A CANCER-TREATING RECOMBINANT PROTEIN THAT IMPROVES THE ACTIVITY OF CYTOTOXIC KILLER CELLS TARGETING CANCER CELLS AND USE THEREOF
20190309036 ยท 2019-10-10
Assignee
Inventors
Cpc classification
C12N5/0638
CHEMISTRY; METALLURGY
A61K39/4611
HUMAN NECESSITIES
A61K35/17
HUMAN NECESSITIES
C07K2319/10
CHEMISTRY; METALLURGY
A61K39/464466
HUMAN NECESSITIES
A61K2239/38
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
A61K35/17
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
Abstract
A cancer killer cell in which a therapeutic recombinant protein or recombinant protein which improves cytotoxic activity of the cancer killer cell is loaded. In addition, a pharmaceutical composition including the recombinant protein or a recombinant protein-loaded cancer killer cell is disclosed. Further, disclosed is a method for preparing a recombinant protein-loaded cancer killer cell.
Claims
1. A recombinant protein for treating cancer consisting of an amino acid sequence of SEQ ID NO: 1, which is loaded in a cancer killer cell to improve cytotoxic activity of the cancer killer cell.
2. The recombinant protein of claim 1, wherein the recombinant protein is further fused with a protein transduction domain (PTD).
3. The recombinant protein of claim 2, wherein the fusion of PTD is by a peptide linker or direct fusion.
4. The recombinant protein of claim 1, capable of stabilizing actin polymerized in an immunological synapse by stimulation of a T-cell antigen receptor.
5. The recombinant protein of claim 1, wherein cytokine expression is increased when the recombinant protein is loaded in the cancer killer cell compared to a control group in which the recombinant protein is not loaded in the cancer killer cell.
6. The recombinant protein of claim 5, wherein the cytokine is at least one of mIL-2, mIFN?, and mGZMB.
7. A recombinant protein-loaded cancer killer cell, wherein the cancer killer cell comprises the recombinant protein of claim 1.
8. The recombinant protein-loaded cancer killer cell of claim 7, wherein the loading of the recombinant protein in the cancer killer cell is performed by: i) transduction of a polynucleotide encoding the recombinant protein consisting of the amino acid sequence of SEQ ID NO:1 by retrovirus.
9. A pharmaceutical composition for treating cancer, comprising: i) a recombinant protein for treating cancer consisting of an amino acid sequence of SEQ ID NO: 1, which is loaded in a cancer killer cell to improve cytotoxic activity of the cancer killer cell; ii) a recombinant protein, wherein a PTD is further fused into the i) protein; or iii) a cancer killer cell in which the recombinant protein of claim 7 is loaded.
10. The pharmaceutical composition for treating cancer of claim 9, wherein the cancer is lung cancer, gastric cancer, colon cancer, breast cancer, bone cancer, pancreatic cancer, skin cancer, head cancer, head and neck cancer, melanoma, uterine cancer, ovarian cancer, colon cancer, small intestine cancer, rectal cancer, anal cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulva cancer, Hodgkin's disease, esophageal cancer, lymph node cancer, bladder cancer, gall bladder cancer, endocrine cancer, prostate cancer, adrenal gland cancer, soft tissue sarcoma, urethral cancer, penile cancer, chronic or acute leukemia, lymphocytic lymphoma, renal cancer, ureteral cancer, renal pelvic cancer, central nervous system (CNS) tumor, spinal cord tumor, brainstem glioma, or pituitary adenoma.
11. A method for treating cancer, comprising administering the composition of claim 9 in a pharmaceutically effective amount to a subject suspected of having a cancer excluding humans.
12. A method for producing a recombinant protein-loaded cancer killer cell, comprising: (a) fusing a PTD into an amino acid of SEQ ID NO: 1; and (b) introducing the fusion protein of (a) into a cancer killer cell.
13. A method for producing a recombinant protein-loaded cancer killer cell, comprising: transducing into a cancer killer cell using retrovirus comprising a polynucleotide encoding an amino acid sequence of SEQ ID NO: 1.
