MATERIALS AND METHODS FOR RAPID AND SENSITIVE DETECTION OF SMALL-MOLECULE TARGETS
20190309296 ยท 2019-10-10
Assignee
Inventors
Cpc classification
C12N2310/51
CHEMISTRY; METALLURGY
C12N15/115
CHEMISTRY; METALLURGY
G01N33/92
PHYSICS
International classification
C12N15/115
CHEMISTRY; METALLURGY
G01N33/94
PHYSICS
Abstract
The subject invention provides methods, assays and products for detecting small-molecules in a sample, in particular, in both clinical and field settings. The method for detecting a small-molecule target in a sample comprises providing a sample, contacting the sample with an aptamer-based sensor selective for the small-molecule target, and sensitively and rapidly detecting the small-molecule target in the sample. Specifically, the method utilizes EATR-amplified small-molecule sensors based on cooperative binding split aptamers (CBSAs).
Claims
1. A cooperative binding split aptamer (CBSA)-based enzyme-assisted target recycling (EATR)-amplified sensor comprising a short fragment and a long fragment, the short fragment and the long fragment associating upon binding of dehydroisoandrosterone-3-sulfate (DIS)to form a CBSA-DIS complex, and the CBSA-based EATR-amplified sensor being derived from two molecules of SEQ ID NO: 1 and comprising two target binding domains for DIS.
2. The CBSA-based EATR-amplified sensor according to claim 1, the CBSA being modified by addition of a reporter label.
3. The CBSA-based EATR-amplified sensor according to claim 2, the reporter label being a fluorescent dye, a gold nanoparticle (AuNP), or a fluorescent dye and quencher pair.
4. The CBSA-based EATR-amplified sensor according to claim 1, the short fragment or the long fragment comprising a C3 spacer abasic site.
5. The CBSA-based EATR-amplified sensor according to claim 4, the C3 spacer abasic site being recognized and cleaved by exonuclease III (Exo III).
6. The CBSA-based EATR-amplified sensor according to claim 1, the CBSA comprising a long fragment of SEQ ID NO: 2, and a short fragment of SEQ ID NO: 3, or SEQ ID NO: 8.
7. A method for detecting a small-molecule target in a sample comprising contacting the sample with a CBSA-based, EATR-amplified sensor, and detecting the small-molecule in the sample, the detection of the small-molecule target comprising measuring a signal generated upon binding of the small-molecule target to the CBSA-based, EATR-amplified sensor, the signal being a change in absorbance or fluorescence intensity, and the small-molecule target being dehydroisoandrosterone-3-sulfate (DIS).
8-9. (canceled)
10. The method according to claim 7, the sample being selected from blood, plasma, urine, tears, and saliva.
11. (canceled)
12. A method for detecting DIS in a sample comprising contacting the sample with a CBSA-based, EATR-amplified sensor of claim 1, the CBSA-based, EATR-amplified sensor selectively binding to DIS to form a CBSA-DIS complex, and detecting DIS in the sample by measuring a signal generated upon assembly and digestion of the CBSA-DIS complex.
13. The method according to claim 12, the short fragment of the CBSA being modified to conjugate a fluorophore at one end and a quencher at the other end.
14. The method according to claim 12, the CBSA being recognized and cleaved by Exo III at a C3 spacer abasic site.
15. The method according to claim 12, the CBSA being DIS-CBSA-4536.
16. A method for detecting cocaine in a sample comprising contacting the sample with a CBSA-based, EATR-amplified sensor selective for cocaine, the CBSA-based, EATR-amplified sensor comprising a C3 spacer abasic site, the CBSA-based, EATR-amplified sensor and cocaine forming a CBSA-cocaine complex, and detecting cocaine in the sample by measuring a signal generated upon assembly and digestion of the CBSA-cocaine complex.
17. The method according to claim 16, wherein the CBSA can be recognized and cleaved by Exo III at the C3 spacer abasic site, and wherein the CBSA can be recognized and bound by a fluorescent dye at the C3 spacer abasic site.
18. The method according to claim 16, wherein the CBSA is a CBSA comprising a long fragment selected from SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 22, and SEQ ID No:24; and a short fragment selected from SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 23, SEQ ID NO: 25, and SEQ ID No:26.
19. (canceled)
20. The method according to claim 16, wherein the CBSA-based, EATR-amplified sensor is a CBSA comprising a short fragment and a long fragment, wherein the short fragment is conjugated to the surface of an AuNP.
21. The CBSA-based EATR-amplified sensor according to claim 1, the enzyme assisting target recycling being an exonuclease.
22. The CBSA-based EATR-amplified sensor according to claim 1, the CBSA being DIS-CBSA-4536.
23. The method according to claim 12, the sample being selected from blood, plasma, urine, tears, and saliva.
24. The method according to claim 12, the signal being a change in absorbance or fluorescence intensity.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
BRIEF DESCRIPTION OF SEQUENCES
[0062] SEQ ID NO: 1 is the sequence of a DIS-binding aptamer DISS.1-AT contemplated for use according to the subject invention.
[0063] SEQ ID NO: 2 is the sequence of a long fragment of DIS-binding CBSA modified with a 3 poly (A).sub.5 extension contemplated for use according to the subject invention.
[0064] SEQ ID NO: 3 is the sequence of a short fragment of DIS-binding CBSA, which is modified with a fluorophore-quencher pair, an abasic site, and a 3 poly (A).sub.5 extension contemplated for use according to the subject invention.
[0065] SEQ ID NO: 4 is the sequence of a long fragment of DIS-binding split aptamer modified with a 3 poly (A).sub.5 extension contemplated for use according to the subject invention.
[0066] SEQ ID NO: 5 is the sequence of a short fragment of DIS-binding split aptamer modified with a fluorophore-quencher pair and a 3 poly (A).sub.5 extension contemplated for use according to the subject invention.
[0067] SEQ ID NO: 6 is the sequence of a long fragment of DIS-binding split aptamer modified with a 3 poly (A).sub.5 extension contemplated for use according to the subject invention.
[0068] SEQ ID NO: 7 is the sequence of a short fragment of DIS-binding split aptamer, which is modified with a fluorophore-quencher pair, an abasic site, and a 3 poly (A).sub.5 extension contemplated for use according to the subject invention.
[0069] SEQ ID NO: 8 is the sequence of a short fragment of DIS-binding CBSA modified with an abasic site and a 3 poly (A).sub.5 extension contemplated for use according to the subject invention.
[0070] SEQ ID NO: 9 is the sequence of a long fragment of cocaine-binding CBSA contemplated for use according to the subject invention.
[0071] SEQ ID NO: 10 is the sequence of a short fragment of cocaine-binding CBSA modified with an abasic site contemplated for use according to the subject invention.
[0072] SEQ ID NO: 11 is the sequence of a long fragment of cocaine-binding CBSA contemplated for use according to the subject invention.
[0073] SEQ ID NO: 12 is the sequence of a short fragment of cocaine-binding CBSA modified with an abasic site contemplated for use according to the subject invention.
[0074] SEQ ID NO: 13 is the sequence of a long fragment of cocaine-binding CBSA contemplated for use according to the subject invention.
[0075] SEQ ID NO: 14 is the sequence of a short fragment of cocaine-binding CBSA modified with an abasic site contemplated for use according to the subject invention.
[0076] SEQ ID NO: 15 is the sequence of a long fragment of cocaine-binding CBSA contemplated for use according to the subject invention.
[0077] SEQ ID NO: 16 is the sequence of a short fragment of cocaine-binding CBSA modified with an abasic site contemplated for use according to the subject invention.
[0078] SEQ ID NO: 17 is the sequence of a long fragment of cocaine-binding CBSA modified with a 3 poly (T).sub.5 extension contemplated for use according to the subject invention.
[0079] SEQ ID NO: 18 is the sequence of a long fragment of cocaine-binding CBSA modified with a single 3 inverted deoxythymidine contemplated for use according to the subject invention.
[0080] SEQ ID NO: 19 is the sequence of a short fragment of cocaine-binding CBSA, which is modified with an abasic site and a 3 poly (T).sub.5 extension, contemplated for use according to the subject invention.
[0081] SEQ ID NO: 20 is the sequence of a short fragment of cocaine-binding CBSA, which is modified with an abasic site and a single 3 inverted deoxythymidine, contemplated for use according to the subject invention.
[0082] SEQ ID NO: 21 is the sequence of a short fragment of cocaine-binding CBSA, which is modified with a fluorophore-quencher pair, an abasic site, and a single 3 inverted deoxythymidine, contemplated for use according to the subject invention.
[0083] SEQ ID NO: 22 is the sequence of a long fragment of cocaine-binding CBSA modified with a 3 poly (T).sub.18 extension contemplated for use according to the subject invention.
[0084] SEQ ID NO: 23 is the sequence of a thiolated short fragment of cocaine-binding CBSA modified with an abasic site and a 5 poly (T).sub.5 extension contemplated for use according to the subject invention.
[0085] SEQ ID NO: 24 is the sequence of a long fragment of cocaine-binding CBSA modified with a 3 poly (A).sub.5 extension contemplated for use according to the subject invention.
[0086] SEQ ID NO: 25 is the sequence of a short fragment of cocaine-binding CBSA, which is modified with an abasic site and a 5 poly (A).sub.5 extension, contemplated for use according to the subject invention.
[0087] SEQ ID NO: 26 is the sequence of a short fragment of cocaine-binding CBSA, which is modified with an abasic site and a 3 poly (A).sub.5 extension, contemplated for use according to the subject invention.
[0088] SEQ ID NO: 27 is sequence of a short fragment of cocaine-binding CBSA in which the abasic site is replaced with deoxythymidine contemplated for use according to the subject invention.
[0089] SEQ ID NO: 28 is the sequence of two tandem abasic-site-incorporated, thiolated short fragment repeats with an internal (T).sub.6 linker and a 5 poly (T).sub.5 extension contemplated for use according to the subject invention.
DETAILED DESCRIPTION
[0090] The subject invention provides methods, assays, and products for detecting small molecules in a sample, in particular, in both clinical and field settings. In one embodiment, the method for detecting a small-molecule target in a sample comprises providing a sample, contacting the sample with an aptamer-based sensor selective for the small-molecule target, and detecting the small-molecule target in the sample.
