Method relating to myostatin pathway inhibition

11693013 · 2023-07-04

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides a method for determining whether a patient will respond to treatment with a myostatin pathway inhibitor, the method comprising: (a) determining a level of myostatin and/or activin type II receptor (ActRII) and/or follistatin in at least one muscle biopsy obtained from a treatment target muscle in a subject having or suspected of having muscle atrophy or a muscle wasting condition; and (b) determining a level of myostatin and/or follistatin in a systemic sample obtained from the patient, wherein if: (i) the level of myostatin in the systemic sample is higher than a threshold and/or if the level of follistatin in the sample is lower than a threshold; and (ii) the level of myostatin and/or ActRII receptor in the at least one biopsy sample is higher than a threshold level and/or if the level of follistatin in the at least one biopsy sample is lower than a threshold level, the patient will respond to treatment.

Claims

1. A method for determining whether a subject having or suspected of having a muscle atrophy or a muscle wasting condition will respond to treatment with a myostatin pathway inhibitor, the method comprising: (a) measuring a level of myostatin in a systemic sample obtained from the subject, (b) selecting a subject wherein the level of myostatin in the systemic sample is higher than myostatin levels in systemic samples from individuals with significant muscle atrophy and/or severe or advanced muscle wasting conditions, but below myostatin levels in systemic samples from healthy individuals; and (c) administering a myostatin pathway inhibitor to the subject of (b).

2. The method according to claim 1, wherein the myostatin is measured as protein or mRNA.

3. The method according to claim 1, wherein the myostatin is measured in a pro-peptide or mature protein form.

4. The method according to claim 1, wherein the systemic sample is a whole blood sample, a serum sample, a plasma sample or a urine sample.

5. The method according to claim 1, wherein the muscle atrophy or muscle wasting condition is a muscle dystrophy; a central or spinal muscular atrophy; a neurogenic muscular atrophy; a congenital myopathy; or an ‘idiopathic’ muscle wasting condition.

6. The method according to claim 1, wherein the myostatin pathway inhibitor is a myostatin antagonist or an ActRII antagonist.

7. The method according to claim 6, wherein the myostatin antagonist is an anti-myostatin antibody, a myostatin decoy, a follistatin or a follistatin analogue.

8. The method according to claim 6, wherein the ActRII antagonist is an anti-ActRII antibody, an ActRII decoy or an inhibitor of effectors downstream of the ActRII.

9. A method for treating muscle atrophy or a muscle wasting condition, the method comprising: (a) measuring a level of myostatin in a systemic sample obtained from a subject having or suspected of having the muscle atrophy or the muscle wasting condition; (b) selecting a subject wherein the level of myostatin in the systemic sample is higher than myostatin levels in systemic samples from individuals with significatn muscle atrophy and/or severe or advanced muscle wasting conditions, but below myostation levels in systemic samples from healthy individuals;and (c) administering a treatment for the muscle atrophy or the muscle wasting condition to the subject of (b).

10. A method for determining inclusion of a subject, having or suspected of having muscle atrophy or a muscle wasting condition into a clinical trial for evaluation of a myostatin pathway inhibitor, the method comprising: (a) measuring a level of myostatin in a systemic sample obtained from the subject, (b) selecting a subject wherein the level of myostatin in the systemic sample is higher than myostatin levels in systemic samples from individuals with significant muscle atrophy and/or severe or advanced muscle wasting conditions, but below myostatin levelss in systemic samples from healthy individuals; and (c) including the subject of (b) in the clinical trial; (d) commencing the clinical trial; and (e) administering the myostatin pathway inhibitor to the subject.

11. The method according to claim 9, wherein the myostatin is measured as protein or mRNA.

12. The method according to claim 9, wherein the myostatin is measured in a pro-peptide or mature protein form.

13. The method according to claim 9, wherein the systemic sample is a whole blood sample, a serum sample, a plasma sample or a urine sample.

14. The method according to claim 9, wherein the muscle atrophy or muscle wasting condition is a muscle dystrophy; a central or spinal muscular atrophy; a neurogenic muscular atrophy; a congenital myopathy; or an ‘idiopathic’ muscle wasting condition.

15. The method according to claim 9, wherein the myostatin pathway inhibitor is a myostatin antagonist or an ActRII antagonist.

16. The method according to claim 15, wherein the myostatin antagonist is an anti-myostatin antibody, a myostatin decoy, a follistatin or a follistatin analogue.

17. The method according to claim 15, wherein the ActRII antagonist is an anti-ActRII antibody, an ActRII decoy or an inhibitor of effectors downstream of the ActRII.

18. The method according to claim 10, wherein the myostatin is measured as protein or mRNA.

19. The method according to claim 10, wherein the myostatin is measured in a pro-peptide or mature protein form.

20. The method according to claim 10, wherein the systemic sample is a whole blood sample, a serum sample, a plasma sample or a urine sample.

21. The method according to claim 10, wherein the muscle atrophy or muscle wasting condition is a muscle dystrophy; a central or spinal muscular atrophy; a neurogenic muscular atrophy; a congenital myopathy; or an ‘idiopathic’ muscle wasting condition.

22. The method according to claim 10, wherein the myostatin pathway inhibitor is a myostatin antagonist or an ActRII antagonist.

23. The method according to claim 22, wherein the myostatin antagonist is an anti-myostatin antibody, a myostatin decoy, a follistatin or a follistatin analogue.

24. The method according to claim 22, wherein the ActRII antagonist is an anti-ActRII antibody, an ActRII decoy or an inhibitor of effectors downstream of the ActRII.

25. A method for determining whether a subject having or suspected of having a muscle atrophy or a muscle wasting condition will respond to treatment with a myostatin pathway inhibitor, the method comprising: (a) measuring a level of myostatin in at least one muscle biopsy sample obtained from a treatment target muscle in the subject; and (b) selecting a subject wherein the level of myostatin in the at least one muscle biopsy sample is higher than myostatin levels in muscle biopsy samples from individuals with significant muscle atrophy and/or severe or advanced muscle wasting conditions, but below myostatin levels in muscle biopsy samples from healthy individuals; and (c) administering a myostatin pathway inhibitor to the subject of (b).

26. The method according to claim 25, wherein the myostatin is measured as protein or mRNA.

27. The method according to claim 25, wherein the myostatin is measured in a pro-peptide or mature protein form.

28. The method according to claim 25, wherein the at least one muscle biopsy sample has been obtained from a skeletal muscle.

