Detecting esophageal disorders

10435755 ยท 2019-10-08

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein is technology for esophageal disorder screening and particularly, but not exclusively, to methods, compositions, and related uses for detecting the presence of esophageal disorders (e.g., Barrett's esophagus, Barrett's esophageal dysplasia, etc.). In addition, the technology provides methods, compositions and related uses for distinguishing between Barrett's esophagus and Barrett's esophageal dysplasia, and between Barrett's esophageal low-grade dysplasia, Barrett's esophageal high-grade dysplasia, and esophageal adenocarcinoma within samples obtained through endoscopic brushing or nonendoscopic whole esophageal brushing or swabbing using a tethered device (e.g. such as a capsule sponge, balloon, or other device).

Claims

1. A method for measuring the methylation level of no more than ten genetic markers at least including ELMO1 and CD1D comprising: a) extracting genomic DNA from a biological sample of a human individual suspected of having or having Barrett's esophageal dysplasia and/or esophageal adenocarcinoma, b) treating the extracted genomic DNA with bisulfite, c) amplifying the bisulfite-treated genomic DNA with primers consisting of a pair of primers specific for ELMO1 and a pair of primers specific for CD1D, and d) measuring the methylation level of no more than ten genetic markers at least including ELMO1 and CD1D by measuring the methylation of CpG sites in the genetic markers by methylation-specific PCR, quantitative methylation-specific PCR, methylation sensitive DNA restriction enzyme analysis or bisulfite genomic sequencing PCR.

2. The method of claim 1, wherein the biological sample comprises esophageal tissue obtained through whole esophageal swabbing or brushing.

3. The method of claim 1, wherein the sample is a stool sample, a tissue sample, a blood sample, or a urine sample.

4. The method of claim 1 wherein the pair of primers specific for ELMO1 consists of SEQ ID Nos: 11 and 12 and the pair of primers specific for CD1D consists of SEQ ID NO: 9 and 10.

5. A method, comprising a) obtaining a sample comprising DNA from a human individual suspected of having or having Barrett's esophageal dysplasia and/or esophageal adenocarcinoma, b) treating the obtained DNA with a reagent which selectively modifies unmethylated cytosine residues in the obtained DNA to produce modified residues but which does not modify methylated cytosine residues; c) measuring the methylation level of no more than ten genetic markers at least including ELMO1 and CD1D in the DNA having the treating of step b).

6. The method of claim 5 wherein the treating of step b) is accomplished through bisulfite modification of the obtained DNA.

7. The method of claim 5 wherein said measuring the methylation level of no more than ten genetic markers at least including ELMO1 and CD1D in the DNA having undergone the treating of step b) is achieved by a technique selected from the group consisting of methylation-specific PCR, quantitative methylation-specific PCR, methylation-sensitive DNA restriction enzyme analysis, quantitative bisulfite pyrosequencing, and bisulfite genomic sequencing PCR.

8. The method of claim 5 wherein the sample comprises esophageal tissue, wherein the esophageal tissue is obtained through whole esophageal swabbing or brushing or use of a sponge capsule device.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1: Positivity rates of a 3-marker panel (DIO3, MAX20.218, NDRG4) (Table 5) in tissue DNA from BE subgroups without dysplasia and with different seventies of dysplasia (Examples I, II, III and IV).

(2) FIG. 2: Methylated DNA marker levels (PCR copies/20 ng DNA) in BE cases and normal (Nl) controls from Phase 2 (endoscopic brush study) (Example V).

(3) FIG. 3: Hit Matrix of Top Methylated DNA markers from Phase 2 highlighting complementarity (endoscopic brush study) (Example V).

(4) FIG. 4: Methylated DNA marker levels (PCR copies/30 ng DNA) in BE cases and normal (Nl) controls from Phase 3 (capsule sponge study) (Example V).

DETAILED DESCRIPTION

(5) Barrett's esophagus (BE) is the strongest risk factor for and only known precursor for esophageal adenocarcinoma (EAC), a lethal malignancy with poor survival (<20% at 5 years) when detected after the onset of symptoms (see, Nelsen E M, et al., The Surgical clinics of North America 2012; 92:1135-54). The incidence of esophageal adenocarcinoma has increased by almost 600% in the last three decades in the population (see, Hur C, et al., Cancer 2013; 119:1149-58). BE progresses to EAC through a step-wise pathway from no dysplasia, to low grade dysplasia (LGD) to high grade dysplasia (HGD) to carcinoma. This metaplasia to dysplasia to carcinoma sequence has prompted several national gastroenterology societies to recommend screening for BE in high risk subjects with multiple risk factors followed by endoscopic surveillance (depending on the grade of dysplasia) to detect the development of dysplasia or carcinoma at an early stage (see, Spechler S J, et al., Gastroenterology 2011; 140:e18-52; Wang K K, et al., Am J Gastroenterol 2008; 103:788-97; Fitzgerald R C, et al., Gut 2014; 63:7-42). Endoscopic treatments of LGD, HGD and early carcinoma have been developed and shown to be effective in reducing the incidence of carcinoma and improving survival in BE subjects (see, e.g., Prasad G A, et al., Gastroenterology 2007; 132:1226-33; Prasad G A, et al., Gastroenterology 2009; Shaheen N J, et al., N Engl J Med 2009; 360:2277-88; Phoa K N, et al., JAMA 2014; 311:1209-17).

(6) Screening for BE is currently performed using conventional sedated endoscopy (sEGD) which reveals the replacement of the normal squamous lining of the esophagus by metaplastic columnar epithelium in subjects with BE. However sedated endoscopy is expensive with both direct and indirect costs and not suitable for widespread application. It is also associated with potential complications (see, Sami S S, et al., Clinical gastroenterology and hepatology: the official clinical practice journal of the American Gastroenterological Association 2015; 13:623-34). Other techniques such as unsedated transnasal endoscopy (uTNE) have comparable accuracy to sEGD with lower cost, but continue to be poorly regarded as a widely applicable tool by providers (see, Sami S S, et al., The American journal of gastroenterology 2015; 110:148-58; Peery A F, et al., Gastrointestinal endoscopy 2012; 75:945-953 e2; Atkinson M, et al., Gastroenterology & hepatology 2007; 4:426-7). Despite adequate access to the uTNE device the utilization of uTNE by referring physicians remains limited (see, Atkinson M, et al., The American journal of gastroenterology 2008; 103:92-7). The absence of accurate risk stratification tools to determine BE risk and target screening efforts are additional limitations to a widely applicable BE screening (see, Sami S S, et al., Clinical gastroenterology and hepatology: the official clinical practice journal of the American Gastroenterological Association 2015; 13:623-34).

(7) Endoscopic detection of dysplasia is currently performed using four quadrant random biopsies every 1-2 cm of the BE segment in addition to careful inspection of the BE segment with high resolution white light imaging and advanced imaging techniques. While this has been recommended by GI societies (see, e.g., Spechler S J, et al., Gastroenterology 2011; 140:e18-52; Wang K K, et al., Am J Gastroenterol 2008; 103:788-97; Fitzgerald R C, et al., Gut 2014; 63:7-42, the compliance with these recommendations amongst practicing gastroenterologists remains poor (see, Abrams J A, et al., Clin Gastroenterol Hepatol 2009). Indeed compliance decreases with increasing BE segment length leading to increasing rates of missed dysplasia. Other challenges with dysplasia detection in BE include the spotty distribution of dysplasia in BE (see, Cameron A J, et al., Am J Gastroenterol 1997; 92:586-91) which leads to sampling error, poor inter-observer agreement amongst pathologists while grading dysplasia and the relatively poor sensitivity of current surveillance strategies in detecting prevalent dysplasia or carcinoma (see, Sharma P, et al., Gastroenterology 2004; 127:310-30). The utility of advanced imaging techniques in the community remains unclear with only a third of practicing gastroenterologists reporting use routinely in BE surveillance (see, Singh M, et al., Gastrointestinal endoscopy 2013; 78:689-95). Recently a sponge on a string device has been studied in BE screening (see, Kadri S R, et al., Bmj 2010; 341:c4372). This device consists of a polyurethane foam sponge compressed in a gelatin capsule, attached to a string. The capsule is swallowed by the patient. The gelatin shell of the capsule dissolves in the gastric fluid releasing the foam device as a sphere which is then pulled out with the attached string, providing brushing/cytology samples of the proximal stomach and esophagus. Biomarker studies can then be performed on these samples to detect BE. Two large multicenter studies have been performed in the United Kingdom with such a device using trefoil factor 3 (a protein specific to BE epithelium) detected on immunohistochemistry as a BE marker, demonstrating the feasibility, safety and accuracy of this approach (see, Kadri S R, et al., Bmj 2010; 341:c4372; Ross-Innes C S, et al., PLoS medicine 2015; 12:e1001780). The sensitivity and specificity of this marker in the detection of BE has been reported to be 73% and 94% for BE segments of >1 cm in circumferential length. Additionally this capsule sponge device has been used safely in a study conducted at Mayo Clinic Rochester in subjects with eosinophilic esophagitis (see, Katzka D A, et al., Clinical gastroenterology and hepatology: the official clinical practice journal of the American Gastroenterological Association 2015; 13:77-83 e2). Methylated DNA markers specific to BE epithelium (with and without dysplasia) have been described (see, Kaz A M, et al., Cancer letters 2014; 342:193-9; Ahlquist D A, et al., Clinical gastroenterology and hepatology: the official clinical practice journal of the American Gastroenterological Association 2012; 10:272-7 e1).

(8) Provided herein is technology for esophageal disorder screening and particularly, but not exclusively, to methods, compositions, and related uses for detecting the presence of esophageal disorders (e.g., Barrett's esophagus, Barrett's esophageal dysplasia, etc.). In addition, the technology provides methods, compositions and related uses for distinguishing between Barrett's esophagus and Barrett's esophageal dysplasia, and between Barrett's esophageal low-grade dysplasia, Barrett's esophageal high-grade dysplasia, and esophageal adenocarcinoma within samples obtained through whole esophageal swabbing or brushing or use of a sponge capsule device.

(9) As the technology is described herein, the section headings used are for organizational purposes only and are not to be construed as limiting the subject matter in any way.

(10) In this detailed description of the various embodiments, for purposes of explanation, numerous specific details are set forth to provide a thorough understanding of the embodiments disclosed. One skilled in the art will appreciate, however, that these various embodiments may be practiced with or without these specific details. In other instances, structures and devices are shown in block diagram form. Furthermore, one skilled in the art can readily appreciate that the specific sequences in which methods are presented and performed are illustrative and it is contemplated that the sequences can be varied and still remain within the spirit and scope of the various embodiments disclosed herein.

(11) All literature and similar materials cited in this application, including but not limited to, patents, patent applications, articles, books, treatises, and internet web pages are expressly incorporated by reference in their entirety for any purpose. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which the various embodiments described herein belongs. When definitions of terms in incorporated references appear to differ from the definitions provided in the present teachings, the definition provided in the present teachings shall control.

Definitions

(12) To facilitate an understanding of the present technology, a number of terms and phrases are defined below. Additional definitions are set forth throughout the detailed description.

(13) Throughout the specification and claims, the following terms take the meanings explicitly associated herein, unless the context clearly dictates otherwise. The phrase in one embodiment as used herein does not necessarily refer to the same embodiment, though it may. Furthermore, the phrase in another embodiment as used herein does not necessarily refer to a different embodiment, although it may. Thus, as described below, various embodiments of the invention may be readily combined, without departing from the scope or spirit of the invention.

(14) In addition, as used herein, the term or is an inclusive or operator and is equivalent to the term and/or unless the context clearly dictates otherwise. The term based on is not exclusive and allows for being based on additional factors not described, unless the context clearly dictates otherwise. In addition, throughout the specification, the meaning of a, an, and the include plural references. The meaning of in includes in and on.

(15) As used herein, a nucleic acid or nucleic acid molecule generally refers to any ribonucleic acid or deoxyribonucleic acid, which may be unmodified or modified DNA or RNA. Nucleic acids include, without limitation, single- and double-stranded nucleic acids. As used herein, the term nucleic acid also includes DNA as described above that contains one or more modified bases. Thus, DNA with a backbone modified for stability or for other reasons is a nucleic acid. The term nucleic acid as it is used herein embraces such chemically, enzymatically, or metabolically modified forms of nucleic acids, as well as the chemical forms of DNA characteristic of viruses and cells, including for example, simple and complex cells.

(16) The terms oligonucleotide or polynucleotide or nucleotide or nucleic acid refer to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and usually more than ten. The exact size will depend on many factors, which in turn depends on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. Typical deoxyribonucleotides for DNA are thymine, adenine, cytosine, and guanine. Typical ribonucleotides for RNA are uracil, adenine, cytosine, and guanine.

(17) As used herein, the terms locus or region of a nucleic acid refer to a subregion of a nucleic acid, e.g., a gene on a chromosome, a single nucleotide, a CpG island, etc.

(18) The terms complementary and complementarity refer to nucleotides (e.g., 1 nucleotide) or polynucleotides (e.g., a sequence of nucleotides) related by the base-pairing rules. For example, the sequence 5-A-G-T-3 is complementary to the sequence 3-T-C-A-5. Complementarity may be partial, in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be complete or total complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands effects the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions and in detection methods that depend upon binding between nucleic acids.

(19) The term gene refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of an RNA, or of a polypeptide or its precursor. A functional polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence as long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signal transduction, etc.) of the polypeptide are retained. The term portion when used in reference to a gene refers to fragments of that gene. The fragments may range in size from a few nucleotides to the entire gene sequence minus one nucleotide. Thus, a nucleotide comprising at least a portion of a gene may comprise fragments of the gene or the entire gene.

(20) The term gene also encompasses the coding regions of a structural gene and includes sequences located adjacent to the coding region on both the 5 and 3 ends, e.g., for a distance of about 1 kb on either end, such that the gene corresponds to the length of the full-length mRNA (e.g., comprising coding, regulatory, structural and other sequences). The sequences that are located 5 of the coding region and that are present on the mRNA are referred to as 5 non-translated or untranslated sequences. The sequences that are located 3 or downstream of the coding region and that are present on the mRNA are referred to as 3 non-translated or 3 untranslated sequences. The term gene encompasses both cDNA and genomic forms of a gene. In some organisms (e.g., eukaryotes), a genomic form or clone of a gene contains the coding region interrupted with non-coding sequences termed introns or intervening regions or intervening sequences. Introns are segments of a gene that are transcribed into nuclear RNA (hnRNA); introns may contain regulatory elements such as enhancers. Introns are removed or spliced out from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA) transcript. The mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.

(21) In addition to containing introns, genomic forms of a gene may also include sequences located on both the 5 and 3 ends of the sequences that are present on the RNA transcript. These sequences are referred to as flanking sequences or regions (these flanking sequences are located 5 or 3 to the non-translated sequences present on the mRNA transcript). The 5 flanking region may contain regulatory sequences such as promoters and enhancers that control or influence the transcription of the gene. The 3 flanking region may contain sequences that direct the termination of transcription, posttranscriptional cleavage, and polyadenylation.

(22) The term wild-type when made in reference to a gene refers to a gene that has the characteristics of a gene isolated from a naturally occurring source. The term wild-type when made in reference to a gene product refers to a gene product that has the characteristics of a gene product isolated from a naturally occurring source. The term naturally-occurring as applied to an object refers to the fact that an object can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by the hand of a person in the laboratory is naturally-occurring. A wild-type gene is often that gene or allele that is most frequently observed in a population and is thus arbitrarily designated the normal or wild-type form of the gene. In contrast, the term modified or mutant when made in reference to a gene or to a gene product refers, respectively, to a gene or to a gene product that displays modifications in sequence and/or functional properties (e.g., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.

(23) The term allele refers to a variation of a gene; the variations include but are not limited to variants and mutants, polymorphic loci, and single nucleotide polymorphic loci, frameshift, and splice mutations. An allele may occur naturally in a population or it might arise during the lifetime of any particular individual of the population.

(24) Thus, the terms variant and mutant when used in reference to a nucleotide sequence refer to a nucleic acid sequence that differs by one or more nucleotides from another, usually related, nucleotide acid sequence. A variation is a difference between two different nucleotide sequences; typically, one sequence is a reference sequence.

(25) Amplification is a special case of nucleic acid replication involving template specificity. It is to be contrasted with non-specific template replication (e.g., replication that is template-dependent but not dependent on a specific template). Template specificity is here distinguished from fidelity of replication (e.g., synthesis of the proper polynucleotide sequence) and nucleotide (ribo- or deoxyribo-) specificity. Template specificity is frequently described in terms of target specificity. Target sequences are targets in the sense that they are sought to be sorted out from other nucleic acid. Amplification techniques have been designed primarily for this sorting out.