[0091] In one embodiment, the detection of the small-molecule target comprises measuring a signal generated upon assembly of the aptamer-target complex. In another embodiment, the method further comprises determining the concentration of the small-molecule target in the sample.
[0092] The term small molecule, or small-molecule target, as used herein, includes any molecule capable of being detected using an aptamer technique. In one embodiment, the small-molecule target may be an amino acid, an amino acid-related molecule, a peptide, a steroid, a lipid, a sugar, a carbohydrate, a biomarker, a drug molecule, a drug metabolite, a coenzyme, a nucleotide, a nucleotide-related molecule, a pyridine nucleotide, a cyclic nucleotide, or a cyclic dinucleotide. In other embodiments, the small-molecule target may be an infective agent, antigen, toxin, disease biomarker, or a specific metal ion.
[0093] In one embodiment, the small molecule is a steroid hormone. In a specific embodiment, the steroid hormone is dehydroisoandrosterone-3-sulfate (DIS).
[0094] In another embodiment, the small molecule is a drug molecule. In a specific embodiment, the drug molecule is cocaine or cocaine derivative. Cocaine derivative may or may not have the core structure of cocaine. Exemplary cocaine derivatives include, but are not limited to, 4-fluorococaine, 2-hydroxycocaine, 3-(p-fluorobenzoyloxy)tropane (pFBT), procaine, and dimethocaine.
[0095] The subject invention provides aptamer-based sensors for detecting small-molecule targets. Aptamers are nucleic acid molecules characterized by the ability to bind to a target molecule with high specificity and high affinity. Almost every aptamer identified to date is a non-naturally occurring molecule. Aptamers to a given target may be identified and/or produced by the method of SELEX.
[0096] In one embodiment, the aptamer may be an oligonucleotide, such as a DNA or RNA molecule and may be single stranded or double stranded. Preferably, the aptamer is single stranded. They may form various secondary structures (e.g., stems, loops, bulges, pseudoknots, G-quadruplexes and kissing hairpins), which in turn can form unique three-dimensional architectures able to specifically recognize their targets by exploiting a variety of interactionssuch as hydrophobic and electrostatic interactions, hydrogen bonding, van der Waals forces, and - stacking as well as shape complementarity.
[0097] As used herein, the terms polynucleotide, nucleotide, oligonucleotide, and nucleic acid can be used interchangeably to refer to a nucleic acid comprising DNA, RNA, derivatives thereof, or combinations thereof.
[0098] In another embodiment, the aptamer is a split aptamer, e.g., an aptamer is split into two, three or more pieces, which re-associate in the presence of a target ligand. The use of a split aptamer offers distinct advantages for sensor development over other aptamers, e.g., structure-switching aptamers, as the only requirement is that the split aptamer binds its target. In a preferred embodiment, the aptamer is a DNA split aptamer.
[0099] In one embodiment, each piece of the split aptamer according to the present invention may have a minimum length of, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides. Each piece of the split aptamer according to the present invention may have a maximum length of, for example, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides. Each piece of the split aptamer according to the present invention may have a length of, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides.
[0100] In one embodiment, the split aptamer comprises at least one stem, two stems, or three stems. Preferably, the aptamer comprises three stems. Each stem may be fully or partially complementary. Each stem may comprise the same or a different number of nucleotides. Exemplary lengths of each stem may be, for example, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides.
[0101] In one embodiment, the split aptamer comprises at least one junction, which is formed when two or more stems meet. In certain embodiments, the junction may be a loop between two stems, or a three-way junction (TWJ). The junction may comprise, for example, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. The junction in an aptamer can serve as a binding domain for a small-molecule target. In specific embodiments, the split aptamer comprises one TWJ-binding domain. In some embodiments, the split aptamer may be a monomer, dimer, trimer, or tetramer. Such aptamer can comprise one, two, three, or four TWJ-binding domains.
[0102] In one embodiment, the aptamer-based sensor is a cooperative binding split aptamer (CBSA). CBSAs can be engineered from parent split aptamers comprising a single target-binding domain and consist of a short fragment and a long fragment that contain two target-binding domains. Advantageously, CBSAs with two target-binding domains exhibit enhanced target response compared with single-domain split aptamers. The first binding event partially stabilizes the CBSA and facilitates the second binding event. This cooperative assembly can reduce the target concentration required to assemble the CBSA several-fold, resulting in far greater specificity and sensitivity relative to the parent split aptamer.
[0103] In one embodiment, each fragment of CBSA according to the present invention may have a minimum length of, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleotides. Each fragment of CBSA according to the present invention may have a maximum length of, for example, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides. Each fragment of CBSA according to the present invention may have a length of, for example, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 nucleotides.
[0104] The CBSAs according to the present invention may comprise at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, or at least 80 nucleotides. The CBSAs according to the present invention may comprise at most about 200 nucleotides, at most about 150 nucleotides, at most about 120 nucleotides, at most about 100 nucleotides, at most about 90 nucleotides, at most about 80 nucleotides, at most about 70 nucleotides, at most about 60 nucleotides, or at most about 50 nucleotides. The aptamer according to the present invention comprises, for example, in the range of 10 to 200 nucleotides, preferably 15 to 150 nucleotides, more preferably 20 to 100 nucleotides.
[0105] In one embodiment, the subject invention provides a method for generating a CBSA selective for a small-molecule target, comprising producing a parent split aptamer selective for the small-molecule target, and generating the CBSA by merging two of the parent split aptamers, wherein the parent split aptamer comprises a first piece of the split aptamer and a second piece of the split aptamer, and wherein the parent split aptamer comprises a single binding domain for the small-molecule target.
[0106] In one embodiment, the parent split aptamer may be generated by the steps of 1) providing a first piece of a split aptamer and a second piece of the split aptamer, wherein the first piece and the second piece of the split aptamer form a single-domain split aptamer in the presence of a small-molecule target, wherein the single-domain split aptamer comprises a first stem, a second stem and a third stem, 2) removing a number of base pairs in at least one of the stems selected from the first stem, the second stem and the third stem, and 3) removing a loop region of the single-domain split aptamer.
[0107] In a further embodiment, the parent split aptamer may be generated by the steps of 1) providing a first piece of a split aptamer and a second piece of the split aptamer, wherein the first piece and the second piece of the split aptamer form a single-domain split aptamer in the presence of a small-molecule target, wherein the single-domain split aptamer comprises a first stem, a second stem and a third stem, 2) removing a number of base pairs in the first stem, and 3) removing a loop region of the single-domain split aptamer, wherein the loop region is a poly(T)n loop region (n>2).
[0108] In some embodiments, the aptamers/split aptamers/CBSAs may each independently have free ends. For example, the 3 and 5 ends may not be ligated to form a loop, although they may be conjugated to other molecules or otherwise modified. The aptamers/split aptamers/CBSAs according to the subject invention may each independently adopt a tertiary structure such as a hairpin loop. In some embodiments, the aptamers/split aptamers/CBSAs according to the subject invention may each independently be looped. For example, the 5 and 3 ends of the nucleic acid are covalently bonded, e.g. by ligation, to form a loop not having any free ends.
[0109] The aptamers/split aptamers/CBSAs of the present invention may or may not include chemical modifications as described herein such as a chemical substitution at a sugar position, a phosphate position, and/or a base position of the nucleic acid including, for example, incorporation of a modified nucleotide, incorporation of a capping moiety (e.g., 3 capping), conjugation to a high molecular weight, non-immunogenic compound (e.g., polyethylene glycol (PEG)), conjugation to a lipophilic compound, and substitutions in the phosphate backbone. Base modifications may include 5-position pyrimidine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo- or 5-iodo-uracil, and backbone modifications. Sugar modifications may include 2-amine nucleotides (2-NH2). 2-fluoronucleotides (2-F), and 2-O-methyl (2-OMe) nucleotides. Such modifications may improve the stability of the aptamers/split aptamers/CBSAs or make the aptamers/split aptamers/CBSAs more resistant to degradation. In some embodiments, each base of a given type (e.g., A, T, C, and G) may contain the same chemical modification.
[0110] The aptamers/split aptamers/CBSAs may be modified by addition of one or more reporter labels (or detectable labels). In some embodiments, the label may be attached to either the 5 or 3 end of the aptamer/split aptamer/CBSA. The label may also be attached with the backbone of the aptamer/split aptamer/CBSA. The skilled person will be aware of techniques for attaching labels to nucleic acid strands. The detectable label may be attached directly or indirectly to the nucleic acid aptamer. If the label is indirectly attached to the nucleic acid aptamer, it may be by any mechanism known to one of skill in the art, such as using biotin and streptavidin.
[0111] In one embodiment, the aptamers/split aptamers/CBSAs may comprise a reporter label, such as a fluorescent dye, nanoparticle, or an enzyme. Exemplary labels include, but not limited to, an organic donor fluorophore or an organic acceptor fluorophore, a luminescent lanthanide, a fluorescent or luminescent nanoparticle, an affinity tag such as biotin, or a polypeptide. In some embodiments, the aptamer may comprise a fluorescent label, for example, 2-amino-5,6,7-trimethyl-1,8-naphthyridine (ATMND), fluorescein, TAMRA, rhodamine, Texas Red, Alexa Fluor (e.g., AlexaFluor 488, AlexaFluor 532, AlexaFluor 546, AlexaFluor 594, AlexaFluor 633 and AlexaFluor 647), cyanine dye (e.g., Cy5, Cy5.5 and Cy3), Tye dye (e.g., TYE 563, TYE 665, TYE 705), atto dye (e.g., Atto 594 and Atto 633), Hexachlorofluorescein, FAM (6-carboxyfluroescein), BODIPY FL, OliGreen, 40, 6-diamidino-2-phenylindol (DAPI), Hoechst 33,258, malachite green (MG), and FITC. The nanoparticle can be an upconversion nanoparticle. In some embodiments, the fluorophore is selected from the group consisting of fluorophores that emit a blue, green, near red, or far red fluorescence.
[0112] In one embodiment, the reporter label is a fluorescent dye and quencher pair. In certain embodiments, a fluorophore is conjugated at one end of the short fragment of CBSAs and a quencher at the other end of the short fragment of CBSAs. In the absence of its target, the short fragment of the CBSA is folded into a hairpin conformation, thereby positioning the fluorophore close to the quencher. Upon target binding, base-pairing in the hairpin is interrupted and the CBSA converts to its open conformation, in which the fluorophore and the quencher do not interact. The resulting recovery of the fluorescence signal directly reflects the extent of the binding and can be used for detection and quantitative measurement of the target concentration.