29. The method according to claim 25, wherein the muscle atrophy or muscle wasting condition is a muscle dystrophy; a central or spinal muscular atrophy; a neurogenic muscular atrophy; a congenital myopathy; or an ‘idiopathic’ muscle wasting condition.

30. The method according to claim 25, wherein the myostatin pathway inhibitor is a myostatin antagonist or an ActRII antagonist.

31. The method according to claim 30, wherein the myostatin antagonist is an anti-myostatin antibody, a myostatin decoy, a follistatin or a follistatin analogue.

32. The method according to claim 30, wherein the ActRII antagonist is an anti-ActRII antibody, an ActRII decoy or an inhibitor of effectors downstream of the ActRII.

33. A method for determining whether a subject having or suspected of having a muscle atrophy or a muscle wasting condition will respond to treatment with a myostatin pathway inhibitor, the method comprising: (a) measuring a level of myostatin in at least one muscle biopsy obtained from a treatment target muscle in the subject; and (b) measuring a level of myostatin in a systemic sample obtained from the subject, (c) selecting a subject wherein: (i) the level of myostatin in the systemic sample is higher than myostatin levels in systemic samples from individuals with significant muscle atrophy and/or severe or advanced muscle wasting conditions, but below myostatin levels in systemic samples from healthy individuals; and (ii) the level of myostatin in the at least one muscle biopsy sample is higher than myostatin levels in muscle biopsy samples from individuals with significant muscle atrophy and/or severe or advanced muscle wasting conditions, but below myostatin levels in muscle biopsy samples from heathy individuals; and (d) administering a myostatin pathway inhibitor to the subject of (c).

34. The method according to claim 33, wherein the myostatin is measured as protein or mRNA.

35. The method according to claim 33, wherein the myostatin is measured in a pro-peptide or mature protein form.

36. The method according to claim 33, wherein the at least one muscle biopsy sample has been obtained from a skeletal muscle.

37. The method according to claim 33, wherein the systemic sample is a whole blood sample, a serum sample, a plasma sample or a urine sample.

38. The method according to claim 33, wherein the muscle atrophy or muscle wasting condition is a muscle dystrophy; a central or spinal muscular atrophy; a neurogenic muscular atrophy; a congenital myopathy; or an ‘idiopathic’ muscle wasting condition.

39. The method according to claim 33, wherein the myostatin pathway inhibitor is a myostatin antagonist or an ActRII antagonist.

40. The method according to claim 39, wherein the myostatin antagonist is an anti-myostatin antibody, a myostatin decoy, a follistatin or a follistatin analogue.

41. The method according to claim 39, wherein the ActRII antagonist is an anti-ActRII antibody, an ActRII decoy or an inhibitor of effectors downstream of the ActRII.

42. A method for treating muscle atrophy or a muscle wasting condition, the method comprising: (a) measuring a level of myostatin in at least one muscle biopsy obtained from a treatment target muscle in a subject having or suspected of having the muscle atrophy or the muscle wasting condition; and (b) selecting a subject wherein the level of myostatin in the at least one muscle biopsy sample is higher than myostatin levels in muscle biopsy samples from individuals with significant muscle atrophy and/or severe or advanced muscle wasting conditions, but below myostatin levels in muscle biopsy samples from healthy individuals; and (c) administering a treatment for the muscle atrophy or the muscle wasting condition to the subject of (b).

43. The method according to claim 42, wherein the myostatin is measured as protein or mRNA.

44. The method according to claim 42, wherein the myostatin is measured in a pro-peptide or mature protein form.

45. The method according to claim 42, wherein the at least one muscle biopsy sample has been obtained from a skeletal muscle.

46. The method according to claim 42, wherein the systemic sample is a whole blood sample, a serum sample, a plasma sample or a urine sample.

47. The method according to claim 42, wherein the muscle atrophy or muscle wasting condition is a muscle dystrophy; a central or spinal muscular atrophy; a neurogenic muscular atrophy; a congenital myopathy; or an ‘idiopathic’ muscle wasting condition.

48. The method according to claim 42, wherein the myostatin pathway inhibitor is a myostatin antagonist or an ActRII antagonist.

49. The method according to claim 48, wherein the myostatin antagonist is an anti-myostatin antibody, a myostatin decoy, a follistatin or a follistatin analogue.

50. The method according to claim 48, wherein the ActRII antagonist is an anti-ActRII antibody, an ActRII decoy or an inhibitor of effectors downstream of the ActRII.

51. A method for treating muscle atrophy or a muscle wasting condition, the method comprising: (a) measuring a level of myostatin in at least one muscle biopsy sample obtained from a treatment target muscle in a subject having or suspected of having the muscle atrophy or the muscle wasting condition; and (b) measuring a level of myostatin in a systemic sample obtained from the subject; (c) selecting a subject wherein: (i) the level of myostatin in the systemic sample is higher than myostatin levels in systemic samples from individuals with significant muscle atrophy and/or severe or advanced muscle wasting conditions, but below myostatin levels in systemic samples from healthy individuals; and (ii) the level of myostatin in the at least one muscle biopsy sample is higher than myostatin levels in muscle biopsy samples from individuals with significant muscle atrophy and/or severe or advanced muscle wasting conditions, but below myostatin levels in muscle biopsy samples from healthy individuals; and (d) administering a treatment for the muscle atrophy or the muscle wasting condition to the subject of (c).

52. The method according to claim 51, wherein the myostatin is measured as protein or mRNA.

53. The method according to claim 51, wherein the myostatin is measured in a pro-peptide or mature protein form.

54. The method according to claim 51, wherein the at least one muscle biopsy sample has been obtained from a skeletal muscle.

55. The method according to claim 51, wherein the systemic sample is a whole blood sample, a serum sample, a plasma sample or a urine sample.

56. The method according to claim 51, wherein the muscle atrophy or muscle wasting condition is a muscle dystrophy; a central or spinal muscular atrophy; a neurogenic muscular atrophy; a congenital myopathy; or an ‘idiopathic’ muscle wasting condition.

57. The method according to claim 51, wherein the myostatin pathway inhibitor is a myostatin antagonist or an ActRII antagonist.

58. The method according to claim 57, wherein the myostatin antagonist is an anti-myostatin antibody, a myostatin decoy, a follistatin or a follistatin analogue.

59. The method according to claim 57, wherein the ActRII antagonist is an anti-ActRII antibody, an ActRII decoy or an inhibitor of effectors downstream of the ActRII.