(26) Amplification of nucleic acids generally refers to the production of multiple copies of a polynucleotide, or a portion of the polynucleotide, typically starting from a small amount of the polynucleotide (e.g., a single polynucleotide molecule, 10 to 100 copies of a polynucleotide molecule, which may or may not be exactly the same), where the amplification products or amplicons are generally detectable. Amplification of polynucleotides encompasses a variety of chemical and enzymatic processes. The generation of multiple DNA copies from one or a few copies of a target or template DNA molecule during a polymerase chain reaction (PCR) or a ligase chain reaction (LCR; see, e.g., U.S. Pat. No. 5,494,810) are forms of amplification. Additional types of amplification include, but are not limited to, allele-specific PCR (see, e.g., U.S. Pat. No. 5,639,611), assembly PCR (see, e.g., U.S. Pat. No. 5,965,408), helicase-dependent amplification (see, e.g., U.S. Pat. No. 7,662,594), Hot-start PCR (see, e.g., U.S. Pat. Nos. 5,773,258 and 5,338,671), intersequence-specific PCR, inverse PCR (see, e.g., Triglia, et al et al. (1988) Nucleic Acids Res., 16:8186), ligation-mediated PCR (see, e.g., Guilfoyle, R. et al., Nucleic Acids Research, 25:1854-1858 (1997); U.S. Pat. No. 5,508,169), methylation-specific PCR (see, e.g., Herman, et al., (1996) PNAS 93(13) 9821-9826), miniprimer PCR, multiplex ligation-dependent probe amplification (see, e.g., Schouten, et al., (2002) Nucleic Acids Research 30(12): e57), multiplex PCR (see, e.g., Chamberlain, et al., (1988) Nucleic Acids Research 16(23) 11141-11156; Ballabio, et al., (1990) Human Genetics 84(6) 571-573; Hayden, et al., (2008) BMC Genetics 9:80), nested PCR, overlap-extension PCR (see, e.g., Higuchi, et al., (1988) Nucleic Acids Research 16(15) 7351-7367), real time PCR (see, e.g., Higuchi, et al et al., (1992) Biotechnology 10:413-417; Higuchi, et al., (1993) Biotechnology 11:1026-1030), reverse transcription PCR (see, e.g., Bustin, S. A. (2000) J. Molecular Endocrinology 25:169-193), solid phase PCR, thermal asymmetric interlaced PCR, and Touchdown PCR (see, e.g., Don, et al., Nucleic Acids Research (1991) 19(14) 4008; Roux, K. (1994) Biotechniques 16(5) 812-814; Hecker, et al., (1996) Biotechniques 20(3) 478-485). Polynucleotide amplification also can be accomplished using digital PCR (see, e.g., Kalinina, et al., Nucleic Acids Research. 25; 1999-2004, (1997); Vogelstein and Kinzler, Proc Natl Acad Sci USA. 96; 9236-41, (1999); International Patent Publication No. WO05023091A2; US Patent Application Publication No. 20070202525).

(27) The term polymerase chain reaction (PCR) refers to the method of K. B. Mullis U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,965,188, that describe a method for increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. This process for amplifying the target sequence consists of introducing a large excess of two oligonucleotide primers to the DNA mixture containing the desired target sequence, followed by a precise sequence of thermal cycling in the presence of a DNA polymerase. The two primers are complementary to their respective strands of the double stranded target sequence. To effect amplification, the mixture is denatured and the primers then annealed to their complementary sequences within the target molecule. Following annealing, the primers are extended with a polymerase so as to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times (i.e., denaturation, annealing and extension constitute one cycle; there can be numerous cycles) to obtain a high concentration of an amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and therefore, this length is a controllable parameter. By virtue of the repeating aspect of the process, the method is referred to as the polymerase chain reaction (PCR). Because the desired amplified segments of the target sequence become the predominant sequences (in terms of concentration) in the mixture, they are said to be PCR amplified and are PCR products or amplicons.

(28) Template specificity is achieved in most amplification techniques by the choice of enzyme. Amplification enzymes are enzymes that, under conditions they are used, will process only specific sequences of nucleic acid in a heterogeneous mixture of nucleic acid. For example, in the case of Q-beta replicase, MDV-1 RNA is the specific template for the replicase (Kacian et al., Proc. Natl. Acad. Sci. USA, 69:3038 [1972]). Other nucleic acid will not be replicated by this amplification enzyme. Similarly, in the case of T7 RNA polymerase, this amplification enzyme has a stringent specificity for its own promoters (Chamberlin et al, Nature, 228:227 [1970]). In the case of T4 DNA ligase, the enzyme will not ligate the two oligonucleotides or polynucleotides, where there is a mismatch between the oligonucleotide or polynucleotide substrate and the template at the ligation junction (Wu and Wallace (1989) Genomics 4:560). Finally, thermostable template-dependant DNA polymerases (e.g., Taq and Pfu DNA polymerases), by virtue of their ability to function at high temperature, are found to display high specificity for the sequences bounded and thus defined by the primers; the high temperature results in thermodynamic conditions that favor primer hybridization with the target sequences and not hybridization with non-target sequences (H. A. Erlich (ed.), PCR Technology, Stockton Press [1989]).

(29) As used herein, the term nucleic acid detection assay refers to any method of determining the nucleotide composition of a nucleic acid of interest. Nucleic acid detection assay include but are not limited to, DNA sequencing methods, probe hybridization methods, structure specific cleavage assays (e.g., the INVADER assay, Hologic, Inc.) and are described, e.g., in U.S. Pat. Nos. 5,846,717, 5,985,557, 5,994,069, 6,001,567, 6,090,543, and 6,872,816; Lyamichev et al., Nat. Biotech., 17:292 (1999), Hall et al., PNAS, USA, 97:8272 (2000), and US 2009/0253142); enzyme mismatch cleavage methods (e.g., Variagenics, U.S. Pat. Nos. 6,110,684, 5,958,692, 5,851,770); polymerase chain reaction; branched hybridization methods (e.g., Chiron, U.S. Pat. Nos. 5,849,481, 5,710,264, 5,124,246, and 5,624,802); rolling circle replication (e.g., U.S. Pat. Nos. 6,210,884, 6,183,960 and 6,235,502); NASBA (e.g., U.S. Pat. No. 5,409,818); molecular beacon technology (e.g., U.S. Pat. No. 6,150,097); E-sensor technology (Motorola, U.S. Pat. Nos. 6,248,229, 6,221,583, 6,013,170, and 6,063,573); cycling probe technology (e.g., U.S. Pat. Nos. 5,403,711, 5,011,769, and 5,660,988); Dade Behring signal amplification methods (e.g., U.S. Pat. Nos. 6,121,001, 6,110,677, 5,914,230, 5,882,867, and 5,792,614); ligase chain reaction (e.g., Barnay Proc. Natl. Acad. Sci USA 88, 189-93 (1991)); and sandwich hybridization methods (e.g., U.S. Pat. No. 5,288,609).

(30) The term amplifiable nucleic acid refers to a nucleic acid that may be amplified by any amplification method. It is contemplated that amplifiable nucleic acid will usually comprise sample template.

(31) The term sample template refers to nucleic acid originating from a sample that is analyzed for the presence of target (defined below). In contrast, background template is used in reference to nucleic acid other than sample template that may or may not be present in a sample. Background template is most often inadvertent. It may be the result of carryover or it may be due to the presence of nucleic acid contaminants sought to be purified away from the sample. For example, nucleic acids from organisms other than those to be detected may be present as background in a test sample.

(32) The term primer refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, that is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product that is complementary to a nucleic acid strand is induced, (e.g., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer, and the use of the method.

(33) The term probe refers to an oligonucleotide (e.g., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantly, or by PCR amplification, that is capable of hybridizing to another oligonucleotide of interest. A probe may be single-stranded or double-stranded. Probes are useful in the detection, identification, and isolation of particular gene sequences (e.g., a capture probe). It is contemplated that any probe used in the present invention may, in some embodiments, be labeled with any reporter molecule, so that is detectable in any detection system, including, but not limited to enzyme (e.g., ELISA, as well as enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. It is not intended that the present invention be limited to any particular detection system or label.

(34) As used herein, methylation refers to cytosine methylation at positions C5 or N4 of cytosine, the N6 position of adenine, or other types of nucleic acid methylation. In vitro amplified DNA is usually unmethylated because typical in vitro DNA amplification methods do not retain the methylation pattern of the amplification template. However, unmethylated DNA or methylated DNA can also refer to amplified DNA whose original template was unmethylated or methylated, respectively.

(35) Accordingly, as used herein a methylated nucleotide or a methylated nucleotide base refers to the presence of a methyl moiety on a nucleotide base, where the methyl moiety is not present in a recognized typical nucleotide base. For example, cytosine does not contain a methyl moiety on its pyrimidine ring, but 5-methylcytosine contains a methyl moiety at position 5 of its pyrimidine ring. Therefore, cytosine is not a methylated nucleotide and 5-methylcytosine is a methylated nucleotide. In another example, thymine contains a methyl moiety at position 5 of its pyrimidine ring; however, for purposes herein, thymine is not considered a methylated nucleotide when present in DNA since thymine is a typical nucleotide base of DNA.

(36) As used herein, a methylated nucleic acid molecule refers to a nucleic acid molecule that contains one or more methylated nucleotides.

(37) As used herein, a methylation state, methylation profile, and methylation status of a nucleic acid molecule refers to the presence of absence of one or more methylated nucleotide bases in the nucleic acid molecule. For example, a nucleic acid molecule containing a methylated cytosine is considered methylated (e.g., the methylation state of the nucleic acid molecule is methylated). A nucleic acid molecule that does not contain any methylated nucleotides is considered unmethylated.

(38) The methylation state of a particular nucleic acid sequence (e.g., a gene marker or DNA region as described herein) can indicate the methylation state of every base in the sequence or can indicate the methylation state of a subset of the bases (e.g., of one or more cytosines) within the sequence, or can indicate information regarding regional methylation density within the sequence with or without providing precise information of the locations within the sequence the methylation occurs.

(39) The methylation state of a nucleotide locus in a nucleic acid molecule refers to the presence or absence of a methylated nucleotide at a particular locus in the nucleic acid molecule. For example, the methylation state of a cytosine at the 7th nucleotide in a nucleic acid molecule is methylated when the nucleotide present at the 7th nucleotide in the nucleic acid molecule is 5-methylcytosine. Similarly, the methylation state of a cytosine at the 7th nucleotide in a nucleic acid molecule is unmethylated when the nucleotide present at the 7th nucleotide in the nucleic acid molecule is cytosine (and not 5-methylcytosine).

(40) The methylation status can optionally be represented or indicated by a methylation value (e.g., representing a methylation frequency, fraction, ratio, percent, etc.) A methylation value can be generated, for example, by quantifying the amount of intact nucleic acid present following restriction digestion with a methylation dependent restriction enzyme or by comparing amplification profiles after bisulfate reaction or by comparing sequences of bisulfate-treated and untreated nucleic acids. Accordingly, a value, e.g., a methylation value, represents the methylation status and can thus be used as a quantitative indicator of methylation status across multiple copies of a locus. This is of particular use when it is desirable to compare the methylation status of a sequence in a sample to a threshold or reference value.

(41) As used herein, methylation frequency or methylation percent (%) refer to the number of instances in which a molecule or locus is methylated relative to the number of instances the molecule or locus is unmethylated.

(42) As such, the methylation state describes the state of methylation of a nucleic acid (e.g., a genomic sequence). In addition, the methylation state refers to the characteristics of a nucleic acid segment at a particular genomic locus relevant to methylation. Such characteristics include, but are not limited to, whether any of the cytosine (C) residues within this DNA sequence are methylated, the location of methylated C residue(s), the frequency or percentage of methylated C throughout any particular region of a nucleic acid, and allelic differences in methylation due to, e.g., difference in the origin of the alleles. The terms methylation state, methylation profile, and methylation status also refer to the relative concentration, absolute concentration, or pattern of methylated C or unmethylated C throughout any particular region of a nucleic acid in a biological sample. For example, if the cytosine (C) residue(s) within a nucleic acid sequence are methylated it may be referred to as hypermethylated or having increased methylation, whereas if the cytosine (C) residue(s) within a DNA sequence are not methylated it may be referred to as hypomethylated or having decreased methylation. Likewise, if the cytosine (C) residue(s) within a nucleic acid sequence are methylated as compared to another nucleic acid sequence (e.g., from a different region or from a different individual, etc.) that sequence is considered hypermethylated or having increased methylation compared to the other nucleic acid sequence. Alternatively, if the cytosine (C) residue(s) within a DNA sequence are not methylated as compared to another nucleic acid sequence (e.g., from a different region or from a different individual, etc.) that sequence is considered hypomethylated or having decreased methylation compared to the other nucleic acid sequence. Additionally, the term methylation pattern as used herein refers to the collective sites of methylated and unmethylated nucleotides over a region of a nucleic acid. Two nucleic acids may have the same or similar methylation frequency or methylation percent but have different methylation patterns when the number of methylated and unmethylated nucleotides are the same or similar throughout the region but the locations of methylated and unmethylated nucleotides are different. Sequences are said to be differentially methylated or as having a difference in methylation or having a different methylation state when they differ in the extent (e.g., one has increased or decreased methylation relative to the other), frequency, or pattern of methylation. The term differential methylation refers to a difference in the level or pattern of nucleic acid methylation in a cancer positive sample as compared with the level or pattern of nucleic acid methylation in a cancer negative sample. It may also refer to the difference in levels or patterns between patients that have recurrence of cancer after surgery versus patients who not have recurrence. Differential methylation and specific levels or patterns of DNA methylation are prognostic and predictive biomarkers, e.g., once the correct cut-off or predictive characteristics have been defined.

(43) Methylation state frequency can be used to describe a population of individuals or a sample from a single individual. For example, a nucleotide locus having a methylation state frequency of 50% is methylated in 50% of instances and unmethylated in 50% of instances. Such a frequency can be used, for example, to describe the degree to which a nucleotide locus or nucleic acid region is methylated in a population of individuals or a collection of nucleic acids. Thus, when methylation in a first population or pool of nucleic acid molecules is different from methylation in a second population or pool of nucleic acid molecules, the methylation state frequency of the first population or pool will be different from the methylation state frequency of the second population or pool. Such a frequency also can be used, for example, to describe the degree to which a nucleotide locus or nucleic acid region is methylated in a single individual. For example, such a frequency can be used to describe the degree to which a group of cells from a tissue sample are methylated or unmethylated at a nucleotide locus or nucleic acid region.

(44) As used herein a nucleotide locus refers to the location of a nucleotide in a nucleic acid molecule. A nucleotide locus of a methylated nucleotide refers to the location of a methylated nucleotide in a nucleic acid molecule.

(45) Typically, methylation of human DNA occurs on a dinucleotide sequence including an adjacent guanine and cytosine where the cytosine is located 5 of the guanine (also termed CpG dinucleotide sequences). Most cytosines within the CpG dinucleotides are methylated in the human genome, however some remain unmethylated in specific CpG dinucleotide rich genomic regions, known as CpG islands (see, e.g, Antequera et al. (1990) Cell 62: 503-514).

(46) As used herein, a CpG island refers to a G:C-rich region of genomic DNA containing an increased number of CpG dinucleotides relative to total genomic DNA. A CpG island can be at least 100, 200, or more base pairs in length, where the G:C content of the region is at least 50% and the ratio of observed CpG frequency over expected frequency is 0.6; in some instances, a CpG island can be at least 500 base pairs in length, where the G:C content of the region is at least 55%) and the ratio of observed CpG frequency over expected frequency is 0.65. The observed CpG frequency over expected frequency can be calculated according to the method provided in Gardiner-Garden et al (1987) J. Mol. Biol. 196: 261-281. For example, the observed CpG frequency over expected frequency can be calculated according to the formula R=(AB)/(CD), where R is the ratio of observed CpG frequency over expected frequency, A is the number of CpG dinucleotides in an analyzed sequence, B is the total number of nucleotides in the analyzed sequence, C is the total number of C nucleotides in the analyzed sequence, and D is the total number of G nucleotides in the analyzed sequence. Methylation state is typically determined in CpG islands, e.g., at promoter regions. It will be appreciated though that other sequences in the human genome are prone to DNA methylation such as CpA and CpT (see, e.g., Ramsahoye (2000) Proc. Natl. Acad. Sci. USA 97: 5237-5242; Salmon and Kaye (1970) Biochim. Biophys. Acta. 204: 340-351; Grafstrom (1985) Nucleic Acids Res. 13: 2827-2842; Nyce (1986) Nucleic Acids Res. 14: 4353-4367; Woodcock (1987) Biochem. Biophys. Res. Commun. 145: 888-894).

(47) As used herein, a reagent that modifies a nucleotide of the nucleic acid molecule as a function of the methylation state of the nucleic acid molecule, or a methylation-specific reagent, refers to a compound or composition or other agent that can change the nucleotide sequence of a nucleic acid molecule in a manner that reflects the methylation state of the nucleic acid molecule. Methods of treating a nucleic acid molecule with such a reagent can include contacting the nucleic acid molecule with the reagent, coupled with additional steps, if desired, to accomplish the desired change of nucleotide sequence. Such a change in the nucleic acid molecule's nucleotide sequence can result in a nucleic acid molecule in which each methylated nucleotide is modified to a different nucleotide. Such a change in the nucleic acid nucleotide sequence can result in a nucleic acid molecule in which each unmethylated nucleotide is modified to a different nucleotide. Such a change in the nucleic acid nucleotide sequence can result in a nucleic acid molecule in which each of a selected nucleotide which is unmethylated (e.g., each unmethylated cytosine) is modified to a different nucleotide. Use of such a reagent to change the nucleic acid nucleotide sequence can result in a nucleic acid molecule in which each nucleotide that is a methylated nucleotide (e.g., each methylated cytosine) is modified to a different nucleotide. As used herein, use of a reagent that modifies a selected nucleotide refers to a reagent that modifies one nucleotide of the four typically occurring nucleotides in a nucleic acid molecule (C, G, T, and A for DNA and C, G, U, and A for RNA), such that the reagent modifies the one nucleotide without modifying the other three nucleotides. In one exemplary embodiment, such a reagent modifies an unmethylated selected nucleotide to produce a different nucleotide. In another exemplary embodiment, such a reagent can deaminate unmethylated cytosine nucleotides. An exemplary reagent is bisulfite.

