Method for the biotechnological production of flavonoids

10435673 ยท 2019-10-08

Assignee

Inventors

Cpc classification

International classification

Abstract

A method is proposed for producing flavonoids, comprising the steps: (a) providing of a transgenic microorganism, containing (i) a first nucleic acid section (A), comprising or consisting of a gene coding for a CYP450 oxidase, (ii) a second nucleic acid section (B), comprising or consisting of a gene coding for a plant O-methyltransferase, and (b) adding of one or more flavanones to the transgenic microorganism, (c) the conversion of the substrate flavanones by the transgenic microorganism to the corresponding flavonoids, and optionally (d) isolating and purifying of the final products.

Claims

1. A process for the production of flavonoids, comprising: (a) adding one or more flavanones selected from naringenin and naringin to a transgenic microorganism, the transgenic microorganism comprising a first nucleic acid segment (A), comprising the nucleotide sequence set forth as SEQ ID NO:1 and/or the nucleotide sequence set forth as SEQ ID NO:2 and/or a nucleotide sequence at least 95% identical to SEQ ID NO:1 and/or SEQ ID NO:2 and which codes for a CYP450 oxidase that catalyzes the conversion of naringenin to eriodictyol and which comprises A75G, F88V, L189Q, and R472C amino acid substitutions and/or comprises A75G, F88V, L189Q, A331S and R472C amino acid substitutions, the numbering of amino acid residues being in accordance with that of SEQ ID NO:6, and a second nucleic acid segment (B), comprising a gene having the nucleotide sequence set forth as SEQ ID NO:3 or having a nucleotide sequence at least 95% identical to the nucleotide sequence set forth as SEQ ID NO:3 and which codes for a plant O-methyltransferase that catalyzes the conversion of eriodictyol to hesperetin, whereby the flavanones naringenin and/or naringin are converted to the corresponding flavonoid(s) eriodictyol, homoeriodictyol, hesperetin, sterubin, apigenin, luteolin, diosmetin, and/or chryseriol by the transgenic microorganism, and optionally (b) isolating and purifying the end products.

2. An enzymatic process for the production of flavonoids, comprising the following steps: (a) providing (i) a first CP450 oxidase enzyme that catalyzes the conversion of naringenin to eriodictyol and which comprises A75G, F88V, L189Q, and R472C amino acid substitutions and/or comprises A75G, F88V, L189Q, A331S and R472C amino acid substitutions, the numbering of amino acid residues being in accordance with that of SEQ ID NO:6, and (ii) a second plant O-methyltransferase enzyme encoded by a gene having the nucleotide sequence set forth as SEQ ID NO:3 or a sequence at least 95% identical to the nucleotide sequence set forth as SEQ ID NO:3 and which catalyzes the conversion of eriodictyol to hesperetin, (b) adding one or more flavanones selected from naringenin and naringin to the reaction of (a), (c) converting the flavanones naringenin and/or naringin to the corresponding flavonoid(s) eriodictyol, homoeriodictyol, hesperetin, sterubin, apigenin, luteolin, diosmetin, and/or chryseriol by first and/or the second enzyme, and optionally (d) isolating and purifying the end products.

3. The process of claim 1, wherein the transgenic microorganism comprises a first nucleic acid segment (A), comprising the nucleotide sequence set forth as SEQ ID NO:1 and/or the nucleotide sequence set forth as SEQ ID NO:2 and a second nucleic acid segment (B), comprising a gene coding for a plant O-methyltransferase having the nucleotide sequence set forth as SEQ ID NO:3.

4. The process of claim 1, wherein the gene coding for a bacterial CYP450 oxidase codes for an oxidase from the microorganism Bacillus megaterium.

5. The process of claim 1, wherein the gene coding for a plant O-methyltransferase codes for an O-methyltransferase from the plant genus Mesembryanthemum.

6. The process of claim 1, wherein the microorganism is a facultatively anaerobic microorganism.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 depicts a plasmid pSYM BM3 with CYP450 oxidase gene;

(2) FIG. 2 depicts a plasmid pSYM PFOMT gene coding for O-methyltransferase;

(3) FIG. 3 depicts a plasmid pSYM AtCOMT qene codinq for cation-independent O-methyltransferase;

(4) FIG. 4 shows the biocatalytic transformation from narinqenin to eriodictyol;

(5) FIG. 5 shows the biocatalytic transformation from eriodictyol to homoeriodictyol;

(6) FIG. 6 shows the fermentative transformation from naringenin to homoeriodictyol;

(7) FIG. 7 shows the fermentative transformation from eriodictyol to homoeriodictyol;

(8) FIG. 8 shows the fermentative transformation from narinqenin to eriodictyol;

(9) FIG. 9 shows the isolation of CYP450 oxidase BM3;

(10) FIG. 10 shows isolation of O-methyltransferase PfOMT;

(11) FIG. 11 shows isolation of O-methyltransferase AtCOMT; and

(12) FIG. 12 compares product formation of various variants of BM3.