[0113] The quenchers can be, for example, Dabcyl, DDQ-I, Eclipse, Iowa Black FQ, BHQ-1, QSY-7, BHQ-2, DDQ-II, Iowa Black RQ, QSY-21, or BHQ-3.
[0114] In some embodiments, the fluorophore is at a location of, for example, 1.sup.st, 2.sup.nd, 3.sup.th, 4.sup.th, 5.sup.th, 6.sup.th, 7.sup.th, 8.sup.th, 9.sup.th, 10.sup.th, 11.sup.th, 12.sup.th, 13.sup.th, 14.sup.th, 15.sup.th, 16.sup.th, 17.sup.th, 18.sup.th, 19.sup.th or 20.sup.th nucleotide from either 5 end or 3 end of the short fragment of the CBSAs. The quencher is at a location of, for example, 1.sup.st, 2.sup.nd, 3.sup.th, 4.sup.th, 5.sup.th, 6.sup.th, 7.sup.th, 8.sup.th, 9.sup.th, 10.sup.th, 11.sup.th, 12.sup.th, 13.sup.th, 14.sup.th, 15.sup.th, 16.sup.th, 17.sup.th, 18.sup.th, 19.sup.th, or 20.sup.th nucleotide from either 3 end or 5 end of the short fragment of the CBSAs.
[0115] It is contemplated that the location of the fluorophore and quencher-conjugated short fragment is such that the proximity of fluorophore and quencher in a hairpin conformation provide maximal quenching and the fluorophore and quencher in an open conformation provide maximal fluorescence of the fluorophore. For optimized detection of fluorescence changes that allows utilization of the CBSAs for target detection, it is desirable that the fluorescence in the quenched conformation is as low as possible and the fluorescence in the unquenched conformation is as high as possible combined with the most rapid interconversion from one conformation to the other.
[0116] In one embodiment, the CBSA-target complex may produce a time resolved fluorescence energy transfer (TR-FRET) signal or a signal that can be measured by fluorescence polarization (FP), and/or luminescence.
[0117] In one embodiment, the subject invention provides methods for detecting a small-molecule target in a sample using CBSAs, comprising contacting the sample with a CBSA selective for the small-molecule target to form a CBSA-target complex, and detecting the small-molecule target in the sample by measuring a signal generated upon assembly of the CBSA-target complex.
[0118] In some embodiments, the signal generated upon assembly of the CBSA-target complex has optical properties selected from the group consisting of: light reflectivity, color, the fluorescence emission wavelength(s) and the fluorescence emission intensity.
[0119] In specific embodiments, the 3 end of the short fragment or the long fragment of the CBSAs is conjugated with a fluorophore, such as Cy5, and the 5 end of the short fragment or the long fragment of the CBSAs is conjugated with a quencher, such as Iowa Black RQ. The fluorescence emission change is indicative of the binding of CBSAs with the small molecules and the detection of such small molecules in the sample.
[0120] In one embodiment, the CBSA may comprise a cleavage site of a chemical or enzymatic reaction within the short fragment or the long fragment. In a further embodiment, the cleavage site is an abasic site which can be a natural or synthetic abasic site. The abasic site may be positioned in a phosphodiester backbone shortened by 1-carbon atom or duplexes where phosphorothioate replaces the phosphate group 5 to the abasic site. In some embodiments, the cleavage site is a duplexed nucleotide containing modifications including, but not limited to, a 2dexoyribose, 2-deoxyribosylformamide, tetrahydrofuranyl, ethanyl, or propanyl (C3 spacer) group.
[0121] In one embodiments, the cleavage site can be cleaved by, for example, nucleases (e.g., exonucleases, and endonucleases), and DNAzymes. The nucleases include, but not limited to, endonuclease IV, apurinic/apyrimidinic endonuclease, or exonuclease III (Exo III).
[0122] In a specific embodiment, the cleavage site is a C3 spacer abasic site, which can be recognized and cleaved by Exo III. The duplexed C3 spacer abasic site is introduced between the two binding domains in the short fragment or the long fragment.
[0123] Advantageously, the cleavage of the short fragment containing a duplexed C3 spacer abasic site of the CBSA results in disassembly of the CBSA-target complex, releasing the long fragment, the small-molecule target, and the fluorophore that now fluoresces due to its separation from the quencher. The released long fragment and small-molecule target are then free to assemble with another short fragment of the CBSA, enabling EATR signal amplification. On the other hand, the cleavage of the long fragment containing a duplexed C3 spacer abasic site of the CBSA results in disassembly of the CBSA-target complex, releasing the short fragment, the small-molecule target, and the fluorophore that now fluoresces due to its separation from the quencher. The released short fragment and small-molecule target are free to assemble with another long fragment of the CBSA, enabling EATR signal amplification. As a result, a very small amount of target molecules can be recycled for multiple rounds of assembly and cleavage, thereby generating a substantially amplified fluorescence signal.
[0124] In one embodiment, the subject invention provides an approach for the development of rapid and sensitive EATR-amplified small-molecule sensors based on CBSAs. The CBSA-based EATR-amplified sensor for detecting a small-molecule target in a sample comprises a short fragment of a CBSA and a long fragment of the CBSA, wherein the short fragment of the CBSA comprises an enzyme cleavage site, wherein the short fragment of the CBSA and the long fragment of the CBSA are assembled in the presence of the small-molecule target to form a CBSA-target complex. In some embodiments, the CBSAs may comprise a fluorescent dye, or nanoparticle (e.g., AuNP) at the end of either the short fragment or the long fragment, preferably, at the end of the short fragment of CBSAs. In a further embodiment, the sensor also comprises an enzyme that recognizes and cleaves abasic sites including, but not limited to, 2dexoyribose, 2-deoxyribosylfoanamide, tetrahydrofuranyl, propanyl, and ethanyl sites. In a preferred embodiment, the cleavage site is a duplexed C3 spacer abasic site, and the enzyme that recognizes and cleaves the abasic site is Exo III.
[0125] In one embodiment, the CBSA according to the subject invention comprises a long fragment selected from SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 22, and SEQ ID No:24; or a sequence sharing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identity with SEQ ID No: 2, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 22, or SEQ ID No:24.
[0126] In one embodiment, the CBSA according to the subject invention comprises a short fragment selected from SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID No:26, SEQ ID NO: 27 and SEQ ID NO: 28; or a sequence sharing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identity with SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID No:26, SEQ ID NO: 27 or SEQ ID NO: 28.
[0127] In one embodiment, the subject invention provides a method for detecting a small-molecule target in a sample employing CBSAs as EATR-amplified sensors. Advantageously, the methods utilizing CBSA-based, EATR-amplified assays are rapid, sensitive, and specific for the detection of various small-molecule targets.
[0128] In one embodiment, the subject invention provides methods for detecting small-molecule targets using EATR-amplified sensors, comprising contacting the sample with an EATR-amplified sensor selective for the small-molecule target, and detecting the small-molecule target in the sample. In a further embodiment, the detection of the small-molecule target comprises measuring a signal generated upon assembly and cleavage of CBSA-target complex in the EATR-amplified sensor.
[0129] In one embodiment, the EATR-amplified sensor is a CBSA comprising an enzyme cleavage site in the short fragment, a fluorophore conjugated at the 3 end of the short fragment, and a quencher conjugated at the 5 end of the short fragment. In another embodiment, the EATR-amplified sensor is a CBSA comprising an enzyme cleavage site in the long fragment, a fluorophore conjugated at the 3 end of the long fragment, and a quencher conjugated at the 5 end of the long fragment.
[0130] In one embodiment, the EATR-amplified sensor is a CBSA comprising an enzyme cleavage site in the short fragment, a fluorophore conjugated at the 5 end of the short fragment, and a quencher conjugated at the 3 end of the short fragment. In another embodiment, the EATR-amplified sensor is a CBSA comprising an enzyme cleavage site in the long fragment, a fluorophore conjugated at the 5 end of the long fragment, and a quencher conjugated at the 3 end of the long fragment.
[0131] In a preferred embodiment, the fluorophore is Cy5 and the quencher is Iowa Black RQ. In a preferred embodiment, the cleavage site is a duplexed C3 spacer abasic site, and the enzyme that recognizes and cleaves the abasic site is Exo III.
[0132] In one embodiment, the method further comprises determining the concentration of the small-molecule target in the sample. The determination can comprise comparing the fluorescent signal generated upon binding of target and cleavage of the CBSA-target complex in the EATR-amplified sensor with a standard calibration curve of the fluorescence signal of the fluorophore in the presence of various concentrations of the small-molecule target.
[0133] In one embodiment, the subject invention provides an instrument-free colorimetric assay employing EATR-mediated aggregation of CBSA-modified gold nanoparticles (AuNPs) for the rapid detection of small molecules at very low concentration. This sensor utilizes CBSA-conjugated AuNPs and EATR amplification for visual detection of the small molecules. The sensor comprises a short fragment of a CBSA and a long fragment of the CBSA, wherein the short fragment of the CBSA comprises an enzyme cleavage site within the backbone of the short fragment, wherein an end of the short fragment of the CBSA is conjugated to an AuNP, and wherein the short fragment of the CBSA and the long fragment of the CBSA are associated in the presence of the small-molecule target to form a CBSA-target complex.
[0134] In the presence of target, the fragments assemble to form CBSA-target complexes on the nanoparticle surface. The enzyme specifically recognizes the cleavage site between the two binding domains and cleaves the AuNP-conjugated short fragment, releasing the intact long fragment and target molecule for another round of target assembly and enzyme cleavage. Once all of the short fragments have been cleaved from the particle surface, the AuNPs aggregate and produce a visible red-to-blue color change. In contrast, in the absence of target, the intact short fragments of CBSA prevent AuNP aggregation such that the color remains red.