14. The recombinant protein-loaded cancer killer cell of claim 7, wherein the loading of the recombinant protein in the cancer killer cell is performed by: i) transduction of a polynucleotide encoding the recombinant protein consisting of the amino acid sequence of SEQ ID NO: 1 further fused with a protein transduction domain (PTD) by retrovirus.
15. The recombinant protein-loaded cancer killer cell of claim 7, wherein the loading of the recombinant protein in the cancer killer cell is performed by: i) introduction in the form of the recombinant protein consisting of sequence of SEQ ID NO: 1 further fused with a protein transduction domain (PTD).
Description
BRIEF DESCRIPTION OF DRAWINGS
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
DETAILED DESCRIPTION
Mode for Invention
[0064] Hereinafter, the present disclosure will be described in more detail with reference to the following Examples. However, these Examples are for illustrative purposes only, and the invention is not intended to be limited by these Examples.
Experimental Example 1: Reagents and Antibodies
[0065] Rabbit polyclonal anti-TAGLN2 antibodies were raised in rabbits using purified full-length TAGLN2 (AbFrontier, Seoul, Korea). Rabbit polyclonal anti-green fluorescent protein (GFP) and rabbit polyclonal anti-?-actin antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, Calif., USA). Mouse polyclonal anti-His, anti-Vinculin, anti-Talin, anti-RapL, anti-LFA-1, anti-Rap1, horseradish peroxidase-conjugated anti-mouse IgG, and anti-rabbit or mouse IgG antibodies were obtained from Cell Signaling Technology (Danvers, Mass., USA). 145-2C11 (mouse anti-CD3; CRL-1975) and PV1 (mouse anti-CD28; HB-12352) hybridoma cell lines were purchased from the American Type Culture Collection (ATCC; Manassas, Va., USA). TS1/18 (anti-human LFA-1; HB-203) and R6.5 (anti-human ICAM-1) hybridoma cell lines were a gift from T.A. Springer (Harvard Medical School, Boston, Mass., USA). Anti-human CD28 and anti-mouse ICAM-1 antibodies were acquired from R&D Systems (Minneapolis, Minn., USA). Anti-mouse CD8a, anti-rabbit IFN, and anti-rabbit GZMB antibodies were obtained from Abcam (Cambridge, Mass., USA). Anti-mouse LFA-1, fluorescein isothiocyanate (FITC)-conjugated anti-mouse ICAM-1, and FITC-rat IgG1 isotype control antibodies were purchased from Biolegend (San Diego, Calif., USA). CellTracker CMFDA-green, CMRA-orange, and Lipofectamine reagent were obtained from Invitrogen (Carlsbad, Calif., USA). OVA peptide fragments (257-265) were purchased from InvivoGen (San Diego, Calif., USA). Staphylococcal enterotoxin E (SEE) and staphylococcal enterotoxin B (SEB) were obtained from Toxin Technology, Inc. (Sarasota, Fla., USA). Tetramethylrhodamine (TRITC)-phalloidin and poly-L-lysine (PLL) were purchased from Sigma (St. Louis, Mo., USA). PCR premix was purchased from Enzynomics (Daejeon, Korea). Restriction enzymes were purchased from New England Biolabs, Inc. (Beverly, Mass., USA). The plasmid DNA purification kit and WEST-ZOL Western Blot Detection kit were purchased from iNtRON Biotechnology (Seongnam, Korea). PrimeSTAR HS DNA polymerase was purchased from TaKaRa Bio Inc. (Shiga, Japan). Unless otherwise stated, all chemical reagents were purchased from Sigma.
Experimental Example 2: Cells
[0066] Jurkat T (TIB-152), E0771 (CRL-2755), and B16F10 (CRL-6475; all from ATCC) cells and Platinum-E (Plat-E) retroviral packaging cells (Cell Biolabs, San Diego, Calif., USA) were maintained in RPMI-1640 or Dulbecco's modified Eagle medium (Invitrogen) supplemented with 10% (v/v) fetal bovine serum (FBS; Invitrogen). Stable E0771 cells expressing OVA (pCL-neo-cOVA; Addgene, Cambridge, Mass., USA) were prepared by transfection with Lipofectamine 2000 reagent (Invitrogen) and selected with G418 (InvivoGen). Naive CD3.sup.+ T cells were purified from mouse spleen and lymph nodes by negative selection using a T-cell enrichment column (R&D Systems). To generate mouse T-cell blasts, CD3.sup.+ T cells were incubated in 2 ?g/mL anti-CD3/28 coated culture plates with 100 U/mL rIL-2 for 48 hours and cultured for an additional 5 days with 100 U/mL rIL-2. Mouse splenocytes were dispersed and purified into CD8.sup.+ and CD19.sup.+ populations using EasySep (StemCell Technologies, Seattle, Wash., USA). The purity of each population was confirmed to be more than 95% by flow cytometry.