DESCRIPTION OF THE INVENTION

(13) A first subject-matter of the invention relates to a process for the production of flavonoids, comprising the following steps: (a) Providing a transgenic microorganism, comprising (i) A first nucleic acid fragment (A), comprising or consisting of a gene coding for a CYP450 oxidase, (ii) A second nucleic acid fragment (B), comprising or consisting of a gene coding for a plant O-methyltransferase, and (b) Adding one or more flavanones to the transgenic microorganism, (c) Converting the flavanones contained in the substrate by the transgenic microorganism to the corresponding flavonoids, and, optionally (d) Isolating and purifying the final products.

(14) Surprisingly, it was found that by insertion of two different nucleic acid fragments, which contain a gene coding for a bacterial CYP450 oxidase on the one hand and a gene coding for a plant O-methyltransferase on the other into a suitable microorganism, preferably a facultatively anaerobic microorganism, a system is provided which allows the conversion to flavonoids in short times as well as excellent yields after the addition of flavanones and cultivation.

(15) The process is illustrated by means of the example of homoeriodictoyl produced from naringenin in the following scheme:

(16) ##STR00001##

(17) It was known from the state of the art that naringenin can be converted to eriodicytol by transgenic microorganisms such as, for example, Sacharomyces cerevisiae, creating a flavonoid-3-hydroxylase from Gerbera hydride or a CYP450 oxidase from Phanerochaete chrysosporium (Kasai, N. et al. Enzymatic properties of cytochrome P450 catalyzing 3-hydroxylation of naringenin from the white-rot fungus Phanerochaete chrysosporium. Biochem. Biophys. Res. Commun. 387, 103-8 (2009). However, in this case the conversion was carried out up to eriodictyol only, however, a direct further reaction to obtain homoeriodictyol has not been demonstrated yet.

(18) Further processes for the production of eriodictyol from naringenin are published in Kitamura, E. et al. Production of Hydroxlated Flavonoids with Cytochrome P450 BM3 Variant F88V and Their Antioxidative Activities [Biosci. Biotechnol. Biochem. 77, 1340-1343 (2013)] and Kabumoto, H., Miyazaki, K. & Arisawa, A Directed Evolution of the Actinomycete Cytochrome P450 MoxA (CYP105) for Enhanced Activity [Biosci. Biotechnol. Biochem. 73, 1922-1927 (2009)]. Furthermore, these are not to be understood as (biotechnological) processes for the production of eriodictyol and/or homoeriodictyol within the meaning of the present invention, particularly not as a process (as described above) suitable for the industrial production of eriodictyol and/or homoeriodictyol, as the yields can be estimated to be very small (e.g., 5.2% in Kitamura et al.).

(19) In addition, the methylation of flavonoids using the enzyme O-methyltransferase from Bacillus cereus in which homoeriodictyol is formed from eriodictyol is known from J. Microbiol. Biotech. 16(7), 1090-1096 (2006).

(20) Within the scope of the studies performed in the context of the present invention, it was possible to explain and to characterise critical molecular biological and biochemical principles of biotransformation for the purposes of the process described hereinwith the object of producing eriodictyol and/or homoeriodictyol on an industrial scale.

(21) The state of the art describes various enzymatic systems for the formation of eriodictyol based on caffeic acid (Leonard, E., Yan, Y. & Koffas, M. A. G. Functional expression of a P450 flavonoid hydroxylase for the biosynthesis of plant-specific hydroxylated flavonols in Escherichia coli [Metab. Eng. 8, 172-81 (2006)]. However, these are always based on the biosynthesis path for flavonoids described in plants, wherein naringenin is merely formed as an intermediate product. Further, plant enzymes are used exclusively herein. A synthesis method for the formation of homoeriodicytol or hesperetin based on naringenin is not known yet.

(22) The two international patent applications WO 2006 010117 AI (KOFFAS) and WO 2005 084305 AI (SCHMIDT-DANNERT) describe the application of the heterologous expression for the formation of flavonoids. They (exclusively) describe plant genes which are used for a heterologous expression of various substances (based on L-phenylalanine, tyrosine and cinnamic acid).

