA [331] [R] [1111, [A, [R, 0.999982 1 1621] I] R] LENSG00000273485.1 ENSG00000138172 CALHM2 5P Anti GGCCTCA [50] [R] [905, [A, [R, 0.99998 1 1732] I] R] LENSG00000267769.1 ENSG00000167671 UBXN6 5P Anti GGCCTCA [141] [F] [905, [A, [R, 0.99998 1 1732] I] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti GGCCTCA [874, [F, [905, [A, [R, 0.99998 1 1250, F, 1732] I] R] 1051] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same GGCCTCA [874, [F, [905, [A, [R, 0.99998 1 1250, F, 1732] I] R] 1051] R] LENSG00000261460.1 ENSG00000213614 HEXA 5P Same GGGAATA [331] [R] [1111, [A, [R, 0.999982 1 1621] I] R] LENSG00000273485.1 ENSG00000138172 CALHM2 5P Same GGCCTCA [50] [R] [905, [A, [R, 0.99998 1 1732] I] R] LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same GGCCTCA [269] [F] [905, [A, [R, 0.99998 1 1732] I] R] LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same TGGGAAT [339] [F] [1112, [A, [R, 0.875691 1 1640] I] R] LENSG00000255119.1 ENSG00000184224 C11orf72 5P Same GCTCCAC [5] [R] [1223, [A, [R, 0.964162 1 1348] I] R] LENSG00000125967.12 ENSG00000149609 C20orf144 5P Same GGCCTCA [319] [F] [905, [A, [R, 0.99998 1 1732] I] R] LENSG00000261460.1 ENSG00000213614 HEXA 5P Anti GGCAAAT [60] [R] [1000] [A] [R] 0.999583 1 LENSG00000273151.1 ENSG00000239857 GET4 5P Anti CCCAAAG [5916, [F, [1152] [A] [R] 0.999991 1 1502, R, 5419] R] LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti AACAAAA [1766] [F] [886] [A] [R] 1 1 LENSG00000235703.1 ENSG00000197021 CXorf40B 5P Anti GCCTCAG [590] [R] [904] [A] [R] 0.999754 1 LENSG00000137497.13 ENSG00000184154 LRTOMT 5P Anti GAACCCA [459, [F, [1155] [A] [R] 0.999837 1 513] F] LENSG00000245482.2 ENSG00000139133 ALG10 5P Anti TCCAAGA [420, [F, [965] [A] [R] 0.999992 1 677, F, 1893] R] LENSG00000233175.2 ENSG00000184922 FMNL1 5P Anti GGGCCTG [561, [F, [828] [A] [R] 1 1 191] R] LENSG00000233175.2 ENSG00000184922 FMNL1 5P Anti TGGCAAA [1] [F] [1001] [A] [R] 1 1 LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Anti TCCAAGA [167] [F] [965] [A] [R] 0.999992 1 LENSG00000247708.3 ENSG00000168818 STX18 5P Anti CTAGCTG [217] [F] [852] [A] [R] 0.986328 1 LENSG00000273485.1 ENSG00000138172 CALHM2 5P Anti GCCTCAG [49] [R] [904] [A] [R] 0.999754 1 LENSG00000273485.1 ENSG00000138172 CALHM2 5P Anti CAAATGC [398] [R] [998] [A] [R] 0.971655 1 LENSG00000168569.7 ENSG00000162227 TAF6L 5P Anti AAGCTGC [222] [R] [1130] [A] [R] 0.999922 1 LENSG00000267769.1 ENSG00000167671 UBXN6 5P Anti CGGCTCG [306, [F, [834] [A] [R] 1 1 68] R] LENSG00000132581.5 ENSG00000109111 SUPT6H 5P Anti GAAAACA [138] [R] [1012] [A] [R] 1 1 LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti AGCTGCC [1220] [F] [1129] [A] [R] 0.999972 1 LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti GCCTCAG [875, [F, [904] [A] [R] 0.999754 1 1251, F, 944] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti TGGCCTC [873, [F, [906] [A] [R] 0.804552 1 1052] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti GCTGCCC [1221] [F] [1128] [A] [R] 1 1 LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti CTCCTGG [1298] [F] [1217] [A] [R] 0.983765 1 LENSG00000248724.2 ENSG00000113971 NPHP3 5P Anti ATGAAAA [1799] [F] [1014] [A] [R] 0.999366 1 LENSG00000245330.4 ENSG00000155792 DEPTOR 5P Anti AAAATAG [221] [R] [883] [A] [R] 0.99597 1 LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti CAAAGAC [1082] [F] [1150] [A] [R] 1 1 LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti CTTCGAA [1028] [F] [1044] [A] [R] 0.478428 1 LENSG00000198910.8 ENSG00000196987 LCA10 5P Anti GGTGCCC [468] [F] [1209] [A] [R] 0.999997 1 LENSG00000198910.8 ENSG00000196987 LCA10 5P Anti GGGCCTG [436] [F] [828] [A] [R] 1 1 LENSG00000196220.11 ENSG00000134077 THUMPD3 5P Anti TCCAAGA [315] [R] [965] [A] [R] 0.999992 1 LENSG00000255808.1 ENSG00000186642 PDE2A 5P Anti GCCGCAT [704] [R] [1099] [A] [R] 0.967908 1 LENSG00000272405.1 ENSG00000132692 BCAN 5P Anti GGAACCC [2047] [F] [1156] [A] [R] 1 1 LENSG00000178803.6 ENSG00000128271 ADORA2A 5P Anti GGAACCC [210] [F] [1156] [A] [R] 1 1 LENSG00000251405.2 ENSG00000172548 NIPAL4 5P Anti CAAAGAC [9] [R] [1150] [A] [R] 1 1 LENSG00000137133.6 ENSG00000137103 TMEM8B 5P Anti GAAGCTG [984] [R] [1131] [A] [R] 1 1 LENSG00000258584.1 ENSG00000140067 FAM181A 5P Anti GCTCTGG [53, [R, [987] [A] [R] 0.999869 1 482] R] LENSG00000227218.3 ENSG00000136908 DPM2 5P Anti ATGGGAA [739] [F] [1113] [A] [R] 1 1 LENSG00000178803.6 ENSG00000100024 UPB1 5P Anti CCCAAAG [152, [F, [1152] [A] [R] 0.999991 1 432] F] LENSG00000205913.2 ENSG00000167978 SRKM2 5P Anti GGGCCTG [141] [R] [828] [A] [R] 1 1 LENSG00000225988.1 ENSG00000125869 LAMP5 5P Same ACAAAAT [394, [R, [885] [A] [R] 0.99847 1 404, R, 419] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same AGCTGCC [1220] [F] [1129] [A] [R] 0.999972 1 LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same GCCTCAG [875, [F, [904] [A] [R] 0.999754 1 1251, F, 944] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same TGGCCTC [873, [F, [906] [A] [R] 0.804552 1 1052] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same GCTGCCC [1221] [F] [1128] [A] [R] 1 1 LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same CTCCTGG [1298] [F] [1217] [A] [R] 0.983765 1 LENSG00000188735.8 ENSG00000139725 RHOF 5P Same GCCTCAG [61] [R] [904] [A] [R] 0.999754 1 LENSG00000262999.1 ENSG00000188897 CTD- 5P Same GAATGCC [208] [R] [934] [A] [R] 0.999931 1 3088G3.8 LENSG00000235703.1 ENSG00000197021 CXorf40B 5P Same GCCTCAG [590] [R] [904] [A] [R] 0.999754 1 LENSG00000258334.1 ENSG00000135406 PRPH 5P Same AGCTGCC [10] [R] [1129] [A] [R] 0.999972 1 LENSG00000258334.1 ENSG00000135406 PRPH 5P Same GGAAGCT [13] [R] [1132] [A] [R] 1 1 LENSG00000258334.1 ENSG00000135406 PRPH 5P Same GAAGCTG [12] [R] [1131] [A] [R] 1 1 LENSG00000264177.1 ENSG00000214860 EVPLL 5P Same CCTGGTG [211, [F, [1215] [A] [R] 0.999063 1 1080, R, 2618] R] LENSG00000261460.1 