[0135] In one embodiment, the nanoparticle, such as AuNP, used in the method according to the subject invention has a size from about 1 nm to about 100 nm, about 1 nm to about 90 nm, about 1 nm to about 80 nm, about 1 nm to about 70 nm, about 1 nm to about 60 nm, about 1 nm to about 50 nm, about 1 nm to about 40 nm, about 1 nm to about 30 nm, about 1 nm to about 20 nm, about 1 nm to about 10 nm, about 1 nm to about 9 nm, about 1 nm to about 8 nm, about 1 nm to about 7 nm, about 1 nm to about 6 nm, or about 1 nm to about 5 nm. In specific embodiments, the AuNP used in the method according to the subject invention has a size of 1 nm, 2 nm, 3 nm, 4 nm, 5 nm, 6 nm, 7 nm, 8 nm, 9 nm, 10 nm, 11 nm, 12 nm, 13 nm, 14 nm, 15 nm, 16 nm, 17 nm, 18 nm, 19 nm, 20 nm, 21 nm, 22 nm, 23 nm, 24 nm, 25 nm, 26 nm, 27 nm, 28 nm, 29 nm, 30 nm, 31 nm, 32 nm, 33 nm, 34 nm, 35 nm, 36 nm, 37 nm, 38 nm, 39 nm, 40 nm, 41 nm, 42 nm, 43 nm, 44 nm, 45 nm, 46 nm, 47 nm, 48 nm, 49 nm, or 50 nm.
[0136] In some embodiments, the nanoparticle (e.g., AuNP) may have more than two short fragments of CBSAs conjugated to its surface. In other embodiments, the surface of a nanoparticle (e.g., AuNP) may be conjugated with CBSA, preferably, the short fragments of the CBSAs, at a range of 2 to 500 strands/particle, 5 to 400 strands/particle, 10 to 300 strands/particle, or 15 to 200 strands/particle. In certain embodiments, the surface of a nanoparticle (e.g., AuNP) may be conjugated with CBSA, preferably, the short fragments of the CBSAs, at a number of, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, or 150 strands/particle.
[0137] In one embodiment, the short fragments of CBSAs may be arranged in repeat through a linker. The repeat of short fragments of CBSAs may be connected through the linker prior to, during, or after the reassociation with the long fragments of CBSAs. In one embodiment, the repeat of short fragment may comprise at least two, at least three, at least four, at least five, or at least six repeats. In another embodiment, the repeat of short fragment may comprise two, three, four, five, or six short fragments. These repeats may be connected in series through linkers. In one embodiment, the linker is a (T).sub.n linker, n>2. In a preferred embodiment, the linker is a (T).sub.6 linker. In another embodiment, these short fragments may each independently comprise the same or different modifications. In a further embodiment, the short fragment repeats comprise an abasic site incorporated in each short fragment. In a specific embodiment, the short fragment repeat has a sequence of SEQ ID No: 28 (i.e., SH-COC-5335-SF-2X) comprising of two tandem abasic-site-incorporated short fragment repeats with a (T).sub.6 linker, or a sequence sharing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identity with SEQ ID No: 28.
[0138] In one embodiment, the method according to the subject invention can achieve superior sensitivity for target detection at low micromolar or nanomolar concentration, for example, as low as 200 M, 100 M, 10 M, 1 M, 100 nM, 10 nM, or 1 nM. In a specific embodiment, the method according to the subject invention can achieve target sensitivity at a low concentration of 1 M.
[0139] Advantageously, the methods for small molecule detection provided herein are rapid and can be completed in about 5 minutes to about 120 minutes, about 6 minutes to about 110 minutes, about 7 minutes to about 100 minutes, about 8 minutes to about 90 minutes, about 9 minutes to about 80 minutes, about 10 minutes to about 70 minutes about 15 minutes to about 60 minutes, about 20 minutes to about 50 minutes, or about 25 minutes to about 40 minutes. In some embodiments, the method can be completed in about 5 minutes, about 10 minutes, about 15 minutes, about 20 minutes, about 25 minutes, about 30 minutes, about 35 minutes, about 40 minutes, about 45 minutes, about 50 minutes, about 55 minutes, about 60 minutes, about 65 minutes, about 70 minutes, about 75 minutes, about 80 minutes, about 85 minutes, about 90 minutes, about 95 minutes, about 100 minutes, about 105 minutes, about 110 minutes, about 115 minutes, or about 120 minutes.
[0140] In one embodiment, the CBSA-based EATR-amplified sensors may be used in a high throughput setting for detecting small molecules.
[0141] In one embodiment, the small molecule is a steroid hormone. In a specific embodiment, the steroid hormone is dehydroisoandrosterone-3-sulfate (DIS).
[0142] In another embodiment, the small molecule is a drug molecule. In a specific embodiment, the drug molecule is cocaine, a cocaine derivative or a cocaine analog. Cocaine derivatives may be synthesized compounds that mimic the structure of the cocaine, either with or without a tropane ring, for example, 4-fluorococaine, 2-hydroxycocaine, 3-(p-fluorobenzoyloxy)tropane (pFBT), and dimethocaine. Cocaine analog may include compounds that are antagonists of the effects of cocaine, or that are agonists of cocaine-binding receptors.
[0143] In one embodiment, the sample may be a biological sample such as blood, plasma, sweat, urine, tears, or saliva of a subject. The subject may be any animal or human, preferably, human. The subjects may also refer to any animal including, but not limited to, non-human primates, rodents, dogs, cats, horses, cattle, pigs, sheep, goats, chickens, guinea pigs, hamsters and the like.
[0144] In one embodiment, the subject invention provides a method for detecting DIS in a sample comprising contacting the sample with an aptamer selective for DIS, and detecting DIS in the sample.
[0145] In one embodiment, the subject invention provides a method for detecting DIS in a biological sample comprising contacting the sample with a CBSA selective for DIS, wherein the CBSA and DIS form a CBSA-DIS complex, and detecting DIS in the biological sample by measuring a signal generated upon assembly of the CBSA-DIS complex. In a specific embodiment, the signal generated upon assembly of the CBSA-DIS complex may be a change in the fluorescence intensity.
[0146] In one embodiment, the subject invention provides a method for detecting DIS in a biological sample using CBSA-based EATR-amplified fluorescence and colorimetric assays. The method comprises providing a biological sample, contacting the biological sample with an EATR-amplified sensor selective to DIS, and detecting DIS in the biological sample by measuring a signal generated upon assembly and cleavage of the CBSA-DIS complex in the EATR-amplified sensor.
[0147] In a further embodiment, the EATR-amplified sensors is a CBSA comprising an enzyme cleavage site in the short fragment, a fluorophore conjugated at the 3 end of the short fragment, and a quencher conjugated at the 5 end of the short fragment. In a preferred embodiment, the fluorophore is Cy5 and the quencher is Iowa Black RQ. In a preferred embodiment, the cleavage site is a duplexed C3 spacer abasic site, and the enzyme that recognizes and cleaves the abasic site is Exo III.
[0148] In specific embodiments, the long fragment of CBSA is DIS-4536-LF according to SEQ ID No: 2 or a sequence sharing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identity with SEQ ID No: 2. The short fragment of CBSA is FQ-DIS-4536-SF according to SEQ ID No: 3 or a sequence sharing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identity with SEQ ID No: 3.
[0149] In a preferred embodiment, the CBSA selective for DIS is DIS-CBSA-4536.
[0150] The method can further comprise introducing Exo III in the sample, resulting in recycling of the long fragment and DIS molecules for further rounds of detection, while releasing a fluorescent signal for each detection event.
[0151] In a preferable embodiment, the biological sample is a urine sample. Advantageously, this method can achieve 100-fold enhanced target sensitivity relative to a non-EATR-based method. The detection limit of the CBSA-based EATR-amplified fluorescence assay is 100 and 50 times lower than previously reported DIS assays based on a split aptamer and a structure-switching aptamer, respectively. This method also allows the detection of DIS in 50% urine within 30 minutes at concentrations as low as 1 M.
[0152] In one embodiment, the subject invention provides a method for detecting cocaine in a sample comprising contacting the sample with an aptamer selective for cocaine, and detecting cocaine in the sample.
[0153] In one embodiment, the subject invention provides a method for detecting cocaine in a biological sample comprising contacting the biological sample with a CBSA selective for cocaine, wherein the CBSA and cocaine form a CBSA-cocaine complex, and detecting cocaine in the biological sample by measuring a signal generated upon assembly of the CBSA-cocaine complex. In a specific embodiment, the signal generated upon assembly of the CBSA-cocaine complex may be the changes in the fluorescence intensity.
[0154] In one embodiment, the subject invention provides a method for detecting cocaine in a biological sample using CBSA-based EATR-amplified fluorescence and colorimetric assays. The method comprises providing a biological sample, contacting the biological sample with an EATR-amplified sensor selective for cocaine, and detecting cocaine in the biological sample by measuring a signal generated upon assembly and cleavage of the CBSA-cocaine complex in the EATR-amplified sensor.
[0155] In another embodiment, the EATR-amplified sensors selective for cocaine is a CBSA comprising a short fragment and a long fragment, wherein the short fragment comprises an enzyme cleavage site that can be recognized and bound by a fluorescent dye. In a preferred embodiment, the fluorescent dye is ATMND. In a specific embodiment, the cleavage site is a duplexed C3 spacer abasic site, and the enzyme that recognizes and cleaves the abasic site is Exo III.
[0156] In a preferred embodiment, the long fragment is COC-5325-LF according to SEQ ID: 9 or a sequence sharing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity with SEQ ID No: 9. The short fragment is COC-5325-SF according to SEQ ID No: 10 or a sequence sharing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identity with SEQ ID No: 10.
[0157] In another embodiment, the EATR-amplified sensors selective for cocaine is a CBSA comprising a short fragment and a long fragment, wherein the short fragment comprises an enzyme cleavage site within the backbone, wherein an end of the short fragment is conjugated to an AuNP, and wherein the short fragment and the long fragment are associated in the presence of cocaine to form a CBSA-target complex.
[0158] In a preferred embodiment, the long fragment is COC-5335-LF according to SEQ ID No:11 or a sequence sharing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% identity with SEQ ID No: 11. The short fragment is SH-COC-5335-SF-2X according to SEQ ID No: 28 or a sequence sharing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identity with SEQ ID No: 28.
[0159] In another embodiment, the short fragment is a derivative of COC-5335-SF. In some embodiments, the derivative can include a poly(A).sub.5 extension at the 5 end that allows digestion of both the abasic site and the 3 terminus, or at the 3 instead of 5 end, allowing cleavage only at the abasic site. In a specific embodiment, the derivative may comprise a thymine.