(23) Surprisingly, a variant of CYP450 oxidase from Bacillus megaterium was identified in the present invention, which could be produced by heterologous expression, and which hydroxylates naringenin regioselectively at the 3 or 5 position. By means of the additional expression of a O-methyltransferase, the conversion of the intermediately formed eriodictyol to homoeriodictyol was advantageously obtained.

(24) CYP450 OXIDASES

(25) A cytochrome P450 oxidase (CYP450) within the meaning of the present invention is an enzyme which catalyses the reaction flavanone3-hydroxyflavanone. In particular, CYP450 catalyses the reaction of naringenin to obtain eriodictyol (cf. the reaction scheme shown above). Particularly preferred are CYP450 oxidases from the gram-positive bacterium Bacillus megaterium.

(26) Therefore, a process is particularly preferred in which the gene coding for a bacterial CYP450 oxidase codes for an oxidase from the microorganism Bacillus megaterium.

(27) A particular embodiment of the present invention thus relates to a process characterised in that the nucleic acid fragment (A) introduced into the transgenic microorganism comprises or consists of (i-i) A nucleotide sequence according to SEQ ID NO:1 (nucleotide sequence of the gene coding for the A75G/F88V/L189Q/R472C variant of bacterial CYP450 from B. megaterium ATCC 14581) and/or (i-ii) A nucleotide sequence according to SEQ ID NO:2 (nucleotide sequence of the gene coding for the A75G/F88V/L189Q/A331S/R472C variant of bacterial CYP450 from B. megaterium ATCC 14581) and/or (i-iii) A similar nucleotide sequence with a nucleotide sequence identity of 40% or more with SEQ ID NO:1 and/or SEQ ID NO:2, preferably of 50% or more, 60 or more, or 80% or more, particularly preferably of 95% or more.

(28) Another subject-matter of the invention, mutatis mutandis, is a process in which the preferably bacterial CYP450 oxidase contains (i-i) A nucleotide sequence according to SEQ ID NO:1 (nucleotide sequence of the gene coding for the A75G/F88V/L189Q/R472C variant of bacterial CYP450 from B. megaterium ATCC 14581) and/or (i-ii) A nucleotide sequence SEQ ID NO:2 (nucleotide sequence of the gene coding for the A75G/F88V/L189Q/A331S/R472C variant of bacterial CYP450 from B. megaterium ATCC14581) and/or (i-iii) A similar nucleotide sequence with a nucleotide sequence identity of 40% or more with SEQ ID NO:1 and/or SEQ ID NO:2, preferably of 50% or more, 60 or more, or 80% or more, particularly preferably of 95% or more.

(29) Another preferred embodiment of the invention thus relates to a process characterized in that the amino acid fragment (A) introduced into the transgenic microorganism comprises or consists of (i-i) An amino acid sequence according to SEQ ID NO:6 (amino acid sequence of the gene coding for the A75G/F88V/L189Q/R472C variant of bacterial CYP450 from B. megaterium ATCC 14581) and/or (i-ii) An amino acid sequence SEQ ID NO:7 (amino acid sequence of the gene coding for the A75G/F88V/L189Q/A331S/R472C variant of bacterial CYP450 from B. megaterium ATCC 14581) and/or (i-iii) A similar amino acid sequence with an amino acid sequence identity of 40% or more with SEQ ID NO:6 and/or SEQ ID NO:7, preferably, of 50% or more, 60% or more or 80% or more, particularly preferably of 95% or more.

(30) Another subject-matter of the invention, mutatis mutandis, is a process in which the preferably bacterial CYP450 oxidase contains (i-i) An amino acid sequence according to SEQ ID NO:6 (amino acid sequence of the gene coding for the A75G/F88V/L189Q/R472C variant of bacterial CYP450 from B. megaterium ATCC 14581) and/or (i-ii) An amino acid sequence SEQ ID NO:7 (amino acid sequence of the gene coding for the A75G/F88V/L189Q/A331S/R472C variant of bacterial CYP450 from B. megaterium ATCC 14581) and/or (i-iii) A similar amino acid sequence with an amino acid sequence identity of 40% or more with SEQ ID NO:6 and/or SEQ ID NO:7, preferably of 50% or more, 60 or more, or 80% or more, particularly preferably of 95% or more.