60. A method for determining inclusion of a subject, having or suspected of having muscle atrophy or a muscle wasting condition into a clinical trial for evaluation of a myostatin pathway inhibitor, the method comprising: (a) measuring a level of myostatin in at least one muscle biopsy obtained from a treatment target muscle in the subject; and (b) selecting a subject wherein the level of myostatin in the at least one muscle biopsy sample is higher than myostatin levels in muscle biopsy samples from individuals with significant muscle atrophy and/or severe or advanced muscle wasting conditions, but below myostatin levels in muscle biopsy samples from healthy individuals;and (c) including the subject of (b) in the clinical trial; (d) commencing the clinical trial; and (e) administering the myostatin pathway inhibitor to the subject.

61. The method according to claim 60, wherein the myostatin is measured as protein or mRNA.

62. The method according to claim 60, wherein the myostatin is measured in a pro-peptide or mature protein form.

63. The method according to claim 60, wherein the at least one muscle biopsy sample has been obtained from a skeletal muscle.

64. The method according to claim 60, wherein the muscle atrophy or muscle wasting condition is a muscle dystrophy; a central or spinal muscular atrophy; a neurogenic muscular atrophy; a congenital myopathy; or an ‘idiopathic’ muscle wasting condition.

65. The method according to claim 60, wherein the myostatin pathway inhibitor is a myostatin antagonist or an ActRII antagonist.

66. The method according to claim 65, wherein the myostatin antagonist is an anti-myostatin antibody, a myostatin decoy, a follistatin or a follistatin analogue.

67. The method according to claim 65, wherein the ActRII antagonist is an anti-ActRII antibody, an ActRII decoy or an inhibitor of effectors downstream of the ActRII.

68. A method for determining inclusion of a subject, having or suspected of having muscle atrophy or a muscle wasting condition into a clinical trial for evaluation of a myostatin pathway inhibitor, the method comprising: (a) measuring a level of myostatin in at least one muscle biopsy obtained from a treatment target muscle in the subject; and (b) measuring a level of myostatin in a systemic sample obtained from the subject; (c) selecting a subject wherein: (i) the level of myostatin in the systemic sample is higher than myostatin levels in systemic samples from individuals with significant muscle atrophy and/or severe or advanced muscle wasting conditions, but below myostatin levels in systemic samples from healthy individuals; and (ii) the level of myostatin in the at least one muscle biopsy sample is higher than myostatin levels in muscle biopsy samples from individuals with significant muscle atrophy and/or severe or advanced muscle wasting conditions, but below myostatin levels in muscle biopshy samples from healthy individuals; (d) including the subject of (c) in the clinical trial; (e) commencing the clinical trial; and (f) administering the myostatin pathway inhibitor to the subject.

69. The method according to claim 68, wherein the myostatin is measured as protein or mRNA.

70. The method according to claim 68, wherein the myostatin is measured in a pro-peptide or mature protein form.

71. The method according to claim 68, wherein the at least one muscle biopsy sample has been obtained from a skeletal muscle.

72. The method according to claim 68, wherein the systemic sample is a whole blood sample, a serum sample, a plasma sample or a urine sample.

73. The method according to claim 68, wherein the muscle atrophy or muscle wasting condition is a muscle dystrophy; a central or spinal muscular atrophy; a neurogenic muscular atrophy; a congenital myopathy; or an ‘idiopathic’ muscle wasting condition.

74. The method according to claim 68, wherein the myostatin pathway inhibitor is a myostatin antagonist or an ActRII antagonist.

75. The method according to claim 74, wherein the myostatin antagonist is an anti-myostatin antibody, a myostatin decoy, a follistatin or a follistatin analogue.

76. The method according to claim 74, wherein the ActRII antagonist is an anti-ActRII antibody, an ActRII decoy or an inhibitor of effectors downstream of the ActRII.

Description

(1) The invention will now be described in detail, by way of example only, with reference to the figures.

(2) FIGS. 1A-1D: Circulating levels of GDF8, FSTN, ACTIVIN A and GDF11

(3) Circulating levels of either GDF8 (A), FSTN (B), ACTIVIN A (C) and GDF11 (D) were measured in healthy control (Ctrl, N=9), Becker Muscular Dystrophy (BMD, N=6), Spinal Muscular Atrophy (SMA, N=4), Duchenne Muscular Dystrophy (DMD, N=4), Inclusion Body Myositis (IBM, N=54), Myastenia Gravis (MG, N=12) or Facioscapulohumeral Dystrophy (FSHD, N=13) patients. Horizontal lines are medians, the extremities of the boxes are delimitated by the first and third quartile, and the whiskers correspond to the 10th and 90th percentile. A multiparametric analysis of variance and a Newman-Keuls post hoc test were performed. Degree of freedom=6.

(4) FIGS. 2A-2C: Myostatin pathway in muscle biopsies

(5) mRNA levels of either MSTN, FSTN, or ACTRIIB were measured by RT-qPCR in in healthy controls (Ctrl, N=9), Becker Muscular Dystrophy (BMD, N=6), Duchenne Muscular Dystrophy (DMD, N=17), Inclusion Body Myositis (IBM, N=17), Facioscapulohumeral Dystrophy (FSHD, N=13) or Limb Girdle Muscular Dystrophy (LGMD, N=11) patients. Horizontal lines are medians, the extremities of the boxes are delimitated by the first and third quartile, and the whiskers correspond to the 10th and 90th percentile. A multiparametric analysis of variance and a Newman-Keuls post hoc test were performed. Degree of freedom=6.

(6) FIGS. 3A-3I: Myostatin network in Mtm1-KO mice.

(7) The tibialis anterior (TAs) of 3 week-old Mtm1-KO mice were injected with either PBS (A, F, G, H, I), an AAV vector coding the myostatin pro-peptide D76A mutant (PropD76A) (A), an AAV vector coding Mtm1 (Mtm1) (F, G, H, I), or an AAV coding both Mtm1 and propD76A (F, G, H, I). Two weeks later, mice were sacrificed and the TAs were weighed (A, F). The weights (B), Msnt mRNA (C), Fsnt mRNA (D) or ActRIIb mRNA (E) were measured at 14, 21 or 30 days in the TAs of either Mtm1-KO mice (KO) or wild type littermates (WT).