ENSG00000213614 HEXA 5P Same GGCAAAT [60] [R] [1000] [A] [R] 0.999583 1 LENSG00000178803.6 ENSG00000128271 ADOPA2A 5P Same GGAACCC [210] [F] [1156] [A] [R] 1 1 LENSG00000260625.1 ENSG00000140688 C16orf58 5P Same GCCTCAG [374] [F] [904] [A] [R] 0.999754 1 LENSG00000178803.6 ENSG00000100024 UPB1 5P Same CCCAAAG [152, [F, [1152] [A] [R] 0.999991 1 432] F] LENSG00000273485.1 ENSG00000138172 CALHM2 5P Same GCCTCAG [49] [R] [904] [A] [R] 0.999754 1 LENSG00000273485.1 ENSG00000138172 CALHM2 5P Same CAAATGC [398] [R] [998] [A] [R] 0.971655 1 LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same AACACTC [304] [F] [816] [A] [R] 0.558887 1 LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same GCCTCAG [270] [F] [904] [A] [R] 0.999754 1 LENSG00000168569.7 ENSG00000162227 TAF6L 5P Same AAGCTGC [222] [R] [1130] [A] [R] 0.999922 1 LENSG00000196220.11 ENSG00000134077 THUMPD3 5P Same TCCAAGA [315] [R] [965] [A] [R] 0.999992 1 LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same AACAAAA [1766] [F] [886] [A] [R] 1 1 LENSG00000226482.1 ENSG00000181092 ADIPOQ 5P Same ACAAAAT [2619] [F] [885] [A] [R] 0.99847 1 LENSG00000226482.1 ENSG00000181092 ADIPOQ 5P Same GCTCTGG [2463] [F] [987] [A] [R] 0.999869 1 LENSG00000226482.1 ENSG00000181092 ADIPOQ 5P Same CAAAATA [1801, [F, [884] [A] [R] 0.947478 1 2620] F] LENSG00000226482.1 ENSG00000181092 ADIPOQ 5P Same GCCTCAG [2532, [F, [904] [A] [R] 0.999754 1 1283, R, 2002] R] LENSG00000226482.1 ENSG00000181092 ADIPOQ 5P Same AAAATAG [2621] [F] [883] [A] [R] 0.99597 1 LENSG00000255119.1 ENSG00000184224 C11orf72 5P Same ACAAAAT [246] [R] [885] [A] [R] 0.99847 1 LENSG00000254602.1 ENSG00000166793 YPEL4 5P Same CTTGGCA [697, [F, [1003] [A] [R] 0.495606 1 144] R] LENSG00000258584.1 ENSG00000140067 FAM181A 5P Same GCTCTGG [53, [R, [987] [A] [R] 0.999869 1 482] R] LENSG00000137497.13 ENSG00000184154 LRTOMT 5P Same GAACCCA [459, [F, [1155] [A] [R] 0.999837 1 513] F] LENSG00000161040.12 ENSG00000128606 LRRC17 5P Same AAAATAG [383] [F] [883] [A] [R] 0.99597 1 LENSG00000266962.1 ENSG00000108786 HSD17B1 5P Same ACCAACA [665, [F, [889] [A] [R] 0.999995 1 1156, F, 1395] R] LENSG00000266962.1 ENSG00000108786 HSD17B1 5P Same TCTAGCG [587] [F] [950] [A] [R] 0.544959 1 LENSG00000266962.1 ENSG00000108786 HSD17B1 5P Same CCTGGTG [568] [F] [1215] [A] [R] 0.999063 1 LENSG00000266962.1 ENSG00000108786 HSD17B1 5P Same CTAGCGG [588] [F] [949] [A] [R] 0.999999 1 LENSG00000257985.1 ENSG00000257955 RP1- 5P Same GCAAATG [435] [F] [999] [A] [R] 0.976881 1 228P16.5 LENSG00000257985.1 ENSG00000257955 RP1- 5P Same CCCAAAG [204] [R] [1152] [A] [R] 0.999991 1 228P16.5 LENSG00000125967.12 ENSG00000149609 C20orf144 5P Same GCCTCAG [320] [F] [904] [A] [R] 0.999754 1 LENSG00000125967.12 ENSG00000149609 C20orf144 5P Same CTGGTCC [654] [R] [984] [A] [R] 0.993655 1 LENSG00000186615.6 ENSG00000126777 KTN1 5P Same CAAAGAC [1082] [F] [1150] [A] [R] 1 1 LENSG00000186615.6 ENSG00000126777 KTN1 5P Same CTTCGAA [1028] [F] [1044] [A] [R] 0.478428 1 LENSG00000247708.3 ENSG00000168818 STX18 5P Same CTAGCTG [217] [F] [852] [A] [R] 0.986328 1 LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Same TCCAAGA [167] [F] [965] [A] [R] 0.999992 1 LENSG00000251405.2 ENSG00000172548 NIPAL4 5P Same CAAAGAC [9] [R] [1150] [A] [R] 1 1 LENSG00000255808.1 ENSG00000186642 PDE2A 5P Same GCCGCAT [704] [R] [1099] [A] [R] 0.967908 1 LENSG00000255389.1 ENSG00000056972 TPAF3IP2 5P Anti CAGGCTC [486] [R] [437, [I, [R, 0.78438 1 1226] A] R] LENSG00000059915.12 ENSG00000107872 FBXL15 5P Anti AAAACCA [150] [F] [228, [I, [F, 1 1 892] A] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti CAGGCTC [1184] [F] [437, [I, [R, 0.78438 1 1226] A] R] LENSG00000272578.1 ENSG00000159496 RGL4 5P Anti AGGCTCC [162] [R] [436, [I, [R, 0.999943 1 1225] A] R] LENSG00000234775.1 ENSG00000163485 ADOPA1 5P Anti CAGGCTC [225] [R] [437, [I, [R, 0.78438 1 1226] A] R] LENSG00000228384.3 ENSG00000144043 TEX261 5P Anti GGGTCAT [2987] [F] [1655, [I, [F, 0.504667 1 1118] A] R] LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti CAGGCTC [1055] [F] [437, [I, [R, 0.78438 1 1226] A] R] LENSG00000228315.7 ENSG00000159496 RGL4 5P Anti AGGCTCC [162] [R] [436, [I, [R, 0.999943 1 1225] A] R] LENSG00000255389.1 ENSG00000056972 TPAF3IP2 5P Same CAGGCTC [486] [R] [437, [I, [R, 0.78438 1 1226] A] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same CAGGCTC [1184] [F] [437, [I, [R, 0.78438 1 1226] A] R] LENSG00000271122.1 ENSG00000122557 HERPUD2 5P Same GTGGTGC [1633] [F] [1324, [I, [F, 0.995808 1 1211] A] R] LENSG00000272578.1 ENSG00000159496 RGL4 5P Same AGGCTCC [162] [R] [436, [I, [R, 0.999943 1 1225] A] R] LENSG00000161040.12 ENSG00000128606 LRRC17 5P Same CATGGCC [413] [F] [1330, [I, [F, 0.998686 1 908] A] R] LENSG00000161040.12 ENSG00000128606 LRRC17 5P Same GGGTCAT [323] [F] [1655, [I, [F, 0.504667 1 1118] A] R] LENSG00000228315.7 ENSG00000159496 RGL4 5P Same AGGCTCC [162] [R] [436, [I, [R, 0.999943 1 1225] A] R] LENSG00000186615.6 ENSG00000126777 KTN1 5P Same CAGGCTC [1055] [F] [437, [I, [R, 0.78438 1 1226] A] R] LENSG00000234028.3 ENSG00000172071 EIF2AK3 5P Anti CCCGGCC [140] [R] [257, [I, [F, 0.999957 1 1265, I, F, 260, I, R, 927] A] R] LENSG00000115840.9 ENSG00000172878 METAP1D 5P Anti ACCAAAG [235] [F] [1144, [A, [F, NA NA 117, I, R, 283] I] R] LENSG00000115840.9 ENSG00000172878 METAP1D 5P Anti GGAAACC [925] [R] [1140, [A, [F, NA NA 1255, I, F, 1835] I] R] LENSG00000255542.1 ENSG00000110436 SLC1A2 5P Same CACCACC [228] [F] [1212, [A, [F, NA NA 1320, I, R, 1323] I] R] LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti AGGTGAA [1080, [F, [956, [A, [F, NA NA 2401] F] 1844] I] F] LENSG00000248636.2 ENSG00000111725 PRKAB1 5P Anti AAAGGAA [161] [F] [1193, [A, [F, NA NA 114] I] R] LENSG00000130821.11 ENSG00000130822 PNCK 5P Anti GTGGAGC [373] [F] [1223, [A, [F, NA NA 1348] I] F] LENSG00000236432.3 ENSG00000168958 