(48) As used herein, the term bisulfite reagent refers to a reagent comprising in some embodiments bisulfite, disulfite, hydrogen sulfite, or combinations thereof to distinguish between methylated and unmethylated cytidines, e.g., in CpG dinucleotide sequences.

(49) The term methylation assay refers to any assay for determining the methylation state of one or more CpG dinucleotide sequences within a sequence of a nucleic acid.

(50) The term MS AP-PCR (Methylation-Sensitive Arbitrarily-Primed Polymerase Chain Reaction) refers to the art-recognized technology that allows for a global scan of the genome using CG-rich primers to focus on the regions most likely to contain CpG dinucleotides, and described by Gonzalgo et al. (1997) Cancer Research 57: 594-599.

(51) The term MethyLight refers to the art-recognized fluorescence-based real-time PCR technique described by Eads et al. (1999) Cancer Res. 59: 2302-2306.

(52) The term HeavyMethyl refers to an assay wherein methylation specific blocking probes (also referred to herein as blockers) covering CpG positions between, or covered by, the amplification primers enable methylation-specific selective amplification of a nucleic acid sample.

(53) The term HeavyMethyl MethyLight assay refers to a HeavyMethyl MethyLight assay, which is a variation of the MethyLight assay, wherein the MethyLight assay is combined with methylation specific blocking probes covering CpG positions between the amplification primers.

(54) The term Ms-SNuPE (Methylation-sensitive Single Nucleotide Primer Extension) refers to the art-recognized assay described by Gonzalgo & Jones (1997) Nucleic Acids Res. 25: 2529-2531.

(55) The term MSP (Methylation-specific PCR) refers to the art-recognized methylation assay described by Herman et al. (1996) Proc. Natl. Acad. Sci. USA 93: 9821-9826, and by U.S. Pat. No. 5,786,146.

(56) The term COBRA (Combined Bisulfite Restriction Analysis) refers to the art-recognized methylation assay described by Xiong & Laird (1997) Nucleic Acids Res. 25: 2532-2534.

(57) The term MCA (Methylated CpG Island Amplification) refers to the methylation assay described by Toyota et al. (1999) Cancer Res. 59: 2307-12, and in WO 00/26401A1.

(58) As used herein, a selected nucleotide refers to one nucleotide of the four typically occurring nucleotides in a nucleic acid molecule (C, G, T, and A for DNA and C, G, U, and A for RNA), and can include methylated derivatives of the typically occurring nucleotides (e.g., when C is the selected nucleotide, both methylated and unmethylated C are included within the meaning of a selected nucleotide), whereas a methylated selected nucleotide refers specifically to a methylated typically occurring nucleotide and an unmethylated selected nucleotides refers specifically to an unmethylated typically occurring nucleotide.

(59) The terms methylation-specific restriction enzyme or methylation-sensitive restriction enzyme refers to an enzyme that selectively digests a nucleic acid dependent on the methylation state of its recognition site. In the case of a restriction enzyme that specifically cuts if the recognition site is not methylated or is hemimethylated, the cut will not take place or will take place with a significantly reduced efficiency if the recognition site is methylated. In the case of a restriction enzyme that specifically cuts if the recognition site is methylated, the cut will not take place or will take place with a significantly reduced efficiency if the recognition site is not methylated. Preferred are methylation-specific restriction enzymes, the recognition sequence of which contains a CG dinucleotide (for instance a recognition sequence such as CGCG or CCCGGG). Further preferred for some embodiments are restriction enzymes that do not cut if the cytosine in this dinucleotide is methylated at the carbon atom C5.

(60) As used herein, a different nucleotide refers to a nucleotide that is chemically different from a selected nucleotide, typically such that the different nucleotide has Watson-Crick base-pairing properties that differ from the selected nucleotide, whereby the typically occurring nucleotide that is complementary to the selected nucleotide is not the same as the typically occurring nucleotide that is complementary to the different nucleotide. For example, when C is the selected nucleotide, U or T can be the different nucleotide, which is exemplified by the complementarity of C to G and the complementarity of U or T to A. As used herein, a nucleotide that is complementary to the selected nucleotide or that is complementary to the different nucleotide refers to a nucleotide that base-pairs, under high stringency conditions, with the selected nucleotide or different nucleotide with higher affinity than the complementary nucleotide's base-paring with three of the four typically occurring nucleotides. An example of complementarity is Watson-Crick base pairing in DNA (e.g., A-T and C-G) and RNA (e.g., A-U and C-G). Thus, for example, G base-pairs, under high stringency conditions, with higher affinity to C than G base-pairs to G, A, or T and, therefore, when C is the selected nucleotide, G is a nucleotide complementary to the selected nucleotide.

(61) As used herein, the sensitivity of a given marker refers to the percentage of samples that report a DNA methylation value above a threshold value that distinguishes between neoplastic and non-neoplastic samples. In some embodiments, a positive is defined as a histology-confirmed neoplasia that reports a DNA methylation value above a threshold value (e.g., the range associated with disease), and a false negative is defined as a histology-confirmed neoplasia that reports a DNA methylation value below the threshold value (e.g., the range associated with no disease). The value of sensitivity, therefore, reflects the probability that a DNA methylation measurement for a given marker obtained from a known diseased sample will be in the range of disease-associated measurements. As defined here, the clinical relevance of the calculated sensitivity value represents an estimation of the probability that a given marker would detect the presence of a clinical condition when applied to a subject with that condition.

(62) As used herein, the specificity of a given marker refers to the percentage of non-neoplastic samples that report a DNA methylation value below a threshold value that distinguishes between neoplastic and non-neoplastic samples. In some embodiments, a negative is defined as a histology-confirmed non-neoplastic sample that reports a DNA methylation value below the threshold value (e.g., the range associated with no disease) and a false positive is defined as a histology-confirmed non-neoplastic sample that reports a DNA methylation value above the threshold value (e.g., the range associated with disease). The value of specificity, therefore, reflects the probability that a DNA methylation measurement for a given marker obtained from a known non-neoplastic sample will be in the range of non-disease associated measurements. As defined here, the clinical relevance of the calculated specificity value represents an estimation of the probability that a given marker would detect the absence of a clinical condition when applied to a patient without that condition.

(63) The term AUC as used herein is an abbreviation for the area under a curve. In particular it refers to the area under a Receiver Operating Characteristic (ROC) curve. The ROC curve is a plot of the true positive rate against the false positive rate for the different possible cut points of a diagnostic test. It shows the trade-off between sensitivity and specificity depending on the selected cut point (any increase in sensitivity will be accompanied by a decrease in specificity). The area under an ROC curve (AUC) is a measure for the accuracy of a diagnostic test (the larger the area the better; the optimum is 1; a random test would have a ROC curve lying on the diagonal with an area of 0.5; for reference: J. P. Egan. (1975) Signal Detection Theory and ROC Analysis, Academic Press, New York).

(64) As used herein, the term neoplasm refers to an abnormal mass of tissue, the growth of which exceeds and is uncoordinated with that of the normal tissues See, e.g., Willis R A, The Spread of Tumors in the Human Body, London, Butterworth & Co, 1952.

(65) As used herein, the term adenoma refers to a benign tumor of glandular origin. Although these growths are benign, over time they may progress to become malignant.

(66) The term pre-cancerous or pre-neoplastic and equivalents thereof refer to any cellular proliferative disorder that is undergoing malignant transformation.

(67) A site or region of a neoplasm, adenoma, cancer, etc. is the tissue, organ, cell type, anatomical area, body part, etc. in a subject's body where the neoplasm, adenoma, cancer, etc. is located.

(68) As used herein, the term esophageal disorder refers to types of disorder associated with the esophagus and/or esophageal tissue. Examples of esophageal disorders include, but are not limited to, Barrett's esophagus (BE), Barrett's esophageal dysplasia (BED), Barrett's esophageal low-grade dysplasia (BE-LGD), Barrett's esophageal high-grade dysplasia (BE-HGD), and esophageal adenocarcinoma (EAC).

(69) As used herein, a diagnostic test application includes the detection or identification of a disease state or condition of a subject, determining the likelihood that a subject will contract a given disease or condition, determining the likelihood that a subject with a disease or condition will respond to therapy, determining the prognosis of a subject with a disease or condition (or its likely progression or regression), and determining the effect of a treatment on a subject with a disease or condition. For example, a diagnostic can be used for detecting the presence or likelihood of a subject contracting a neoplasm or the likelihood that such a subject will respond favorably to a compound (e.g., a pharmaceutical, e.g., a drug) or other treatment.

(70) The term marker, as used herein, refers to a substance (e.g., a nucleic acid or a region of a nucleic acid) that is able to diagnose a disorder (e.g., a non-cancerous disorder) (e.g., a cancerous disorder) by distinguishing disorder-associated cells (e.g., non-cancerous cells associated with the disorder) (e.g., cancerous cells associated with the disorder) from normal cells, e.g., based its methylation state.

(71) The term isolated when used in relation to a nucleic acid, as in an isolated oligonucleotide refers to a nucleic acid sequence that is identified and separated from at least one contaminant nucleic acid with which it is ordinarily associated in its natural source. Isolated nucleic acid is present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated nucleic acids, such as DNA and RNA, are found in the state they exist in nature. Examples of non-isolated nucleic acids include: a given DNA sequence (e.g., a gene) found on the host cell chromosome in proximity to neighboring genes; RNA sequences, such as a specific mRNA sequence encoding a specific protein, found in the cell as a mixture with numerous other mRNAs which encode a multitude of proteins. However, isolated nucleic acid encoding a particular protein includes, by way of example, such nucleic acid in cells ordinarily expressing the protein, where the nucleic acid is in a chromosomal location different from that of natural cells, or is otherwise flanked by a different nucleic acid sequence than that found in nature. The isolated nucleic acid or oligonucleotide may be present in single-stranded or double-stranded form. When an isolated nucleic acid or oligonucleotide is to be utilized to express a protein, the oligonucleotide will contain at a minimum the sense or coding strand (i.e., the oligonucleotide may be single-stranded), but may contain both the sense and anti-sense strands (i.e., the oligonucleotide may be double-stranded). An isolated nucleic acid may, after isolation from its natural or typical environment, by be combined with other nucleic acids or molecules. For example, an isolated nucleic acid may be present in a host cell in which into which it has been placed, e.g., for heterologous expression.

(72) The term purified refers to molecules, either nucleic acid or amino acid sequences that are removed from their natural environment, isolated, or separated. An isolated nucleic acid sequence may therefore be a purified nucleic acid sequence. Substantially purified molecules are at least 60% free, preferably at least 75% free, and more preferably at least 90% free from other components with which they are naturally associated. As used herein, the terms purified or to purify also refer to the removal of contaminants from a sample. The removal of contaminating proteins results in an increase in the percent of polypeptide or nucleic acid of interest in the sample. In another example, recombinant polypeptides are expressed in plant, bacterial, yeast, or mammalian host cells and the polypeptides are purified by the removal of host cell proteins; the percent of recombinant polypeptides is thereby increased in the sample.

(73) The term composition comprising a given polynucleotide sequence or polypeptide refers broadly to any composition containing the given polynucleotide sequence or polypeptide. The composition may comprise an aqueous solution containing salts (e.g., NaCl), detergents (e.g., SDS), and other components (e.g., Denhardt's solution, dry milk, salmon sperm DNA, etc.).

(74) The term sample is used in its broadest sense. In one sense it can refer to an animal cell or tissue. In another sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples may be obtained from plants or animals (including humans) and encompass fluids, solids, tissues, and gases. Environmental samples include environmental material such as surface matter, soil, water, and industrial samples. These examples are not to be construed as limiting the sample types applicable to the present invention. In some embodiments, the sample includes esophageal tissue. In some embodiments, the sample includes esophageal tissue obtained through endoscopic brushing or nonendoscopic whole esophageal brushing or swabbing using a tethered device (e.g. such as a capsule sponge, balloon, or other device).

(75) As used herein, a remote sample as used in some contexts relates to a sample indirectly collected from a site that is not the cell, tissue, or organ source of the sample. For instance, when sample material originating from the pancreas is assessed in a stool sample (e.g., not from a sample taken directly from a pancreas), the sample is a remote sample.

(76) As used herein, the terms patient or subject refer to organisms to be subject to various tests provided by the technology. The term subject includes animals, preferably mammals, including humans. In a preferred embodiment, the subject is a primate. In an even more preferred embodiment, the subject is a human.

(77) As used herein, the term kit refers to any delivery system for delivering materials. In the context of reaction assays, such delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents (e.g., oligonucleotides, enzymes, etc. in the appropriate containers) and/or supporting materials (e.g., buffers, written instructions for performing the assay etc.) from one location to another. For example, kits include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and/or supporting materials. As used herein, the term fragmented kit refers to delivery systems comprising two or more separate containers that each contain a subportion of the total kit components. The containers may be delivered to the intended recipient together or separately. For example, a first container may contain an enzyme for use in an assay, while a second container contains oligonucleotides. The term fragmented kit is intended to encompass kits containing Analyte specific reagents (ASR's) regulated under section 520(e) of the Federal Food, Drug, and Cosmetic Act, but are not limited thereto. Indeed, any delivery system comprising two or more separate containers that each contains a subportion of the total kit components are included in the term fragmented kit. In contrast, a combined kit refers to a delivery system containing all of the components of a reaction assay in a single container (e.g., in a single box housing each of the desired components). The term kit includes both fragmented and combined kits.

(78) Embodiments of the Technology

(79) Barrett's Esophagus is a precursor lesion for most esophageal adenocarcinomas which is a malignancy with rapidly rising incidence and persistently poor outcomes. Early detection of esophageal adenocarcinoma has been shown to be associated with earlier stage and increased survival. Early detection of Barrett's Esophagus may enable placement of patients into surveillance programs which may allow detection of neoplastic progression at an earlier stage amenable to endoscopic or surgical therapy with improved outcomes. Screening for Barrett's Esophagus and esophageal adenocarcinoma has been hampered by the lack of a widely applicable tool, as well as the lack of a biomarker which can be combined with a screening tool. Acceptability and feasibility of screening by endoscopic and novel non-endoscopic methods has been demonstrated in the population. Non-endoscopic screening methods, such as by swallowed cytology brush or stool DNA testing, offer potential cost-effective alternatives to endoscopy for identification of Barrett's Esophagus in the general population. More recently, it has also shown that several aberrantly methylated genes could serve as highly discriminant markers for Barrett's Esophagus. Indeed, a study performed on archived frozen esophageal biopsies in patients with and without Barrett's revealed that a panel of tumor-associated genes was potentially useful to discriminate between Barrett's Esophagus and squamous mucosa. (see, e.g., Yang Wu, et al, DDW Abstract 2011).

(80) Dysplasia is known to be distributed in a patchy manner in Barrett's esophagus, leading to sampling error on routine endoscopic surveillance as performed by four quadrant biopsies. It is known that conventional endoscopic surveillance with biopsies samples less than 10% of the BE segment. Compliance of endoscopists with conventional surveillance is known to be poor. While newer endoscopic techniques have been shown to improve the yield of dysplasia detection in studies performed in tertiary care centers, their applicability in the community remains uncertain. Methods which sample a larger mucosal surface area, such as swabbing or brushing, are likely to increase the yield of dysplasia and neoplasia, particularly if combined with molecular markers of dysplasia/neoplasia. This may ultimately allow non-biopsy (via swabbing or brushing) or non-endoscopic surveillance of BE subjects with potential substantial cost savings.

(81) Accordingly, provided herein is technology for esophageal disorder screening and particularly, but not exclusively, to methods, compositions, and related uses for detecting the presence of esophageal disorders (e.g., Barrett's esophagus, Barrett's esophageal dysplasia, etc.). In addition, the technology provides methods, compositions and related uses for distinguishing between Barrett's esophagus and Barrett's esophageal dysplasia, and between Barrett's esophageal low-grade dysplasia, Barrett's esophageal high-grade dysplasia, and esophageal adenocarcinoma within samples obtained through endoscopic brushing or nonendoscopic whole esophageal brushing or swabbing using a tethered device (e.g. such as a capsule sponge, balloon, or other device).

(82) Indeed, experiments conducted during the course of developing this technology compared the methylation state of DNA markers from esophageal tissue of subjects having Barrett's esophagus to the methylation state of the same DNA markers from control subjects (e.g., normal tissue for the respective tissue type), and to the methylation state of the same DNA markers from subjects having Barrett's esophagus dysplasia (see, Examples 1-4).

(83) Markers and/or panels of markers were identified (e.g., a chromosomal region having an annotation provided in Tables 1, 7 and/or 8) capable of classifying Barrett's esophagus (BE) versus control (e.g., normal tissue for the respective tissue type) within esophageal tissue (see, Examples 1, 2 and 5).

(84) Markers and/or panels of markers were identified (e.g., a chromosomal region having an annotation provided in Tables 2, 3, 5, and/or 6) capable of classifying BE versus Barrett's esophagus related dyspasia (BED) within esophageal tissue (see, Examples 1, 3 and 4).

(85) Markers and/or panels of markers were identified (e.g., a chromosomal region having an annotation provided in Table 5) capable of predicting Barrett's esophagus related low-grade dyspasia (BE-LGD), Barrett's esophagus related dyspasia high-grade dysplasia (BE-HGD), and esophageal adenocarcinoma (EAC) within samples obtained through whole esophageal swabbing or brushing (see, Example 1 and 4).