[0160] In specific embodiment, the derivative is COC-5335-SF-5A according to SEQ ID No: 25, COC-5335-SF-3A according to SEQ ID No: 26, COC-5335-SF-T according to SEQ ID No: 27 or a sequence sharing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identity with SEQ ID Nos: 25-27.
[0161] In a preferred embodiment, the short fragment conjugated to the surface of AuNP is SH-COC-5335-SF-1X according to SEQ ID No. 23 or a sequence sharing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identity with SEQ ID No: 23.
[0162] In specific embodiments, the CBSA selective for cocaine is COC-CBSA-5325, COC-CBSA-5335, COC-CBSA-5435, COC-CBSA-5445, or a sequence sharing at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99% identity with COC-CBSA-5325, COC-CBSA-5335, COC-CBSA-5435 or COC-CBSA-5445.
[0163] In one embodiment, this assay enables detection of cocaine at low micromolar concentration within 15 minutes in 10% saliva.
[0164] In one embodiment, the CBSA-based EATR-amplified colorimetric assay is target-specific. In other embodiment, the CBSA-based EATR-amplified colorimetric assay can be used to distinguish cocaine from other common cutting agents observed in street samples such as lidocaine, caffeine, levamisole, and benzocaine. As a result, the EATR colormetric assay can be used for the specific and sensitive naked-eye detection of cocaine in seized samples.
[0165] In one embodiment, the subject invention provides a method for detecting small molecules that are biomarkers for diagnosis of diseases and conditions, or monitoring therapeutic response to specific treatments. In specific embodiments, the condition can be, for example, cancer, an injury, an inflammatory disease or a neurodegenerative disease.
[0166] In one embodiment, the aptamer engineering methods, detection assays, and aptamer products according to the subject invention will accelerate the development of sensitive and accurate sensors for detecting small-molecule targets in fields including environmental monitoring, food safety, law enforcement, medical diagnostics, and public health.
[0167] The subject invention encompasses the use of sequences having a degree of sequence identity or sequence similarity with the nucleic acid sequence(s) of the present invention. A similar sequence is taken to include a nucleotide sequence which may be at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the subject sequence. Typically, the similar sequences will comprise the same or similar secondary structure as the subject nucleic acid aptamer. In one embodiment, a similar sequence is taken to include a nucleotide sequence which has one or several additions, deletions, substitutions and/or chemical modifications compared with the subject sequence.
EXAMPLES
Materials and Methods
[0168] All DNA strands used in this work were synthesized by Integrated DNA Technologies and purified with high performance liquid chromatography. DNA was dissolved in PCR grade water and DNA concentrations were measured with a NanoDrop 2000 (Thermo Scientific). The sequences of the oligonucleotide strands are listed below in Table 1. Tris(hydroxymethyl)aminomethane (Tris), hydrochloric acid, sodium chloride, magnesium chloride, bovine serine albumin (BSA), 1,4-dithiothreitol (DTT), gold (III) chloride trihydrate, cocaine hydrochloride, and DIS were purchased from Sigma-Aldrich. Exo III was purchased from New England Biolabs. OliGreen and SYBR gold were purchased from Thermo Fisher Scientific. Urine samples used in this work were collected from healthy and consenting adult donors.
TABLE-US-00001 TABLE1 Thesequencesoftheoligonucleotidestrands SEQIDNo. SequenceID Sequence(5 -3) SEQIDNo:1 DISS.1-AT CTCGGGACGTGGATTTTCCGCATACGAAGT TGTCCCGAG SEQIDNo:2 DIS-4536-LF GTCCGCATACGAAGTTGTCTTCCGCATACG AAGTTGTCCAAAAA SEQIDNo:3 FQ-DIS-4536- /5IAbRQ/GGACGTGGA/iSpC3/GACGTGGAC/iC SF y5/AAAAA SEQIDNo:4 DIS-36-LF GTCCGCATACGAAGTTGTCAAAAA SEQIDNo:5 FQ-DIS-36-SF /5IAbRQ/GACGTGGAC/iCy5/AAAAA SEQIDNo:6 DIS-536-LF GTCCGCATACGAAGTTGTCTTCCGCAAAAA SEQIDNo:7 FQ-DIS-536-SF /5IAbRQ/GTGGA/iSpC3/GACGTGGAC/iCy5/AA AAA SEQIDNo:8 DIS-4536-SF GGACGTGGA/iSpC3/GACGTGGACAAAAA SEQIDNo:9 COC-5325-LF CTCCTTCAACGAAGTGGGTTCCTTCAACGA AGTGGGTCTC SEQIDNo:10 COC-5325-SF GAGACAAGG/iSpC3/ACAAGGAG SEQIDNo:11 COC-5335-LF CTCCTTCAACGAAGTGGGTCTCCTTCAACGA AGTGGGTCTC SEQIDNo:12 COC-5335-SF GAGACAAGG/iSpC3/GACAAGGAG SEQIDNo:13 COC-5435-LF CTCCTTCAACGAAGTGGGTCTTCCTTCAACG AAGTGGGTCTC SEQIDNo:14 COC-5435-SF GAGACAAGGA/iSpC3/GACAAGGAG SEQIDNo:15 COC-5445-LF CTCCTTCAACGAAGTGGGTTCTTCCTTCAAC GAAGTGGGTCTC SEQIDNo:16 COC-5445-SF GAGACAAGGA/iSpC3/GAACAAGGAG SEQIDNo:17 COC-5325-LF-P CTCCTTCAACGAAGTGGGTTCCTTCAACGA AGTGGGTCTCTTTTT SEQIDNo:18 COC-5325-LF-B CTCCTTCAACGAAGTGGGTTCCTTCAACGA AGTGGGTCTCT/3InvdT/ SEQIDNo:19 COC-5325-SF-P GAGACAAGG/iSpC3/ACAAGGAGTTTTT SEQIDNo:20 COC-5325-SF-B GAGACAAGG/iSpC3/ACAAGGAGT/3InvdT/ SEQIDNo:21 FQ-COC-5325- /5IAbRQ/GAGACAAGG/iSpC3/ACAAGGAGT/i SF-B Cy5/T/3InvdT/ SEQIDNo:22 COC-5325-LF- CTCCTTCAACGAAGTGGGTTCCTTCAACGA P-18 AGTGGGTCTCTTTTTTTTTTTTTTTTTT SEQIDNo:23 SH-COC-5335- HS-(CH.sub.2).sub.6- SF-1X TTTTTTGAGACAAGG/iSpC3/GACAAGGAG SEQIDNo:24 COC-5335-LF- CTCCTTCAACGAAGTGGGTCTCCTTCAACGA 3A AGTGGGTCTCAAAAA SEQIDNo:25 COC-5335-SF- AAAAAGAGACAAGG/iSpC3/GACAAGGAG 5A SEQIDNo:26 COC-5335-SF- GAGACAAGG/iSpC3/GACAAGGAGAAAAA 3A SEQIDNo:27 COC-5335-SF-T AAAAAGAGACAAGGTGACAAGGAG SEQIDNo:28 SH-COC-5335- HS-(CH.sub.2).sub.6- SF-2X /TTTTTTGAGACAAGG/iSpC3/GACAAGGAGT TTTTTGAGACAAGG/iSpC3/GACAAGGAG a /iSpC3/ represents internal C3 spacer modification b /5IAbRQ/ represents Iowa Black RQ quencher modification c. /iCy5/ represents Cy5 fluorophore modification d. /3InvdT/ represents a 3 inverted deoxythymidine.
Isothermal Titration Calorimetry (ITC)
[0169] ITC experiments were performed with a MicroCal ITC200 (Malvern). 200 M DIS was titrated into 10 M DISS.1-AT, with both diluted in DIS binding buffer (10 mM Tris-HCl, 0.5 mM MgCl.sub.2, pH 7.4). The experiment consisted of 19 successive 2 L injections after an initial 0.4 L purge injection with spacing of 180 seconds at 23 C. The injection heat was analyzed with the MicroCal analysis kit integrated into Origin 7 software, and the titration curve was fitted with a single-site binding model.
Determination of Binding Affinity of DIS-CBSA-4536, DIS-SA-536 and DIS-SA-36
[0170] The binding affinities of the split aptamers were determined using a previously reported fluorescence assay with some modifications. 1 L of 100 M DIS long fragment (DIS-4536-LF, DIS-536-LF or DIS-36-LF), 1 L of 100 M respective fluorophore/quencher-modified DIS short fragment (FQ-DIS-4536-SF, FQ-DIS-536-SF or FQ-DIS-36-SF), and 93 L of DIS binding buffer were mixed with 5 L of solution containing various concentrations of DIS. 80 L of each sample was then transferred into wells of a 96-well plate. After a 30-minute incubation at room temperature, the fluorescence was measured using a TECAN M1000 Pro (.sub.ex/en=648/668 nm). Each sample was analyzed in triplicate, and the means and standard deviations were plotted. The data were fitted with the Hill equation using OriginLab 9 to calculate Hill coefficient (n.sub.H) and K.sub.1/2 (DIS concentration producing half occupancy) of each split aptamer.
Exo III Digestion and Gel Electrophoresis Analysis
[0171] All digestion experiments were performed as followed unless specified otherwise. 1 L each of 50 M short and long CBSA fragments were added into 43 L of reaction buffer to yield final DIS and cocaine concentrations of 250 M and 500 M, respectively. The buffer composition varied for each aptamer/target mixture, with final concentrations for each reaction as follows: DIS (10 mM Tris-HCl, 0.5 mM MgCl.sub.2, 0.1 mg/mL BSA, pH 7.4) and cocaine (10 mM Tris-HCl, 0.1 mM MgCl.sub.2, 0.1 mg/mL BSA, pH 7.4). After incubation at 23 C. for 30 minutes, 5 L of 0.01 U/L Exo III was added. After 5, 10, 15, 30, and 60 minutes of digestion, 5 L of each sample was collected and immediately mixed with 10 L of loading buffer (71.25% formamide, 10% glycerol, 0.125% SDS, 25 mM EDTA, and 0.15% (w/v) xylene cyanol) to inactivate Exo III. Control samples were prepared similarly, but with 5 L reaction buffer instead of Exo III. The digestion products were characterized via denaturing polyacrylamide gel electrophoresis (PAGE), with 3 L of each sample loaded into each well. Separation was carried out at 20 V/cm for 3 hours in 0.5TBE running buffer. The gel was stained with 1SYBR Gold for 25 minutes and imaged using a ChemiDoc MP imaging system (Bio-Rad). The percent of digestion was calculated based on band intensity relative to the control sample.
