Use of probiotics to increase male fertility

Abstract

The present invention relates to the use of Lactobacillus rhamnosus in combination with Bifidobacterium longum to manufacture a formulation to increase male fertility in a subject. In particular, said strains are the strains Lactobacillus rhamnosus CECT 8361 and Bifidobacterium longum CECT 7347. Additionally, the formulation comprising the said strains Lactobacillus rhamnosus CECT 8361 and Bifidobacterium longum CECT 7347 is also described.

Claims

1. A formulation comprising the strains Lactobacillus rhamnosus CECT 8361 and Bifidobacterium longum CECT 7347, the combination of which is able to improve semen quality, and a carrier and/or an excipient.

2. The formulation according to claim 1, wherein the Lactobacillus rhamnosus CECT 8361: Bifidobacterium longum CECT 7347 ratio is 50:50.

3. The formulation according to claim 1, wherein the formulation is a pharmaceutical formulation or a functional nutritional formulation.

4. The formulation according to claim 3, wherein the pharmaceutical formulation comprises a pharmaceutically acceptable carrier and/or excipient.

5. The formulation according to claim 3, wherein the pharmaceutical formulation is suitable for oral administration.

6. The formulation according to claim 3, wherein the nutritional formulation is a functional food or a nutritional supplement.

7. The formulation according to claim 6, wherein the food is selected from the group consisting of a dairy product, a meat product, a vegetable product, an animal feed and a beverage.

8. The formulation according to claim 1, wherein the total concentration of microorganisms of the strains Lactobacillus rhamnosus CECT 8361 and Bifidobacterium longum CECT 7347 in the formulation is between 10.sup.6 and 10.sup.12 cfu.

9. The formulation according to claim 1, wherein the strains Lactobacillus rhamnosus CECT 8361 shows greater antioxidant activity than other strains of Lactobacillus, wherein greater antioxidant activity means that Lactobacillus rhamnosus CECT 8361 affords cells greater protection against oxidative stress than other strains of Lactobacillus.

10. The formulation of claim 8, wherein the total concentration of microorganisms of the strains Lactobacillus rhamnosus CECT 8361 and Bifidobacterium longum CECT 7347 in the formulation is 10.sup.9 cfu.

11. A method for improving semen quality in a subject comprising administering to a subject a formulation comprising a Lactobacillus rhamnosus strain CECT 8361 in combination with a Bifidobacterium longum strain CECT 7347 and a carrier and/or excipient.

12. The method according to claim 11, wherein the Lactobacillus rhamnosus: Bifidobacterium longum ratio is 50:50.

13. The method according to claim 11, wherein the formulation is a pharmaceutical formulation or a functional nutritional formulation.

14. The method according to claim 13, wherein the pharmaceutical formulation comprises a pharmaceutically acceptable carrier and/or excipient.

15. The method according to claim 13, wherein the pharmaceutical formulation is developed for oral administration.

16. The method according to claim 13, wherein the functional nutritional formulation is a food or a nutritional supplement.

17. The method according to claim 16, wherein the food is selected from the group consisting of a dairy product, a meat product, a vegetable product, an animal feed and a beverage.

18. The method according to claim 11, wherein the subject is a fish or a mammal.

19. The method according to claim 11, wherein the microorganisms of the strains Lactobacillus rhamnosus and Bifidobacterium longum in the formulation are administered at a dose of between 10.sup.6 and 10.sup.12 cfu/day.

20. The method according to claim 19, wherein the microorganisms of the strains Lactobacillus rhamnosus and Bifidobacterium longum in the formulation are administered at a dose of 10.sup.9 cfu/day.

21. The method according to claim 11, wherein the dosage of the formulation is at least once a day.

Description

BRIEF DESCRIPTION OF THE FIGURES

(1) FIG. 1 is a bar graph showing the variation in motile sperm (%) throughout the experimental design: C (control; n=9), T1 (treatment 1; n=8), T2 (treatment 2; n=7), L1 (washout period 1; n=8), L2 (washout period 2; n=7). The values (meanerror) marked with an asterisk are significantly different from the control according to a Student t test statistical analysis for related samples (p<0.05).

(2) FIG. 2 is a bar graph depicting the variation in the sperm DNA fragmentation index (DFI) (%) throughout the experimental design: C (control; n=9), T1 (treatment 1; n=9), T2 (treatment 2; n=7), L1 (washout period 1; n=8), L2 (washout period 2; n=6). The values (meanerror) marked with an asterisk are significantly different from the control according to a Student t test statistical analysis for related samples (p<0.05).

(3) FIG. 3 is a bar graph showing the antioxidant capacity of Lactobacillus rhamnosus CECT 8361 in Caenorhabditis elegans (hereinafter, C. elegans). Screening was performed of twenty isolates belonging to the genus Lactobacillus in the collection of one of the two applicants of the present invention, namely Biopolis, SL to test antioxidant activity in C. elegans. The figure shows the survival rate of C. elegans fed on each isolate as compared to C. elegans survival in control conditions (E. coli OP50). Positive values indicate antioxidant activity and negative values indicate a possible pro-oxidant effect.