MFF 5P Anti TAAAGGA [205] [F] [1192, [A, [F, NA NA 576] I] R] LENSG00000259673.1 ENSG00000189227 C15orf61 5P Anti TTCAAAG [287] [F] [821, [A, [F, NA NA 802] I] R] LENSG00000236404.4 ENSG00000147852 VLDLR 5P Anti CTAGAGG [295] [F] [952, [A, [F, NA NA 1810] I] F] LENSG00000246090.2 ENSG00000187758 ADH1A 5P Anti TAATCAA [1193] [F] [1021, [A, [F, NA NA 1671] I] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti GCACCAC [843] [F] [1211, [A, [F, NA NA 1324] I] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti GGGAAAC [938] [F] [1139, [A, [F, NA NA 1254] I] F] LENSG00000228384.3 ENSG00000144043 TEX261 5P Anti AAAGGAA [628, [R, [1193, [A, [F, NA NA 1804] R] 114] I] R] LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti ATTCCCA [1135] [F] [1112, [A, [F, NA NA 1640] I] F] LENSG00000206417.4 ENSG00000184897 H1FX 5P Anti GGGAAAC [1055] [F] [1139, [A, [F, NA NA 1254] I] F] LENSG00000183242.7 ENSG00000184937 WT1 5P Anti TGAGGCC [44] [F] [905, [A, [F, NA NA 1732] I] F] LENSG00000268677.1 ENSG00000224420 ADM5 5P Anti GCCCGAG [377] [F] [831, [A, [F, NA NA 303] I] R] LENSG00000178803.6 ENSG00000100024 UPB1 5P Anti TGAGGCC [1016] [F] [905, [A, R NA NA 1732] I] LENSG00000183242.7 ENSG00000184937 WT1 5P Same TGAGGCC [44] [F] [905, [A, [F, NA NA 1732] I] F] LENSG00000236404.4 ENSG00000147852 VLDLR 5P Same CTAGAGG [295] [F] [952, [A, [F, NA NA 1810] I] F] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same GCACCAC [843] [F] [1211, [A, [F, NA NA 1324] I] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same GGGAAAC [938] [F] [1139, [A, [F, NA NA 1254] I] F] LENSG00000236432.3 ENSG00000168958 MFF 5P Same TAAAGGA [205] [F] [1192 [A, [F, NA NA 576] I] R] LENSG00000178803.6 ENSG00000100024 UPB1 5P Same TGAGGCC [1016] [F] [905, [A, R NA NA 1732] I] LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same AGGTGAA [1080, [F, [956, [A, [F, NA NA 2401] F] 1844] I] F] LENSG00000259673.1 ENSG00000189227 C15orf61 5P Same TTCAAAG [287] [F] [821, [A, [F, NA NA 802] I] R] LENSG00000246090.2 ENSG00000187758 ADH1A 5P Same TAATCAA [1193] [F] [1021, [A, [F, NA NA 1671] I] R] LENSG00000186615.6 ENSG00000126777 KTN1 5P Same ATTCCCA [1135] [F] [1112, [A, [F, NA NA 1640] I] F] LENSG00000250309.2 ENSG00000164591 MYOZ3 5P Same CCCATGA [141] [F] [1115, [A, [F, NA NA 1626] I] F] LENSG00000261570.1 ENSG00000006530 AGK 5P Anti GAGGCCA [127] [F] [906] [A] [F] NA NA LENSG00000255389.1 ENSG00000056972 TRAF3IP2 5P Anti AAGCAGG [83, [R, [825] [A] [F] NA NA 477] R] LENSG00000255389.1 ENSG00000056972 TRAF3IP2 5P Anti ATGATTA [192] [F] [912] [A] R NA NA LENSG00000266304.1 ENSG00000266258 RP11- 5P Anti AACTTAA [305] [F] [1188] [A] [F] NA NA 41O4.1 LENSG00000266304.1 ENSG00000266258 RP11- 5P Anti GAGGCCA [292] [F] [906] [A] [F] NA NA 41O4.1 LENSG00000273151.1 ENSG00000239857 GET4 5P Anti TAAGAGG [5898, [F, [917] [A] R NA NA 3454] R] LENSG00000273151.1 ENSG00000239857 GET4 5P Anti AGAGGTG [2427, [F, [954] [A] [F] NA NA 5900] F] LENSG00000273151.1 ENSG00000239857 GET4 5P Anti GAGGTTC [5870] [F] [1040] [A] [F] NA NA LENSG00000264589.1 ENSG00000186868 MAPT 5P Anti CTGAGGC [134] [R] [904] [A] [F] NA NA LENSG00000169442.4 ENSG00000158062 UBXN11 5P Anti TGCCAAG [389] [F] [1003] [A] [F] NA NA LENSG00000169442.4 ENSG00000158062 UBXN11 5P Anti CTAGGAA [89] [F] [855] [A] [F] NA NA LENSG00000059915.12 ENSG00000107872 FBXL15 5P Anti GGGCACC [275] [R] [1209] [A] R NA NA LENSG00000229619.3 ENSG00000152601 MBNL1 5P Anti AATGGAA [32] [R] [863] [A] R NA NA LENSG00000229619.3 ENSG00000152601 MBNL1 5P Anti TTTTCAT [563, [F, [1014] [A] R NA NA 815] F] LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti AGTGTTC [2433, [F, [817] [A] R NA NA 2109] R] LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti AGAGGTG [773, [F, [954] [A] [F] NA NA 2399] F] LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti GAGGTGA [2400] [F] [955] [A] [F] NA NA LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti TGCAAAG [967] [F] [1177] [A] [F] NA NA LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti ATTTGCC [184] [F] [1000] [A] [F] NA NA LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti TTTGCCA [185] [F] [1001] [A] [F] NA NA LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti CATTTGC [183] [F] [999] [A] [F] NA NA LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti GCAGCTT [2192, [R, [1130] [A] [F] NA NA 2353] R] LENSG00000226937.5 ENSG00000165512 ZNF22 5P Anti GAAAGCA [1492] [F] [994] [A] [F] NA NA LENSG00000231074.4 ENSG00000204599 TRIM39 5P Anti GGTTCTA [148] [F] [879] [A] [F] NA NA LENSG00000272894.1 ENSG00000164654 MIOS 5P Anti ACTGAGG [192] [R] [903] [A] [F] NA NA LENSG00000255847.1 ENSG00000187726 DNAJB13 5P Anti CTATTTT [1190] [F] [883] [A] [F] NA NA LENSG00000255847.1 ENSG00000187726 DNAJB13 5P Anti TTTCATT [465] [F] [1015] [A] [F] NA NA LENSG00000260681.1 ENSG00000103534 TMC5 5P Anti TGGAGCC [10, [F, [1224] [A] [F] NA NA 279] F] LENSG00000137497.13 ENSG00000184154 LRTOMT 5P Anti GGGCAGC [234] [R] [1128] [A] [F] NA NA LENSG00000245482.2 ENSG00000139133 ALG10 5P Anti GATCAGA [719] [F] [1053] [A] [F] NA NA LENSG00000245482.2 ENSG00000139133 ALG10 5P Anti TTGCCAA [24, [F, [1002] [A] [F] NA NA 579] F] LENSG00000245482.2 ENSG00000139133 ALG10 5P Anti CTGAAAC [660] [F] [1184] [A] [F] NA NA LENSG00000250616.2 ENSG00000090238 YPEL3 5P Anti CGGGGGC [50, [R, [930] [A] [F] NA NA 57] R] LENSG00000117543.15 ENSG00000269175 AC093157.1 5P Anti CAAAGCA [203] [F] [823] [A] [F] NA NA LENSG00000255282.2 ENSG00000196611 MMP1 5P Anti TTGCAAA [15] [F] [1176] [A] R NA NA LENSG00000179295.11 ENSG00000089009 RPL6 5P Anti CGGCGAT [169] [F] [1094] [A] [F] NA NA LENSG00000205890.3 ENSG00000162069 CCDC64B 5P Anti TCGGAGG [39] [F] [1037] [A] R NA NA LENSG00000261664.1 ENSG00000085831 TTC39A 5P Anti AGGAGTG [162] [F] [1219] [A] [F] NA NA LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Anti GATCAGA [1141] [R] [1053] [A] [F] NA NA LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Anti GCATTTG [952] [R] [998] [A] [F] NA NA LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Anti AGCATTT [953] [R] [997] [A] R NA NA LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Anti CATGATT [94] [R] [911] [A] [F] NA NA LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Anti ATGATTA [93] [R] [912] [A] [F] NA NA LENSG00000067829.14 ENSG00000180879 SSR4 5P Anti GCCATGA [131] [F] [909] [A] R NA NA LENSG00000267121.1 ENSG00000184922 FMNL1 5P Anti AGGGCAC [927, [R, [1208] [A] R NA NA 1160] R] LENSG00000267121.1 ENSG00000184922 FMNL1 5P Anti CTGAGGC [701, [F, [904] [A] [F] NA NA 574, R, 1665] R] LENSG00000267121.1 ENSG00000184922 FMNL1 5P Anti ACTGAGG [700] [F] [903] [A] [F] NA NA LENSG00000247708.3 ENSG00000168818 STX18 5P Anti AACTGAG [513] [F] [902] [A] [F] NA NA LENSG00000259673.1 ENSG00000189227 C15orf61 5P Anti GTTCAAA [536] [F] [820] [A] [F] NA NA LENSG00000231154.1 ENSG00000123562 MORF4L2 5P Anti ACCAGGA [204] [F] [1216] [A] [F] NA NA LENSG00000261519.2 ENSG00000166548 TK2 5P Anti TGTTCAA [43] [R] [819] [A] R NA NA LENSG00000261519.2 ENSG00000166548 TK2 5P Anti GTTCAAA [42] [R] [820] [A] [F] NA NA LENSG00000273485.1 ENSG00000138172 CALHM2 5P Anti TTTGCCA [381] [R] [1001] [A] [F] NA NA LENSG00000236333.3 ENSG00000072657 TRHDE 5P Anti AGCATTT [512, [F, [997] [A] [F] NA NA 343, R, 435] R] LENSG00000265205.1 ENSG00000109111 SUPT6H 5P Anti TGTTCAA [103] [R] [819] [A] [F] NA NA LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti AATAGGA [1286] [F] [868] [A] [F] NA NA LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti AGAGGTG [902] [F] [954] [A] [F] NA NA LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti ATAGGAC [1287] [F] [869] [A] [F] NA NA LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti ACTGAGG [263, [F, [903] [A] R NA NA 943, F, 876, R, 1252] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti GTGAAAT [1269] [F] [958] [A] [F] NA NA LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti AACTGAG [942, [F, [902] [A] R NA NA 877, R, 1253] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti CGCAGCT [1217] [F] [850] [A] [F] NA NA LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti CTGAGGC [944, [F, [904] [A] R NA NA 875, R, 1251] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti GTTCAAA [1092, [F, [820] [A] [F] NA NA 1209] F] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Anti TAGGACC [1288] [F] [870] [A] [F] NA NA LENSG00000253320.1 ENSG00000155096 AZIN1 5P Anti CTTTGGG [168] [F] [1152] [A] [F] NA NA LENSG00000272578.1 ENSG00000159496 RGL4 5P Anti GAGGTTC [206] [R] [1040] [A] [F] NA NA LENSG00000272578.1 ENSG00000159496 RGL4 5P Anti CAAGAAC [218] [R] [1025] [A] [F] NA NA LENSG00000272578.1 ENSG00000159496 RGL4 5P Anti AGAGGTG [114, [F, [954] [A] R NA NA 154] R] LENSG00000272578.1 ENSG00000159496 RGL4 5P Anti AGGTTCG [205] [R] [1041] [A] [F] NA NA LENSG00000272578.1 ENSG00000159496 RGL4 5P Anti GATCATT [234] [R] [1861] [A] [F] NA NA LENSG00000248724.2 ENSG00000113971 NPHP3 5P Anti CAAAGCT [723, [F, [1179] [A] [F] NA NA 1548, F, 14, R, 163] R] LENSG00000228775.3 ENSG00000106028 SSBP1 5P Anti CTATTTT [177] [R] [883] [A] [F] NA NA LENSG00000234775.1 ENSG00000163485 ADOPA1 5P Anti GCAGGCT [226] [R] [1227] [A] [R] NA NA LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti CATTAAT [943] [R] [1018] [A] [F] NA NA LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti ATGATTA [888] [F] [912] [A] R NA NA LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti TGCAAAG [1080] [F] [1177] [A] [F] NA NA LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti TCCCATG [1137] [F] [1114] [A] [F] NA NA LENSG00000186615.6 ENSG00000126777 KTN1 5P Anti TTCCCAT [1136] [F] [1113] [A] [F] NA NA LENSG00000228384.3 ENSG00000258881 AC007040.11 5P Anti CTAGGAA [8] [F] [855] [A] [F] NA NA LENSG00000206417.4 ENSG00000184897 H1FX 5P Anti CTGAGGC [792, [F, [904] [A] R NA NA 889, R, 956, R, 2563] R] LENSG00000206417.4 ENSG00000184897 H1FX 5P Anti AAAGCAG [1439] [F] [824] [A] R NA NA LENSG00000206417.4 ENSG00000184897 H1FX 5P Anti AGGGCAC [567, [R, [1208] [A] [F] NA NA 607] R] LENSG00000228315.7 ENSG00000159496 RGL4 5P Anti GAGGTTC [206] [R] [1040] [A] [F] NA NA LENSG00000228315.7 ENSG00000159496 RGL4 5P Anti CAAGAAC [218] [R] [1025] [A] [F] NA NA LENSG00000228315.7 ENSG00000159496 RGL4 5P Anti AGAGGTG [114, [F, [954] [A] R NA NA 154] R] LENSG00000228315.7 ENSG00000159496 RGL4 5P Anti AGGTTCG [205] [R] [1041] [A] [F] NA NA LENSG00000228315.7 ENSG00000159496 RGL4 5P Anti GATCATT [234] [R] [1861] [A] [F] NA NA LENSG00000198910.8 ENSG00000196987 LCA10 5P Anti GAAGGGC [433] [F] [1206] [A] [F] NA NA LENSG00000198910.8 ENSG00000196987 LCA10 5P Anti CCGAGCC [506] [F] [833] [A] [F] NA NA LENSG00000198910.8 ENSG00000196987 LCA10 5P Anti GGAAGGG [432] [F] [1205] [A] [F] NA NA LENSG00000255808.1 ENSG00000186642 PDE2A 5P Anti CATGACC [4] [R] [1117] [A] [F] NA NA LENSG00000272405.1 ENSG00000132692 BCAN 5P Anti GAGGTTC [341, [F, [1040] [A] [F] NA NA 2054] F] LENSG00000272405.1 ENSG00000132692 BCAN 5P Anti ATGTTTT [2023] [F] [1011] [A] [F] NA NA LENSG00000236778.3 ENSG00000102786 INTS6 5P Anti CAAAGCA [417] [F] [823] [A] [F] NA NA LENSG00000224066.1 ENSG00000160051 IQCC 5P Anti CTGAGGC [2465] [F] [904] [A] [F] NA NA LENSG00000237945.3 ENSG00000241837 ATP5O 5P Anti GGGTTCC [11] [R] [1156] [A] [F] NA NA LENSG00000182841.8 ENSG00000183569 SERHL2 5P Anti CAGGCCC [34] [R] [828] [A] [F] NA NA LENSG00000178803.6 ENSG00000128271 ADORA2A 5P Anti CTGAGGC [204] [R] [904] [A] [F] NA NA LENSG00000267092.1 ENSG00000185761 ADAMTSL5 5P Anti CTGAGGC [544, [F, [904] [A] [F] NA NA 552, R, 573] R] LENSG00000245573.3 ENSG00000176697 BDNF 5P Anti TTTCATT [51] [F] [1015] [A] [F] NA NA LENSG00000268677.1 ENSG00000224420 ADM5 5P Anti CGAGCCG [369] [F] [834] [A] [F] NA NA LENSG00000234076.1 