(8) FIG. 4A: Natural history of circulating myostatin levels in healthy and Golden Retriever muscular dystrophy (GRMD) dogs. While the myostatin level increases in healthy dogs as they age, it decreases in GRMD dogs. At the age of 2.5 months the myostatin level is sufficient to distinguish heathy and GRMD dogs. FIG. 4B: Locoregional injection of an AAV vector coding a dog microdystrophin. The injections restrict the myostatin decrease observed in GRMD dogs. FIGS. 4C and 4D: The systemic injection of a low or high dose of an AAV vector coding a dog microdystrophin is not sufficient to increase myostatin levels in GRMD dogs. Even after injection, myostatin level never reaches the levels observed in the WT animals. However, after high dose injection, myostatin level is maintained until the age of 20 months, while after low dose injection, myostatin level slowly decrease. Very interestingly, at the age of 25 months, myostatin levels suddenly fall and reach the levels observed in the non-injected animals. This probably highlights the moment when microdystrophin level is decreasing and the effect of AAV-microdystrophin therapy is waning. Indeed, after AAV injection, the muscle degeneration/regeneration cycle continues in the dogs because the treatment does not cure the animals. The microdystrophin transgene is therefore slowly cleared from the muscles leading to a decrease in microdystrophin and myostatin expression.

(9) FIG. 5: The different elements of FIG. 4 are combined. A difference in circulating myostatin levels is observed in the low dose, high dose and untreated groups. The more microdystrophin is expressed, the higher the myostatin levels are.

EXAMPLES

(10) Materials and Methods

(11) Ethics Statement and Patient Reports

(12) The collection of sera and biopsies were approved by the “Comite de Protection des Personnes” Paris VI and the French regulatory agency (ANSM) (CCP #99-12, ID RCB 2012-A01277-36), the research and Development Office (#DN 12DN29), and the East Central London Research Ethics Committee 1 (reference number 10/H0721/28). The characteristics of the patients are described in tables 1 and 2.

(13) TABLE-US-00001 TABLE 1 Characteristics of patients' sera Ctrl BMD SMA DMD IBM MG FSHD (n = 9) (n = 6) (n = 4) (n = 5) (n = 54) (n = 12) (n = 13) Age Mean  34.2  18.3  11.0   9.2 64.9 46.6  46.8 (years) Range 23.1-45.3 7.2-48.7 8.9-12.9 6.0-13.9 41.3-87.1 16.5-64.3 14.5-61.2 Gender Female 6 — 1 — 17 7  4 Male 3 6 3 5 37 5  9 Age of Mean — Early Infant Early 56.5 37.3 20  onset Range — Childhood Childhood 35-82 14.5-62.3  2-49

(14) TABLE-US-00002 TABLE 2 Characteristics of patients' biopsies Ctrl BMD DMD IBM FSHD LGMD (n = 9) (n = 6) (n = 17) (n = 17) (n = 13) (n = 11) Age Mean  43.2 32.5 9.7 70.5 45.0 28.8 (years) Range 24.0-69.0 1.6-61.3  0.8-17.7 56.9-81.0 13.0-79.4 8.6-57.9 Gender Female 6 — — 3  5  5  Male 3 6  17   14   8  6  Age of Mean — 23.8 3.3 65.4 27.2 23.3 onset Range — 5-48 2-6 45-78 16-40 2-55 (years)

(15) Mouse Experiments

(16) Mice were handled according to French and European legislation on animal care and experimentation, and protocols were approved by the institutional ethical committee. The constitutive knockout of the myotubularin gene (Mtm1-KO, also named BS53d4-129pas) was described previously (Buj-Bello et al, 2002). Wild-type littermate males were used as controls.

(17) Generation of Recombinant AAV Vector and Delivery

(18) A recombinant serotype 1 AAV vector containing mutated myostatin propeptide D76A under the CMV promoter (AAV-PropD76A) was produced as previously described (Bartoli et al, 2007). Mouse Mtm1 cDNA (AF073996, NCBI) was cloned in the AAV expression pGG2-DES plasmid, which contains the human desmin promoter. Recombinant serotype 1 viral particles (AAV1-Mtm1) were obtained by a tri-transfection procedure from HEK293 cells as previously described (Buj-Bello et al, 2008). Vector titers were expressed as viral genomes per ml (vg/ml).

(19) AAV vectors were intramuscularly delivered to 3 week-old KO mice and age matched wild type males. Mice were anesthetized by intraperitoneal injection of 5 μL/body gram of ketamine (20 mg/mL, Virbac) and xylazine (0.4%, Rompun, Bayer). Tibialis anterior (TA) muscles were injected with 3.5×109 vg of AAV-CMV-PropD76A, 5×109 vg of AAV-Mtm1 or sterile phosphate buffer saline (PBS) solution. Muscles were dissected 14 days after injection and frozen in either liquid nitrogen-cooled isopentane or liquid nitrogen for histological and molecular assays.

(20) Measurement of MSTN, FSTN, GDF11 and ACTIVIN a in Blood Serum

(21) Peripheral venous blood was collected from healthy and patients' volunteers using serum separator tubes (10 mL). After 30 minutes on the benchcoat at room temperature, the tubes were centrifuged at 2000 rpm for 10 min at 4° C. The collected serum (5 mL) was aliquoted and stored at −80° C. until further use. The concentrations of either GDF8, FOLLISTATIN, GDF11 or ACTIVIN A in the sera were measured using an ELISA kit (respectively #DGDF8, #DFN00, #DY1958 and #DAC00B R&D Systems Europe, Ltd, Abingdon, United Kingdom) according to the manufacturer's instructions. The optical density was measured using a microplate reader (Infinite 200 Pro, Tecan Group Ltd., Mannedorf, Switzerland). Importantly, the myostatin immunoassay was designed to recognize mature GDF8. According to the manufacturer, no significant cross-reactivity or interference was observed in the presence of 50 ng/ml (20 times more than the highest value measured in our experiment) of different proteins including the GDF8 propeptide, GDF11 or GDF15. We have experimentally confirmed this result by using 4000 pg/ml of recombinant GDF11. The absence of cross reactivity with FOLLISTATIN (8000 pg/ml), ACTIVIN 1 (4000 pg/ml) and GASP-1 (4000 pg/ml) was also experimentally validated.

(22) RNA Extraction, PCR and Real-Time PCR

(23) For murine samples, Total RNA was purified from muscles of 5 week-old males using TRIzol reagent (Life Technologies, Saint Aubin, France) according to manufacturer's instructions. RNA concentration was measured by spectrophotometry (OD 260 nm) using a nanodrop ND-1000 spectrophotometer (Thermo Scientific, Wilmington, Del., USA) and RNA integrity was verified by electrophoresis using ethidium bromide. After DNAse treatment (Ambion), RNA was reverse transcribed using Super Script II RNase H Reverse Transcriptase (Invitrogen) in the presence of Random Primers (Promega). Real-time PCR was performed at 60° C. as melting temperature and with primers described in Table 3 using an ABI Prism 7900 apparatus (Applied Biosystems) in a final volume of 25 μl with reverse transcriptase, forward and reverse primers (0.5 nmol/ml) and SYBRGreen Mastermix (Roche, Basel, Switzerland).