Experimental Example 3: cDNA Constructs
[0067] To generate TAGLN2, a TAGLN2 clone coding for the full-length open reading frame was purchased from ImaGene (Berlin, Germany). TAGLN2, TAGLN2?CR (?174-199), TAGLN2?CH (?2-136), and TAGLN2?AB (?153-160) genes were generated by standard or overlapping PCR, and subcloned into the pEGFP vector (Addgene).
[0068] To produce His-tagged TG2P, the pET-21a vector was used as an expression vector; this vector has a T7 promoter and provides six His residues at the C-terminus of the expressed protein. The coding sequence of TAGLN2 was amplified by PCR, and the products were incorporated into the pET-21a vector (Novagen, Madison, Wis., USA).
Experimental Example 4: Animals
[0069] C57BL/6 wild-type mice and OTI TCR transgenic mice (C57BL/6 background) were purchased from Jackson Laboratories (Bar Harbor, Me., USA). All mice were housed in specific pathogen-free conditions. All experimental methods and protocols were approved by the Institutional Animal Care and Use Committee of the School of Life Sciences, Gwangju Institute of Science and Technology and carried out in accordance with their approved guidelines.
Experimental Example 5: Retroviral Transduction from Mouse T Cell
[0070] Before retroviral transduction, mouse CD3.sup.+ T cells from C57BL/6 mice or CD8.sup.+ T cells from OTI TCR C57BL/6 mice were incubated in 2 ?g/mL anti-CD3/28-coated plates with 100 U/mL hIL-2 for 48 hours. A total of 5?10.sup.6 retroviral packaging cells (Plat-E; Cell Biolabs) were plated overnight in 10 cm.sup.2 dishes. Retroviral particles were generated by transfection with retroviral vectors (empty vector, GFP, and TG2) and pCL-Eco packaging vector using Lipofectamine 2000 (Invitrogen). After 48 hours, virus supernatants (1 mL) were harvested, mixed with 10.sup.6 mouse T cells, incubated in 12-well plates coated with 20 ?g/mL retronectin, and centrifuged for 90 minutes at 2,000?g at 25? C. with 100 U/mL hIL-2. The transduced T cells were maintained with fresh media with hIL-2 and expanded for 5 to 8 days.
Experimental Example 6: Determination of Cellular F-Actin Contents
[0071] Cells were maintained in serum-free medium for 12 hours and incubated with anti-CD3/28 for the indicated times at 37? C. The reactions were terminated by adding 4% paraformaldehyde. Fixed cells were washed once with PBS and resuspended in PBS containing 1% bovine serum albumin and 0.25% Triton X-100 for 5 minutes. After permeabilization, the cells were washed, stained for 30 minutes with TRITC-phalloidin (Sigma), and then analyzed by flow cytometry.
Experimental Example 7: Analysis of Adhesion
[0072] T cells and target cells (B cell, B16F10, and E0771) were stained with Cell Tracker Green CMFDA and Orange CMRA, respectively, in accordance with the manufacturer's protocols (Invitrogen). B cells (5?10.sup.5) were incubated with 5 ?g/mL SEB or vehicle control for 30 minutes, washed, and resuspended in RPMI 1650 medium. E0771 or B16F10 cells (5?10.sup.5) were incubated with 10 ?g/mL OVA257-264 peptides for 30 minutes, washed, and resuspended in RPMI 1640 medium.