EXAMPLES

(4) Below, the invention will be illustrated by experiments undertaken by the inventors, which demonstrate the effectiveness of the product of the invention.

Example 1: Improvement of Sperm Quality after Co-Administration to a Subject of Strains Lactobacillus rhamnosus CECT 8361 and Bifidobacterium longum CECT 7347

(5) To address this study, strains Lactobacillus rhamnosus CECT 8361 and Bifidobacterium longum CECT 7347 were selected. This selection was based on the high antioxidant activity displayed by the strain Lactobacillus rhamnosus CECT 8361 and the anti-inflammatory activity previously described for the strain Bifidobacterium longum CECT 7347.

(6) Administration was in the form of a capsule containing a combination of both microorganisms at fifty percent (50%) each. The dosage was one capsule daily, corresponding to an intake of 10.sup.9 cfu/day.

(7) Pursuant to approval of the Bioethics Committee of the University of Leon, asthenozoospermic men who were not under medication and shared similar eating habits participated in the experiment, after having signed the corresponding informed consent in accordance with the Declaration of Helsinki and in compliance with the laws in force in the Spanish state.

(8) Volunteers donated their ejaculate sample as described in the World Health Organization handbook (WHO, 2010) after three days of sexual abstinence and using sterile containers. Donations were collected quickly straight after sampling to be processed in the laboratory forthwith.

(9) Biological samples requested from donors were the following: control, C (prior to starting probiotic intake); treatment 1 T1 (after 3 weeks of probiotic intake); Treatment 2, T2, (6 weeks after probiotic intake); washout period 1 L1 (3 weeks after probiotic intake completion); and washout period 2 L2 (6 weeks after probiotic intake completion). Probiotic intake was daily. The dosage was one capsule per day; each capsule contained both strains Lactobacillus rhamnosus CECT 8361 and Bifidobacterium longum CECT 7347 at a concentration of 10.sup.9 cfu/capsule.

(10) The sperm was diluted in 1PBS buffer to a final concentration of 10-2010.sup.6 cells/mL. This dilution was loaded on a Makler counting chamber of 10-m at 37 C. Sperm motility was assessed in the same way for each sample using Computer-Assisted Sperm Analysis (CASA) consisting of a trinocular phase contrast microscope using a negative phase contrast objective 10, equipped with a 37 C. heating plate and Basler A312fc digital camera. Images were captured and analyzed using a computerized motility analyzer with specific settings for human sperm. Overall, the system provided the following three parameters: (1) percentage of motile sperm, (2) percentage of progressive sperm and (3) percentage of static spermatozoa.

(11) The SCSA (Sperm Chromatin Structure Assay) (Evenson) technique was conducted to evaluate DNA fragmentation. One metachromatic staining was performed with acridine orange (AO) with one aliquot of the sample. This molecule emits fluorescence in the red bandwidth when combined with denatured DNA and the green bandwidth when combined with an undamaged double helix of DNA. Ejaculates were diluted with THE (0.15 M NaCl, 0.01 M Tris-HCl, 1 mM EDTA, pH 7.4) buffer to a final cell concentration of approximately 1-210.sup.6 cells/mL. Samples were immediately frozen in liquid nitrogen until processing. Subsequently, the samples were thawed in a bath at 37 C. and mixed with 200 l of an acid detergent solution (0.08 N HCl, 0.15 M NaCl, 0.15 Triton X 100, pH 1.4). After 30 seconds of exposure to acid detergent, staining was performed with acridine orange by adding 1.2 mL of the staining solution containing 6 g of OA per ml of buffer (0.037 M citric acid, 0.126 M Na2HPO4, 0.0011 M EDTA (di-sodium), 0.15 M NaCl, pH 6.0). After exactly 3 minutes of staining, the samples were analyzed in a flow cytometer equipped with standard optics and an argon laser tuned to 488 m. Cell flow was maintained at around 200 cells/sec and 5000 events were counted for each sample. Data corresponding to the red (FL3 photodetector; 670 Long Pass filter) and green fluorescence (FL1 photodetector; 530/30 bandpass filter) of particles were recorded and analyzed with the free software Weasel 3.1. The main parameter, DNA fragmentation index (DFI), was analyzed, which corresponds to a ratio of red fluorescence to the total fluorescence (red and green).

(12) Statistical analysis was performed using SPSS version 20. Data are presented as meanSE in all cases. The mean values of each variable were compared using Student's t test for related samples (p<0.05).