(24) TABLE-US-00003 TABLE 3 Oligonucleotides used in this study Gene SEQ Amplicon symbol Accession no Name 5′ 3′ ID NO length Actb NM_007393.5 b-actin_F CTGGCTCCTAGCACCATGAA  1 123 b-actin_R CTGCTTGCTGATCCACATCT  2 Activin A NM_008380.2 Activin A-F CACACTTCTGCACGCTCCAC 33  92 Activin A-R TTTGCCGAGTCAGGCACAG 34 Tubb5 NM_011655.5 b-tubulin_F CCTTCATTGGAAACAGCACA  3 222 b-tubulin_R CCTCCTCTCCGAAATCCTCT  4 Gapdh NM_001289726.1 Gapdh_F TTGTGATGGGTGTGAACCAC  5 283 Gapdh_R TTCAGCTCTGGGATGACCTT  6 Gdf11 NM_010272 Gdf11-F ATCAGCCGGGAGGTAGTGAA 35 159 Gdf11-R CTGGGCCATGCTTATGACCGT 36 Hprt NM_013556.2 Hprt1_F GCAAACTTTGCTTTCCCTGG  7  85 Hprt1_R ACTTCGAGAGGTCCTTTTCACC  8 Rplp0 NM_007475.5 P0_F CTCCAAGCAGATGCAGCAGA  9  87 P0_R ATAGCCTTGCGCATCATGG 10 Acvr2b NM_007397.3 ActrIIB_F GCTCAGCTCATGAACGACT 11  68 ActrIIB_R CTCTGCCACGACTGCTTGT 12 Fst NM_001301373.1 Fstn_F CTCTTCAAGTGGATGATTTTC 13 345 Fstn_R ACAGTAGGCATTATTGGTCTG 14 Mstn NM_010834.3 Mstn_F GCACTGGTATTTGGCAGAGTA 15 345 Mstn_R CACACTCTCCTGAGCAGTAAT 16 INHIBIN A ENST00000242208.4 F-ACTIVIN A TTATGGAGCAGACCTCGGAG 37  75 R-ACTIVIN A AAATCTCGAAGTGCAGCGTC 38 B2M NM_004048 F_B2M CTCTCTTTCTGGCCTGGAGG 17  67 R_B2M TGCTGGATGACGTGAGTAAACC 18 GAPDH ENST00000229239 F-GAPDH2 AAGGTGAAGGTCGGAGTCAACGG 19 199 R-GAPDH2 TGACAAGCTTCCCGTTCTCAGCC 20 GUS ENST00000304895 F-GUS CTCATTTGGAATTTTGCCGATT 21  81 R-GUS CCGAGTGAAGATCCCCTTTTTA 22 RPLP0 ENSG00000089157 F-P0 TCCAGGCTTTAGGTATCACCAC 23  94 R-P0 GCTCCCACTTTGTCTCCAGTC 24 PPIA ENST00000355968 F-PPIA CCTAAAGCATACGGGTCCTG 25 133 R-PPIA TTTCACTTTGCCAAACACCA 26 ACVR2B ENST00000352511 F52-AcvRIIb CTCCTCTGGGGATCGCTGT 27  84 R135-AcvRIIb CTCCCAGTTGGCGTTGTAGT 28 FST ENST00000256759 F1-FST CGGCTGAGCACCTCGTG 29 155 R1-FST TTCTTGTTCATTCGGCATTT 30 GDF11 ENST00000257868.9 F-GDF11 ATTGGCAGAGCATCGACTTC 39 182 R-GDF11 TTTTGTGTTCTCTAGGACTCG 40 MSTN NM_005259 F-972 TTTTACCCAAAGCTCCTCCA 31 258 R-3017 GAGTCTCGACGGGTCTCAAA 32 MYL1 ENST00000352451 F-MYL1 GCAATGAAGAGCTGAATGCCA 41 126 R-MYL1 TGTCAAAGACACGCAGACCCT 42

(25) For human samples, cryopreserved tissues were transferred in tube containing 1.4 mm ceramic beads (Precellys, Bertin Corp, Maryland, United State) plus 1 mL of Trizol (Life technologies, Saint Aubin, France) and shaken 3 times at 5700 rpm for 30s. Between each cycle, tubes were incubated in ice during at least 1 min. Total RNAs were extracted using trizol according to the manufacturer's protocol (Life technologies, Saint Aubin, France). The quantity of RNA was determined using a nanodrop ND-1000 spectrophotometer (Thermo Scientific, Wilmington, Del., USA). The reverse transcription and polymerase chain reaction (PCR) were described previously 29. qPCRs were performed on a LightCycler 480 Real-Time PCR System (Roche, Meylan, France) in a final volume of 4 μl with 0.4 μl of reverse transcriptase (RT) product, 0.18 μl each of forward and reverse primers (20 pmol/ml) and 4.5 μl of SYBRGreen Mastermix (Roche, Basel, Switzerland). After qPCR, the PCR products were run on a 2% agarose gel and were cloned using the Topocloning kit (Life Technologies, Saint Aubin, France) and sequenced. Primers used in this study are described in Table 3.

(26) Quantitative PCR (qPCR) was designed according to the MIQE standards 30. Among the 87 items to review, 57 were classified as essential. All were followed. In particular, to determine the best human housekeeping gene, 5 genes were evaluated: B2M, GAPDH, GUS, PO and PPIA. A MANOVA test has demonstrated that none of these genes were suitable for housekeeping since significant statistical changes were observed between the different groups. GUS, PO and PPIA were then chosen to calculate the expression normalization factor for each sample using geNorm software (V3.5). To determine the best housekeeping mouse gene, 6 genes were evaluated: Gapdh, Po, Hprt1, β-actin, β-tubulin and 18S and Po was chosen.