[0073] For conjugation, equal volumes of the T cells and target cells were mixed and incubated at 37? C. The relative proportion of green, orange, and green-orange events in each tube was determined by two-color flow cytometry using FACSCanto (BD Biosciences, San Jose, Calif., USA), and analyzed with FlowJo software (Treestar, San Carlos, Calif., USA). The number of gated events counted per sample was at least 10,000. The percentage of the conjugated T cells was determined as the number of dual-labeled (CMFDA- and CMRA-positive) events divided by the number of CMFDA-positive T cells.
Experimental Example 8: Observation with Confocal Microscopy
[0074] To investigate TAGLN2 localization, Jurkat T cells expressing TG2 GFP were transfected with LifeA_RFP, and incubated for 30 minutes with 1 ?g/mL SEE-pulsed Raji B cells stained with ICAM-1_Cy5. The cells were then placed on PLL-coated glass and imaged using a 100?, NA 1.40 oil immersion objective on a laser-scanning confocal microscope (FV1000; Olympus, Tokyo, Japan).
[0075] To evaluate ICAM-1 expression in B16F10 and E0771 cells, cells were detached using 10 mM ethylenediaminetetraacetic acid, stained with anti-ICAM-1-FITC, and observed using a 60?, NA 1.40 oil immersion objective. In some conjugation assays, samples were prepared as described above, and E0771 (5?10.sup.5) cells were stained with CMRA-orange cell tracker for 30 minutes, washed, and seeded on glass-bottom confocal dishes for 24 hours. The next day, EV- or TG2P-treated OTI CD8.sup.+ T cells (5?10.sup.5) were stained with CMFDA-green and incubated with cancer cells for 2 hours. The unattached cells were removed by washing with warm PBS and observed using a 40?, NA 1.40 oil immersion objective.
Experimental Example 9: Western Blotting
[0076] Cells were lysed in an ice-cold lysis buffer (50 mM Tris-HCl, pH 7.4, containing 150 mM NaCl, 1% Triton X-100, and a protease inhibitor) for 15 minutes on ice. Cell lysates were centrifuged at 16,000?g for 30 minutes at 4? C., and the supernatants were eluted with an SDS sample buffer (100 mM Tris-HCl, pH 6.8, 4% SDS, and 20% glycerol with bromophenol blue) and heated for 5 minutes. The proteins were separated by SDS PAGE on 10% to 15% gels and were transferred to nitrocellulose membranes using a Trans-Blot SD semidry transfer cell (Bio-Rad, Hercules, Calif., USA). The membrane was blocked in 5% skim milk (1 hour), rinsed, and incubated with appropriate antibodies in TBS containing 0.1% Tween 20 (TBS-T) and 0.5% skim milk overnight. Excess primary antibody was then removed by washing the membrane three times in TBST. The membrane was then incubated with 0.1 ?g/mL peroxidase-conjugated secondary antibodies (anti-rabbit or anti-mouse) for 1 hour. After three washes with TBST, bands were visualized using western blotting detection reagents and were then exposed to X-ray film (Kodak, Rochester, N.Y., USA).
Experimental Example 10: Immunoprecipitation (IP)
[0077] Cell lysates were pre-cleared, and the supernatants were incubated with the antibodies overnight at 4? C., followed by incubation with protein A/G agarose beads (Santa Cruz Biotechnology). The beads were collected and washed with PBS, and then resuspended with a 5? SDS loading buffer. The immunoprecipitated proteins were separated by SDS-PAGE on 12% gels, and analyzed by Western blotting, as described above.
Experimental Example 11: Pull-Down Analysis for Rap1
[0078] Active GTP-bound Rap1 levels were measured using an EZ-Detect Rho activation kit in accordance with the manufacturer's instructions (Thermo Fisher Scientific Inc., Rockford, Ill., USA). Specifically, Jurkat T cells expressing GFP or TG2_GFP cells were stimulated with anti-CD3/28 at 37? C. for an indicated times, washed once with ice-cold PBS, and lysed in a buffer containing 20 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% Triton X-100, and protease inhibitor cocktail.