ENSG00000188001 TPRG1 5P Anti CTGAGGC [186] [F] [904] [A] [F] NA NA LENSG00000137133.6 ENSG00000137103 TMEM8B 5P Anti AAGCTGA [481] [F] [1181] [A] [F] NA NA LENSG00000258584.1 ENSG00000140067 FAM181A 5P Anti GAAACCA [172] [R] [1141] [A] R NA NA LENSG00000178803.6 ENSG00000100024 UPB1 5P Anti CTGAGGC [874] [R] [904] [A] [F] NA NA LENSG00000178803.6 ENSG00000100024 UPB1 5P Anti ACTGAGG [875] [R] [903] [A] [F] NA NA LENSG00000221817.5 ENSG00000166348 USP54 5P Anti AATGATC [3968] [F] [1861] [A] [R] NA NA LENSG00000221817.5 ENSG00000166348 USP54 5P Anti ACCAGGA [1262] [R] [1216] [A] [F] NA NA LENSG00000114648.7 ENSG00000088727 KIF9 5P Same CAGCTTC [59, [F, [1131] [A] [F] NA NA 1337] R] LENSG00000114648.7 ENSG00000088727 KIF9 5P Same AGCTTCC [60] [F] [1132] [A] [F] NA NA LENSG00000114648.7 ENSG00000088727 KIF9 5P Same GCAGCTT [1338] [R] [1130] [A] [F] NA NA LENSG00000253320.1 ENSG00000155096 AZIN1 5P Same CTTTGGG [168] [F] [1152] [A] [F] NA NA LENSG00000255389.1 ENSG00000056972 TPAF3IP2 5P Same AAGCAGG [83, [R, [825] [A] [F] NA NA 477] R] LENSG00000255389.1 ENSG00000056972 TPAF3IP2 5P Same ATGATTA [192] [F] [912] [A] R NA NA LENSG00000236364.2 ENSG00000143179 UCK2 5P Same ATAATGG [580] [R] [861] [A] [F] NA NA LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same AATAGGA [1286] [F] [868] [A] [F] NA NA LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same AGAGGTG [902] [F] [954] [A] [F] NA NA LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same ATAGGAC [1287] [F] [869] [A] [F] NA NA LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same ACTGAGG [263, [F, [903] [A] R NA NA 943, F, 876, R, 1252] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same GTGAAAT [1269] [F] [958] [A] [F] NA NA LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same AACTGAG [942, [F, [902] [A] R NA NA 877, R, 1253] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same CGCAGCT [1217] [F] [850] [A] [F] NA NA LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same CTGAGGC [944, [F, [904] [A] R NA NA 875, R, 1251] R] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same GTTCAAA [1092, [F, [820] [A] [F] NA NA 1209] F] LENSG00000267387.1 ENSG00000130813 C19orf66 5P Same TAGGACC [1288] [F] [870] [A] [F] NA NA LENSG00000261664.1 ENSG00000085831 TTC39A 5P Same AGGAGTG [162] [F] [1219] [A] [F] NA NA LENSG00000271360.1 ENSG00000148429 USP6NL 5P Same TTTCATT [13] [R] [1015] [A] [F] NA NA LENSG00000131187.5 ENSG00000198055 GRK6 5P Same CGCCTGG [454] [R] [839] [A] [F] NA NA LENSG00000264177.1 ENSG00000214860 EVPLL 5P Same CATTAAT [3758, [F, [1018] [A] R NA NA 3759] R] LENSG00000264177.1 ENSG00000214860 EVPLL 5P Same AAAGCAG [3822] [F] [824] [A] [F] NA NA LENSG00000264177.1 ENSG00000214860 EVPLL 5P Same AAGCAGG [3823] [F] [825] [A] [F] NA NA LENSG00000264177.1 ENSG00000214860 EVPLL 5P Same GAGGTTC [3806] [F] [1040] [A] [F] NA NA LENSG00000264177.1 ENSG00000214860 EVPLL 5P Same ATCATTA [3621, [F, [1862] [A] [F] NA NA 3756] F] LENSG00000264177.1 ENSG00000214860 EVPLL 5P Same GCCAAGA [3727] [F] [1004] [A] [F] NA NA LENSG00000205890.3 ENSG00000162069 CCDC64B 5P Same TCGGAGG [39] [F] [1037] [A] R NA NA LENSG00000178803.6 ENSG00000128271 ADORA2A 5P Same CTGAGGC [204] [R] [904] [A] [F] NA NA LENSG00000231721.2 ENSG00000128585 MKLN1 5P Same AAAGTCT [203] [F] [1147] [A] R NA NA LENSG00000237945.3 ENSG00000241837 ATP5O 5P Same GGGTTCC [11] [R] [1156] [A] [F] NA NA LENSG00000225855.2 ENSG00000160753 RUSC1 5P Same AATGGAA [469] [R] [863] [A] [F] NA NA LENSG00000228838.1 ENSG00000157193 LRP8 5P Same GGGCAGC [54] [F] [1128] [A] [F] NA NA LENSG00000178803.6 ENSG00000100024 UPB1 5P Same CTGAGGC [874] [R] [904] [A] [F] NA NA LENSG00000178803.6 ENSG00000100024 UPB1 5P Same ACTGAGG [875] [R] [903] [A] [F] NA NA LENSG00000273485.1 ENSG00000138172 CALHM2 5P Same TTTGCCA [381] [R] [1001] [A] [F] NA NA LENSG00000255847.1 ENSG00000187726 DNAJB13 5P Same CTATTTT [1190] [F] [883] [A] [F] NA NA LENSG00000255847.1 ENSG00000187726 DNAJB13 5P Same TTTCATT [465] [F] [1015] [A] [F] NA NA LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same GGGGGCA [218] [F] [931] [A] [F] NA NA LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same GAATAGG [291] [F] [867] [A] [F] NA NA LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same CCAGGAG [207] [F] [1217] [A] [F] NA NA LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same ATGGAAT [288] [F] [864] [A] [F] NA NA LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same GGAATAG [290] [F] [866] [A] [F] NA NA LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same TGGAATA [289] [F] [865] [A] [F] NA NA LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same GCAGGCC [266] [F] [827] [A] [F] NA NA LENSG00000114529.8 ENSG00000174500 GCSAM 5P Same CTGAGGC [251] [F] [904] [A] [F] NA NA LENSG00000257097.1 ENSG00000130779 CLIP1 5P Same TTTGGGT [644] [F] [1153] [A] [F] NA NA LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same AGTGTTC [2433, [F, [817] [A] R NA NA 2109] R] LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same AGAGGTG [773, [F, [954] [A] [F] NA NA 2399] F] LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same GAGGTGA [2400] [F] [955] [A] [F] NA NA LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same TGCAAAG [967] [F] [1177] [A] [F] NA NA LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same ATTTGCC [184] [F] [1000] [A] [F] NA NA LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same TTTGCCA [185] [F] [1001] [A] [F] NA NA LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same CATTTGC [183] [F] [999] [A] [F] NA NA LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same GCAGCTT [2192, [R, [1130] [A] [F] NA NA 2353] R] LENSG00000226937.5 ENSG00000165512 ZNF22 5P Same GAAAGCA [1492] [F] [994] [A] [F] NA NA LENSG00000204934.6 ENSG00000171130 ATP6V0E2 5P Same GAAAGCA [114, [F, [994] [A] [F] NA NA 