(31) Within the scope of the present invention, the nucleic acid and/or amino acid sequence identity is preferably determined using the Smith Waterman algorithm with a gap open penalty of 10, a gap extension penalty of 0.5 and the BLOSUM62 Matrix (for information on the Smith Waterman algorithm see, for example, Smith, T. F. and Waterman, M. S. Identification of common molecular subsequences, Journal of Molecular Biology (1981), 147:195-197; implemented online via the corresponding tool page of the EMBL). The submitted nucleotide sequences were created using the software BISSAP of the European Patent Office pursuant to WIPO Standard 25.

(32) O-Methyltransferases

(33) An O-methyltransferase (OMT) within the meaning of the present invention is an enzyme which catalyses the regiospecific methylation of particular compounds, in particular the transformation from eriodicytol to hesperetin, sterubin and/or homoeriodictyol (cf. the reaction scheme shown above). Particularly preferred are cation-independent O-methyltransferases from Mesembryanthemurn crystallinum or Arabidopsis thaliana.

(34) Expressly preferred is therefore a process in which the gene coding for a plant O-methyltransferase codes for an O-methyltransferase from the plant genus Mesembryanthemum.

(35) Altogether, particular combinations of CYP450 oxidases and O-methyltransferases are preferred, namely those which are produced from the bacterium Bacillis megaterium on the one hand, and from the plants of the species Mesembryanthemum crystallinum or Arabidopsis thaliana on the other.

(36) A further particular embodiment of the invention therefore relates to a process which is characterised in that the nucleic acid fragment (B) introduced into the transgenic microorganism comprises or consists of (ii-i) A nucleotide sequence according to SEQ ID NO:3 (nucleotide sequence of OMT from M. crystallinum (McPFOMT)), and/or (ii-ii) A nucleotide sequence according to SEQ ID NO:4 (nucleotide sequence of O-methyltransferase 1 (OMT1)) and/or (ii-iii) A nucleotide sequence according to SEQ ID NO:5 (nucleotide sequence of O-methyltransferase (AOMT)) and/or (ii-iv) A further nucleotide sequence with a nucleotide sequence identity of 40% or more with SEQ ID NO:3, SEQ ID NO:4 and/or SEQ ID NO:5, preferably of 50% or more, 60% or more, or 80% or more, particularly preferably of 95% or more.

(37) Another subject-matter of the invention, mutatis mutandis, is a process in which the O-methyltransferase contains (ii-i) A nucleotide sequence according to SEQ ID NO:3 (nucleotide sequence of OMT from M. crystallinum (McPFOMT)), and/or (ii-ii) A nucleotide sequence according to SEQ ID NO:4 (nucleotide sequence of O-methyltransferase 1 (OMT1)) and/or (ii-iii) A nucleotide sequence according to SEQ ID NO:5 (nucleotide sequence of O-methyltransferase (AOMT)) and/or (ii-vii) A further nucleotide sequence with a nucleotide sequence identity of 40% or more with SEQ ID NO:3, SEQ ID NO:4 and/or SEQ ID NO:5, preferably of 50% or more, 60% or more, or 80% or more, particularly preferably of 95% or more.
A further particular embodiment of the invention therefore relates to a process which is characterised in that an amino acid fragment (B) introduced into the transgenic microorganism comprises or consists of (ii-i) An amino acid sequence according to SEQ ID NO:8 (amino acid sequence of OMT from M. crystallinum (McPFOMT)), and/or (ii-ii) An amino acid sequence according to SEQ ID NO:9 (amino acid sequence of O-methyltransferase 1 (OMT1)) and/or (ii-iii) An amino acid sequence according to SEQ ID NO:10 (amino acid sequence of O-methyltransferase (AOMT)) and/or (ii-iv) A further amino acid sequence with an amino acid sequence identity of 40% or more with SEQ ID NO:8, SEQ ID NO:9 and/or SEQ ID NO:10, preferably, of 50% or more, 60% or more, or 80% or more, particularly preferably of 95% or more.

(38) Another subject-matter of the invention, mutatis mutandis, is a process in which the O-methyltransferase contains (ii-i) An amino acid sequence according to SEQ ID NO:8 (amino acid sequence of the OMT from M. crystallinum (McPFOMT)), and/or (ii-ii) An amino acid sequence according to SEQ ID NO:9 (amino acid sequence of the O-methyltransferase 1 (OMT1)) and/or (ii-iii) An amino acid sequence according to SEQ ID NO:10 (amino acid sequence of the O-methyltransferase (AOMT)) and/or (ii-vii) A further amino acid sequence with an amino acid sequence identity of 40% or more with SEQ ID NO:8, SEQ ID NO:9 and/or SEQ ID NO:10, preferably of 50% or more, 60% or more or 80% or more, particularly preferably of 95% or more.