[0079] The samples were incubated on ice for 20 minutes, followed by centrifugation (16,000?g, 30 minutes, 4? C.). Equal amounts of supernatants were incubated with GST-RalGDS-RBD/GSH-beads for GTP-Rap1 for 12 hours at 4? C. The beads were washed three times with the lysis buffer, and the bound proteins were eluted with sample buffer by boiling. Samples were electrophoresed and analyzed by Western Blotting with anti-Rap1 antibodies.
Experimental Example 12: Flow Cytometric Analysis
[0080] The cells were suspended in PBS containing 2% FBS, and stained with fluorescent-conjugated antibodies against mouse ICAM-1 or isotype control for 15 minutes at room temperature. The cells were then assessed on a FACSCanto (BD Biosciences), and the resulted data were analyzed with FlowJo software (Treestar).
Experimental Example 13: Measurement of Cytokine Secretion
[0081] CD3.sup.+ T or OTI CD8.sup.+ T cells were stimulated with SEB-loaded B cells or OVA-loaded cancer cells. After incubation for the indicated times, the amounts of mIL-2, mIFN?, and mGZMB in a supernatant were measured by ELISA.
Experimental Example 14: In Vitro Cytotoxicity Assay
[0082] For in vitro cytotoxic T-cell activity assays, OTI CD8.sup.+ T cells were generated and incubated with E0771 or B16F10 cells in the absence or presence of OVA. After 6 hours or 24 hours, cell-mediated cytotoxicity was determined using a Pierce LDH Cytotoxicity Assay Kit (Thermo Scientific Inc.), and the percent cytotoxicity was calculated according to the manufacturer's instructions.
[0083] For flow cytometric cytotoxicity assays, PKH26 (Sigma) was diluted according to the manufacturer's kit directions. E0771 or B16F10 cells were washed in PBS and resuspended in 1 mL diluent C from the kit. The PKH26 was diluted to 4 ?M in 1 mL diluent C. Cells were combined with dye, and the tube was inverted several times over 3 minutes. About 2 mL FBS was added to the tube, and tube was inverted continuously for 1 minute. Cells were then transferred to 15 mL conical tubes with 4 mL phenol red-free of RPMI 1640 with 10% FBS and washed three times in the same medium. OTI CD8.sup.+ T cells were washed twice in phenol red-free RPMI with 10% FBS, mixed with PKH26-labeled cancer cells, and incubated at 37? C. for 4 hours. After incubation, 10 ?L of a 5 ?g/mL solution of 7-AAD was added to the cell suspension for 10 minutes on ice. Cells were evaluated on a FACSCanto (BD Biosciences), and data were analyzed with FlowJo software (Treestar).
Experimental Example 15: Xenograft Model
[0084] For the preparation of an OVA-E0771 tumor model, the fourth mammary fat pads of 8-week-old C57BL/6 female mice were orthotopically injected with 5?10.sup.5 OVA-E0771 cells on day 0. The mice were conditioned with 5 Gy total body irradiation immediately before T cell transfer. OTI CD8.sup.+ T (1?10.sup.7 cells), OTI TG2-CD8.sup.+ T, or OTI TG2P-CD8.sup.+ T cells were injected into the tail vein on days 7, 10, and 13 after tumor inoculation. The animals were sacrificed 28 days after tumor injection, and tumors were weighed and imaged.
[0085] For analysis of the in vivo activity of TG2-loaded CD8.sup.+ T cells, OTI CD8.sup.+ T (1?10.sup.7 cells), OTI TG2-CD8.sup.+ T, or OTI TG2P-CD8.sup.+ T cells were injected into the tail vein on day 14 after tumor inoculation. Two days later, animals were sacrificed, and tumor tissues were extracted.
[0086] For immunofluorescence, tumor tissues were fixed in 4% paraformaldehyde for 2 hours at room temperature, washed with PBS, and dehydrated in 30% sucrose until tumor tissues sunk. Tissues were then cryoprotected with Tissue-Tek OCT (Sakura Finetek, Torrance, Calif., USA), and 10 ?m cryosections were mounted with Fluorescent Mounting Medium (Dako, Carpinteria, Calif., USA). Images were obtained using a 40?, NA 1.40 oil immersion objective on a laser-scanning confocal microscope (FV1000).