(27) Statistical Analysis

(28) A one-way ANOVA was used for all the experiments, followed by the Fisher's Least Significant Difference multiple comparison test. Differences were considered to be statistically different at p*<0.05; **<0.01; ***<0.001

(29) Results

(30) Human Myostatin Serum Concentrations are Lowest in the Most Marked Muscle Atrophying Diseases

(31) Serum concentrations of MSTN, FSTN, GDF11 and ACTIVIN A were determined in patients with different pathologies affecting skeletal muscles (summarized in Table 1). BMD (Becker Muscular Dystrophy) and DMD (Duchenne Muscular Dystrophy) share similar clinical signs and symptoms including muscle weakness and atrophy but in BMD, symptoms are milder and patients have a later onset. Both DMD and BMD are caused by different mutations in the DMD gene but mutations in DMD patients lead to an absence of any functional dystrophin protein whereas mutations in BMD patients lead to a less functional protein. SMA (Spinal Muscular Atrophy) is characterized by a loss of motor neurons leading to muscle wasting often leading to premature death. IBM (Inclusion-Body Myositis) is the most common age-related muscle disease in elderly and is a slowly progressive inflammatory and degenerative myopathy characterized by chronic muscle weakness and atrophy. FSHD (Facioscapulohumeral Dystrophy) is the most common muscular dystrophy in adults characterized by the selective atrophy of groups of muscles. Finally, MG (Myasthenia Gravis) is the most common primary disorder of neuromuscular transmission, caused by antibodies to the acetylcholine receptor leading to muscle weakness usually without severe muscle atrophy. For ACTIVIN A, no differences were observed but a trend to a lower expression in SMA and DMD patients (p=0.06 for both) was noted. No modification of GDF11 was noted, except in SMA sera in which a massive overexpression was observed. Concerning GDF8, in the most atrophic (SMA) and most wasting (DMD) muscle diseases studied a two-fold or higher decrease of circulating MSTN was observed (SMA 30.6%±13.7 and DMD 50.6%±17.18 MSTN compared to controls respectively) (FIG. 1A). Associated with this MSTN decrease, an important trend to an increase of circulating FSTN was observed (SMA 135.6%±71.3 and DMD 189.4%±35.2 compared to controls respectively) (FIG. 1B).

(32) BMD, IBM and FSHD patients, who clinically show a less pronounced muscle atrophy, have more circulating myostatin than DMD and SMA patients but less than controls (BMD 71%±23.7, IBM 71%±55.6 and FSHD 66%±35 compared to controls respectively). The levels of circulating FSTN were not increased in BMD patients (85.5%±22.4) whereas a trend to an increase was observed in both IBM and FSHD patients (146.3±70.9 and 145.8±72.8). In MG patients, who do not show any atrophy, no modification of MSTN nor FSTN was observed. Importantly, regarding all the effectors of the myostatin pathway, an important variation across samples is observed in IBM and FSHD patients, suggesting that the myostatin network may be significantly down-regulated in some patients whereas there is still preserved myostatin expression in others. A correlation test was performed between MSTN and FSTN levels, but no correlation was found.

(33) The MSTN pathway is down-regulated at mRNA level in the most atrophying diseases

(34) As MSTN is mainly produced by skeletal muscle, the mRNA expression levels of several genes implicated in the myostatin pathway were investigated in muscle biopsies (summarized in Table 2). Unfortunately, SMA biopsy could not be studied since the diagnosis is essentially genetic and a muscle biopsy is not normally performed in SMA. A massive down-regulation of MSTN was observed in both the DMD and IBM patients as only 29% and 12% of the respective mRNA levels were detectable (FIG. 2A). At the same time, FSTN was up-regulated by 2.7 fold in IBM patients (p=0.039) (FIG. 2B). Interestingly, the myostatin receptor ActRIIB was strongly down-regulated in both DMD (30% of residual mRNA, p=0.014) and IBM (40% of residual mRNA, P=0.07) but up-regulated in FSHD (+28%, p=0.006) (FIG. 2C). In LGMD and BMD, no significant modification of muscle MSTN, FSTN or ACTRIIB was observed. An important variability across LGMD and BMD samples was observed but the most atrophying diseases (DMD, SMA) showed again a general down-regulation of the myostatin pathway. No correlation was found between MSTN, ACTRIIB and FSTN in all individual diseases. However, concerning FSHD patients, FSHD1 patients express less MSTN than FSHD2 patients (p=0.048), but no difference was observed in FSTN (data not shown). FSHD2 patients showed a trend to express more ACTRIIB than FSHD1 (+120%, p=0.08).

(35) Expression of Myostatin is Crucial for a Successful Anti-Myostatin Approach

(36) In order to determine whether or not the endogenous expression level of the myostatin pathway could impact the success of anti-myostatin approaches, we used the Mtm1-KO mouse model. We have chosen the Mmt1-KO model because X-linked myotubular myopathy (XLMTM), which is a severe congenital disease due to mutations in the myotubularin coding gene MTM1, is characterized by generalized muscle hypotrophy and weakness and this mouse model recapitulates the muscle atrophy. Moreover, the XLMTM muscle phenotype can be corrected by AAV-mediated gene replacement therapy in the Mtm1-KO mouse model of the disease.

(37) Three week-old myotubularin KO (Mtm1-KO) and wild type (WT) mice were intramuscularly (in the tibialis anterior (TA)) injected with an AAV coding the myostatin pro-peptide D76A mutant (AAV8PropD76A). While an increase in muscle weight was observed in the WT mice after 1 injection (123.8%±12.7% of residual mRNA, p=1.16.10e-10), no muscle growth was observed in the Mtm1-KO mice (93.7%±26.9 of residual mRNA, p>0.05) (FIG. 3A). Because at 3 weeks, Mtm1-KO mice already show an important loss of muscle weight compared to WT littermates (84%±12% of residual mRNA at 14 days, 50%±8.1% at 21 days and 34,5%±7.2% at 30 days in tibialis anterior, FIG. 3B), the expression level of the myostatin network was investigated. A strong down expression of Mstn (47.6%±18.6% of residual mRNA at 14 days, 22.5%±7.8% at 21 days and 25%±6.5% at 30 days, FIG. 3C), associated with a massive up-regulation of Fstn (159%±44.9% of residual mRNA at 14 days, 567%±201% at day 21 and 768%±190% at day 30, FIG. 3D) was observed. ActRIIb expression was only barely affected (FIG. 3E). These results suggest that inhibiting the myostatin pathway might not be a successful therapeutic strategy in the Mtm1-KO mice at the time point of our analysis because the myostatin pathway is already dramatically down-regulated with 4.4 fold decrease of Mstn mRNA and a 5.6 fold increase of Fstn mRNA in the TA of 3 weeks old Mtm1-KO mice.