179] R] LENSG00000255119.1 ENSG00000184224 C11orf72 5P Same CAGCTTC [499] [F] [1131] [A] [F] NA NA LENSG00000107872.8 ENSG00000059915 PSD 5P Same AAGGAAT [238] [R] [1194] [A] [F] NA NA LENSG00000258584.1 ENSG00000140067 FAM181A 5P Same GAAACCA [172] [R] [1141] [A] R NA NA LENSG00000259673.1 ENSG00000189227 C15orf61 5P Same GTTCAAA [536] [F] [820] [A] [F] NA NA LENSG00000231154.1 ENSG00000123562 MORF4L2 5P Same ACCAGGA [204] [F] [1216] [A] [F] NA NA LENSG00000231074.4 ENSG00000204599 TRIM39 5P Same GGTTCTA [148] [F] [879] [A] [F] NA NA LENSG00000271122.1 ENSG00000122557 HERPUD2 5P Same AAGCTGA [235] [F] [1181] [A] [F] NA NA LENSG00000138018.13 ENSG00000173567 GPR113 5P Same GAGTGGA [91] [F] [1221] [A] R NA NA LENSG00000236295.1 ENSG00000223874 AC007557.1 5P Same AAGCAGG [358] [F] [825] [A] [F] NA NA LENSG00000257176.1 ENSG00000064763 FAR2 5P Same GGATCAT [178] [R] [1860] [A] [F] NA NA LENSG00000137497.13 ENSG00000184154 LRTOMT 5P Same GGGCAGC [234] [R] [1128] [A] [F] NA NA LENSG00000204261.4 ENSG00000204264 PSMB8 5P Same GCAGCTT [281, [R, [1130] [A] [F] NA NA 1088] R] LENSG00000255282.2 ENSG00000196611 MMP1 5P Same TTGCAAA [15] [F] [1176] [A] R NA NA LENSG00000272578.1 ENSG00000159496 RGL4 5P Same GAGGTTC [206] [R] [1040] [A] [F] NA NA LENSG00000272578.1 ENSG00000159496 RGL4 5P Same CAAGAAC [218] [R] [1025] [A] [F] NA NA LENSG00000272578.1 ENSG00000159496 RGL4 5P Same AGAGGTG [114, [F, [954] [A] R NA NA 154] R] LENSG00000272578.1 ENSG00000159496 RGL4 5P Same AGGTTCG [205] [R] [1041] [A] [F] NA NA LENSG00000272578.1 ENSG00000159496 RGL4 5P Same GATCATT [234] [R] [1861] [A] [F] NA NA LENSG00000161040.12 ENSG00000128606 LRRC17 5P Same AATCAAG [286] [F] [1022] [A] [F] NA NA LENSG00000161040.12 ENSG00000128606 LRRC17 5P Same GGATACC [355] [F] [844] [A] [F] NA NA LENSG00000161040.12 ENSG00000128606 LRRC17 5P Same TTGTTGG [370] [F] [888] [A] [F] NA NA LENSG00000161040.12 ENSG00000128606 LRRC17 5P Same ACGGACC [346] [F] [982] [A] [F] NA NA LENSG00000266962.1 ENSG00000108786 HSD17B1 5P Same AGCTTCC [648] [F] [1132] [A] [F] NA NA LENSG00000266962.1 ENSG00000108786 HSD17B1 5P Same GCAGCTA [677] [F] [851] [A] [F] NA NA LENSG00000266962.1 ENSG00000108786 HSD17B1 5P Same AGCTAGG [679, [F, [853] [A] R NA NA 2221] R] LENSG00000266962.1 ENSG00000108786 HSD17B1 5P Same CAGCTAG [678] [F] [852] [A] [F] NA NA LENSG00000228315.7 ENSG00000159496 RGL4 5P Same GAGGTTC [206] [R] [1040] [A] [F] NA NA LENSG00000228315.7 ENSG00000159496 RGL4 5P Same CAAGAAC [218] [R] [1025] [A] [F] NA NA LENSG00000228315.7 ENSG00000159496 RGL4 5P Same AGAGGTG [114, [F, [954] [A] R NA NA 154] R] LENSG00000228315.7 ENSG00000159496 RGL4 5P Same AGGTTCG [205] [R] [1041] [A] [F] NA NA LENSG00000228315.7 ENSG00000159496 RGL4 5P Same GATCATT [234] [R] [1861] [A] [F] NA NA LENSG00000100911.9 ENSG00000092098 RNF31 5P Same TCTTGGA [389] [R] [965] [A] [F] NA NA LENSG00000186615.6 ENSG00000126777 KTN1 5P Same CATTAAT [943] [R] [1018] [A] [F] NA NA LENSG00000186615.6 ENSG00000126777 KTN1 5P Same ATGATTA [888] [F] [912] [A] R NA NA LENSG00000186615.6 ENSG00000126777 KTN1 5P Same TGCAAAG [1080] [F] [1177] [A] [F] NA NA LENSG00000186615.6 ENSG00000126777 KTN1 5P Same TCCCATG [1137] [F] [1114] [A] [F] NA NA LENSG00000186615.6 ENSG00000126777 KTN1 5P Same TTCCCAT [1136] [F] [1113] [A] [F] NA NA LENSG00000247708.3 ENSG00000168818 STX18 5P Same AACTGAG [513] [F] [902] [A] [F] NA NA LENSG00000266304.1 ENSG00000266258 RP11- 5P Same AACTTAA [305] [F] [1188] [A] [F] NA NA 41O4.1 LENSG00000266304.1 ENSG00000266258 RP11- 5P Same GAGGCCA [292] [F] [906] [A] [F] NA NA 41O4.1 LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Same GATCAGA [1141] [R] [1053] [A] [F] NA NA LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Same GCATTTG [952] [R] [998] [A] [F] NA NA LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Same AGCATTT [953] [R] [997] [A] R NA NA LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Same CATGATT [94] [R] [911] [A] [F] NA NA LENSG00000245293.2 ENSG00000155016 CYP2U1 5P Same ATGATTA [93] [R] [912] [A] [F] NA NA LENSG00000226377.1 ENSG00000176658 MYO1D 5P Same GGTTGCA [634] [F] [1174] [A] [F] NA NA LENSG00000255808.1 ENSG00000186642 PDE2A 5P Same CATGACC [4] [R] [1117] [A] [F] NA NA LENSG00000228775.3 ENSG00000106028 SSBP1 5P Same CTATTTT [177] [R] [883] [A] [F] NA NA LENSG00000250616.2 ENSG00000090238 YPEL3 5P Anti CCGGGGG [51] [R] [262, [I, [F, NA NA 929, A, F, 1161] A] F] LENSG00000161040.12 ENSG00000128606 LRRC17 5P Same CCGGGGG [33, [F, [262, [I, [F, NA NA 423] F] 929, A, F, 1161] A] F] LENSG00000228384.3 ENSG00000144043 TEX261 5P Anti GCCGGGG [3539] [F] [261, [I, [F, NA NA 928, A, F, 1753, I, F, 256] I] R] LENSG00000230487.3 ENSG00000157778 PSMG3 5P Anti AGAGGGA [407] [R] [432, [I, R NA NA 919, A, 1445] I] LENSG00000230487.3 ENSG00000157778 PSMG3 5P Same AGAGGGA [407] [R] [432, [I, R NA NA 919, A, 1445] I] LENSG00000255389.1 ENSG00000056972 TRAF3IP2 5P Anti GAGCCTG [486] [F] [437, [I, R NA NA 1226] A] LENSG00000245482.2 ENSG00000139133 ALG10 5P Anti TGAAACT [661] [F] [80, [I, [F, NA NA 1185] A] F] LENSG00000245482.2 ENSG00000139133 ALG10 5P Anti ATCAGAT [720] [F] [220, [I, [F, NA NA 1054] A] F] LENSG00000231154.1 ENSG00000123562 MORF4L2 5P Anti TGATCCT [275, [F, [8, [I, [F, NA NA 261] R] 1859] A] R] LENSG00000255389.1 ENSG00000056972 TRAF3IP2 5P Same GAGCCTG [486] [F] [437, [I, R NA NA 1226] A] LENSG00000188735.8 ENSG00000139725 RHOF 5P Same CGGCGGC [179] [R] [277, [I, [F, NA NA 1102] A] F] LENSG00000264177.1 ENSG00000214860 EVPLL 5P Same TCATTAA [3757] [F] [96, [I, [F, NA NA 1017] A] F] LENSG00000244198.1 ENSG00000213214 ARHGEF35 5P Same GGAGCCT [581] [R] [436, [I, [F, NA NA 1225] A] F] LENSG00000258672.1 ENSG00000036530 CYP46A1 5P Same AGCAGGC [265] [F] [472, [I, [F, NA NA 826] A] F] LENSG00000231154.1 ENSG00000123562 MORF4L2 5P Same TGATCCT [275, [F, [8, [I, [F, NA NA 261] R] 1859] A] R]