[0087] To compare the amounts of tumor infiltrated CD8.sup.+ T cells (OTI CD8.sup.+ T (green) and OTI TG2-CD8.sup.+ T (green/red) or OTI TG2P-CD8.sup.+ T (red) cells, tumor tissues were homogenized in PBS, and cells were evaluated on a FACSCanto (BD Biosciences). Data was analyzed with FlowJo software (Treestar).
[0088] For immunohistochemistry, the extracted tumor tissues were fixed in 4% paraformaldehyde and embedded in paraffin. Tissue slices (5 ?m) were incubated with anti-ICAM-1, anti-CD8T, anti-Ki67, anti-GZMB, and anti-INF antibodies or TdT-BiOTIn-dUTP mix (100 ?L TdT buffer [30 mM Tris, pH 7.2, 140 mM sodium cacodylate, 1 mM cobalt chloride], 30 U TdT, and 0.5 ?L BiOTIn-dUTP mix [Boehringer Mannheim, Indianapolis, Ind., USA]) followed by diaminobenzidine staining (Dako and R&D Systems) according to the manufacturer's instructions. TUNEL assays were performed using an In Situ Cell Death Detection kit, AP (Roche, Mannheim, Germany). Microscopy images were analyzed using ImmunoRatio (http://imtmicroscope.uta.fi/immunoratio) or recorded by a pathologist.
Experimental Example 16: Purification of TG2P
[0089] Expression of TG2P in Escherichia coli BL21 (DE3) cells was performed as described for transduction of the aforementioned recombinant plasmids. The expression of TG2P was induced by addition of 0.5 mM isopropyl ?-D-1-thiogalactopyranoside to the culture medium overnight at 25? C., and cells were then collected. The cell pellets were resuspended in PBS, sonicated, and centrifuged. After centrifugation, the TG2P in the supernatant was purified by affinity chromatography on a His-selected Nickel Affinity gel (Sigma). The gel was equilibrated with 10 volumes of buffer (50 mM sodium phosphate, pH 8.0, and 0.3 M NaCl) and incubated with the supernatant. The gel was washed with 5 volumes of wash buffer (50 mM sodium phosphate, pH 8.0, 0.3 M NaCl, and 10 mM imidazole). The TG2P was eluted with increasing concentrations of imidazole up to 250 mM. The eluted TG2P was desalted using PD-10 Sephadex G-25 (Amersham Pharmacia Biotech, Uppsala, Sweden), supplemented with 10% glycerol and separated into aliquots, followed by flash-freezing at ?70? C.
Experimental Example 17: Reverse Transcription PCR (RT-PCR) and Real-Time Quantitative RT-PCR (qRT-PCR)
[0090] Total RNA was isolated from cells using TRIzol reagent (Molecular Research Center, Cincinnati, Ohio, USA). cDNA was prepared using RT Premix. Real-time qPCR was conducted in an ABI PRISM 7300 RT-PCR system using a SYBRreen PCR Master Mix (Applied Biosystems, Carlsbad, Calif., USA). Gene-specific primers (forward and reverse primer pairs, respectively) are shown in Table 1 below.
TABLE-US-00001 TABLE1 SEQ SEQ Gene Primer5.fwdarw.3 (Forward) IDNO Primer5.fwdarw.3 (Reverse) IDNO IL-2 CACGTCTTGCACTTGTCAC 3 CCTTCTTGGGCATGTAAAACT 4 INF? GCTCTGAGACAATGAACGCT 5 AAAGAGATAATCTGGCTCTG 6 GZMB TTTCATCCTGTAATTGGACTAA 7 GCGATCTCCACACTTCTC 8 GAPDH GCACAGTCAAGGCCGAGAAT 9 GCCTTCTCCATGGTGGTGAA 10
[0091] The mRNA levels of the target genes relative to GAPDH were normalized using the following formula: relative mRNA expression=2?(.sup.?Ct of target gene??C of GAPDH), where Ct is the threshold cycle value. In each sample, the expression of the analyzed gene was normalized to that of GAPDH, and described as the mRNA level relative to GAPDH.
Experimental Example 18: Statistical Analysis
[0092] Mean values were calculated using data taken from at least three independent experiments conducted on different days. In the case of the significance testing, unpaired Student's t tests and one-way analysis of variance tests were used. Differences between groups were considered significant when the P value was less than 0.05.