(38) The tibialis anterior of WT or Mtm1-KO mice were next intramuscularly injected with either an AAV coding the Mtm1 gene (AAV-Mtm1) or a combination of the AAV-Mtm1 gene and the AAV16 PropD76A. In the presence of the Mtm1 protein, muscle histology was greatly improved with an increase of cross-sectional fiber size, and an improved intracellular architecture revealed after NADH-TR staining (data not shown). The abnormal localizations of the dihydropyrine 1α receptor (DHPR1α) and ryanodine receptor 1 (RYR1) were partially restored. In the Mtm1-KO mice, the muscle mass was improved in the presence of the AAV-Mtm1 (148.1%±12.9% of residual mRNA, p=5.3 10e-6 compared to the Mtm1 KO injected with PBS) whereas no modification of muscle mass was observed in the WT mice (FIG. 3F). Interestingly, the presence of both AAV-Mtm1 and AAV-PropD76A allowed a further increase in muscle mass in the Mtm1-KO mice (179%±25.2%, p=7.15 10e-11, compared to the TAs injected with PBS, FIG. 3F). A similar effect was observed in the WT mice (123.3%±6.8%, p=8.5 10e-9 compared to the WT mice injected with PBS). Importantly, in both Mtm1-KO and WT mice, the simultaneous injection of AAV-PropD76A+AAV-Mtm1 led to a higher increase in muscle mass than AAV-Mtm1 alone (FIG. 3F).

(39) To determine if the myostatin pathway was restored by the expression of Mtm1 in the Mtm1-KO mice, the expression levels of Mstn, Fstn and ActRIIb were analyzed in the transduced TAs. An increase of Mstn, associated with a decrease of Fstn was observed in the presence of Mtm1 (FIG. 3G, H), without modification of ActRIIb level (FIG. 31). The combination of myostatin pathway inhibition and Mtm1 rescue enhanced both the Mstn increase and the Fstn decrease (FIG. 3G, H). These results suggest that the expression of Mtm1 in the Mtm1-KO mice leading to a 2.4 increase of Mstn and a 2.8 decrease of Fstn was sufficient to enable an anabolic effect of the myostatin propeptide on muscle mass. The muscle atrophy observed in the Mtm1-KO mice may not be due to an up-regulation of the myostatin pathway but rather a consequence of the absence of myotubularin.

DISCUSSION

(40) During the past 12 years at least 15 clinical trials aimed at inhibiting the myostatin pathway have been carried out to improve muscle mass and function in muscular diseases, and several of these studies are still underway (https://clinicaltrials.gov/). Different pathologies were targeted among them BMD, DMD, LGMD, IBM and FSHD. The concept of anti-myostatin therapy for neuromuscular diseases has been based on the postulate that inhibiting this pathway in patients might lead to an increase in muscle mass and muscle strength/function as it does in normal muscle, which implies that the level of circulating myostatin is high enough to be down-regulated by such a therapeutic approach. However, the results were disappointing: (i) the injection of MYO-29, a recombinant human neutralizing antibody to myostatin, in adult muscular dystrophies (BMD, FSHD and LGMD) did not improve any of the outcome measures (strength, lean body mass, muscle volume). (ii) DMD patients treated with ACE-031, a soluble form of activin type IIB receptor, showed a very slight increase in total body lean mass (+4.1% compared to +2.6% in the placebo group) and a non-statistically significant trend for maintenance of 6 minute walk test was observed in the ACE-031 treated group, although the study had to be interrupted after 12-16 weeks due to safety concerns. (iii) For sIBM patients treated with bimagrumab, a human monoclonal antibody targeting activin receptors IIA and IIB, an increased muscle and lean body mass was observed, as well as an improvement in the 6-minute walking test after 6 month treatment in a single dose phase 2 study. However, Novartis has recently announced that bimagrumab had not met its primary endpoint (6-minute walk distance) in a late-stage Phase2b/3 study. (iv) Only one approach in phase 2 showed preliminary promising results: BMD patients, multiply intramuscularly injected in 3 of the 4 muscles forming the quadriceps with an AAV vector encoding the follistatin isoform FS344 showed an improvement of the 6 minute walk test by 11.5% at 6 months post injection. Currently, several clinical trials are underway and results are expected next year.

(41) Different possibilities could explain this absence of functional improvement, among them the drug pharmacokinetic/pharmacodynamic (PK/PD) in the conditions studied so far in humans. A retrospective analysis demonstrated that central clearance of MYO-029 in humans is greater than 2 fold than typical IgG1 mAbs and PK/PD analyses in monkeys suggesting that peak and steady state exposures in the MYO-029 trial might achieve only 50% and 10% of the maximum effect seen in monkeys. This would explain why the MYO-029 had a low probability to induce a muscle mass increase in patients. Another explanation could be the lack of specificity of the drugs themselves, MSTN and GDF11 sharing 90% in their mature region for example. Finally, MSTN might not be the only ligand implicated in muscle growth to bind ACTRIIB, as it was demonstrated that blocking ActRIIb in Mstn deficient mice further enhances muscle mass.

(42) In our study, we have explored another confounding possibility based on the expression levels of circulating and muscle-endogenous proteins implicated in the myostatin pathway. Recently, Burch et al. (2017) have published that serum myostatin concentrations are reduced in patients with muscle diseases. They concluded that because myostatin is mainly produced by muscle tissue, these reduced circulating myostatin may reflect the net loss of functional muscle mass. Our data however do not support this hypothesis. Indeed, we have observed that whole myostatin pathway is strongly altered in the most atrophying neuromuscular diseases, at both mRNA and protein levels, and that the lower expression of serum myostatin is associated with a reduced muscle expression of MSTN mRNA. These results indicated that reduced circulating myostatin levels are not, or at least not only, the reflexion of muscle loss but represent an altered myostatin homeostasis of the diseased tissue. In addition, the muscle atrophy observed in DMD patients is not the consequence of an activation of the myostatin pathway. On the contrary, our data indicate that the myostatin pathway may be intrinsically down-regulated in atrophying or wasting muscle diseases to counterbalance the wasting process. This could explain the apparent contradictory results in mice and humans regarding the efficacies of anti-myostatin approaches. Indeed, the outcome of a clinical trial in DMD patients was not encouraging, while myostatin pathway blockade has been successful in mdx mice. Despite the fact that Duchenne patients and mdx mice share a mutation in the same gene, no important muscle atrophy is observed before 6 months of age in the mdx mouse and experiments are usually performed before this age. Moreover, even if myostatin levels are lower in mdx mouse than in wild type mouse, the endogenous circulating myostatin level is at least 50 times higher in mice than in humans. This could be one of the reasons why anti-myostatin approaches in the mdx model were successful.