(86) Markers and/or panels of markers were identified (e.g., a chromosomal region having an annotation provided in Table 5) capable of classifying BE versus BED within samples obtained through whole esophageal swabbing or brushing (see, Example 1 and 4).

(87) Although the disclosure herein refers to certain illustrated embodiments, it is to be understood that these embodiments are presented by way of example and not by way of limitation.

(88) The methods comprise determining the methylation status of at least one methylation marker in a biological sample isolated from a subject, wherein a change in the methylation state of the marker is indicative of the presence, or class of an esophageal disorder (e.g., BE, BED, BE-LGD, BE-HGD, EAC). Particular embodiments relate to markers comprising a differentially methylated region (DMR, e.g., DMR 1-229, see Tables 1, 2, 3, 5, 6, 7, 8) that are used for diagnosis (e.g., screening) of esophageal disorders (e.g., BE, BED, BE-LGD, BE-HGD, EAC), including early detection during, for example, pre-cancerous stages of disease (e.g., BE versus BED).

(89) The markers of the present technology are particularly efficient in detecting or distinguishing between esophageal disorders (e.g., BE, BED, BE-LGD, BE-HGD, EAC), thereby providing improved means for the early detection, classification, and treatment of said disorders.

(90) In addition to embodiments wherein the methylation analysis of at least one marker, a region of a marker, or a base of a marker comprising a DMR (e.g., DMR 1-229 from Tables 1, 2, 3, 5, 6, 7, and/or 8) provided herein and listed in Tables 1, 2, 3, 5, 6, and/or 7 is analyzed, the technology also provides panels of markers comprising at least one marker, region of a marker, or base of a marker comprising a DMR with utility for the detection of esophageal disorders (e.g., BE, BED, BE-LGD, BE-HGD, EAC), in esophageal tissue.

(91) Some embodiments of the technology are based upon the analysis of the CpG methylation status of at least one marker, region of a marker, or base of a marker comprising a DMR.

(92) In some embodiments, the present technology provides for the use of the bisulfate technique in combination with one or more methylation assays to determine the methylation status of CpG dinucleotide sequences within at least one marker comprising a DMR (e.g., as provided in Tables 1, 2, 3, 5, 6, 7, 8 (e.g., DMR 1-229)). Genomic CpG dinucleotides can be methylated or unmethylated (alternatively known as up- and down-methylated respectively). However the methods of the present invention are suitable for the analysis of biological samples of a heterogeneous nature, e.g., a low concentration of tumor cells, or biological materials therefrom, within a background of a remote sample (e.g., blood, organ effluent, or stool). Accordingly, when analyzing the methylation status of a CpG position within such a sample one may use a quantitative assay for determining the level (e.g., percent, fraction, ratio, proportion, or degree) of methylation at a particular CpG position.

(93) According to the present technology, determination of the methylation status of CpG dinucleotide sequences in markers comprising a DMR has utility both in the diagnosis and characterization of esophageal disorders (e.g., BE, BED, BE-LGD, BE-HGD, EAC).

(94) Combinations of Markers

(95) In some embodiments, the technology relates to assessing the methylation state of combinations of markers comprising two or more DMRs from Tables 1, 2, 3, 5, 6, 7, 8 (e.g., two or more DMRs from DMR Nos. 1-194). In some embodiments, assessing the methylation state of more than one marker increases the specificity and/or sensitivity of a screen or diagnostic for identifying an esophageal disorder (e.g., BE, BED, BE-LGD, BE-HGD, EAC) in a subject.

(96) Various cancers are predicted by various combinations of markers, e.g., as identified by statistical techniques related to specificity and sensitivity of prediction. The technology provides methods for identifying predictive combinations and validated predictive combinations for some cancers.

(97) In some embodiments, combinations of markers (e.g., comprising a DMR) predict the site of a neoplasm.

(98) For example, markers and/or panels of markers were identified (e.g., a chromosomal region having an annotation provided in Tables 1, 7 and/or 8) capable of classifying Barrett's esophagus (BE) versus control (e.g., normal tissue for the respective tissue type) within esophageal tissue (see, Examples 1, 2 and 5).

(99) Markers and/or panels of markers were identified (e.g., a chromosomal region having an annotation provided in Tables 2, 3, 5, and/or 6) capable of classifying BE versus Barrett's esophagus related dyspasia (BED) within esophageal tissue (see, Examples 1, 3 and 4).

(100) Markers and/or panels of markers were identified (e.g., a chromosomal region having an annotation provided in Table 5) capable of predicting Barrett's esophagus related low-grade dyspasia (BE-LGD), Barrett's esophagus related dyspasia high-grade dysplasia (BE-HGD), and esophageal adenocarcinoma (EAC) within samples obtained through whole esophageal swabbing or brushing (see, Examples 1 and 4).

(101) Markers and/or panels of markers were identified (e.g., a chromosomal region having an annotation provided in Table 5) capable of classifying BE versus BED within samples obtained through whole esophageal swabbing or brushing (see, Examples 1 and 4).

(102) Methods for Assaying Methylation State

(103) The most frequently used method for analyzing a nucleic acid for the presence of 5-methylcytosine is based upon the bisulfite method described by Frommer, et al. for the detection of 5-methylcytosines in DNA (Frommer et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1827-31) or variations thereof. The bisulfite method of mapping 5-methylcytosines is based on the observation that cytosine, but not 5-methylcytosine, reacts with hydrogen sulfite ion (also known as bisulfite). The reaction is usually performed according to the following steps: first, cytosine reacts with hydrogen sulfite to form a sulfonated cytosine. Next, spontaneous deamination of the sulfonated reaction intermediate results in a sulfonated uracil. Finally, the sulfonated uricil is desulfonated under alkaline conditions to form uracil. Detection is possible because uracil forms base pairs with adenine (thus behaving like thymine), whereas 5-methylcytosine base pairs with guanine (thus behaving like cytosine). This makes the discrimination of methylated cytosines from non-methylated cytosines possible by, e.g., bisulfite genomic sequencing (Grigg G, & Clark S, Bioessays (1994) 16: 431-36; Grigg G, DNA Seq. (1996) 6: 189-98) or methylation-specific PCR (MSP) as is disclosed, e.g., in U.S. Pat. No. 5,786,146.

(104) Some conventional technologies are related to methods comprising enclosing the DNA to be analyzed in an agarose matrix, thereby preventing the diffusion and renaturation of the DNA (bisulfite only reacts with single-stranded DNA), and replacing precipitation and purification steps with a fast dialysis (Olek A, et al. (1996) A modified and improved method for bisulfite based cytosine methylation analysis Nucleic Acids Res. 24: 5064-6). It is thus possible to analyze individual cells for methylation status, illustrating the utility and sensitivity of the method. An overview of conventional methods for detecting 5-methylcytosine is provided by Rein, T., et al. (1998) Nucleic Acids Res. 26: 2255.

(105) The bisulfite technique typically involves amplifying short, specific fragments of a known nucleic acid subsequent to a bisulfite treatment, then either assaying the product by sequencing (Olek & Walter (1997) Nat. Genet. 17: 275-6) or a primer extension reaction (Gonzalgo & Jones (1997) Nucleic Acids Res. 25: 2529-31; WO 95/00669; U.S. Pat. No. 6,251,594) to analyze individual cytosine positions. Some methods use enzymatic digestion (Xiong & Laird (1997) Nucleic Acids Res. 25: 2532-4). Detection by hybridization has also been described in the art (Olek et al., WO 99/28498). Additionally, use of the bisulfite technique for methylation detection with respect to individual genes has been described (Grigg & Clark (1994) Bioessays 16: 431-6; Zeschnigk et al. (1997) Hum Mol Genet. 6: 387-95; Feil et al. (1994) Nucleic Acids Res. 22: 695; Martin et al. (1995) Gene 157: 261-4; WO 9746705; WO 9515373).

(106) Various methylation assay procedures are known in the art and can be used in conjunction with bisulfite treatment according to the present technology. These assays allow for determination of the methylation state of one or a plurality of CpG dinucleotides (e.g., CpG islands) within a nucleic acid sequence. Such assays involve, among other techniques, sequencing of bisulfite-treated nucleic acid, PCR (for sequence-specific amplification), Southern blot analysis, and use of methylation-sensitive restriction enzymes.

(107) For example, genomic sequencing has been simplified for analysis of methylation patterns and 5-methylcytosine distributions by using bisulfite treatment (Frommer et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1827-1831). Additionally, restriction enzyme digestion of PCR products amplified from bisulfite-converted DNA finds use in assessing methylation state, e.g., as described by Sadri & Hornsby (1997) Nucl. Acids Res. 24: 5058-5059 or as embodied in the method known as COBRA (Combined Bisulfite Restriction Analysis) (Xiong & Laird (1997) Nucleic Acids Res. 25: 2532-2534).

(108) COBRA analysis is a quantitative methylation assay useful for determining DNA methylation levels at specific loci in small amounts of genomic DNA (Xiong & Laird, Nucleic Acids Res. 25:2532-2534, 1997). Briefly, restriction enzyme digestion is used to reveal methylation-dependent sequence differences in PCR products of sodium bisulfite-treated DNA. Methylation-dependent sequence differences are first introduced into the genomic DNA by standard bisulfite treatment according to the procedure described by Frommer et al. (Proc. Natl. Acad. Sci. USA 89:1827-1831, 1992). PCR amplification of the bisulfite converted DNA is then performed using primers specific for the CpG islands of interest, followed by restriction endonuclease digestion, gel electrophoresis, and detection using specific, labeled hybridization probes. Methylation levels in the original DNA sample are represented by the relative amounts of digested and undigested PCR product in a linearly quantitative fashion across a wide spectrum of DNA methylation levels. In addition, this technique can be reliably applied to DNA obtained from microdissected paraffin-embedded tissue samples.

(109) Typical reagents (e.g., as might be found in a typical COBRA-based kit) for COBRA analysis may include, but are not limited to: PCR primers for specific loci (e.g., specific genes, markers, DMR, regions of genes, regions of markers, bisulfite treated DNA sequence, CpG island, etc.); restriction enzyme and appropriate buffer; gene-hybridization oligonucleotide; control hybridization oligonucleotide; kinase labeling kit for oligonucleotide probe; and labeled nucleotides. Additionally, bisulfite conversion reagents may include: DNA denaturation buffer; sulfonation buffer; DNA recovery reagents or kits (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.

(110) Preferably, assays such as MethyLight (a fluorescence-based real-time PCR technique) (Eads et al., Cancer Res. 59:2302-2306, 1999), Ms-SNuPE (Methylation-sensitive Single Nucleotide Primer Extension) reactions (Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997), methylation-specific PCR (MSP; Herman et al., Proc. Natl. Acad. Sci. USA 93:9821-9826, 1996; U.S. Pat. No. 5,786,146), and methylated CpG island amplification (MCA; Toyota et al., Cancer Res. 59:2307-12, 1999) are used alone or in combination with one or more of these methods.

(111) The HeavyMethyl assay, technique is a quantitative method for assessing methylation differences based on methylation-specific amplification of bisulfite-treated DNA. Methylation-specific blocking probes (blockers) covering CpG positions between, or covered by, the amplification primers enable methylation-specific selective amplification of a nucleic acid sample.

(112) The term HeavyMethyl MethyLight assay refers to a HeavyMethyl MethyLight assay, which is a variation of the MethyLight assay, wherein the MethyLight assay is combined with methylation specific blocking probes covering CpG positions between the amplification primers. The HeavyMethyl assay may also be used in combination with methylation specific amplification primers.

(113) Typical reagents (e.g., as might be found in a typical MethyLight-based kit) for HeavyMethyl analysis may include, but are not limited to: PCR primers for specific loci (e.g., specific genes, markers, DMR, regions of genes, regions of markers, bisulfite treated DNA sequence, CpG island, or bisulfite treated DNA sequence or CpG island, etc.); blocking oligonucleotides; optimized PCR buffers and deoxynucleotides; and Taq polymerase.

(114) MSP (methylation-specific PCR) allows for assessing the methylation status of virtually any group of CpG sites within a CpG island, independent of the use of methylation-sensitive restriction enzymes (Herman et al. Proc. Natl. Acad. Sci. USA 93:9821-9826, 1996; U.S. Pat. No. 5,786,146). Briefly, DNA is modified by sodium bisulfite, which converts unmethylated, but not methylated cytosines, to uracil, and the products are subsequently amplified with primers specific for methylated versus unmethylated DNA. MSP requires only small quantities of DNA, is sensitive to 0.1% methylated alleles of a given CpG island locus, and can be performed on DNA extracted from paraffin-embedded samples. Typical reagents (e.g., as might be found in a typical MSP-based kit) for MSP analysis may include, but are not limited to: methylated and unmethylated PCR primers for specific loci (e.g., specific genes, markers, DMR, regions of genes, regions of markers, bisulfite treated DNA sequence, CpG island, etc.); optimized PCR buffers and deoxynucleotides, and specific probes.

(115) The MethyLight assay is a high-throughput quantitative methylation assay that utilizes fluorescence-based real-time PCR (e.g., TaqMan) that requires no further manipulations after the PCR step (Eads et al., Cancer Res. 59:2302-2306, 1999). Briefly, the MethyLight process begins with a mixed sample of genomic DNA that is converted, in a sodium bisulfite reaction, to a mixed pool of methylation-dependent sequence differences according to standard procedures (the bisulfite process converts unmethylated cytosine residues to uracil). Fluorescence-based PCR is then performed in a biased reaction, e.g., with PCR primers that overlap known CpG dinucleotides. Sequence discrimination occurs both at the level of the amplification process and at the level of the fluorescence detection process.

(116) The MethyLight assay is used as a quantitative test for methylation patterns in a nucleic acid, e.g., a genomic DNA sample, wherein sequence discrimination occurs at the level of probe hybridization. In a quantitative version, the PCR reaction provides for a methylation specific amplification in the presence of a fluorescent probe that overlaps a particular putative methylation site. An unbiased control for the amount of input DNA is provided by a reaction in which neither the primers, nor the probe, overlie any CpG dinucleotides. Alternatively, a qualitative test for genomic methylation is achieved by probing the biased PCR pool with either control oligonucleotides that do not cover known methylation sites (e.g., a fluorescence-based version of the HeavyMethyl and MSP techniques) or with oligonucleotides covering potential methylation sites.

(117) The MethyLight process is used with any suitable probe (e.g. a TaqMan probe, a Lightcycler probe, etc.) For example, in some applications double-stranded genomic DNA is treated with sodium bisulfite and subjected to one of two sets of PCR reactions using TaqMan probes, e.g., with MSP primers and/or HeavyMethyl blocker oligonucleotides and a TaqMan probe. The TaqMan probe is dual-labeled with fluorescent reporter and quencher molecules and is designed to be specific for a relatively high GC content region so that it melts at about a 10 C. higher temperature in the PCR cycle than the forward or reverse primers. This allows the TaqMan probe to remain fully hybridized during the PCR annealing/extension step. As the Taq polymerase enzymatically synthesizes a new strand during PCR, it will eventually reach the annealed TaqMan probe. The Taq polymerase 5 to 3 endonuclease activity will then displace the TaqMan probe by digesting it to release the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescent detection system.

(118) Typical reagents (e.g., as might be found in a typical MethyLight-based kit) for MethyLight analysis may include, but are not limited to: PCR primers for specific loci (e.g., specific genes, markers, DMR, regions of genes, regions of markers, bisulfite treated DNA sequence, CpG island, etc.); TaqMan or Lightcycler probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase.

(119) The QM (quantitative methylation) assay is an alternative quantitative test for methylation patterns in genomic DNA samples, wherein sequence discrimination occurs at the level of probe hybridization. In this quantitative version, the PCR reaction provides for unbiased amplification in the presence of a fluorescent probe that overlaps a particular putative methylation site. An unbiased control for the amount of input DNA is provided by a reaction in which neither the primers, nor the probe, overlie any CpG dinucleotides. Alternatively, a qualitative test for genomic methylation is achieved by probing the biased PCR pool with either control oligonucleotides that do not cover known methylation sites (a fluorescence-based version of the HeavyMethyl and MSP techniques) or with oligonucleotides covering potential methylation sites.

(120) The QM process can be used with any suitable probe, e.g., TaqMan probes, Lightcycler probes, in the amplification process. For example, double-stranded genomic DNA is treated with sodium bisulfite and subjected to unbiased primers and the TaqMan probe. The TaqMan probe is dual-labeled with fluorescent reporter and quencher molecules, and is designed to be specific for a relatively high GC content region so that it melts out at about a 10 C. higher temperature in the PCR cycle than the forward or reverse primers. This allows the TaqMan probe to remain fully hybridized during the PCR annealing/extension step. As the Taq polymerase enzymatically synthesizes a new strand during PCR, it will eventually reach the annealed TaqMan probe. The Taq polymerase 5 to 3 endonuclease activity will then displace the TaqMan probe by digesting it to release the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescent detection system. Typical reagents (e.g., as might be found in a typical QM-based kit) for QM analysis may include, but are not limited to: PCR primers for specific loci (e.g., specific genes, markers, DMR, regions of genes, regions of markers, bisulfite treated DNA sequence, CpG island, etc.); TaqMan or Lightcycler probes; optimized PCR buffers and deoxynucleotides; and Taq polymerase.