Example 1: Determination Whether TAGLN2, an F-Actin Stabilizer, is a Cytoplasmic Factor Modulating Inside-Out Signal of LFA-1
[0093] TAGLN2 (TG2), predominantly expressed in lymphocytes, is highly concentrated at the peripheral actin ring of an IS (
[0094] These results suggested that TAGLN2, in addition to its biochemical characteristics enabling it to control actin dynamics, acted as a cytosolic factor to modulate inside-out signaling of the integrin LFA-1.
[0095]
[0096] These dual regulatory mechanisms of TAGLN2 enhanced T cell activation, thereby leading to a hypothesis that TAGLN2 could be a potential effector molecule capable of potentiating cancer cell killing via cell therapies. That is, TAGLN2 may be applicable in many types of cancer immunotherapy including CAR or TCR transgene-adopted cytotoxic T and NK cells.
Example 2: Adhesion of Cytotoxic T Cells onto Cancer Cells
[0097] In order to determine whether the retroviral transduction of TAGLN2 potentiates the adhesion of cytotoxic T cells onto ICAM-1-positive cancer cells, a retroviral DNA construct containing wild-type TAGLN2 and eGFP genes or eGFP (empty vector [EV]) alone was generated (
[0098] Specifically, retroviral particles containing TAGLN2 or EV were produced from host plat E cells and infected into mouse primary CD8.sup.+ T cells for determination of the viral transduction efficiency by flow cytometry. The efficiency was generally over 80% (
[0099] As the conjugation of T cells with APCs was observed, the expression levels of ICAM-1 in two cancer cell lines were observed to find whether TAGLN2 expression may influence CD8.sup.+ T cell adhesion to cancer cells via the LFA-1/ICAM-1 interaction.
[0100] As a result, B16F10 melanoma expressed little ICAM-1, whereas E0771 breast cancer cells expressed relatively high amounts of ICAM-1 (
[0101] Further, during the conjugation assays, the OTI TCR+CD8.sup.+ T cells overexpressing TG2 (OTI TG2-CD8.sup.+ T cells) showed significant increases in the numbers of the conjugates when incubated with OVA257-264 peptide-loaded cells (OVA257-264), but not with the OVA-loaded B16F10 (OVA-B16F10) (
Example 3: Cytokine Release and Cytotoxicity
[0102] Whether the strong conjugation of OTI TG2-CD8.sup.+ T cells with E0771 cells was correlated with increased cytokine release cytotoxicity was measured.
[0103] Specifically, mGranzyme B (mGZMB) was observed to be significantly elevated in the population of OTI TG2-CD8.sup.+ T cells interacting with OVA-E0771 cells (
[0104] This suggests that overexpression of TG2 influenced the ability of OTI CD8.sup.+ T cells to effectively kill tumor cells, presumably by upregulating actin-dependent signaling pathways and promoting costimulatory LFA-1 activation.
Example 4: Potentiation of Anti-Tumor Activity
[0105] As it was revealed in vitro in Example 3 that the OTI TG2-CD8.sup.+ T cells showed increased conjugation with target cancer cells together with enhanced cytokine release and higher cytotoxicity, the effectiveness of OTI TG2-CD8.sup.+ T cells was to be examined in vivo.
[0106] To this end, OVA-E0771 cells were implanted into the mammary fat pads of C57BL/6 female mice. 14 days later, the mice were injected intravenously with OTI EV-CD8.sup.+ T and/or OTI TG2-CD8.sup.+ T cells (
[0107] Immunohistochemistry was used to determine the expression levels of several proteins and the number of apoptotic cells in the tumor sites, and found that cells positive for mKi67, a cancer cell proliferation marker, were decreased, whereas cells positive for interferon gamma (mIFN?), mGZMB, and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining were significantly increased in the tumor sites injected with the OTI TG2-CD8.sup.+ T cells compared with OTI EV-CD8.sup.+ T cells (
[0108] To evaluate the effects of OTI TG2-CD8.sup.+ T cells on tumor growth in vivo, OVA-E0771 cells were implanted into the mammary fat pads of C57BL/6 mice. Seven days later, the mice were randomized into three groups for administration of OTI CD8.sup.+ T cells. OTI EV-CD8.sup.+ T or OTI TG2-CD8.sup.+ T cells were injected intravenously three times at 3-day intervals (
[0109] As a result, the average tumor weight from mice injected with OTI EV-CD8.sup.+ T cells was lower than that of tumors without cell injection, suggesting that adoptive cytotoxic T cell transfer efficiently reduced tumor growth in vivo.