(43) Finally, one of the most important questions raised by our work concerns the usefulness of blocking the myostatin pathway in neuromuscular diseases in general. In slowly progressive pathologies such as BMD or FSHD, an important variability of both myostatin and follistatin circulating proteins is observed across samples, suggesting that at least some patients may be eligible for an anti-myostatin approach. However, in the most wasting neuromuscular diseases such as DMD, the whole myostatin pathway is down-regulated. Interestingly, in the Mtm1-KO mouse model, the restoration of Mtm1 expression is associated with a normalisation of the Mstn pathway, indicating by analogy that at least partial restoration of the dystrophin protein might be necessary before the inhibition of myostatin. Such an assumption is supported by the higher circulating myostatin levels in BMD compared to DMD, and experimentally by the stronger effect of anti-myostatin therapy in mdx mice if complemented by dystrophin restoration through exon skipping. Therefore, for future trials of anti-myostatin therapy patient eligibility should be tested by ascertaining sufficient levels of the therapy target and taking into account that general circulating myostatin levels may not be representative of the muscle-intrinsic levels of affected target muscles. Furthermore, in the most atrophying diseases, the mutated gene might need to be rescued first in order to restore myostatin expression before inhibiting the myostatin pathway becomes a therapeutic option.

Example 2

(44) Golden Retriever muscular dystrophy (GRMD) dog samples were obtained from either the Boisbonne center for gene therapy or the Ecole Nationale Veterinaire d′Alfort. Some dogs have been locoregionaly (single administration of 1×10.sup.13 vg/kg via transvenous perfusion of one forelimb) or systemically (single dose of 1×10.sup.14 vg/kg or 1×10.sup.13 vg/kg) treated with a rAAV2/8 vector encoding a canine microdystrophin, as described in Le Guiner et al (Nat Comms, 2017).

(45) Injected dogs were monitored for several months and blood samples were collected at different time before the dogs were euthanized.

(46) The concentrations of GDF8 were assessed by ELISA (#DGDF80, R&D Systems Europe, Ltd, Abingdon, United Kingdom) according to the manufacturer's instructions. The optical density was measured using a microplate reader (Infinite 200 Pro, Tecan Group Ltd., Mannedorf, Switzerland).

(47) Results can be seen in FIGS. 4 and 5 and demonstrate that muscle wastage can be stabilised by gene therapy with a rAAV2/8 vector encoding a canine microdystrophin, particularly when the therapy is administered systemically at the high dose (FIG. 4D).

REFERENCES

(48) M. Bartoli, J. Poupiot, A. Vulin, F. Fougerousse, L. Arandel, N. Daniele, C. Roudaut, F. Noulet, L. Garcia, O. Danos, and I. Richard, AAV-mediated delivery of a mutated myostatin propeptide ameliorates calpain 3 but not alpha-sarcoglycan deficiency, Gene therapy (2007).14 (9), 733. A. Buj-Bello, V. Laugel, N. Messaddeq, H. Zahreddine, J. Laporte, J. F. Pellissier, and J. L. Mandel, The lipid phosphatase myotubularin is essential for skeletal muscle maintenance but not for myogenesis in mice, Proceedings of the National Academy of Sciences of the United States of America (2002). 99 (23), 15060. A. Buj-Bello, F. Fougerousse, Y. Schwab, N. Messaddeq, D. Spehner, C. R. Pierson, M. Durand, C. Kretz, O. Danos, A. M. Douar, A. H. Beggs, P. Schultz, M. Montus, P. Denefle, and J. L. Mandel, AAV-mediated intramuscular delivery of myotubularin corrects the myotubular myopathy phenotype in targeted murine muscle and suggests a function in plasma membrane homeostasis, Human molecular genetics (2008). 17 (14), 2132. S. Cohen, J. A. Nathan, and A. L. Goldberg, Muscle wasting in disease: molecular mechanisms and promising therapies, Nature reviews (2015). 14 (1), 58. P. M. Burch, O. Pogoryelova, J. Palandra, R. Goldstein, D. Bennett, L. Fitz, M. Guglieri, C. M. Bettolo, V. Straub, T. Evangelista, H. Neubert, H. Lochmuller, and C. Morris, Reduced serum myostatin concentrations associated with genetic muscle disease progression, Journal of neurology (2017). 264(3):541-553. L. W. Gamer, K. A. Cox, C. Small, V. Rosen, Gdf11 is a negative regulator of chondrogenesis and myogenesis in the developing chick limb. Developmental Biology (2001). 229(2):407-20. C. Le Guiner, L. Servais, M. Montus, T. Larcher, B. Fraysse, S. Moullec, M. Allais, V. Francois, M. Dutilleul, A. Malerba, T. Koo, J-L Thibaut, B. Matot, M. Devaux, J. Le Duff, J-Y Deschamps, I. Barthelemy, S. Blot, I. Testault, K. Wahbi, S. Ederhy, S. Martin, P. Veron, C. Georger, T. Athanasopoulos, C. Masurier, F. Mingozzi, P. Carlier, B, Gjata, J-Y. Hogrel, O. Adjali, F. Mavilio, T. Voit, P. Moullier & G. Dickson, Long-term microdystrophin gene therapy is effective in a canine model of Duchenne muscular dystrophy, Nature Communications (2017). 8:16105. Q. Jin, C. Qiao, J. Li, J. Li, X. Xiao, Neonatal Systemic AAV-Mediated Gene Delivery of GDF11 Inhibits Skeletal Muscle Growth, Molecular Therapy (2018). February 2. pii: S1525-0016(18)30023-6. J. E. Jones, S. M. Cadena, C. Gong, X. Wang, Z. Chen, S. X. Wang, C. Vickers, H. Chen, E. Lach-Trifilieff, J. R. Hadcock, D. J. Glass, Supraphysiologic Administration of GDF11 Induces Cachexia in Part by Upregulating GDF15, Cell Reports (2018). 22(6):1522-1530. Latres E, Mastaitis J, Fury W, Miloscio L, Trejos J, Pangilinan J, Okamoto H, Cavino K, Na E, Papatheodorou A, Willer T, Bai Y, Hae Kim J, Rafique A, Jaspers S, Stitt T, Murphy A J, Yancopoulos G D, Gromada J, Activin A more prominently regulates muscle mass in primates than does GDF8, Nature Communications (2017). 8:15153