(121) The Ms-SNuPE technique is a quantitative method for assessing methylation differences at specific CpG sites based on bisulfite treatment of DNA, followed by single-nucleotide primer extension (Gonzalgo & Jones, Nucleic Acids Res. 25:2529-2531, 1997). Briefly, genomic DNA is reacted with sodium bisulfite to convert unmethylated cytosine to uracil while leaving 5-methylcytosine unchanged. Amplification of the desired target sequence is then performed using PCR primers specific for bisulfite-converted DNA, and the resulting product is isolated and used as a template for methylation analysis at the CpG site of interest. Small amounts of DNA can be analyzed (e.g., microdissected pathology sections) and it avoids utilization of restriction enzymes for determining the methylation status at CpG sites.

(122) Typical reagents (e.g., as might be found in a typical Ms-SNuPE-based kit) for Ms-SNuPE analysis may include, but are not limited to: PCR primers for specific loci (e.g., specific genes, markers, DMR, regions of genes, regions of markers, bisulfite treated DNA sequence, CpG island, etc.); optimized PCR buffers and deoxynucleotides; gel extraction kit; positive control primers; Ms-SNuPE primers for specific loci; reaction buffer (for the Ms-SNuPE reaction); and labeled nucleotides. Additionally, bisulfite conversion reagents may include: DNA denaturation buffer; sulfonation buffer; DNA recovery reagents or kit (e.g., precipitation, ultrafiltration, affinity column); desulfonation buffer; and DNA recovery components.

(123) Reduced Representation Bisulfite Sequencing (RRBS) begins with bisulfite treatment of nucleic acid to convert all unmethylated cytosines to uracil, followed by restriction enzyme digestion (e.g., by an enzyme that recognizes a site including a CG sequence such as MspI) and complete sequencing of fragments after coupling to an adapter ligand. The choice of restriction enzyme enriches the fragments for CpG dense regions, reducing the number of redundant sequences that may map to multiple gene positions during analysis. As such, RRBS reduces the complexity of the nucleic acid sample by selecting a subset (e.g., by size selection using preparative gel electrophoresis) of restriction fragments for sequencing. As opposed to whole-genome bisulfite sequencing, every fragment produced by the restriction enzyme digestion contains DNA methylation information for at least one CpG dinucleotide. As such, RRBS enriches the sample for promoters, CpG islands, and other genomic features with a high frequency of restriction enzyme cut sites in these regions and thus provides an assay to assess the methylation state of one or more genomic loci.

(124) A typical protocol for RRBS comprises the steps of digesting a nucleic acid sample with a restriction enzyme such as MspI, filling in overhangs and A-tailing, ligating adaptors, bisulfite conversion, and PCR. See, e.g., et al. (2005) Genome-scale DNA methylation mapping of clinical samples at single-nucleotide resolution Nat Methods 7: 133-6; Meissner et al. (2005) Reduced representation bisulfite sequencing for comparative high-resolution DNA methylation analysis Nucleic Acids Res. 33: 5868-77.

(125) In some embodiments, a quantitative allele-specific real-time target and signal amplification (QuARTS) assay is used to evaluate methylation state. Three reactions sequentially occur in each QuARTS assay, including amplification (reaction 1) and target probe cleavage (reaction 2) in the primary reaction; and FRET cleavage and fluorescent signal generation (reaction 3) in the secondary reaction. When target nucleic acid is amplified with specific primers, a specific detection probe with a flap sequence loosely binds to the amplicon. The presence of the specific invasive oligonucleotide at the target binding site causes cleavase to release the flap sequence by cutting between the detection probe and the flap sequence. The flap sequence is complementary to a nonhairpin portion of a corresponding FRET cassette. Accordingly, the flap sequence functions as an invasive oligonucleotide on the FRET cassette and effects a cleavage between the FRET cassette fluorophore and a quencher, which produces a fluorescent signal. The cleavage reaction can cut multiple probes per target and thus release multiple fluorophore per flap, providing exponential signal amplification. QuARTS can detect multiple targets in a single reaction well by using FRET cassettes with different dyes. See, e.g., in Zou et al. (2010) Sensitive quantification of methylated markers with a novel methylation specific technology Clin Chem 56: A199; U.S. patent application Ser. Nos. 12/946,737, 12/946,745, 12/946,752, and 61/548,639.

(126) The term bisulfite reagent refers to a reagent comprising bisulfite, disulfite, hydrogen sulfite, or combinations thereof, useful as disclosed herein to distinguish between methylated and unmethylated CpG dinucleotide sequences. Methods of said treatment are known in the art (e.g., PCT/EP2004/011715). It is preferred that the bisulfite treatment is conducted in the presence of denaturing solvents such as but not limited to n-alkylenglycol or diethylene glycol dimethyl ether (DME), or in the presence of dioxane or dioxane derivatives. In some embodiments the denaturing solvents are used in concentrations between 1% and 35% (v/v). In some embodiments, the bisulfite reaction is carried out in the presence of scavengers such as but not limited to chromane derivatives, e.g., 6-hydroxy-2,5,7,8,-tetramethylchromane 2-carboxylic acid or trihydroxybenzone acid and derivates thereof, e.g., Gallic acid (see: PCT/EP2004/011715). The bisulfite conversion is preferably carried out at a reaction temperature between 30 C. and 70 C., whereby the temperature is increased to over 85 C. for short times during the reaction (see: PCT/EP2004/011715). The bisulfite treated DNA is preferably purified prior to the quantification. This may be conducted by any means known in the art, such as but not limited to ultrafiltration, e.g., by means of Microcon columns (manufactured by Millipore). The purification is carried out according to a modified manufacturer's protocol (see, e.g., PCT/EP2004/011715).

(127) In some embodiments, fragments of the treated DNA are amplified using sets of primer oligonucleotides according to the present invention (e.g., see Tables 4 and 9) and an amplification enzyme. The amplification of several DNA segments can be carried out simultaneously in one and the same reaction vessel. Typically, the amplification is carried out using a polymerase chain reaction (PCR). Amplicons are typically 100 to 2000 base pairs in length.

(128) In another embodiment of the method, the methylation status of CpG positions within or near a marker comprising a DMR (e.g., DMR 1-229 as provided in Tables 1, 2, 3, 5, 6, 7, 8) may be detected by use of methylation-specific primer oligonucleotides. This technique (MSP) has been described in U.S. Pat. No. 6,265,171 to Herman. The use of methylation status specific primers for the amplification of bisulfite treated DNA allows the differentiation between methylated and unmethylated nucleic acids. MSP primer pairs contain at least one primer that hybridizes to a bisulfite treated CpG dinucleotide. Therefore, the sequence of said primers comprises at least one CpG dinucleotide. MSP primers specific for non-methylated DNA contain a T at the position of the C position in the CpG.

(129) The fragments obtained by means of the amplification can carry a directly or indirectly detectable label. In some embodiments, the labels are fluorescent labels, radionuclides, or detachable molecule fragments having a typical mass that can be detected in a mass spectrometer. Where said labels are mass labels, some embodiments provide that the labeled amplicons have a single positive or negative net charge, allowing for better delectability in the mass spectrometer. The detection may be carried out and visualized by means of, e.g., matrix assisted laser desorption/ionization mass spectrometry (MALDI) or using electron spray mass spectrometry (ESI).

(130) Methods for isolating DNA suitable for these assay technologies are known in the art. In particular, some embodiments comprise isolation of nucleic acids as described in U.S. patent application Ser. No. 13/470,251 (Isolation of Nucleic Acids).

(131) Methods

(132) In some embodiments the technology, methods are provided that comprise the following steps: 1) contacting a nucleic acid (e.g., genomic DNA, e.g., isolated from a body fluids such as a stool sample, a blood sample, or a tissue sample (e.g., esophageal tissue)) obtained from a subject with at least one reagent or series of reagents that distinguishes between methylated and non-methylated CpG dinucleotides within at least one marker comprising a DMR (e.g., DMR 1-78 as provided in Table 1, DMR 21, 188-193 as provided in Table 7, DMR 2-4, 6, 7, 14, 30, 77, 80, 82-86, 88, 90-102, 108, 122, 135, 136, 141, 142, 144, 146, 148-149, 152, 154, 156, 164, 166, 171, 173, 175, 178, 179, 181, 185, 187, 193-229 as provided in Table 8) and 2) detecting a lack of Barrett's esophagus (e.g., afforded with a sensitivity of greater than or equal to 80% and a specificity of greater than or equal to 80%).

(133) In some embodiments the technology, methods are provided that comprise the following steps: 1) contacting a nucleic acid (e.g., genomic DNA, e.g., isolated from a body fluids such as a stool sample, a blood sample, or a tissue sample (e.g., esophageal tissue)) obtained from a subject with at least one reagent or series of reagents that distinguishes between methylated and non-methylated CpG dinucleotides within at least one marker comprising a DMR (e.g., DMR 1-78 as provided in Table 1, DMR 21, 188-193 as provided in Table 7, DMR 2-4, 6, 7, 14, 30, 77, 80, 82-86, 88, 90-102, 108, 122, 135, 136, 141, 142, 144, 146, 148-149, 152, 154, 156, 164, 166, 171, 173, 175, 178, 179, 181, 185, 187, 193-229 as provided in Table 8) and 2) detecting a presence of Barrett's esophagus (e.g., afforded with a sensitivity of greater than or equal to 80% and a specificity of greater than or equal to 80%).

(134) In some embodiments the technology, methods are provided that comprise the following steps: 1) contacting a nucleic acid (e.g., genomic DNA, e.g., isolated from a body fluids such as a stool sample, a blood sample, or a tissue sample (e.g., esophageal tissue)) obtained from a subject with at least one reagent or series of reagents that distinguishes between methylated and non-methylated CpG dinucleotides within at least one marker comprising a DMR (e.g., DMR No. 3, 5, 30, 33, 43, 58, 77 and 79-128 as provided in Table 2, DMR No. 77, 27, 193, 90, 92, 101 and 129-134 as provided in Table 3, DMR No. 77, 90 and 135 as provided in Table 5, DMR No. 136-187 as provided in Table 6) and 2) classifying Barrett's esophagus or Barrett's esophageal dysplasia (e.g., afforded with a sensitivity of greater than or equal to 80% and a specificity of greater than or equal to 80%).

(135) In some embodiments the technology, methods are provided that comprise the following steps: 1) contacting a nucleic acid (e.g., genomic DNA, e.g., isolated from esophageal tissue (e.g., esophageal tissue obtained through whole esophageal swabbing or brushing)) obtained from a subject with at least one reagent or series of reagents that distinguishes between methylated and non-methylated CpG dinucleotides within at least one marker comprising a DMR (e.g., DMR No. 77, 90 and 135 as provided in Table 5) and 2) classifying Barrett's esophagus or Barrett's esophageal dysplasia (e.g., afforded with a sensitivity of greater than or equal to 80% and a specificity of greater than or equal to 80%).

(136) In some embodiments the technology, methods are provided that comprise the following steps: 1) contacting a nucleic acid (e.g., genomic DNA, e.g., isolated from esophageal tissue (e.g., esophageal tissue obtained through whole esophageal swabbing or brushing)) obtained from a subject with at least one reagent or series of reagents that distinguishes between methylated and non-methylated CpG dinucleotides within at least one marker comprising a DMR (e.g., DMR No. 77, 90 and 135 as provided in Table 5) and 2) classifying Barrett's esophageal low-grade dysplasia, Barrett's esophageal high-grade dysplasia, or esophageal adenocarcinoma (e.g., afforded with a sensitivity of greater than or equal to 80% and a specificity of greater than or equal to 80%).
Preferably, the sensitivity is from about 70% to about 100%, or from about 80% to about 90%, or from about 80% to about 85%. Preferably, the specificity is from about 70% to about 100%, or from about 80% to about 90%, or from about 80% to about 85%.

(137) Genomic DNA may be isolated by any means, including the use of commercially available kits. Briefly, wherein the DNA of interest is encapsulated in by a cellular membrane the biological sample must be disrupted and lysed by enzymatic, chemical or mechanical means. The DNA solution may then be cleared of proteins and other contaminants, e.g., by digestion with proteinase K. The genomic DNA is then recovered from the solution. This may be carried out by means of a variety of methods including salting out, organic extraction, or binding of the DNA to a solid phase support. The choice of method will be affected by several factors including time, expense, and required quantity of DNA. All clinical sample types comprising neoplastic matter or pre-neoplastic matter are suitable for use in the present method, e.g., cell lines, histological slides, biopsies, paraffin-embedded tissue, body fluids, stool, colonic effluent, urine, blood plasma, blood serum, whole blood, isolated blood cells, cells isolated from the blood, and combinations thereof.

(138) In some embodiments wherein the sample includes esophageal tissue, the sample is obtained through endoscopic techniques.

(139) In some embodiments wherein the sample includes esophageal tissue, the sample is obtained through endoscopic brushing or nonendoscopic whole esophageal brushing or swabbing using a tethered device (e.g. such as a capsule sponge, balloon, or other device).

(140) The technology is not limited in the methods used to prepare the samples and provide a nucleic acid for testing. For example, in some embodiments, a DNA is isolated from a stool sample or from blood or from a plasma sample using direct gene capture, e.g., as detailed in U.S. Pat. Appl. Ser. No. 61/485,386 or by a related method.

(141) The genomic DNA sample is then treated with at least one reagent, or series of reagents, that distinguishes between methylated and non-methylated CpG dinucleotides within at least one marker comprising a DMR (e.g., DMR 1-229, e.g., as provided by Tables 1, 2, 3, 5, 6, 7, 8).

(142) In some embodiments, the reagent converts cytosine bases which are unmethylated at the 5-position to uracil, thymine, or another base which is dissimilar to cytosine in terms of hybridization behavior. However in some embodiments, the reagent may be a methylation sensitive restriction enzyme.

(143) In some embodiments, the genomic DNA sample is treated in such a manner that cytosine bases that are unmethylated at the 5 position are converted to uracil, thymine, or another base that is dissimilar to cytosine in terms of hybridization behavior. In some embodiments, this treatment is carried out with bisulfate (hydrogen sulfite, disulfite) followed byt alkaline hydrolysis.

(144) The treated nucleic acid is then analyzed to determine the methylation state of the target gene sequences (at least one gene, genomic sequence, or nucleotide from a marker comprising a DMR, e.g., at least one DMR chosen from DMR 1-229, e.g., as provided in Tables 1, 2, 3, 5, 6, 7, 8). The method of analysis may be selected from those known in the art, including those listed herein, e.g., QuARTS and MSP as described herein.

(145) The technology relates to the analysis of any sample associated with an esophageal disorder (e.g., BE, BED, BE-LGD, BE-HGD, EAC). For example, in some embodiments the sample comprises a tissue and/or biological fluid obtained from a patient. In some embodiments, the sample comprises esophageal tissue. In some embodiments, the sample comprises esophageal tissue obtained through whole esophageal swabbing or brushing. In some embodiments, the sample comprises a secretion. In some embodiments, the sample comprises blood, serum, plasma, gastric secretions, pancreatic juice, a gastrointestinal biopsy sample, microdissected cells from an esophageal biopsy, esophageal cells sloughed into the gastrointestinal lumen, and/or esophageal cells recovered from stool. In some embodiments, the subject is human. These samples may originate from the upper gastrointestinal tract, the lower gastrointestinal tract, or comprise cells, tissues, and/or secretions from both the upper gastrointestinal tract and the lower gastrointestinal tract. The sample may include cells, secretions, or tissues from the liver, bile ducts, pancreas, stomach, colon, rectum, esophagus, small intestine, appendix, duodenum, polyps, gall bladder, anus, and/or peritoneum. In some embodiments, the sample comprises cellular fluid, ascites, urine, feces, pancreatic fluid, fluid obtained during endoscopy, blood, mucus, or saliva. In some embodiments, the sample is a stool sample.

(146) Such samples can be obtained by any number of means known in the art, such as will be apparent to the skilled person. For instance, urine and fecal samples are easily attainable, while blood, ascites, serum, or pancreatic fluid samples can be obtained parenterally by using a needle and syringe, for instance. Cell free or substantially cell free samples can be obtained by subjecting the sample to various techniques known to those of skill in the art which include, but are not limited to, centrifugation and filtration. Although it is generally preferred that no invasive techniques are used to obtain the sample, it still may be preferable to obtain samples such as tissue homogenates, tissue sections, and biopsy specimens. In some embodiments, the sample is obtained through esophageal swabbing or brushing or use of a sponge capsule device.

(147) In some embodiments, the technology relates to a method for treating a patient (e.g., a patient with BE, BED, BE-LGD, BE-HGD, and/or EAC), the method comprising determining the methylation state of one or more DMR as provided herein and administering a treatment to the patient based on the results of determining the methylation state. The treatment may be administration of a pharmaceutical compound, a vaccine, performing a surgery, imaging the patient, performing another test. Preferably, said use is in a method of clinical screening, a method of prognosis assessment, a method of monitoring the results of therapy, a method to identify patients most likely to respond to a particular therapeutic treatment, a method of imaging a patient or subject, and a method for drug screening and development.

(148) In some embodiments of the technology, a method for diagnosing an esophageal disorder (e.g., BE, BED, BE-LGD, BE-HGD, EAC) in a subject is provided. The terms diagnosing and diagnosis as used herein refer to methods by which the skilled artisan can estimate and even determine whether or not a subject is suffering from a given disease or condition or may develop a given disease or condition in the future. The skilled artisan often makes a diagnosis on the basis of one or more diagnostic indicators, such as for example a biomarker (e.g., a DMR as disclosed herein), the methylation state of which is indicative of the presence, severity, or absence of the condition.