[0110] Further, intravenous administration of OTI TG2-CD8.sup.+ T cells significantly reduced tumor size compared with that of tumors without adoptive cell transfer or tumors transferred with OTI EV-CD8.sup.+ T cells (
Example 5: T Cell Adhesion and Cytokine Release of Recombinant TAGLN2
[0111] Whether the recombinant TAGLN2 fused with PTD (TG2P) was efficiently internalized into T cells and enhances T-cell adhesion and cytokine release was measured.
[0112] Small protein domains, commonly referred to as PTDs, are used to deliver certain therapeutic macromolecules into eukaryotic cells. To overcome the disadvantages of virus-mediated gene delivery systems, such as inconsistent transduction efficiency, long-term preparation, high cost, and safety issues, a TAGLN recombinant protein fused with PTD (TG2P), which was easier and faster to transduce into mouse primary T cells, was prepared (
[0113] Next, whether treatment with TG2P showed the same efficacy as viral transduction of TAGLN2 in terms of CD3.sup.+ T cell adhesion to antigen-loaded B cells was to be determined.
[0114] It was found that CD3.sup.+ T cells treated with TG2P (TG2P-CD3.sup.+ T cells) significantly increased the number of conjugates when cells were incubated with SEB-loaded B cells TG2P. The number of conjugates was correlated with the concentration of TG2P used to treat T cells (
[0115] Based on the results above, TG2P was applied to the OTI CD8.sup.+ T cells to establish OTI TG2P-CD8.sup.+ T cells. Treatment with TG2P significantly increased the number of OTI CD8.sup.+ T-OVA-E0771 conjugates (
[0116] OTI TG2P-CD8.sup.+ T cells also produced more cytokines, such as mIL2, mIFN?, and mGZMB (
Example 6: Anti-Tumor Activity of Recombinant TAGLN2 (TG2P)
[0117] As shown in
[0118] Cryosection of removed cancer tissues shows that both CD8.sup.+ T cells were similarly targeted into the E0771 cells. Further, the expression levels of several proteins and the number of apoptotic cells were measured in the tumor sites, and as a result, it was found that all results were similar to those obtained from OTI TCR TG2-CD8.sup.+ T cells (
[0119] The effects of OTI TG2P-CD8.sup.+ T cells on tumor growth in vivo was further to be evaluated.
[0120] It was found that OTI TG2P-CD8.sup.+ T cells significantly reduced the average tumor weight compared with that of tumors without adoptive cell transfer or treated with OTI CD8.sup.+ T cells without TG2P, suggesting that recombinant TG2P had effects similar to those of retrovirus-based gene delivery (
[0121] Kaplan-Meier survival studies showed that untreated mice and mice treated with non-transduced OTI T cells had a median survival of 21 and 23 days, respectively. In contrast, mice adoptively transferred with OTI TG2P-CD8.sup.+ T cells had a 70% or higher probability of surviving more than 28 days (
[0122] Such results suggest that due to the high adhesion activity of the present disclosure to tumor cells, the recombinant TG2P effectively decreases tumor cell growth and increases survivability.
[0123] From the foregoing, a skilled person in the art to which the present disclosure pertains will be able to understand that the present disclosure may be embodied in other specific forms without modifying the technical concepts or essential characteristics of the present disclosure. In this regard, the exemplary embodiments disclosed herein are only for illustrative purposes and should not be construed as limiting the scope of the present disclosure. On the contrary, the present disclosure is intended to cover not only the exemplary embodiments but also various alternatives, modifications, equivalents, and other embodiments that may be included within the spirit and scope of the present disclosure as defined by the appended claims.