CBSA-Based, EATR-Amplified Fluorescence Assay for Detection of DIS
[0172] 2 L of 100 M DIS-4536-LF or DIS-536-LF, 1 L of 100 M FQ-DIS-4536-SF or FQ-DIS-536-SF, and 92 L of DIS binding buffer (10 mM Tris-HCl, 0.5 mM MgCl.sub.2, pH 7.4) or 50% urine diluted with the binding buffer were mixed with 5 L of solution containing various concentrations of DIS in the wells of a 96-well plate. The fluorescence of each sample was first measured (.sub.ex/en=648/668 nm) after a 30-minute incubation at room temperature. Then, 5 L of 0.2 U/L Exo III was added into each well to initiate EATR. After a 30-minute digestion at room temperature, the fluorescence of each sample was measured again. The signal gain was calculated by (FF.sub.0)/F.sub.0100%, where F.sub.0 is the fluorescence of the split aptamer mixtures without DIS and F is the fluorescence of the split aptamer mixtures with different concentrations of DIS. Error bars were calculated from standard deviation of signal gains from three individual measurements at each DIS concentration.
Synthesis of Gold Nanoparticles (AuNPs) Modified with Cocaine-Binding CBSA Short Fragment
[0173] The modification of the thiolated short fragment (SH-COC-5335-SF-1X or SH-COC-5335-SF-2X) onto 13-nm AuNPs was performed using a previously published protocol, at a 300:1 molar ratio of thiolated short fragment:AuNP. The modified AuNPs were then treated with DTT to regulate surface coverage. Specifically, 50 L of 5 nM modified AuNPs were mixed with 20 L of solution containing different concentrations of DTT in 10 mM Tris-HCl (pH 7.4). After a 30-minute incubation, the solution was centrifuged at 28,000 ref for 10 minutes. The supernatant was discarded to remove the excess DTT and displaced DNA strands, and the precipitated AuNPs were resuspended in 10 mM Tris-HCl (pH 7.4). This step was repeated twice. Finally, the modified AuNPs were resuspended in 5 L of the same buffer to obtain a particle concentration of 50 nM.
Quantitation of the Surface Coverage of CBSA Short Fragments on AuNPs Via DTT Displacement
[0174] Surface coverage of the SH-COC-5335-SF-1X- or SH-COC-5335-SF-2X-modified AuNPs were measured using a standard DTT displacement assay. The AuNPs were diluted to a final volume of 55 L in Tris buffer (10 mM Tris-HCl, pH 7.4). 50 L of AuNP solution was loaded into a well of a 384-well plate and the absorbance was measured using a TECAN M1000 Pro. The concentration of AuNPs was calculated using Beer's law (=2.710.sup.8 mol.sup.1.Math.cm.sup.1). 50 L of the modified AuNP solution was collected and mixed with 50 L of 1.0 M DTT solution. After an overnight incubation at room temperature, the solution was centrifuged at 25,000 ref for 10 minutes to remove the AuNP precipitate. 20 L of the supernatant was then mixed with 80 L of 0.625 OliGreen solution to obtain a 0.5 Oligreen concentration. 100 L of supernatant-Oligreen mixture was loaded into a well of a 384-well microplate and fluorescence was measured using a TECAN M1000 Pro (.sub.ex/em=500/525 nm). DTT-displaced oligonucleotides were quantified using an established calibration curve derived from CBSA short fragments that had been subjected to the same DTT treatment.
CBSA-Based, Colorimetric EATR Assay for Detection of Cocaine
[0175] 2.5 L of SH-COC-5335-SF-1X- or SH-COC-5335-SF-2X-modified AuNPs (50 nM), 1 L of 2.5 M long fragment (COC-5335-LF), 2 L of a solution with different cocaine concentrations or different cutting agents with a final concentration of 50 and 15.5 L reaction buffer (final concentrations: 10 mM Tris-HCl, 100 mM NaCl, 0.75 mM MgCl.sub.2, 0.1 mg/mL BSA, pH 7.4) were mixed in wells of a 384-well plate. After 30 minutes, 4 L of 1.25 U/L Exo III was added into each well. Absorbance spectra from 400-800 nm were recorded every 5 minutes, with pictures taken by a Nikon D800 after 20 minutes of Exo III digestion.
Example 1Engineering of DIS-Binding CBSA
[0176] Stojanovic and colleagues recently isolated aptamers for various steroids, including DIS, using a library-immobilized SELEX approach. DIS is one of the most abundant steroid hormones in urine. The concentration of DIS in healthy adults typically ranges from 1-20 M, but can climb to the sub-millimolar range in patients with adrenal tumors. The isolated DIS-binding aptamer (DISS.1-AT) demonstrated a K.sub.D of 0.44 M (
Example 2Design of a CBSA-Based EATR-Amplified Fluorescence Assay
[0177] To confirm binding cooperativity of DIS-CBSA-4536, the short fragment was modified with a Cy5 fluorophore and an Iowa Black RQ quencher at the 3 and 5 terminus, respectively (FQ-DIS-4536-SF) (SEQ ID No: 3) (
[0178] In the absence of the target, both FQ-DIS-4536-SF and the corresponding long fragment (DIS-4536-LF) remain separate, and the fluorophore is quenched due to its close proximity with the quencher (
[0179] By titrating various DIS concentrations, a Hill coefficient (n.sub.H) of 1.6 was determined for DIS-CBSA-4536 (
[0180] To demonstrate the highly sensitive target-induced assembly of the CBSA, two sets of DIS-binding split aptamers were designed with a single binding domain. Specifically, Stem 1 of the DIS-binding parent split aptamer (termed DIS-SA-36) (
[0181] Binding experiments were performed with these two split aptamers along with the CBSA. DIS-CBSA-4536 demonstrated no background assembly in the absence of the target, and progressive target-induced assembly with increasing concentrations of DIS. DIS-SA-536 also showed target-induced assembly with a moderately higher target affinity, but had high background assembly in the absence of DIS (
[0182] The affinity of DIS-CBSA-4536 was too low for direct detection of DIS at physiological relevant concentrations. Nevertheless, the highly target-responsive feature of the CBSA enables the demonstration of its compatibility with EATR-mediated signal amplification. Exo III was selected for this reaction because of its potent apurinic endonuclease activity, along with the fact that this enzyme is highly active at room temperature in a sequence-insensitive manner. When the CBSA-DIS complex assembles in the presence of DIS, Exo III is able to recognize the duplexed structure and specifically cleaves it at the abasic site (
[0183] The end result is that a very small amount of target can be recycled for multiple rounds of assembly and cleavage, generating a substantially amplified fluorescence signal (
Example 3Exo III Efficiently Mediates EATR of DIS-CBSA-4536 in Solution
[0184] In order to prevent nonspecific digestion of the CBSA, a poly (A).sub.5 overhang was added at the 3 terminus of both the short and long fragments. A time-course of digestion with Exo III using DIS-CBSA-4536 was performed in the presence or absence of DIS. The digestion products were collected after 5, 10, 15, 30, 60, and 120 minutes and analyzed by polyacrylamide gel electrophoresis (PAGE) (
[0185] Exo III cleavage of DIS-4536-SF was rapid and specific, with 59% cleavage in the presence of 500 M DIS after 30 minutes. In contrast, only 9% of DIS-4536-SF was cleaved in the absence of the target (
[0186] These results confirmed that the apurunic endonuclease activity of Exo III could specifically cleave the CBSA even when it is bound to the DIS target. Notably, moderate non-specific digestion of DIS-4536-LF by Exo III was observed, resulting in partial removal of its poly(A).sub.5 protection (
[0187] Recycling of target and long fragment were demonstrated by performing an Exo III cleavage reaction with 1 M DIS-4536-LF and 4 M DIS-4536-SF in the presence of 500 M DIS. PAGE analysis confirmed that Exo III achieved efficient and specific cleavage of the short fragment, with 99% of DIS-4536-SF cleaved after 240 minutes (
[0188] Based on the fact that the short fragment was almost completely cleaved despite being present at a concentration greatly exceeding that of the long fragment, it is clear that Exo III-mediated recycling of the long fragment and target was taking place.
Example 4Sensitive DIS Detection in Biofluid Samples Using CBSA-Based EATR-Amplified Fluorescence Assay
[0189] Having demonstrated the feasibility of the CBSA-based EATR-amplified approach, the fluorescence assay described in
[0190] These results demonstrate that the sensitivity of the CBSA binding assay was enhanced 100-fold by implementing EATR, producing a measurable limit of detection that is more than 500-fold lower than the K.sub.1/2 of the CBSA.
[0191] As a control experiment, the EATR-amplified fluorescence assay was also performed using DIS-SA-536. Although DIS-SA-536 underwent target-induced assembly and was efficiently cleaved by Exo III, no target-induced signal amplification occurred after a 30-minute digestion because of the high levels of DIS-independent background assembly (
[0192] Importantly, the assay performed equally well in urine samples. Different concentrations of DIS were spiked into 50% diluted urine and tested with the CBSA-based EATR-amplified fluorescence assay. After a 30-minute enzyme digestion, a calibration curve was obtained with a linear range from 0 to 100 M (
Example 5Design of a Cocaine-Binding CBSA
[0193] To demonstrate the cooperative target binding of a split cocaine-binding aptamer, a previously reported 38-nucleotide cocaine-binding aptamer (38-GC) (Roncancio et al. Anal. Chem., 2014, 86 (22), pp 11100-11106) was split (
[0194] To achieve cooperative target binding, several base-pairs in stem 1 and stem 2 were further truncated in each set of SSA (
[0195] In the absence of target, the short and long fragments are separated. However, in the presence of target, these two fragments assemble via cooperative target binding to form a CBSA-target complex that contains two target-binding domains.