(149) Along with diagnosis, clinical cancer prognosis (e.g., for BED, BE-LGD, BE-HGD, EAC) relates to determining the aggressiveness of the cancer and the likelihood of tumor recurrence to plan the most effective therapy. If a more accurate prognosis can be made or even a potential risk for developing the cancer can be assessed, appropriate therapy, and in some instances less severe therapy for the patient can be chosen. Assessment (e.g., determining methylation state) of cancer biomarkers is useful to separate subjects with good prognosis and/or low risk of developing cancer who will need no therapy or limited therapy from those more likely to develop cancer or suffer a recurrence of cancer who might benefit from more intensive treatments.

(150) As such, making a diagnosis or diagnosing, as used herein, is further inclusive of making determining a risk of developing cancer or determining a prognosis, which can provide for predicting a clinical outcome (with or without medical treatment), selecting an appropriate treatment (or whether treatment would be effective), or monitoring a current treatment and potentially changing the treatment, based on the measure of the diagnostic biomarkers (e.g., DMR) disclosed herein. Further, in some embodiments of the presently disclosed subject matter, multiple determinations of the biomarkers over time can be made to facilitate diagnosis and/or prognosis. A temporal change in the biomarker can be used to predict a clinical outcome, monitor the progression of esophageal disorder, and/or monitor the efficacy of appropriate therapies directed against the cancer. In such an embodiment for example, one might expect to see a change in the methylation state of one or more biomarkers (e.g., DMR) disclosed herein (and potentially one or more additional biomarker(s), if monitored) in a biological sample over time during the course of an effective therapy.

(151) The presently disclosed subject matter further provides in some embodiments a method for determining whether to initiate or continue prophylaxis or treatment of an esophageal disorder (e.g., BE, BED, BE-LGD, BE-HGD, EAC) in a subject. In some embodiments, the method comprises providing a series of biological samples over a time period from the subject; analyzing the series of biological samples to determine a methylation state of at least one biomarker disclosed herein in each of the biological samples; and comparing any measurable change in the methylation states of one or more of the biomarkers in each of the biological samples. Any changes in the methylation states of biomarkers over the time period can be used to predict risk of developing the esophageal disorder, predict clinical outcome, determine whether to initiate or continue the prophylaxis or therapy of the cancer, and whether a current therapy is effectively treating the esophageal disorder. For example, a first time point can be selected prior to initiation of a treatment and a second time point can be selected at some time after initiation of the treatment. Methylation states can be measured in each of the samples taken from different time points and qualitative and/or quantitative differences noted. A change in the methylation states of the biomarker levels from the different samples can be correlated with esophageal disorder risk, prognosis, determining treatment efficacy, and/or progression of the esophageal disorder in the subject.

(152) In preferred embodiments, the methods and compositions of the invention are for treatment or diagnosis of disease at an early stage, for example, before symptoms of the disease appear. In some embodiments, the methods and compositions of the invention are for treatment or diagnosis of disease at a clinical stage.

(153) As noted, in some embodiments, multiple determinations of one or more diagnostic or prognostic biomarkers can be made, and a temporal change in the marker can be used to determine a diagnosis or prognosis. For example, a diagnostic marker can be determined at an initial time, and again at a second time. In such embodiments, an increase in the marker from the initial time to the second time can be diagnostic of a particular type or severity of the esophageal disorder, or a given prognosis. Likewise, a decrease in the marker from the initial time to the second time can be indicative of a particular type or severity of an esophageal disorder, or a given prognosis. Furthermore, the degree of change of one or more markers can be related to the severity of the esophageal disorder and future adverse events. The skilled artisan will understand that, while in certain embodiments comparative measurements can be made of the same biomarker at multiple time points, one can also measure a given biomarker at one time point, and a second biomarker at a second time point, and a comparison of these markers can provide diagnostic information.

(154) As used herein, the phrase determining the prognosis refers to methods by which the skilled artisan can predict the course or outcome of a condition in a subject. The term prognosis does not refer to the ability to predict the course or outcome of a condition with 100% accuracy, or even that a given course or outcome is predictably more or less likely to occur based on the methylation state of a biomarker (e.g., a DMR). Instead, the skilled artisan will understand that the term prognosis refers to an increased probability that a certain course or outcome will occur; that is, that a course or outcome is more likely to occur in a subject exhibiting a given condition, when compared to those individuals not exhibiting the condition. For example, in individuals not exhibiting the condition (e.g., having a normal methylation state of one or more DMR), the chance of a given outcome (e.g., suffering from an esophageal disorder) may be very low.

(155) In some embodiments, a statistical analysis associates a prognostic indicator with a predisposition to an adverse outcome. For example, in some embodiments, a methylation state different from that in a normal control sample obtained from a patient who does not have an esophageal disorder can signal that a subject is more likely to suffer from an esophageal disorder than subjects with a level that is more similar to the methylation state in the control sample, as determined by a level of statistical significance. Additionally, a change in methylation state from a baseline (e.g., normal) level can be reflective of subject prognosis, and the degree of change in methylation state can be related to the severity of adverse events. Statistical significance is often determined by comparing two or more populations and determining a confidence interval and/or a p value (see, e.g., Dowdy and Wearden, Statistics for Research, John Wiley & Sons, New York, 1983). Exemplary confidence intervals of the present subject matter are 90%, 95%, 97.5%, 98%, 99%, 99.5%, 99.9% and 99.99%, while exemplary p values are 0.1, 0.05, 0.025, 0.02, 0.01, 0.005, 0.001, and 0.0001.

(156) In other embodiments, a threshold degree of change in the methylation state of a prognostic or diagnostic biomarker disclosed herein (e.g., a DMR) can be established, and the degree of change in the methylation state of the biamarker in a biological sample is simply compared to the threshold degree of change in the methylation state. A preferred threshold change in the methylation state for biomarkers provided herein is about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 50%, about 75%, about 100%, and about 150%. In yet other embodiments, a nomogram can be established, by which a methylation state of a prognostic or diagnostic indicator (biomarker or combination of biomarkers) is directly related to an associated disposition towards a given outcome. The skilled artisan is acquainted with the use of such nomograms to relate two numeric values with the understanding that the uncertainty in this measurement is the same as the uncertainty in the marker concentration because individual sample measurements are referenced, not population averages.

(157) In some embodiments, a control sample is analyzed concurrently with the biological sample, such that the results obtained from the biological sample can be compared to the results obtained from the control sample. Additionally, it is contemplated that standard curves can be provided, with which assay results for the biological sample may be compared. Such standard curves present methylation states of a biomarker as a function of assay units, e.g., fluorescent signal intensity, if a fluorescent label is used. Using samples taken from multiple donors, standard curves can be provided for control methylation states of the one or more biomarkers in normal tissue, as well as for at-risk levels of the one or more biomarkers in tissue taken from donors with metaplasia or from donors with an esophageal disorder (e.g., BE, BED, BE-LGD, BE-HGD, EAC). In certain embodiments of the method, a subject is identified as having an esophageal disorder upon identifying an aberrant methylation state of one or more DMR provided herein in a biological sample obtained from the subject. In other embodiments of the method, the detection of an aberrant methylation state of one or more of such biomarkers in a biological sample obtained from the subject results in the subject being identified as having an esophageal disorder (e.g., BE, BED, BE-LGD, BE-HGD, EAC).

(158) The analysis of markers can be carried out separately or simultaneously with additional markers within one test sample. For example, several markers can be combined into one test for efficient processing of a multiple of samples and for potentially providing greater diagnostic and/or prognostic accuracy. In addition, one skilled in the art would recognize the value of testing multiple samples (for example, at successive time points) from the same subject. Such testing of serial samples can allow the identification of changes in marker methylation states over time. Changes in methylation state, as well as the absence of change in methylation state, can provide useful information about the disease status that includes, but is not limited to, identifying the approximate time from onset of the event, the presence and amount of salvageable tissue, the appropriateness of drug therapies, the effectiveness of various therapies, and identification of the subject's outcome, including risk of future events.

(159) The analysis of biomarkers can be carried out in a variety of physical formats. For example, the use of microtiter plates or automation can be used to facilitate the processing of large numbers of test samples. Alternatively, single sample formats could be developed to facilitate immediate treatment and diagnosis in a timely fashion, for example, in ambulatory transport or emergency room settings.

(160) In some embodiments, the subject is diagnosed as having an esophageal disorder (e.g., BE, BED, BE-LGD, BE-HGD, EAC) if, when compared to a control methylation state, there is a measurable difference in the methylation state of at least one biomarker in the sample. Conversely, when no change in methylation state is identified in the biological sample, the subject can be identified as not having an esophageal disorder, not being at risk for the esophageal disorder, or as having a low risk of the esophageal disorder. In this regard, subjects having the esophageal disorder or risk thereof can be differentiated from subjects having low to substantially no esophageal disorder or risk thereof. Those subjects having a risk of developing an esophageal disorder can be placed on a more intensive and/or regular screening schedule, including endoscopic surveillance. On the other hand, those subjects having low to substantially no risk may avoid being subjected to an endoscopy or esophageal brushing, until such time as a future screening, for example, a screening conducted in accordance with the present technology, indicates that a risk of esophageal disorder has appeared in those subjects.

(161) As mentioned above, depending on the embodiment of the method of the present technology, detecting a change in methylation state of the one or more biomarkers can be a qualitative determination or it can be a quantitative determination. As such, the step of diagnosing a subject as having, or at risk of developing, an esophageal disorder indicates that certain threshold measurements are made, e.g., the methylation state of the one or more biomarkers in the biological sample varies from a predetermined control methylation state. In some embodiments of the method, the control methylation state is any detectable methylation state of the biomarker. In other embodiments of the method where a control sample is tested concurrently with the biological sample, the predetermined methylation state is the methylation state in the control sample. In other embodiments of the method, the predetermined methylation state is based upon and/or identified by a standard curve. In other embodiments of the method, the predetermined methylation state is a specifically state or range of state. As such, the predetermined methylation state can be chosen, within acceptable limits that will be apparent to those skilled in the art, based in part on the embodiment of the method being practiced and the desired specificity, etc.

(162) Further with respect to diagnostic methods, a preferred subject is a vertebrate subject. A preferred vertebrate is warm-blooded; a preferred warm-blooded vertebrate is a mammal. A preferred mammal is most preferably a human. As used herein, the term subject includes both human and animal subjects. Thus, veterinary therapeutic uses are provided herein. As such, the present technology provides for the diagnosis of mammals such as humans, as well as those mammals of importance due to being endangered, such as Siberian tigers; of economic importance, such as animals raised on farms for consumption by humans; and/or animals of social importance to humans, such as animals kept as pets or in zoos. Examples of such animals include but are not limited to: carnivores such as cats and dogs; swine, including pigs, hogs, and wild boars; ruminants and/or ungulates such as cattle, oxen, sheep, giraffes, deer, goats, bison, and camels; and horses. Thus, also provided is the diagnosis and treatment of livestock, including, but not limited to, domesticated swine, ruminants, ungulates, horses (including race horses), and the like. The presently-disclosed subject matter further includes a system for diagnosing an esophageal disorder (e.g., BE, BED, BE-LGD, BE-HGD, EAC) in a subject. The system can be provided, for example, as a commercial kit that can be used to screen for a risk of esophageal disorder or diagnose an esophageal disorder in a subject from whom a biological sample has been collected. An exemplary system provided in accordance with the present technology includes assessing the methylation state of a DMR as provided in Tables 1, 2, 3, 5, 6, 7 and/or 8.

EXAMPLES

Example I

(163) Molecular markers may aid in detection of Barrett's esophagus (BE) and surveillance of BE-related dysplasia (BED) by either endoscopic or non-endoscopic methods. Experiments were conducted to (1) identify and validate novel methylated DNA markers for BE dysplasia, (2) test the feasibility of candidate markers for detection of BE dysplasia from whole-esophageal brushings.

(164) Using whole methylome bisulfite sequencing on DNA from BE tissues with no dysplasia, low grade dysplasia (BE-LGD), high grade dysplasia (BE-HGD) or adenocarcinoma (EAC) (18 specimens per group), candidate markers were identified to separate BE from normal tissue, and to separate BED from BE without dysplasia.

(165) Tables 1 and 7 provide DMR information including chromosome number, gene annotation, and DMR start/stop position for such markers identified to separate BE from normal tissue (see, Example II for materials/methods utilized in generating Tables 1 and 7).

(166) Tables 2 and 6 provide DMR information including chromosome number, gene annotation, and DMR start/stop position for such markers identified to separate BED from BE without dysplasia (see, Example III for materials/methods utilized in generating Tables 2 and 6). Top candidate markers were validated by methylation-specific PCR assay in independent tissues including BE without dysplasia, BE-LGD, and BE-HGD (30-36 specimens per group).

(167) Consenting BE subjects scheduled for endoscopic BE surveillance or endoscopic assessment of BE related cancers underwent whole esophageal brushings using a high capacity cytology brush (Hobbs Medical, Stafford Springs, Conn.) with circumferential sampling from the cardia through the full esophageal length (BE+squamous mucosa) to simulate a swallowed sponge-on-string device. Following DNA extraction and bisulfite treatment, methylation on target genes was assayed by methylation-specific PCR or quantitative allele-specific real-time target and signal amplification. Marker levels were normalized to -actin (marker for total human DNA). 12 aberrantly methylated genes were identified that best discriminated BED with from BE without dysplasia (e.g. areas under ROC curve 0.86-0.97) (see, Table 3). These 12 markers were DIO3, MAX20.218, CD1D, T-SPYL5, ZNF568, ST8SIA1, ELMO1, ELOVL2, BMP3, NDRG4, HUNK, and CDKN2A. Table 3 DMR provides information including chromosome number, gene annotation, and DMR start/stop position for such markers identified to separate BED from BE without dysplasia within esophageal samples obtained through whole esophageal brushings. Table 4 provides forward primer and reverse primer information for the DMRs provided in Table 3. 39 subjects were studied with a median age of 69 (28-94) years, 74% were males, and median BE length was 4 (1-14) cm; 18 had no dysplasia and 21 had dysplasia (9 LGD, 7 HGD, and 5 EAC (4 asymptomatic early stage). A 3 marker set (DIO3, MAX20.218, NDRG4) (see, Table 5) at 95% specificity detected 78% of LGD, 71% of HGD, 100% of EAC and 81% of all dysplasia (see, FIG. 1). Table 5 provides DMR information including chromosome number, gene annotation, and DMR start/stop position for such markers identified to distinguish between LGD, HGD and EAC.

(168) TABLE-US-00001 TABLE 1 Information for DMRs distinguishing BE and normal tissue DMR Chromosome Gene DMR Start DMR End No. No. Annotation Transcript Position Position 1 chr19 ZNF256 NM_005773 58459137 58459219 2 chr19 ZNF568 NM_198539 37407197 37407284 3 chr5 IRX4 NM_016358 1883238 1883312 4 chr6 RGS17 NM_012419 153451813 153451881 5 chr7 GLI3 NM_000168 42276862 42277220 6 chr4 EPHA5 NM_182472; 66536122 66536220 NM_004439 7 chr10 SFMBT2 NM_001029880; 7451771 7451869 NM_001018039 8 chr3 WNT5A NM_003392 55522021 55522106 9 chr4 VEGFC NM_005429 177713309 177713364 10 chr5 ZNF354C NM_014594 178487249 178487299 11 chr19 ZNF85 NM_003429; 21106043 21106185 NR_034060 12 chr8 FAM150A NM_207413 53477546 53477636 13 chr1 NTNG1 NM_014917; 107684356 107684482 NM_001113226; NM_001113228 14 chr19 A1BG NM_130786 58859193 58859258 15 chr13 SPG20 NM_001142294; 36920933 36921108 NM_015087; NM_001142296; NM_001142295 16 chr3 EPHA6 NM_001080448 96533015 96533096 17 chr16 FOXF1 NM_001451 86542355 86542441 18 chr2 MYT1L NM_015025 1821558 1821642 19 chr9 99449250 99449346 20 chr7 84815089 84815157 21 chr19 ZNF682 NM_001077349; 20149796 20149923 NM_033196 22 chr8 PREX2 NM_025170; 68864872 68864921 NM_024870 23 chr1 WNT3A NM_033131 228195339 228195413 24 chr7 TFPI2 NM_006528 93520157 93520217 25 chr1 EDARADD NM_145861; 236559238 236559336 NM_080738 26 chr1 WNT3A NM_033131 228195101 228195175 27 chr16 NDRG4 NM_020465; 58497251 58497332 NM_001130487; NM_022910 28 chr19 15090770 15090853 29 chr8 49782979 49783039 30 chr12 DPY19L2 NM_173812 64061896 64062007 31 chr14 97685552 97685636 32 chr2 EFEMP1 NM_004105; 56150932 56150987 NM_001039348; NM_001039349 33 chr17 NGFR NM_002507 47574211 47574294 34 chr8 PREX2 NM_025170; 68864927 68865051 NM_024870 35 chr2 PXDN NM_012293 1748578 1748660 36 chr8 C8orf42 NM_175075 494156 494193 37 chr16 DKFZP434H168 NR_026889 56228448 56228463 38 chr14 FLRT2 NM_013231 85998492 85998535 39 chr20 SOX18 NM_018419 62680089 62680150 40 chr1 PIK3CD NM_005026 9711854 9711974 41 chr13 NALCN NM_052867 102069229 102069258 42 chr15 ATP10A NM_024490 26108587 26108685 43 chr10 GRID1 NM_017551 88125585 88125655 44 chr18 NOL4 NM_003787; 31802599 31802655 NM_001198548; NM_001198546; NM_001198547; NR_036752 45 chr5 FSTL4 NM_015082 132946635 132946746 46 chr16 DKFZP434H168 NR_026889 56228468 56228505 47 chr12 TBC1D30 NM_015279 65218475 65218525 48 chr2 GAL3ST2 NM_022134 242742873 242743049 49 chr12 47225496 47225592 50 chr11 FOLH1 NM_001193472; 49229987 49230073 NM_001193473; NM_004476; NM_001193471; NM_001014986 51 chr14 FLJ43390 NR_015358 62584108 62584204 52 chr21 TIAM1 NM_003253 32932297 32932372 53 chr4 SLIT2 NM_004787 20254997 20255028 54 chr6 28979210 28979409 55 chr2 1554621 1554768 56 chr12 PTPRO NM_002848; 15475654 15475697 NM_030667 57 chr4 HAND2 NM_021973 174451394 174451439 58 chr4 180980619 180980711 59 chr10 PPAPDC1A NM_001030059 122216135 122216312 60 chr17 FMNL1 NM_005892 43298763 43298872 61 chr4 FAT4 NM_024582 126237876 126237908 62 chr1 PRRX1 NM_006902; 170633637 170633683 NM_022716 63 chr5 SLC27A6 NM_014031; 128301108 128301233 NM_001017372 64 chr18 TCF4 NM_001083962; 53257019 53257106 NM_003199 65 chr14 FLRT2 NM_013231 85997993 85998139 66 chr20 SLC32A1 NM_080552 37353717 37353740 67 chr8 KCNB2 NM_004770 73450042 73450129 68 chr7 DPY19L2P4 NR_003551 89747980 89748001 69 chr17 19483467 19483522 70 chr10 GRID1 NM_017551 88125122 88125227 71 chr6 B3GAT2 NM_080742 71666972 71667038 72 chr7 42533077 42533175 73 chr19 ANKRD27 NM_032139 33167174 33167250 74 chr4 GABRA2 NM_001114175; 46392399 46392486 NM_000807 75 chr1 39044435 39044453 76 chr3 CHL1 NM_006614 238318 238401 77 chr14 DIO3 NM_001362 102026104 102026145 78 chr9 IGFBPL1 NM_001007563 38424583 38424652