    Summary of Foregoing Findings

    [0285] The foregoing description discloses data demonstrating the two important sequence components of t-NAT1 and t-NAT2: [0286] (1) The MIR element in the 3 end of both transcripts of MAPT AS-lncRNA, t-NAT1 and t-NAT2 (e.g. see FIGS. 1, 2, 6 and 7) [0287] (2) The region of 5-5 antisense overlap of t-NAT1 with the 5UTR of MAPT. (e.g. see FIGS. 1 and 2)

    [0288] This indicates that the region of 5-5 antisense overlap confers specificity to the host coding gene (e.g. MAPT), whereas the MIR element is responsible for a generalised and conserved role in repressing translation, which may apply to other MIR-containing lncRNAs (MIR-lncRNAs) that are paired in antisense orientation with protein coding genes.

    [0289] Using ribosomal profiling, we demonstrated that t-NAT1 and t-NAT2 mediate translational regulation of tau by influencing recruitment to the ribosome; and the MIR element is essential for this activity (see FIG. 18 and also FIG. 22).

    [0290] Using bioinformatics analysis, we also identified the two 7-mer motifs in the conserved CORE-SINE region of the MIR element that are described above e.g. as underlined in SEQ IDs 1-3 on Page 17 and as mentioned on Page 19. See also FIG. 22, wherein the two motifs are numbered Motif 1 (CACCCAC) and Motif 2 (CUGAGGC) and wherein the relative position within the MIR is indicated as dark boxes (in the lower left panel of FIG. 22).

    Further Data Obtained Using MiniNAT Sequences

    [0291] (1) MiniNAT:

    [0292] Having shown that the MIR element, shared by t-NAT1 and t-NAT2, and the 5 region of t-NAT1 that overlaps in antisense orientation with some of the 5-UTR of MAPT (region of overlap) confer activity of the t-NATs, the inventors went on to show that the region of overlap and the MIR element alone are sufficient for a therapeutic RNA to retain the capacity to specifically repress tau translation. Advantageously, shorter sequences may be more amenable to therapeutic delivery to CNS.

    [0293] To test this, a vector for the expression of the MiniNAT for t-NAT1, effectively reducing sequence length from 449 bp to 94 bp (see FIG. 22, lowermost panel).

    [0294] In stably expressing cell lines (SH-SY5Y human neuroblastoma), it was demonstrated that the MiniNAT retained capacity to repress tau protein levels, even more effectively than the full-length t-NAT1 (lowermost panel of FIG. 22).

    [0295] (1) 7-Mer Motifs:

    [0296] To show that the 7mer motifs, Motif 1 and Motif 2, are able to form a functional MIR-lncRNA, we also expressed the full-length t-NAT1 but with each of the motifs deleted. Removal of either Motif 1 or Motif 2, but not Motif 3, abolished the repressive capacity of t-NAT1 (see the lower panel of FIG. 22).

    In Vivo Validation

    [0297] To further validate previous findings in vivo and confirm the therapeutic benefits of tau reduction, the inventors are extending the study to mouse models. Firstly, the htau mouse model, which carries the full-length human MAPT against a Mapt (/) background. This is the only suitable mouse model as the transgene includes the human MAPT promoter and first non-coding exon spanning the core promoter and region of overlap. The inventors are also generating the mouse equivalent of a miniNAT, or optimised mNAT (mouse-NAT) to test against the endogenous Mapt gene in non-transgenic mice.

    [0298] The miniNATs or mNATs will be delivered by direct brain injection of AAV9 vector in mouse pups (P1). Translational repression will then be analysed 1-4 weeks later by quantifying transcript and protein levels. Toxin-induced seizures in a mouse model of epilepsy will be quantified. It has been previously shown that reduction of tau levels results in reductions in seizures in chemically treated mice and also in APP mouse models. The effect of tau reduction in AAV9-t-NAT treated tauopathy mice (htau) on pathological progression and behavioural deficits will also be determined.

    Conclusion

    [0299] The t-NAT1 sequence can be reduced to the following elements; the MIR domain and the 5 region of antisense overlap with the MAPT 5-UTR, without loss of function.

    [0300] Removal of repressive function with deletion of 7-mer motifs supports a role of MAPT-AS1 MIR-lncRNA in suppressing recruitment of MAPT mRNA to the 40S ribosomal subunit through a competitive pairing with the 18S rRNA mediated by the MIR Motif 1 and Motif 2.