[0196] Other cocaine binding CBSAs were created by increasing the total number of base-pairs between the two binding domains of COC-CBSA-5325. For example, COC-CBSA-5335, COC-CBSA-5435 and COC-CBSA-5445 were generated by adding an additional one, two, or three base-pairs between the two binding domains (
[0197] ATMND is a fluorescent dye that can insert itself into duplexed abasic sites. When ATMND is free in solution, it fluoresces, but its fluorescence becomes quenched when it binds to duplexed abasic sites of the CBSA-cocaine complex in the presence of cocaine (
Example 6Assessment of Target-Induced CBSA Assembly and Exo III Digestion of the CBSA-Target Complex Using a Fluorescent Dye-Based Assay
[0198] The target binding cooperativity of COC-CBSA-5325 and the Exo III digestion of the CBSA-cocaine complex was demonstrated using ATMND. When ATMND is free in solution, it fluoresces, but its fluorescence becomes quenched when it binds to duplexed abasic sites. In the absence of cocaine, the short and long fragments remain separate and ATMND fluoresces as it is free in solution (
[0199] Upon the addition of Exo III, the enzyme recognizes and cleaves the duplexed abasic site, releasing the target, long fragment, and ATMND (
[0200] To perform the ATMND assay, 1 M each of both CBSA fragments (COC-5325-LF and COC-5325-SF) was mixed with 200 nM ATMND in binding buffer (10 mM Tris-HCl, 0.1 mM MgCl.sub.2, pH 7.4) in the presence or absence of 250 M cocaine. The change in the fluorescence of ATMND was used to determine the extent of CBSA assembly. After a 10-minute incubation at room temperature, 72% and 28% of ATMND was quenched with and without cocaine, respectively (
[0201] Upon addition of 0.1 U/L Exo III, the fluorescence of ATMND in the cocaine-free sample did not change significantly. In contrast, the fluorescence of ATMND in the cocaine-containing sample gradually increased (
[0202] Another enzyme, AP endonuclease 1 (APE 1) (0.3 U/L) was also used to perform the same experiment because this nuclease has apurinic endonuclease activity. However, a much lower efficiency of abasic site cleavage was observed using APE1 in the binding buffer. It took 20 hours for the cocaine-containing sample to achieve full ATMND fluorescence recovery (
Example 7Characterization of CBSA Digestion Products Using PAGE
[0203] PAGE was used to further identify and characterize the digestion of the CBSA-cocaine complex by Exo III. Specifically, 1 M of both CBSA fragments were first incubated with or without 250 M cocaine in binding buffer for 30 minutes at 23 C. Then, Exo III (0.01 U/L) was added into each sample to initiate digestion.
[0204] Samples were collected after 30, 60, 120, 180, 240, and 300 minutes and mixed with a loading buffer containing EDTA, SDS, and formamide to stop enzyme digestion. The samples were loaded in the wells of a 15% polyacrylamide gel and separation was performed at 300 V for three hours. Afterwards, the gel was stained using SYBR Gold and band intensity was used to characterize the amount of digestion product generated.
[0205] The results show that 38% of COC-5325-SF is digested after 5 hours in the presence of 250 M cocaine, while no significant digestion is observed without cocaine (
Example 8Modifications of the CBSA Long Fragment at its 3Terminus
[0206] To prevent digestion of the long fragment, two modified versions were designed: one with a 3 poly (T).sub.5 extension (termed, COC-5325-LF-P and another with a single 3 inverted deoxythymidine (termed, COC-5325-LF-B). Each modified long fragment was used with COC-5325-SF to perform Exo III digestion in the presence and absence of 250 M cocaine under the same conditions as described above.
[0207] The results show that the short fragment is completely digested for the CBSA mixture in the presence of cocaine while no short fragment digestion occurs in the absence of cocaine (
[0208] As a control experiment, Exo III digestion of a mixture of COC-5325-LF and COC-5325-SF was performed in the presence and absence of cocaine (
Example 9Modification of the CBSA Short Fragment its 3Terminus
[0209] Developing a fluorescence assay using the CBSA preferably requires modification of the short fragment with a fluorophore and a quencher at both of its termini. In the absence of target, the close proximity of the fluorophore and quencher results in minimal background fluorescence. However, a large background signal will be generated if Exo III removes the fluorophore or quencher through digestion of the 3 end of the short fragment. Thus, it is vital to protect the 3 end of the short fragment from enzyme digestion.
[0210] To do so, the 3 end of the short fragment was modified with an inverted deoxythymidine (COC-5325-SF-B) or a poly (T).sub.5 overhang (COC-5325-SF-P) and their resistance to Exo III digestion was tested with COC-5325-LF-P in the presence and absence of cocaine. As a result, only the inverted deoxythymidine modification was cleaved from COC-5325-SF-B without cocaine after 2 hours of digestion with 0.01 U/L Exo III. However, cocaine was still able to assemble the cleaved COC-5325-SF-B with COC-5325-LF-P to successfully facilitate target-induced CBSA digestion (
[0211] Additionally, the poly (T).sub.5 protection of COC-5325-SF-P was partially digested both in the absence and presence of cocaine, generating a major product containing a poly (T).sub.3 overhang. This product was able to mediate target-induced CBSA assembly and digestion, but at a noticeably slower rate (
[0212] A time-course enzyme digestion was then performed using COC-5325-LF-P and COC-5325-SF-B, and the digestion products were characterized by 15% PAGE. 90% of the short fragment was digested in the presence of cocaine within one hour while only 20% of short fragment was digested without cocaine within 5 hours (
Example 10Test Cooperative Target Binding Assisted Cocaine Recycling Using PAGE
[0213] To demonstrate enzyme-assisted target recycling, digestion of COC-5325-LF-P and COC-5325-SF-B CBSA was performed using an 8-fold excess amount of short fragment relative to long fragment. Specifically, 1 M of COC-5325-LF-P and 8 M of COC-5325-SF-B was first incubated for 30 mins and then digested with 0.1 U/L Exo III in the presence and absence of 250 M cocaine. In the presence of cocaine, 95% of the short fragment was digested within 5 hours, indicating that at least 7 rounds of long fragment and cocaine recycling occurred (
Example 11Exo III-Mediated Target Recycling Using FQ-Modified Short Fragment
[0214] A fluorophore-quencher modified version of the short fragment, termed FQ-COC-5325-SF-B, along with COC-5325-LF-P, was used for ultrasensitive cocaine detection via EATR. Specifically, an Iowa Black RQ quencher and a Cy5 fluorophore were modified at the 5 and 3 terminus of the COC-5325-SF-B, respectively. The fluorophore was protected by flanking with an additional thymidine and inverted deoxythymidine at the 3 terminus. Cy5 was chosen as the fluorophore since its emission spectra does not overlap with the spectra emitted by bio-matrices such as saliva.
[0215] In the absence of cocaine, the short and long CBSA fragments remain separate and Exo III cannot cleave the abasic site on the short fragment. Because the fluorophore is in close proximity to the quencher, fluorescence is significantly quenched and a minimal fluorescence signal is observed. When cocaine is present, the two CBSA fragments assemble and form a duplexed apurinic site, which is then cleaved by Exo III's apurinic endonuclease activity. Once the short fragment is cleaved, the fluorophore is separated from the quencher, the fluorescence of the solution increases, and the released long fragment and cocaine are recycled for another round of EATR.
[0216] Temperature can greatly affect the hybridization of DNA and may influence the cocaine-induced background assembly of the CBSA. Therefore, the reaction temperature was optimized. Fluorescence increased rapidly at 20 C. upon addition of 0.1 U/L Exo III without cocaine, implying significant background assembly of the CBSA (
[0217] The concentration of the long fragment also influences the assembly of the CBSA and EATR. This was determined by using 1 M of FQ-COC-5325-SF-B and varying concentrations of COC-5325-LF-P (0.1 to 1 M) and digesting the mixtures with Exo III in the presence of 50 M cocaine. After 30 minutes of digestion, signal gains of 0.2, 0.4, 1.0, and 1.4 were observed for the mixtures containing 0.1, 0.2, 0.5, and 1 M COC-5325-LF-P, respectively (
[0218] Even though the 3 poly (T).sub.5 modification can significantly protect the 3 end of COC-5325-LF-P, the long fragment is still non-specifically and gradually digested during EATR due to the relatively high concentration of enzyme used. To better protect the 3 end of the long fragment, it was modified with a 3 poly (T).sub.18 (COC-5325-LF-P-18). 1 M of COC-5325-LF, COC-5325-LF-P, or COC-5325-LF-P-18 was used with 1 M FQ-COC-5325-SF-B to perform the EATR experiments with 0.1 U/L Exo III in the presence and absence of 50 M of cocaine. The mixture with COC-5325-LF-P showed the highest signal gain within 30 min of enzyme digestion. In contrast, COC-5325-LF was rapidly consumed and was not able to amplify the signal via EATR due to having no 3 protection (
[0219] Finally, the enzyme concentration was optimized to achieve the shortest reaction time with the largest signal gain. 0.025-0.1 U/L of Exo III was tested in the fluorescence assay using COC-5325-LF-P and FQ-COC-5325-SF-B as described above. Signal gains of 1.6, 1.6, 1.5, and 1.4 were achieved for enzyme concentrations of 0.025, 0.05, 0.075, and 0.1 U/L, respectively. Although both the samples containing 0.025 and 0.05 U/L Exo III showed the highest signal gains, the sample with 0.05 U/L Exo III had the highest absolute fluorescence increase (
[0220] After optimization of all experimental parameters, a calibration curve was generated using different concentrations of cocaine (10 nM-1 mM) (
[0221] The CBSA-based EATR assay was then used to detect cocaine in saliva. A calibration curve was established with various concentrations of cocaine (0.1-2500 M) spiked into 20% saliva (
Example 12Design of the CBSA-Based Colorimetric Assay Employing EATR-Mediated AuNP Aggregation
[0222] Due to the highly responsive target-induced assembly feature of CBSAs, a similar EATR-amplified strategy can be readily adopted into different sensing platforms using other small-molecule-binding CBSAs. For example, the EATR-amplified assay described above is instrument-dependent, making it unsuitable for instrument-free applications. However, the same strategy can be also used to achieve rapid colorimetric detection of small-molecule targets in an instrument-free fashion.