(169) TABLE-US-00002 TABLE 2 Information for DMRs Distinguishing BE from BED DMR Chomosome Gene DMR Start DMR Stop No. No. Annotation Transcript Position Position 79 chr10 71267810 71267844 80 chr7 WNT2 NM_003391; 116964596 116964659 NR_024047 81 chr7 ARPC1B NM_005720 98990762 98990837 82 chr19 RGL3 NM_001035223; 11529371 11529430 NM_001161616 83 chr15 FEM1B NM_015322 68569729 68569799 84 chr15 ARNT2 NM_014862 80696170 80696177 85 chr15 LARP6 NM_197958; 71146759 71146820 NM_018357 86 chr7 ZC3HAV1L NM_080660 138720915 138720957 87 chr2 CYBRD1 NM_024843; 172379904 172379997 NM_001127383 88 chr15 Max.chr15.41877531.41877548 41877531 41877548 89 chr7 GTF2IRD1 NM_005685; 73894929 73895008 NM_001199207; NM_016328 90 chr20 Max.chr20.2188420.2188480 2188420 2188480 91 chr18 KLHL14 NM_020805 30351268 30351486 92 chr21 HUNK NM_014586 33246580 33246650 93 chr19 LOC100131691 NR_027334 59073783 59073952 94 chr13 Max.chr13.95620964.95621061 95620964 95621061 95 chr5 Max.chr5.926920.927009 926920 927009 96 chr6 C6orf114 NM_033069 13488436 13488530 97 chr8 ARHGEF10 NM_014629 1771362 1771477 98 chr20 VSTM2L NM_080607 36531194 36531312 99 chr3 ACAD11 NM_032169 132378234 132378296 100 chr12 WSB2 NM_018639 118500206 118500305 101 chr9 CDKN2A NM_000077; 21974710 21974763 NM_001195132; NM_058195; NM_058197 102 chr6 Max.chr6.27064706.27064783 27064706 27064783 103 chr6 SGK1 NM_001143676 134638972 134639020 104 chr6 SLC35B3 NM_015948; 8436074 8436140 NM_001142540; NM_001142541 105 chr1 PDE4DIP NM_022359; 145039649 145039883 NM_001198832 106 chr3 SOX2OT NR_004053 181413970 181414052 107 chr2 KLHL29 NM_052920 23609989 23610069 108 chr12 WIF1 NM_007191 65514995 65515089 109 chr5 EBF1 NM_024007 158526068 158526167 110 chr11 RDX NM_002906 110167594 110167690 111 chr6 LOC100526820 NR_037593 163837485 163837640 5 chr7 GLI3 NM_000168 42276862 42277220 112 chr7 EN2 NM_001427 155249880 155249949 113 chr10 ZNF365 NM_199450; 64133794 64133834 NM_199451; NM_014951 114 chr12 59990783 59990950 115 chr2 238480870 238480950 116 chr19 RYR1 NM_001042723; 39055744 39055882 NM_000540 117 chr3 PTPRG NM_002841 61549380 61549403 118 chr20 CYP24A1 NM_001128915; 52790139 52790206 NM_000782 119 chr19 GDF15 NM_004864 18499563 18499621 120 chr17 ULK2 NM_001142610; 19771310 19771382 NM_014683 121 chr18 SETBP1 NM_015559; 42261225 42261288 NM_001130110 122 chr7 DLX5 NM_005221 96653893 96653955 123 chr12 TRPV4 NM_021625 110271304 110271388 77 chr14 DIO3 NM_001362 102026104 102026145 43 chr10 GRID1 NM_017551 88125585 88125655 58 chr4 180980619 180980711 124 chr16 GPT2 NM_133443; 46963785 46963821 NM_001142466 125 chr10 PIP4K2A NM_005028 23003771 23003865 126 chr4 184718393 184718464 127 chr14 103726953 103727098 128 chr2 LOC91149 NR_026995 173600924 173601006 33 chr17 NGFR NM_002507 47574211 47574294 3 chr5 IRX4 NM_016358 1883238 1883312 30 chr12 DPY19L2 NM_173812 64061896 64062007

(170) TABLE-US-00003 TABLE 3 Information for DMRs Distinguishing BE from BED DMR Chromosome Gene DMR Start DMR End No. No. Annotation Transcript Position Position 129 Chr8 TSPYL5 98289858 98290220 130 chr12 ST8SIA1 22487528 22487620 131 Chr19 ZNF568 37407197 37407365 132 chr6 ELOVL2 11044395 11044834 133 Chr1 cd1d 158150797 158151205 134 Chr7 ELMO1 37487755 37488477 193 Chr4 BMP3 81031173 81031262 27 chr16 NDRG4 NM_020465; 58497251 58497332 NM_001130487; NM_022910 101 Chr9 CDKN2A NM_000077; 21974710 21974763 NM_001195132; NM_058195; NM_058197 90 Chr20 chr20.2188420.2188480 2188420 2188480 77 chr14 DIO3 NM_001362 1020261204 102026145 92 Chr21 HUNK NM_014586 33246580 3326650

(171) TABLE-US-00004 TABLE4 PrimersforDMRsProvidedinTable3. DMRNo. Marker ForwardPrimer(5-3) ReversePrimer(5-3) 129 TSPYL5 TGGCGGCGGAGGTAGTTT TCGATCCCGACCGAAAAC TAAAGATAC TAACGTC (SEQIDNO:1) (SEQIDNO:2) 130 ST8SIA1 GACGTTTGTCGTCGGGTT AAAAACCCTCCGCTACCA CGTTC CTTCGC (SEQIDNO:3) (SEQIDNO:4) 131 ZNF568 TTGAGATGTTGGGTGAAG CGCTAACGCGAAAAAATA GCGATTC ATTCGACG (SEQIDNO:5) (SEQIDNO:6) 132 ELOVL2 CGGTTTTATTTATTATGATTCGT CGACTACCCTAAACAACGCATCG AGCGG C (SEQIDNO:7) (SEQIDNO:8) 133 cd1d GCGCGTAGCGGCGTTTC CCCATATCGCCCGACGTA (SEQIDNO:9) A (SEQIDNO:10) 134 ELMO1 TTATATTTTTCGTTTTTA GAAAACCCGCCGAAACAT GTAATTTCGCGTTAGC TTCGA (SEQIDNO:11) (SEQIDNO:12) 193 BMP3 GTTTAATTTTCGGTTTCGTCGTC CGCTACGAAACACTCCGA (SEQIDNO:13) (SEQIDNO:14) 27 NDRG4 CGGTTTTCGTTCGTTTTTTCG CCGCCTTCTACGCGACTA (SEQIDNO:15) (SEQIDNO:16) 101 CDKN2A GGGGCGTTGTTTAACGTATCGAA GCTACAAACCCTCTACCCACCTA TAGTTAC AATCGAC (SEQIDNO:17) (SEQIDNO:18) 90 chr20.2188420.2 TTTTAGTAAGGGTCGTATTGGAC CAAAAACTCGCTAACACGAAACT 188480 GT CCCG (SEQIDNO:19) (SEQIDNO:20) 77 DIO3 GtTCGtCGttCGGGtC TCCTTCGCTaCCGAAAaCG (SEQIDNO:21) (SEQIDNO:22) 92 HUNK GttTCGttACGGATtCGtC TaCTCGTaaAAaaaCGCCG (SEQIDNO:23) (SEQIDNO:24)

(172) TABLE-US-00005 TABLE 5 Information for DMRs Distinguishing Between LGD, HGD and EAC, and Distinguishing Between BE and BED DMR Chromosome Gene DMR Start DMR End No. No. Annotation Transcript Position Position 135 Chr16 NDRG4 58497395 58497458 90 Chr20 chr20.2188420.2188480 2188420 2188480 77 chr14 DIO3 NM_001362 1020261204 102026145

(173) TABLE-US-00006 TABLE 6 Information for DMRs Distinguishing BE from BED DMR Chromosome Gene DMR Start/End No. No. Annotation Transcript Positions 136 14 VSX2 NM_182894 74724254-74724300 137 9 ROR2 NM_004560 94712523-94712575 138 9 ROR2 NM_004560 94712480-94712521 139 1 ERO1LB NM_019891 236444768-236444845 140 16 RAB11FIP3 NM_014700 476335-476351 141 15 HOMER2 NM_199332; 83621577-83621602 NM_004839; NM_199330; NM_199331 142 21 DSCR6 NM_018962 38379205-38379295 143 15 HOMER2 NM_199332; 83621302-83621420 NM_004839; NM_199330; NM_199331 144 4 C4orf48 NM_001168243; 2043778-2043860 NM_001141936 145 6 OGFRL1 NM_024576 71998477-71998657 146 8 TOX NM_014729 60031838-60032005 147 2 SERPINE2 NM_001136530; 224904018-224904069 NM_006216; NM_001136528 148 11 DENND5A NM_015213 9286532-9286607 149 13 TNFRSF19 NM_018647; 24153164-24153364 NM_148957 150 13 TNFRSF19 NM_018647; 24152949-24153119 NM_148957 151 14 CIDEB NM_014430 24780120-24780207 152 9 FBXO10 NM_012166 37576336-37576403 153 13 ATP12A NM_001676; 25254666-25254800 NM_001185085 154 9 CDKN2A NM_000077; 21975053-21975199 NM_001195132; NM_058195; NM_058197 155 10 STK32C NM_173575 134120900-134120935 156 19 LRP3 NM_002333 33685030-33685057 157 9 NCRNA00092 NR_024129 98783837-98783927 158 15 ARNT2 NM_014862 80697235-80697338 159 15 ARNT2 NM_014862 80696974-80697085 160 1 HTR6 NM_000871 19991341-19991374 161 6 SYNE1 NM_015293; 152623220-152623293 NM_182961; NM_033071 162 1 HTR6 NM_000871 19991278-19991318 163 19 LRP3 NM_002333 33685156-33685205 164 2 IGFBP2 NM_000597 217497874-217497957 165 1 MAX.chr1.244013647- 244013647-244014036 244014036 166 9 LPAR1 NM_057159; 113801112-113801189 NM_001401 167 6 SYNE1 NM_015293; 152623302-152623313 NM_182961; NM_033071 168 5 MCC NM_001085377; 112630385-112630541 NM_002387 169 2 SLC16A14 NM_152527 230933219-230933384 170 2 MAX.chr2.11623000- 11623000-11623066 11623066 171 3 ST3GAL6 NM_006100 98451352-98451466 172 10 STK32C NM_173575 134120798-134120896 173 10 NEURL NM_004210 105254137-105254241 174 2 INHBB NM_002193 121103407-121103512 175 14 PRIMA1 NM_178013 94255128-94255181 176 3 ST3GAL6 NM_006100 98451485-98451504 177 16 MPV17L NM_173803; 15489844-15489897 NM_001128423 178 4 MAX.chr4.184718755- 184718755-184718789 184718789 179 1 TTLL7 NM_024686 84464797-84464851 180 14 PRIMA1 NM_178013 94255078-94255084 181 20 DIDO1 NM_033081; 61560714-61560835 NM_001193369; NM_022105; NM_080797; NM_001193370; NM_080796 182 4 C4orf31 NM_024574 121992630-121992757 183 16 IRX3 NM_024336 54320149-54320196 184 19 LRP3 NM_002333 33685073-33685127 185 11 PRR5L NM_001160167; 36398162-36398218 NM_001160168; NM_024841 186 3 ST3GAL6 NM_006100 98451114-98451159 187 5 MAX.chr5.60921709- 60921709-60921808 60921808

(174) TABLE-US-00007 TABLE7 InformationforDMRsDistinguishingBEfromnormaltissue DMR Chromosome Gene DMR No. No. Annotation Coordinates ForwardMSPPrimer(5-3) ReverseMSPPrimer(5-3) 188 7 adcy1 45613877- GGTTCGGTTGTCGTAGCGC CCGACCGTAATCCTCGACGA 45614572 (SEQIDNO:25) (SEQIDNO:26) 189 7 LRRC4 127671993- GTTAATTTCGCGAGGTAGGCG CGTAATACAATACTCTTATAT 127672310 ACG ATTAACGCCGCG (SEQIDNO:27) (SEQIDNO:28) 190 19 ZNF569 37957760- TGTGGAATCGGGGTTTGTGTT CCCACCCAACACAAAAAATCC 37958046 CGC GACG (SEQIDNO:29) (SEQIDNO:30) 21 19 ZNF682 20149796- GGAGTTTATTTTGGGAAGAGT CCCCGCAATCGAAACAAACG 20149923 CGC (SEQIDNO:32) (SEQIDNO:31) 191 14 PTGDR 52735290- GGGTAGAGAATATATAGTGAA ACTAAATCACCTCCTACTACT 52735389 GAGTACGG AACGCT (SEQIDNO:33) (SEQIDNO:34) 192 10 SFMBT2 7452029- GCGACGTAGTCGTCGTTGT CCAACGCGAAAAAAACGCG 7452452 (SEQIDNO:35) (SEQIDNO:36)

Example II

(175) This example describes the materials and methods utilized in generating Tables 1 and 7.

(176) 18 Barrett's esophagus (BE) and 18 normal esophagus tissue samples were selected from institutional cancer registries at Mayo Clinic Rochester and were reviewed by an expert pathologist to confirm correct classification. Normal leukocyte controls were provided by the Mayo Biospecimens Linking Investigators and Clinicians to GIH Cell Signaling Research Clinical Core.

(177) Library Preparation: Genomic DNA (300 ng) was fragmented by digestion with 10 Units of MspI, a methylation-specific restriction enzyme which recognizes CpG-containing motifs, to enrich sample CpG content and eliminates redundant areas of the genome. Digested fragments were end-repaired and A-tailed with 5 Units of Klenow fragment (3-5 exo-), and ligated overnight to methylated TruSeq adapters (Illumina, San Diego Calif.) containing barcode sequences (to link each fragment to its sample ID.) Size selection of 160-340 bp fragments (40-220 bp inserts) was performed using Agencourt AMPure XP SPRI beads/buffer (Beckman Coulter, Brea Calif.). Buffer cutoffs were 0.7-1.1 sample volumes of beads/buffer. Final elution volume was 22 uL (EB bufferQiagen, Germantown Md.); qPCR was used to gauge ligation efficiency and fragment quality on a small sample aliquot. Samples then underwent bisulfite conversion (twice) using a modified EpiTect protocol (Qiagen). qPCR and conventional PCR (PfuTurbo Cx hotstartAgilent, Santa Clara Calif.) followed by Bioanalyzer 2100 (Agilent) assessment on converted sample aliquots determined the optimal PCR cycle number prior to final library amplification. The following conditions were used for final PCR: 1) each 50 uL reaction contained 5 uL of 10 buffer, 1.25 uL of 10 mM each deoxyribonucleotide triphosphate (dNTP), 5 uL primer cocktail (5 uM), 15 uL template (sample), 1 uL PfuTurbo Cx hotstart and 22.75 water; temperatures and times were 95 C-5 min; 98 C-30 sec; 16 cycles of 98 C-10 sec, 65 C-30 sec, 72 C-30 sec, 72 C-5 min and 4 C hold, respectively. Samples were combined (equimolar) into 4-plex libraries based on the randomization scheme and tested with the bioanalyzer for final size verification, and with qPCR using phiX standards and adaptor-specific primers.