(39) Flavanones

(40) The one, several, or all of the flavanones or their preliminary stages or derivatives to be used according to the invention are preferably selected from the group consisting of: naringenin, naringin, narirutin, or other naturally occurring or synthetically produced naringenin glycosides, sakuranetin, sakuranetin glycosides, isosakuranetin, isosakuranetin glycosides, 4,7-dihydroxyflavanone or its glycosides, 4,7-dihydroxy-3-methoxyflavanone or its glycosides, 3,7-dihydroxy-4-methoxyflavanone or its glycosides, 3,4,7-trihydroxyflavanone or its glycosides, wherein the flavanones may be present as (S)-, as (R)-enantiomer, as racemate or as any mixture of the two enantiomers with regard to the 2-position of the flavanone structure.

(41) In the following, some of the preferably used flavanones are exemplarily depicted:

(42) ##STR00002## ##STR00003## ##STR00004## ##STR00005##

(43) The flavonoids to be produced according to the invention are preferably selected from the group consisting of: eriodictyol and the glycosides thereof (e.g., eriocitrin, neoeriocitrin), homoeriodictyol and the glycosides thereof, sterubin and the glycosides thereof, hesperidin, hesperetin and other hesperetin glycosides (e.g., neohesperidin), apigenin and the glycosides thereof, luteolin, diosmetin, chrysoeriol.

(44) In the following, particularly preferred flavonoids according to the invention are depicted:

(45) ##STR00006## ##STR00007##

(46) Particularly preferred flavanones and the respective flavonoids formed thereof are: naringenin and eriodictyol, naringenin and homoeriodictyol, naringenin and sterubin, naringenin and hesperetin, naringin and eriodictyol, naringin and homoeriodictyol, naringin and hesperetin, naringenin and apigenin, naringenin and luteolin, naringenin and sterubin, naringenin and diosmetin, naringenin and chryseriol, naringin and luteolin, naringin and sterubin, naringin and diosmetin, and naringin and chryseriol.

(47) Cultivation; Expression and Isolation

(48) As described above, in step (ii) of a process according to the invention, one or more flavanones are added to the transgenic microorganism, wherein the transgenic microorganism is cultivated under conditions that enable the transformation of the flavanone(s).

(49) According to a preferred way of carrying out the process according to the invention, the transgenic microorganisms are initially, i.e. before step (ii), cultivated under anaerobic conditions, preferably up to reaching a maximum biomass concentration. In doing so, the OD.sub.600 should preferably be at least in the range of from 1 to 15 or above, preferably in the range of from 5 to 300, particularly in the range of from 10 to 275, preferably in the range of from 15 to 250. Subsequently, in step (ii), the microorganisms are preferably cultivated under anaerobic conditions, in the process of which the expression of the desired amino acid sequences or of the desired enzymes is performed on the basis of the introduced nucleic acid fragments or the introduced transgenes, for example, stimulated by means of an induction by IPTG and/or lactose (when using a corresponding suitable promoter or a corresponding, suitable expression system).

(50) In principle, it is preferred according to the invention if the incubation in step (ii) is performed under anaerobic conditions, at least partly or completely.

(51) Depending on the microorganism, the skilled person may, in step (ii), create ambient conditions that are suitable for the purposes of the present invention, providing a suitable (cultivation) medium in particular. Cultivation is, preferably, performed in LB or TB medium. Alternatively, a (more complex) medium, consisting of or comprising plant-based materials, particularly from citrus, grapefruit, and orange plants, may be used. For example, cultivation is performed at a temperature of more than 20 C., preferably of more than 25 C., particularly of more than 30 C. (preferably in the range of from 30 to 40 C.), which may promote the formation of homoeriodictyol from naringenin in particular, or may increase the yield. Further, also a temperature for induction (cf. above) of less than 40 C., particularly of less than 35 C. (particularly in the range of from 20 to 30 C.), may promote the formation of homoeriodictyol or increase the yield.

(52) The flavonoids are added to the transgenic microorganism in step (ii), preferably in an amount of from 0.1 mM to 100 mM (mMol/L), preferably of from 0.5 to 95 mM, particularly preferably of from 1 to 90 mM based on the (cultivation) medium containing the transgenic microorganisms. Here, suitable (co-)solvents may be used.