(13) The status of donor sperm motility was corroborated in the control sample where it was confirmed that the volunteers were classified as asthenozoospermic following the standards of the World Health Organization (WHO, 2010). The value of motile cells recorded in this sample was 5.562.51% (mean valueSEM). At three weeks of probiotic administration (T1), the percentage of motile sperm increased by about five fold compared to the previous sampling, reaching a value of 31.886.01% (mean valueerror). This increase was maintained at six weeks of probiotic intake (T2) and in both samples taken at 3 and 6 weeks after concluding probiotic administration (L1 and L2). The data collected were respectively: 28.148.79; 33.256.38 and 39.578.52% (meanSEM) (FIG. 1). After performing the statistical analysis, significant differences were found between the control and the other samples (Student t test for related samples, p<0.05). See FIG. 1.

(14) FIG. 2 shows the mean percentages obtained at each key point during the experimental design for DNA fragmentation index. The highest DFI (sperm DNA fragmentation index) 25.740.59% was found in the control sample (C). At six weeks of probiotic administration, the percentage of damaged DNA decreased to 21.111.00 and 21.580.94% (T1 and T2 respectively). This trend continued in the first washout period (L1) with an average DFI of 21.641.73%. Six weeks after completion of treatment with the strains, the improvement recorded during the previous samplings began to change in washout period 2 (L2) with higher DFI being recorded compared to T1, T2 and L1, with a fragmentation index of 23.091.28%, thereby changing the trend. Significant differences (Student t test for related samples, p<0.05) with the control sample were found in T1, T2 and L1.

(15) The results demonstrate that the strains Lactobacillus rhamnosus CECT 8361 and Bifidobacterium longum CECT 7347 play a role in stimulating sperm motility when ingested as a functional nutritional formulation. The results also confirm a significant reduction in sperm DNA fragmentation after treatment.

Example 2. Antioxidant Activity of Lactobacillus rhamnosus CECT 8361

(16) Screening was performed of 23 isolates belonging to the genus Lactobacillus from the collection of one of the two applicants of the present invention, namely Biopolis, SL, based on their antioxidant activity in C. elegans. The strains included in the study were isolated from the feces of breast-fed children under 3 months old.

(17) FIG. 3 shows the results obtained with the Lactobacillus strain in the study. Data show the increase in survival percentages in the animal model C. elegans fed on each bacterial strain compared to C. elegans kept under standard conditions (fed on Escherichia coli strain OP50). As shown, isolate 1, identified as Lactobacillus rhamnosus, corresponded to the highest C. elegans survival rate, after applying an oxidative stress with hydrogen peroxide (an increase in survival of 27% compared to control conditions).

(18) Isolate 1 was unambiguously identified by 16S ribosomal DNA (rDNA) sequencing and subsequent comparison of the sequence obtained with total gene sequences deposited in public databases using the BLAST online (http://blast.ncbi.nlm.nih.gov/Blast.cgi) of the NCBI (National Center for Biotechnology Information). The strain of the present invention CECT 8361 was identified as Lactobacillus rhamnosus given the highest homology (100%) with public sequences belonging to this species. The strain was deposited in the Spanish Type Culture Collection (CECT) as CECT 8361.

(19) TABLE-US-00001 sequenceobtainedby16SrDNAsequencingof LactobacillusrhamnosusCECT8361. SEQIDNO:1 GTCGAACGAGTTCTNATTATTGAAAGGTGCTTGCATCTTGATTTAATTT TGAACGAGTGGCGGACGGGTGAGTAACACGTGGGTAACCTGCCCTTAAG TGGGGGATAACATTTGGAAACAGATGCTAATACCGCATAAATCCAAGAA CCGCATGGTTCTTGGCTGAAAGATGGCGTAAGCTATCGCTTTTGGATGG ACCCGCGGCGTATTAGCTAGTTGGTGAGGTAACGGCTCACCAAGGCAAT GATACGTAGCCGAACTGAGAGGTTGATCGGCCACATTGGGACTGAGACA CGGCCCAAACTCCTACGGGAGGCAGCAGTAGGGAATCTTCCACAATGGA CGCAAGTCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGCTTTCGGGTC GTAAAACTCTGTTGTTGGAGAAGAATGGTCGGCAGAGTAACTGTTGTCG GCGTGACGGTATCCAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGC CGCGGTAATACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAA GCGAGCGCAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCTCGGCTTAAC CGAGGAAGTGCATCGGAAACTGGGAAACTTGAGTGCAGAAGAGGACAGT GGAACTCCATGTGTAGCGGTGAAATGCGTAGATATATGGAAGAACACCA GTGGCGAANGCGGCTGTCTGGTCTGTAACTGACGCTGANGCTCGAAAGC ATGGGTAGCGAACAGGANNAGATACCCTGGTAGTCCATGCCGTAAACGA TGAATGCTAGGTGTTGGAGGGTTTCCGCCCTTCAGTGCCGCAGCTAACG CATTAAGCATTCCGCCTGGGGAGTACNACCGCAAGGNTGAAACTCAAAG GAATTGACGGGGGCCCGCACAAGCGGTGNAGCATGTGGTTTAATTCGAA GCANCNCGAAGAACCTTACCNGGTCTTGACNTCTTTTGATCA