[0223] As a demonstration, the cocaine-binding CBSA, COC-CBSA-5335, was used, which has an n.sub.H of 1.5 and a K.sub.1/2 of 36 to develop an assay with a visual readout that is potentially suitable for field use. Specifically, the short fragment of this CBSA (SH-COC-5335-SF-1X) was immobilized onto AuNPs, and then the free long fragment (COC-5335-LF) in solution was added (
Example 13EATR of CBSA Mediated by AP Endonuclease of Exo III Instead of its 3-5 Exonuclease Activity
[0224] The contribution of Exo III's 3-5 exonuclease activity to the digestion of CBSA-cocaine complexes relative to its endonucleolytic activity was first investigated by engineering three derivatives of COC-5335-SF. The first derivative (COC-5335-SF-5A) included a poly (A).sub.5 extension at the 5 end that allows digestion of both the abasic site and the 3 terminus (
[0225] Exo III digestion of a mixture of COC-5335-LF-3A combined with each of the three different short fragment derivatives was performed in the presence or absence of 250 M cocaine, and the digestion products were characterized using PAGE. For the COC-5335-SF-5A, 61% and 5% of the short fragment was cleaved with and without 250 M cocaine, respectively, after a five-minute enzyme reaction (
[0226] A similar digestion profile for COC-5335-SF-3A was obtained, where Exo III cleavage occurred only at the abasic site. 61% and 8% of the COC-5335-SF-3A were respectively cleaved with and without addition of cocaine after five minutes of digestion, which increased to 95% and 17%, respectively, after 60 minutes (
[0227] These results demonstrated that the apurinic endonuclease activity of Exo III is efficient enough to mediate the digestion of CBSA-cocaine complexes.
[0228] The control experiment with COC-5335-SF-T demonstrated that Exo III was able to remove only one nucleotide from the short fragment. Only 5% of COC-5335-SF-T was digested both with and without cocaine after a five-minute Exo III reaction, and only 15% of the COC-5335-SF-T was digested in the presence of cocaine versus 20% without cocaine after 60 minutes (
[0229] It is clear that the CBSA-cocaine complex inhibits the 340-5 exonuclease activity of Exo III. Thus, the abasic site is sufficient to enable robust EATR signal amplification, and the poly (A).sub.5 protection at the 3 end of the short fragment is unnecessary.
[0230] To demonstrate EATR with the cocaine-binding CBSA in solution, a time-course of Exo III digestion was performed using COC-5335-LF-3A and unprotected COC-5335-SF, with a 1:8 ratio of long fragment:short fragment, either with or without 250 M cocaine. PAGE analysis of the digestion products showed rapid and specific Exo III digestion, with more than 60% of the short fragment cleaved in the presence of cocaine after only 10 minutes (
Example 14DNA Surface Coverage and the Length of the Short Fragment Affects EATR-Mediated AuNP Aggregation
[0231] The CBSA-based EATR-amplified assay was employed to achieve naked-eye detection of cocaine. A thiolated version of COC-5335-SF (Table 1, SH-COC-5335-SF-1X) was conjugated onto AuNPs as described previously..sup.13 Because DNA surface coverage has a critical influence on EATR-mediated AuNP aggregation, a simple strategy was developed for generating AuNPs displaying different quantities of short fragment. This was done by incubating short fragment-saturated AuNPs with various micromolar concentrations of DTT to displace different quantities of immobilized short fragment from the particle surface. Then, the surface coverage resulting from treatment with various DTT concentrations was measured by mixing each of these batches of AuNPs with an equal volume of 1.0 M DTT and incubating overnight to remove all remaining DNA strands from the particle surface. These were subsequently quantified by centrifuging the samples and measuring the DNA concentration in the collected supernatant with OliGreen, a DNA binding dye.
[0232] A calibration curve (
[0233] This demonstrates that DTT treatment can effectively regulate DNA surface coverage on AuNPs in a concentration-dependent manner. AuNPs treated with 500 M DTT yielded a surface coverage of 201 strands/particle; the resulting particles were unstable, and spontaneously aggregated in the reaction buffer. Thus, these AuNPs were omitted from following experiments.
[0234] How differing levels of surface coverage affect CBSA-cocaine assembly, exonuclease cleavage, and AuNP aggregation was then assessed. Because the CBSA will be assembled on the particle, Exo III will have minimal accessibility to the 3 end of the long fragment. Various batches of 5 nM SH-COC-5335-SF-1X-modified AuNPs with 100 nM COC-5335-LF were incubated in the presence or absence of 250 M cocaine for 30 minutes, and then 0.2 U/L Exo III was added. The signal response was tracked by performing time-dependent measurements of UV-vis absorbance. Well-dispersed AuNPs have an absorbance peak at 520 nm; as AuNPs start to aggregate, this peak decreases and a new peak appears at 650 nm. Therefore, the ratio of A.sub.650/A.sub.520 was used to evaluate EATR-mediated AuNP aggregation. When the value of A.sub.650/A.sub.520 is below 0.4, the AuNPs are well separated and the solution appears red. When the value of A.sub.650/A.sub.520 is 0.6, the AuNPs begin to aggregate and the solution appears purple. A value of A.sub.650/A.sub.520>0.8 indicates complete aggregation, and the solution appears dark blue. SH-COC-5335-SF-1X-modified AuNPs with relatively low surface coverage (25 strands/particle) demonstrated much faster aggregation than AuNPs with high surface coverage (102 strands/particle) (
[0235] Although the ratio between COC-5335-LF and AuNP-conjugated SH-COC-5335-SF-1X under this optimal surface coverage was close to 1:1, Exo III-mediated recycling of the long fragment and target was taking place on the particle surface since DNA hybridization efficiency on AuNPs is usually below 20%. The DTT-based strategy for regulating DNA surface coverage plays multiple roles in facilitating exonuclease digestion of AuNP-conjugated short fragments for rapid cocaine detection. First, it prevents non-specific binding of DNA bases by occupying vacant areas on the particle surface with DTT, lifting the covalently-bound aptamer fragments into an upright orientation that increases CBSA-target assembly and enzyme accessibility. Second, it adjusts the surface density by replacing some of the chemically-bound aptamer fragments. This significantly reduces the steric and electrostatic repulsion caused by neighboring DNA strands, enabling optimized CBSA-cocaine complex assembly. Finally, by decreasing DNA surface coverage, this treatment also decreases local salt concentration at the surface, which greatly reduces the salt-induced inhibition of Exo III.
[0236] A longer version of SH-COC-5335-SF-1X should further increase the stability of the modified AuNPs by suppressing nonspecific digestion-mediated aggregation. Thus, a new construct (Table 1, SH-COC-5335-SF-2X) comprising two tandem abasic-site-incorporated short fragment repeats with a (T).sub.6 linker was designed, hereon termed SH-COC-5335-SF-2X. The assay's specificity should be enhanced by this change, because Exo III will have to cleave both abasic sites in order to trigger cocaine recycling and AuNP aggregation (
[0237] Then, 13-nm AuNPs modified with SH-COC-5335-SF-2X were synthesized and the DTT regulation strategy was used to adjust the surface coverage of the AuNPs. The effects of DNA surface coverage on EATR performance was tested. A calibration curve (
[0238] Compared to SH-COC-5335-SF-1X modified-AuNPs, SH-COC-5335-SF-2X modified-AuNPs are stable even with surface coverages as low as 16 strands/particle. This is most likely due to the increased number of negatively charged DNA-phosphate groups located on the AuNP surface, providing more repulsion among particles. Lower-coverage AuNPs underwent EATR-mediated AuNP aggregation at a much faster rate than those with saturating surface coverage (
Example 15Visual Detection of Cocaine Using CBSA-Based EATR-Amplified Colorimetric Assay
[0239] The assay's performance with SH-COC-5335-SF-1X was compared versus SH-COC-5335-SF-2X at optimized surface coverage. SH-COC-5335-SF-2X-modified AuNPs aggregated more rapidly than those modified with SH-COC-5335-SF-1X (
[0240] The target-specificity of the CBSA-based EATR-amplified colorimetric assay was determined by challenging it with cocaine along with common cutting agents observed in street samples such as lidocaine, caffeine, levamisole, and benzocaine at a concentration of 50 M. A red-to-blue color change was observed only in the cocaine-containing sample within 20 minutes (
[0241] This assay facilitated rapid, naked-eye detection of cocaine at low micromolar concentrations and is more sensitive, robust, or simple compared to previously reported methods for the visual detection of cocaine (Table 2).
TABLE-US-00002 TABLE 2 Comparison of assays for the visual detection of cocaine. Visual Detection Detection strategy Detection Limit Time Existing Problems Reference CBSA-based EATR-amplified 10 M 20 min Requires enzyme reaction This work assay Dissociation of aptamer-hybridized 500 M 1 min Preparation of AuNP Liu et al. Angew. Chem., DNA-conjugated AuNP-assemblies assemblies is laborious Int. Ed. 2006, 45, 90-94. Dye-displacement assay 500 M Overnight Long reaction time Stojanovic et al. J. Am. Chem. Soc. 2002, 124, 9678-9679. Aggregation of split aptamer- 50 M 3 min Unmodified AuNPs are Zhang et al. Small 2008, 4, protected unmodified AuNPs unstable 1196-1200. AuNP and conjugated 50 M 2 min Unmodified AuNPs are Xia et al. Proc. Natl. Acad. polyelectrolyte unstable Sci. U.S.A. 2010, 107, 10837-10841. Target-induced dissociation of 2 M 10 min Enzyme-embedded Zhu et al. Angew. Chem., aptamer-linked hydrogels hydrogel is hard to Int. Ed. 2010, 49, 1052-1056. preserve
[0242] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.
[0243] It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.
[0244] The description herein of any aspect or embodiment of the invention using temis such as comprising, having, including or containing with reference to an element or elements is intended to provide support for a similar aspect or embodiment of the invention that consists of, consists essentially of, or substantially comprises that particular element or elements, unless otherwise stated or clearly contradicted by context (e.g., a composition described herein as comprising a particular element should be understood as also describing a composition consisting of that element, unless otherwise stated or clearly contradicted by context).
[0245] The term about means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, about can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively, about can mean a range of up to 0-20%, 0 to 10%, 0 to 5%, or up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term about meaning within an acceptable error range for the particular value should be assumed. In the context of compositions containing amounts of ingredients where the term about is used, these compositions contain the stated amount of the ingredient with a variation (error range) of 0-10% around the value (X10%).
[0246] In addition, any elements or limitations of any invention or embodiment thereof disclosed herein can be combined with any and/or all other elements or limitations (individually or in any combination) or any other invention or embodiment thereof disclosed herein, and all such combinations are contemplated with the scope of the invention without limitation thereto.