    Methods References:

    Vienna Package

    [0301] Lorenz, Ronny and Bernhart, Stephan H. and Honer zu Siederdissen, Christian and Tafer, Hakim and Flamm, Christoph and Stadler, Peter F. and Hofacker, Ivo L. ViennaRNA Package 2.0 Algorithms for Molecular Biology, 6:1 26, 2011, doi:10.1186/1748-7188-6-26

    Python

    [0302] Python Software Foundation. Python Language Reference, version 2.7. Available at http://www.python.org

    R

    [0303] R Core Team (2014). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL (http://www.R-project.org/

    Ggplot2

    [0304] H. Wickham. ggplot2: elegant graphics for data analysis. Springer New York, 2009.

    Dplyr+tidyr

    [0305] Hadley Wickham (2014). tidyr: Easily Tidy Data with spread( ) and gather( ) Functions. R package version 0.2.0. http://CRAN.R-project.org/package=tidyr [0306] Hadley Wickham and Romain Francois (2015). dplyr: A Grammar of Data Manipulation. R package version 0.4.1. http://CRAN.R-project.org/package=dplyr

    Bedtools (v2.22.1)

    [0307] http://bioinformatics.oxfordjournals.org/content/26/6/841.short

    REFERENCES

    [0308] All publications, patent and patent applications cited herein or filed with this application, including references filed as part of an Information Disclosure Statement are incorporated by reference in their entirety. [0309] 1. ENCODE Project Consortium. An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74 (2012). [0310] 2. Carninci, P. et al. The transcriptional landscape of the mammalian genome. Science 309, 1559-1563 (2005). [0311] 3. Djebali, S. et al. Landscape of transcription in human cells. Nature 489, 101-108 (2012). [0312] 4. Rinn, J. L. & Chang, H. Y. Genome regulation by long noncoding RNAs. Annu. Rev. Biochem. 81, 145-166 (2012). [0313] 5. Amaral, P. P., Dinger, M. E. & Mattick, J. S. Non-coding RNAs in homeostasis, disease and stress responses: an evolutionary perspective. Brief. Funct. Genomics 12, 254-278 (2013). [0314] 6. Quinn, J. J. & Chang, H. Y. Unique features of long non-coding RNA biogenesis and function. Nat. Rev. Genet. 17, 47-62 (2015). [0315] 7. Spillantini, M. G. & Goedert, M. Tau pathology and neurodegeneration. Lancet Neurol. 12, 609-622 (2013). [0316] 8. Baker, M. et al. Association of an extended haplotype in the tau gene with progressive supranuclear palsy. Hum. Mol. Genet. 8, 711-715 (1999). [0317] 9. Houlden, H. et al. Corticobasal degeneration and progressive supranuclear palsy share a common tau haplotype. Neurology 56, 1702-1706 (2001). [0318] 10. Desikan, R. S. et al. Genetic overlap between Alzheimer's disease and Parkinson's disease at the MAPT locus. Mol.

    [0319] Psychiatry 20, 1588-1595 (2015). [0320] 11. Santacruz, K. et al. Tau suppression in a neurodegenerative mouse model improves memory function. Science 309, 476-481 (2005). [0321] 12. Vossel, K. A. et al. Tau reduction prevents Abeta-induced defects in axonal transport. Science 330, 198 (2010). [0322] 13. Roberson, E. D. et al. Reducing endogenous tau ameliorates amyloid beta-induced deficits in an Alzheimer's disease mouse model. Science 316, 750-754 (2007). [0323] 14. Pittman, A. M. et al. Linkage disequilibrium fine mapping and haplotype association analysis of the tau gene in progressive supranuclear palsy and corticobasal degeneration. J. Med. Genet. 42, 837-846 (2005). [0324] 15. Lizio, M. et al. Gateways to the FANTOM5 promoter level mammalian expression atlas. Genome Biol. 16, 22 (2015). [0325] 16. Plessy, C. et al. Linking promoters to functional transcripts in small samples with nanoCAGE and CAGEscan. Nat. Methods 7, 528-534 (2010). [0326] 17. Lin, M. F., Jungreis, I. & Kellis, M. PhyloCSF: a comparative genomics method to distinguish protein coding and non-coding regions. Bioinforma. Oxf. Engl. 27, i275-282 (2011). [0327] 18. Glazko, G. V. & Nei, M. Estimation of divergence times for major lineages of primate species. Mol. Biol. Evol. 20, 424-434 (2003). [0328] 19. Gilbert, N. & Labuda, D. CORE-SINEs: eukaryotic short interspersed retroposing elements with common sequence motifs. Proc. Natl. Acad. Sci. U.S.A 96, 2869-2874 (1999). [0329] 20. Sibley, C. R. et al. Recursive splicing in long vertebrate genes. Nature 521, 371-375 (2015). [0330] 21. Morita, T. & Sobue, K. Specification of neuronal polarity regulated by local translation of CRMP2 and Tau via the mTOR-p 70S6K pathway. J. Biol. Chem. 284, 27734-27745 (2009). [0331] 22. Veo, B. L. & Krushel, L. A. Secondary RNA structure and nucleotide specificity contribute to internal initiation mediated by the human tau 5 leader. RNA Biol. 9, 1344-1360 (2012). [0332] 23. Mauro, V. P. & Edelman, G. M. The ribosome filter hypothesis. Proc. Natl. Acad. Sci. U.S.A 99, 12031-12036 (2002). [0333] 24. Pnek, J., Kolr, M., Vohradsk, J. & Shivaya Valsek, L. An evolutionary conserved pattern of 18S rRNA sequence complementarity to mRNA 5 UTRs and its implications for eukaryotic gene translation regulation. Nucleic Acids Res. 41, 7625-7634 (2013). [0334] 25. Weingarten-Gabbay, S. et al. Comparative genetics. Systematic discovery of cap-independent translation sequences in human and viral genomes. Science 351, (2016). [0335] 26. Kapusta, A. et al. Transposable elements are major contributors to the origin, diversification, and regulation of vertebrate long noncoding RNAs. PLoS Genet. 9, e1003470 (2013). [0336] 27. Chen, E. Y. et al. Enrichr: interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinformatics 14, 128 (2013). [0337] 28. Xia, J., Benner, M. J. & Hancock, R. E. W. NetworkAnalystintegrative approaches for protein-protein interaction network analysis and visual exploration. Nucleic Acids Res. 42, W167-174 (2014). [0338] 29. Jjingo, D. et al. Mammalian-wide interspersed repeat (MIR)-derived enhancers and the regulation of human gene expression. Mob. DNA 5, 14 (2014). [0339] 30. Wang, J. et al. MIR retrotransposon sequences provide insulators to the human genome. Proc. Natl. Acad. Sci. U.S.A 112, E4428-4437 (2015). [0340] 31. Sposito, T. et al. Developmental regulation of tau splicing is disrupted in stem cell-derived neurons from frontotemporal dementia patients with the 10+16 splice-site mutation in MAPT. Hum. Mol. Genet. 24, 5260-5269 (2015). [0341] 32. Potter, C. J. & Luo, L. Splinkerette PCR for mapping transposable elements in Drosophila. PloS One 5, e10168 (2010). [0342] 33. Boris Kantor, Rachel M. Bailey, Keon Wimberly, Sahana N. Kalburgi, Steven J. Gray, Advances in Genetics, Volume 87 (2014). [0343] 34. Marc S. Weinberg a, R. Jude Samulski a,b, Thomas J. McCowna, Neuropharmacology 69 (2013) pp82-88. [0344] 35. Petrov AS, Bernier C R, Gulen B, Waterbury C C, Hershkovits E, Hsiao C, Harvey S C, Hud N V, Fox G E, Wartell R M, Williams L D. Secondary structures of rRNAs from all three domains of life. PLoS One. 2014 Feb. 5; 9(2):e88222