(53) In case that one or more inductors, e.g., IPTG or lactose are used for induction (e.g., of lac operon), it is preferred to use, in step (ii), the inductor in an amount of from 0.001 to 1 mM, preferably of from 0.005 to 0.9 mM, particularly preferred of from 0.01 to 0.8 mM based on the (cultivation) medium containing the transgenic microorganisms, as particularly good yields may be achieved in this case.

(54) Extractions may be performed, for example, with organic solvents in order to isolate or purify the expressed flavonoids. These are preferably selected from the following list: isobutane, 2-propanol, toluol, methyl acetate, cyclohexane, 2-butanol, hexane, 1-propanol, light petroleum, 1,1,1,2-tetrafluoroethane, methanol, propane, 1-butanol, butane, ethyl methyl ketone, ethyl acetate, diethyl ether, ethanol, dibutyl ether, CO2, tert. butyl methyl ether, acetone, dichloromethane and N2O. Particularly preferred are those solvents which form a visually perceivable phase boundary with water. Accordingly, a removal of the residual water within the solvent and the removal of the solvent itself may suggest itself, which may be followed by re-dissolving the dihydrochalcone in an (optionally other) solvent which may be suitable, for example, for any optional subsequent crystallisation and drying of the product. Alternatively or additionally, an adsorptive, distillative and/or chromatographic purification may be performed.

(55) Alternatively, methods for drying, particularly methods of vacuum belt drying, spray drying, destillation or lyphilisation of the cell-containing or cell-free fermentation solution may be used in order to isolate or purify the formed flavonoids.

(56) Transgenic Microorganisms

(57) In the context of the present invention, a transgenic microorganism is to be understood as a genetically changed or modified microorganism, into which nucleic acid fragments (see nucleic acid fragments (A) and (B) as described herein) or genes of another organism (so-called transgenes) have been selectively introduced by means of biotechnological processes.

(58) A further subject-matter of the invention thus comprises a transgenic microorganism, containing (i) A first nucleic acid fragment (A), containing a gene coding for a bacterial CYP450 oxidase, and (ii) A second nucleic acid fragment (B), containing a gene coding for a plant O-methyltransferase.

(59) This is preferably a microorganism selected from the group consisting of facultatively anaerobic microorganisms, particularly, of facultatively anaerobic bacteria, preferably proteobacteria, particlarly, enterobacteria, for example, of the genus Escherichia, preferably, E. coli, particularly, E. coli K12, E. coli BL21 and E. coli MG1655 and their derivatives, yeasts, for example, S. cerevesiae and P. pastoris, K. lactis, H. polymorpha, and fungi such as Aspergillus spp. or Trichoderma spp.

(60) The transgenic microorganism according to the invention is particularly characterised in that (i) The gene coding for a CYP450 oxidase codes for a CYP450 oxidase from the microorganism Bacillus megaterium (BM3), preferably for the F88V variant of BM3, particularly for the A75G/F88V variant of BM3, particularly preferably for the variant A75G/F88V/L189Q/R472C of BM3, or for the variant A75G/F88V/L189Q/A331S/R472C of BM3, and/or (ii) The gene coding for an O-methyltransferase codes for an O-methyltransferase from a plant of the order Brassicales, preferably from the Brassicaceae family, preferably from the Camelineae sub-family, particularly, the genus of Arabidopsis, especially the species Arabidopsis thaliana, or from the order Caryophyllales, preferably, the family Aizoaceae, preferably, the sub-family Mesembryanthemoideae, particularly, the genus Mesembryanthemum, especially from the species Mesembryanthemum crystallinum, i.e., particularly preferred for an O-methyltransferase from M. thaliana or M. crystallinum.

(61) Methods to enable an expression of the desired amino acid sequences or of the desired enzymes on the basis of the introduced nucleic acid fragments or transgenes are sufficiently known to the skilled person, e.g., using a regulatory element, particularly a promotor.

(62) Vector

(63) A further aspect of the present invention relates to a vector, i.e. a transport vehicle (gene shuttle) for the transfer of (a) foreign nucleic acid(s) into a recipient cell, particularly a plasmid vector, enabling the cloning of one or more nucleic acid fragments, containing (i) A first nucleic acid fragment (A), containing a gene coding for a bacterial CYP450 oxidase, and (ii) A second nucleic acid fragment (B), containing a gene coding for a plant O-methyltransferase.

(64) The invention also comprises a vector, preferably a plasmid vector, characterised in that it has (i) A first nucleic acid fragment (A), containing a gene coding for a bacterial CYP450 oxidase, and (ii) A second nucleic acid fragment (B), containing a gene coding for a plant O-methyltransferase.

(65) Besides the nucleic acid fragment(s) (A) and (B), a vector according to the invention may optionally contain further common components for the purposes of the present invention, particularly those improving or, where necessary, enabling the expression of the transgenes described herein in microorganisms, particularly in those as described above. In principle, a vector according to the invention preferably also contains one or more further components or elements selected from the group consisting of promotor, on-sequence, sequence for affinity chromatographic purification, selectable markers, operator sequence, terminator, ribosomal binding sites, protease cleavage sequence, recombination binding sites, sequences of fusion proteins and chaperone sequences.

(66) Host Cell

(67) The present invention also relates to a host cell, containing one or more identical or different vectors according to the invention as described herein.

(68) A host cell according to the invention is preferably a microorganism (as described above) according to the invention or a microorganism to be used according to the invention. The host cells according to the invention described herein, or the microorganisms according to the invention, or microorganisms to be used according to the invention preferably are or serve as a (production) strain for the biotechnological production of the flavonoids described herein, particularly of eriodictyol, hesperetin, sterubin and/or homoeriodictyol.

(69) Preparations

(70) By means of the process according to the invention, flavanones may thus be converted to flavonoids using biotechnological methods, and are characterised in that they taste less bitter and more sweet than the original preparation, and are permitted to be designated as natural or nature-identical at the same time.

(71) Therefore, a further subject-matter of the invention is directed to food preparations, containing flavonoids obtained according to the process according to the invention or a process for improving the taste of the flavanone-containing food, comprising the conversion of the food by the process described above.

(72) The flavanone-containing foods or preparations suitable for food production such obtained are then converted by the process according to the invention to flavanoid-containing preparations which may be designated as natural and may then be used as such or, after removal of the host cell and/or its components and optional concentration by means of physical processes, as a preparation suitable for food production, preferably as a preparation suitable for food production with a bitter-masking or sweet-enhancing effect.

(73) Examples for suitable foods particularly comprise confectionary (for example, chocolates, chocolate bar products, other bar products, fruit gum, hard and soft caramels, chewing gum) alcoholic or nonalcoholic beverages (e.g. coffee, tea, wine, wine-containing beverages, beer, beer-containing beverages, liqueurs, schnapps, brandies, (carbonated) fruit-containing lemonades, (carbonated) isotonic beverages, (carbonated) soft drinks, nectars, spritzers, fruit and vegetable juices, fruit or vegetable juice preparations and instant beverages (for example, instant cocoa beverages, instant tea beverages, instant coffee beverages, instant fruit beverages).

(74) Herein, citrus juices, particularly orange juices which contain a high content in naringin and which may be converted by the process according to the invention to flavonoid-containing orange juices according to the invention are particularly preferred as flavanone-containing foods.

EXAMPLES

Example 1

(75) Providing Transgenic Microorganisms (cf. Step (i))

(76) Transformation

(77) 50 l aliquoted chemically competent E. coli BL21(DE) cells were incubated on ice for 5 minutes. After adding 100 ng plasmid DNA (pSYM_BM3), the suspension was stirred and incubated on ice for a further 10 minutes. The transformation was performed by transferring the suspension to a water bath at 42 C. for 30 s, and subsequently to ice water for 5 min. Then, 250 l S.O.C. medium was added, and the cells were cultivated at 37 C. and 200 rpm for 1 h. Finally, 200 l of the culture was spread on LB agar containing the corresponding antibiotic. The petri dish was incubated at 37 C. for 14 h.

(78) Mutagenesis

(79) The QuikChange II Site-Directed Mutagenesis Kit by the company Agilent was used. By means of specific primers (Table 1), which contain the desired mutation including flanking unmodified regions, a PCR was performed using the BM3 plasmid DNA. Subsequently, the PCR reaction mixture was placed on ice for 2 minutes. Then, 10 U Dpn I was added, in the process of which the reaction is incubated at 37 C. for 1 h. The primer sequences for the mutagenesis are shown in Table 1.

(80) TABLE-US-00001 TABLE1 Primersequencesformutagenesis BM3_75G_fwd TTGATAAAAACTTAAGTCAAGGTCTTAAAT TTGTACGTGATTT BM3_75G_rev AAA|CACG|ACAAA|1|AAGACC||GAC|| AAG|111|A|CAA BM3_189Q_fwd TGGATGAAGCAATGAACAAGCAGCAGCGAG CAAATCCAGACGA BM3_189Q_rev TCGTCTGGATTTGCTCGCTGCTGCTTGTTC ATTGCTTCATCCA BM3_331S_fwd TATGGCCAACTGCTCCTTCGTTTTCCCTAT BM3_331S_rev ATAGGGAAAACGAAGGAGCAGTTGGCCATA

Example 2

(81) Biotechnological Production of Eriodictyol (cf. Step (ii))

(82) Enzymatic Production of Eriodicytol

(83) 200 M naringenin were dissolved in 50 mM tris-buffered saline, pH 7.5, and incubated together with 5 mM glucose 6-phosphate, 14 U glucose 6-phosphate dehydrogenase, 100 M NADPH and 50 L cell extract (0.5-1 M CYP450) in a total volume of 1 mL for 14 h at 25 C. and 200 rpm. Subsequently, the reaction solution was extracted twice with 500 L ethyl acetate, in the process of which the organic phases were combined and the solvent was removed in vacuum.

(84) Fermentative Production of Eriodicytol

(85) E. coli BL21 (DE3) cells transformed with pSYM_BM3 were cultivated in LB medium up to an optical density at 600 nm of 0.7, and the protein production was induced by adding 1 mM Isopropyl--D-thiogalactopyranoside. After an incubation time of 3 h, the cultures were directly reacted with 200 M eriodictyol and incubated for 14 h at 37 C. The cultures were centrifuged at 20,000g for 10 min and extracted with the triple volume of ethyl acetate, the organic phase was washed with a saturated sodium chloride solution, and the solvent was destilled in vacuum.

Example 3

(86) Biotechnological Production of Homoeriodictyol and/or Hesperetin (cf. Step (ii))

(87) Enzymatic Production of Homoeriodicytol

(88) 20 M eriodicytol were dissolved in 50 mM potassium phosphate buffer, pH 7.5 and incubated together with 1 M PfOMT, 250 M magnesium chloride and 1 mM S-adenosylmethionine at 37 C. and 200 rpm for 10 minutes. Subsequently, the reaction solvent was extracted twice with 500 L ethyl acetate, in the process of which the organic phases were combined and the solvent was removed in vacuum.

(89) Fermentative Production of Homoeriodicytol (cf. Step (ii))

(90) Cells transformed with pSYM_BM3 and pSYM_PfOMT were inoculated in ZYM-5052 1:20 with starter culture and 200 M naringenin, and incubated at 38 C. and 200 rpm for 24 h. The course of the optical density, of the gene expression and of the substrate turnover was monitored by regular taking of 1 mL samples. For analysis, the cells were harvested by means of centrifugation at 14.000g for 10 minutes, and lysis was performed by means of 150 L B-PER II reagent (Thermo Scientific, Rockford) with 50 L DNAse I according to manufacturer's indications. The samples obtained were analysed by means of SDS polyacrylamide gel electrophoresis. For analysis of the substrate conversion, 1 mL of the culture were extracted twice with 500 L ethyl acetate, in the process of which the organic phases were combined and the solvent was removed in vacuum. Subsequently, the samples were incorporated into acetonitrile and analysed by means of HPLC and UPLC-MS/MS.

(91) Enzymatic Production of Hesperetin

(92) 20 M eriodicytol were dissolved in 50 mM potassium phosphate buffer, pH 7.5 and incubated together with 1 M AOMT, 250 M Magnesiumchlorid and 1 mM S-adenosylmethionine at 37 C. and 200 rpm for 10 minutes. Subsequently, the reaction solution was extracted twice with 500 L ethyl acetate, in the process of which the organic phases were combined and the solvent was removed in vacuum.

(93) Fermentative Production of Hesperetin

(94) Cells transformed with pSYM_BM3 and pSYM_AOMT were inoculated in ZYM-5052 1:20 with starter culture as well as with 200 M naringenin and incubated at 38 C. and 200 rpm for 24 h. The course of the optical density, of the gene expression and of the substrate turnover was monitored by regular taking of 1 mL samples. For analysis, the cells were harvested by means of centrifugation at 14,000g for 10 minutes, and lysis was performed by means of 150 L B-PER II reagent (Thermo Scientific, Rockford) with 50 L DNAse I according to manufacturer's indications. The samples obtained were analysed by means of SDS polyacrylamide gel electrophoresis. For analysis of the substrate conversion, 1 mL of the culture was extracted twice with 500 L ethyl acetate, in the process of which the organic phases were combined and the solvent was removed in vacuum. Subsequently, the samples were incorporated into acetonitril and analysed by means of HPLC and UPLC-MS/MS.