(178) Sequencing and Bioinformatics: Samples were loaded onto flow cells according to a randomized lane assignment with additional lanes reserved for internal assay controls. Sequencing was performed by the Next Generation Sequencing Core at the Mayo Clinic Medical Genome Facility on the Illumina HiSeq 2000. Reads were unidirectional for 101 cycles. Each flow cell lane generated 100-120 million reads, sufficient for a median coverage of 30-50 fold sequencing depth (read number per CpG) for aligned sequences. Standard Illumina pipeline software called bases and sequenced read generation in the fastq format. As described previously, (28) SAAP-RRBS, a streamlined analysis and annotation pipeline for reduced representation bisulfite sequencing, was used for sequence alignment and methylation extraction.

(179) MSP Primer design: Primers for 6 top markers from the sequencing results were designed and ordered (IDT, Coralville Iowa) to target specific bisulfite-modified methylated sequences (table 7). The designs were done by either Methprimer software (University of California, San Francisco Calif.) or MSPPrimer (Johns Hopkins University, Baltimore, Md.). Assays were tested and optimized by qPCR with SYBR Green on dilutions of universally methylated and unmethylated genomic DNA controls.

(180) Methylation specific PCR: Quantitative MSP reactions were performed on independent tissue-extracted DNA: 108 BE samples36 with high grade dysplasia, 36 with low grade dysplasia, and 36 with no dysplasia, 18 normal esophagus samples, and 36 normal leukocyte samples.

(181) Statistical Analysis: Candidate CpGs were filtered by a priori read-depth and variance criteria, significance of differential %-methylation percentages between cases and controls and discrimination of cases from controls based on area under the receiver operating characteristics curve (AUC) and target to background ratio.

(182) For the RRBS discovery phase, the primary comparison of interest was the methylation difference between Barrett's cases, esophagus controls and leukocyte controls at each mapped CpG. CpG islands are biochemically defined by an observed to expected CpG ratio >0.6(30) However, for this model, tiled units of CpG analysis differentially methylated region (DMR) were created based on distance between CpG site locations for each chromosome. Islands with only single CpGs were excluded. Individual CpG sites were considered for differential analysis only if the total depth of coverage per disease group was 200 reads (an average of 10 reads/subject) and the variance of %-methylation was >0 (non-informative CpGs were excluded). Read-depth criteria were based on the desired statistical power to detect a 10% difference in the %-methylation between any two groups in which the sample size of each group was 18 individuals. Statistical significance was determined by logistic regression of the methylation percentage per DMR, based on read counts. To account for varying read depths across individual subjects, an over-dispersed logistic regression model was used, where dispersion parameter was estimated using the Pearson Chi-square statistic of the residuals from fitted model. DMRs, ranked according to their significance level, were further considered if %-methylation in benign esophagus and leukocyte controls, combined, was 1% but 10% in Barrett's cases. This resulted in 78 markers (Table 1). All had AUCs greater than 0.90 and fold changes greater than 25.

(183) For the 6 marker qMSP validation study (Table 7), the primary outcome was the area under the receiver operating characteristics curve (AUC) for each marker, as calculated from logistic regression models of the % methylated copy number per sample with BE in comparison to normal esophagus and normal leukocytes. For each marker, AUCs were again >0.90 and the quantitative difference in mean values of candidate genomic copy number per sample between cases and controls were at least 50-fold.

Example III

(184) This example describes the materials and methods utilized in generating Tables 2 and 6.

(185) 36 Barrett's esophagus with high and low dysplasia (BED) and 18 Barrett's esophagus with no dysplasia (BE) tissue samples were selected from institutional cancer registries at Mayo Clinic Rochester and were reviewed by an expert pathologist to confirm correct classification. 18 Normal leukocyte controls were provided by the Mayo Biospecimens Linking Investigators and Clinicians to GIH Cell Signaling Research Clinical Core.

(186) Library Preparation: Genomic DNA (300 ng) was fragmented by digestion with 10 Units of MspI, a methylation-specific restriction enzyme which recognizes CpG-containing motifs, to enrich sample CpG content and eliminates redundant areas of the genome. Digested fragments were end-repaired and A-tailed with 5 Units of Klenow fragment (3-5 exo-), and ligated overnight to methylated TruSeq adapters (Illumina, San Diego Calif.) containing barcode sequences (to link each fragment to its sample ID.) Size selection of 160-340 bp fragments (40-220 bp inserts) was performed using Agencourt AMPure XP SPRI beads/buffer (Beckman Coulter, Brea Calif.). Buffer cutoffs were 0.7-1.1 sample volumes of beads/buffer. Final elution volume was 22 uL (EB bufferQiagen, Germantown Md.); qPCR was used to gauge ligation efficiency and fragment quality on a small sample aliquot. Samples then underwent bisulfite conversion (twice) using a modified EpiTect protocol (Qiagen). qPCR and conventional PCR (PfuTurbo Cx hotstartAgilent, Santa Clara Calif.) followed by Bioanalyzer 2100 (Agilent) assessment on converted sample aliquots determined the optimal PCR cycle number prior to final library amplification. The following conditions were used for final PCR: 1) each 50 uL reaction contained 5 uL of 10 buffer, 1.25 uL of 10 mM each deoxyribonucleotide triphosphate (dNTP), 5 uL primer cocktail (5 uM), 15 uL template (sample), 1 uL PfuTurbo Cx hotstart and 22.75 water; temperatures and times were 95 C-5 min; 98 C-30 sec; 16 cycles of 98 C-10 sec, 65 C-30 sec, 72 C-30 sec, 72 C-5 min and 4 C hold, respectively. Samples were combined (equimolar) into 4-plex libraries based on the randomization scheme and tested with the bioanalyzer for final size verification, and with qPCR using phiX standards and adaptor-specific primers.

(187) Sequencing and Bioinformatics: Samples were loaded onto flow cells according to a randomized lane assignment with additional lanes reserved for internal assay controls. Sequencing was performed by the Next Generation Sequencing Core at the Mayo Clinic Medical Genome Facility on the Illumina HiSeq 2000. Reads were unidirectional for 101 cycles. Each flow cell lane generated 100-120 million reads, sufficient for a median coverage of 30-50 fold sequencing depth (read number per CpG) for aligned sequences. Standard Illumina pipeline software called bases and sequenced read generation in the fastq format. As described previously, (28) SAAP-RRBS, a streamlined analysis and annotation pipeline for reduced representation bisulfate sequencing, was used for sequence alignment and methylation extraction.

(188) MSP Primer design: Primers for the top 66 markers from the sequencing results were designed and ordered (IDT, Coralville Iowa) to target specific bisulfate-modified methylated sequences (table 7). The designs were done by either Methprimer software (University of California, San Francisco Calif.) or MSPPrimer (Johns Hopkins University, Baltimore, Md.). Assays were tested and optimized by qPCR with SYBR Green on dilutions of universally methylated and unmethylated genomic DNA controls.

(189) Methylation specific PCR: Quantitative MSP reactions were performed on independent tissue-extracted DNA: 108 BE samples36 with high grade dysplasia, 36 with low grade dysplasia, and 36 with no dysplasia, 18 normal esophagus samples, and 36 normal leukocyte samples.

(190) Statistical Analysis: Candidate CpGs were filtered by a priori read-depth and variance criteria, significance of differential %-methylation percentages between cases and controls and discrimination of cases from controls based on area under the receiver operating characteristics curve (AUC) and target to background ratio.

(191) For the RRBS discovery phase, the primary comparison of interest was the methylation difference between Barrett's cases with high and low grade dysplasia, Barrett's with no dysplasia controls, and leukocyte controls at each mapped CpG. CpG islands are biochemically defined by an observed to expected CpG ratio >0.6. (30) However, for this model, tiled units of CpG analysis differentially methylated region (DMR) were created based on distance between CpG site locations for each chromosome. Islands with only single CpGs were excluded. Individual CpG sites were considered for differential analysis only if the total depth of coverage per disease group was 200 reads (an average of 10 reads/subject) and the variance of %-methylation was >0 (non-informative CpGs were excluded). Read-depth criteria were based on the desired statistical power to detect a 10% difference in the %-methylation between any two groups in which the sample size of each group was 18 individuals. Statistical significance was determined by logistic regression of the methylation percentage per DMR, based on read counts. To account for varying read depths across individual subjects, an over-dispersed logistic regression model was used, where dispersion parameter was estimated using the Pearson Chi-square statistic of the residuals from fitted model. DMRs, ranked according to their significance level, were further considered if %-methylation in benign esophagus and leukocyte controls, combined, was 1% but 10% in Barrett's cases. This resulted in 57 markers (Table 2). All had AUCs between 0.60 and 0.87 and fold changes between 2 and 10. A second sorting of the data was performed, loosening the island restriction metrics and focusing on groupings of highly discriminate single CpGs. A batch to batch effect on the leukocyte controls was also removed which increased the overall coverage. This resulted in 52 additional markers with increased fold changes (7-52) and similar AUCs (Table 6).

(192) For the 66 DMR qMSP validation study, the primary outcome was the area under the receiver operating characteristics curve (AUC) for each marker, as calculated from logistic regression models of the % methylated copy number per sample with BED in comparison to BE and normal leukocytes. 12 markers demonstrated superior performance (Table 3). AUCs were 0.86-0.97 and fold changes 2-24. 10 of the 12 markers, along with BMP3 and NDRG4, were carried into the esophageal brushing feasibility study.

Example IV

(193) This example describes the materials and methods utilized in generating Tables 3, 4 and 5.

(194) Consenting BE subjects scheduled for endoscopic BE surveillance or endoscopic assessment of BE related cancers underwent whole esophageal brushings using a high capacity cytology brush (Hobbs Medical, Stafford Springs, Conn.) with circumferential sampling from the cardia through the full esophageal length (BE+squamous mucosa). The cytology brush was removed from the handle and placed into a vial of stability/cell lysis solution and frozen until processing. DNA was extracted using the Gentra Puregene Buccal procedure (Qiagen, Valencia, Calif.). 2 ug of DNA from each patient sample was treated with sodium bisulfite and purified using the EZ DNA Methylation kit (Zymo Research, Irvine, Calif.). MSP was performed using 20 ng of converted DNA on the 10 of the 12 validated DMRs from the BED vs. BE study (Table 3). The primer sequences are highlighted in Table 4. In addition the BMP3 and NDRG4 Cologuard QuARTs assays were run. The method of DeLong, DeLong and Clarke-Pearson was used to compare AUCs and measure significance of differences. A Bonferroni correction was used to avoid bias from multiple comparisons. The 3 markers which (in combination) demonstrated the highest discrimination for BED vs. BE are listed in Table 5.

Example V

(195) This example demonstrates the discovery, validation and feasibility testing of methylated DNA markers for detection of Barrett's Esophagus.

(196) Phase 1 Methods and Results:

(197) Pathologist verified FFPE tissues were provided by the Mayo Clinic Tissue Registry. Clinical groups consisted of patients with Barrett's HGD (N=34), Barrett's LGD (N=34), Barrett's no dysplasia (N=34), esophageal adenocarcinomas (N=12), esophageal squamous cell carcinomas (N=12), normal cardia (N=13), normal esophagus (N=25). DNA was purified using the Qiagen Mini kit and quantified by absorbance and picogreen analysis. Bisulfite conversion was performed using the Zymo method. Methylation markers consisted of top candidates from 3 categories of RRBS subsets: 1) 45 BED vs. BE DMRs (differentially methylated regions), 2) 5 BE vs. normal esophagus DMRs, and 3) 33 previously validated esophageal cancer markers. (Note: All of these DMRs were previously filtered against normal leukocytes for <1% background methylation.) Methylation specific PCR (MSP) primers were designed for each of these genomic regions and tested on 3 sets of methylation controls for performance. Table 8 provides DMR information including chromosome number, gene annotation, and DMR start/stop position for such markers identified to separate BE from normal tissue. QMSP (SYBR Green) was performed using Roche 480 LightCyclers. Serially diluted universal methylated DNA was used as a standard. In addition, QuARTs assays were run on the markers BMP3, NDRG4, SFMBT2, and VAV3. These latter 4 include 2 reference genes -actin and ZDHHC1 in their triplex assay formats.

(198) Results were normalized against -actin and ZDHHC1 and analyzed logistically in JMP. Areas under the ROC curve (AUC) were calculated along with fold changes and p-values. Performance cut-offs for phase 2 were AUC 0.95, fold change 25, and p-value 0.1. 13 markers passed these criteria: CDKN2A, SFMBT2, VAV3, DIO3, ELMO1, FEM1B, HUNK, ADCY1, CD1D, ST3GAL6, LRRC4, NDRG4, and BMP3 (Table 9 provides the identity and primer sequences for these assays including OPLAH).

(199) TABLE-US-00008 TABLE 8 Information for DMRs distinguishing BE and normal tissue DMR Gene Chromosome DMR Start and End No. Annotation No. Position 2 ZNF568 19 37407197-37407284 3 IRX4 5 1883238-1883312 4 RGS17 6 153451813-153451881 6 EPHA5 4 66536122-66536220 7 SFMBT2.1869 10 7451771-7451869 14 A1BG 19 58859193-58859258 30 DPY19L2 12 64061896-64062007 77 DIO3 14 102026104-102026145 80 WNT2 7 116964596-116964659 82 RGL3 19 11529371-11529430 83 FEM1B 15 68569729-68569799 84 ARNT2 15 80696170-80696177 85 LARP6 15 71146759-71146820 86 ZC3HAV1L 7 138720915-138720957 88 Max.chr15.41877531.41877548 15 41877531-41877548 90 Max.chr20.2188420.2188480 20 2188420-2188480 91 KLHL14 18 30351268-30351486 92 HUNK 21 33246580-33246650 93 LOC100131691 19 59073783-59073952 94 Max.chr13.95620964.95621061 13 95620964-95621061 95 Max.chr5.926920.927009 5 926920-927009 96 C6orf114 6 13488436-13488530 97 ARHGEF10 8 1771362-1771477 98 VSTM2L 20 36531194-36531312 99 ACAD11 3 132378234-132378296 100 WSB2 12 118500206-118500305 101 CDKN2A 9 21974710-21974763 102 Max.chr6.27064706.27064783 6 27064706-27064783 108 WIF1 12 65514995-65515089 122 DLX5 7 96653893-96653955 135 NDRG4 16 58497395-58497451 136 VSX2 14 74724254-74724300 141 HOMER2 15 83621577-83621602 142 DSCR6 21 38379205-38379295 144 C4orf48 4 2043778-2043860 146 TOX 8 60031838-60032005 148 DENND5A 11 9286532-9286607 149 TNFRSF19 13 24153164-24153364 152 FBXO10 9 37576336-37576403 154 CDKN2A 9 21975053-21975199 156 LRP3 19 33685030-33685057 164 IGFBP2 2 217497874-217497957 166 LPAR1 9 113801112-113801189 171 ST3GAL6 3 98451352-98451466 173 NEURL 10 105254137-105254241 175 PRIMA1 14 94255128-94255181 178 MAX.chr4.184718755-184718789 4 184718755-184718789 179 TTLL7 1 84464797-84464851 181 DIDO1 20 61560714-61560835 185 PRR5L 11 36398162-36398218 187 MAX.chr5.60921709-60921808 5 60921709-60921808 193 BMP3 4 81952348-81952402 194 VAV3 1 108507608-108507679 195 CYP26C1.F 10 94822416-94822607 196 EMX1.F 2 73147710-73147772 197 LOC645323.R 7 25896389-25896501 198 ELOVL2.F 6 11044395-11044834 199 FLI1.F 11 128563956-128564209 200 KCNK12 2 47797187-47797452 201 SFMBT2.893 10 7450242-7450831 202 SFMBT2.895 10 7452029-7452452 203 ZNF625.F 19 12267378-12267677 204 ELMO1.F 7 37487755-37488477 205 ST8SIA1.F 12 22487528-22487620 206 ZNF568.R 19 37407197-37407365 207 GRIN2D.R 19 48918144-48918350 208 TBX15.F 1 119527066-119527655 209 TSPYL5.F 8 98289858-98290220 210 ZNF610.R 19 52839503-52840013 211 ZNF671.F 19 58238810-58238955 212 ZNF781.F 19 38182950-38183127 213 ADCY11 7 45613877-45614572 214 C13orf18 13 46960767-46961669 215 CD1D 1 158150797-158151205 216 AK055957 (chr12.133) 12 133484978-133485739 217 CLEC11A 19 51228217-51228732 218 RSPO3 6 127440492-127441039 219 TOX2 20 42544780-42544835 220 VWC2 7 49813135-49814168 221 DOCK10.F 2 225907226-225907322 222 LRRC4.R 7 127671993-127672310 223 MAX.chr11.123301058.123301255.R 11 123301058-123301255 224 STC.ZNF569.R 19 37957760-37958046 225 ZNF682.R 19 20149796-20149923 226 GRM8.F 7 126891703-126892479 227 PTGDR.R 14 52735290-52735389 228 OPLAH 8 145106349-145106456 229 SFMBT2 10 7452885-7452956

(200) TABLE-US-00009 TABLE9 PrimersforspecificDMRsProvidedDescribedinExampleV. DMR No. Marker ForwardPrimer(5-3) ReversePrimer(5-3) Probe 204 ELMO1.F TTATATTTTTCGTTTTTA GAAAACCCGCCGAAACAT GTAATTTCGCGTTAGC TTCGA (SEQIDNO:11) (SEQIDNO:12) 213 ADCY1 GGTTCGGTTGTCGTAGCG CCGACCGTAATCCTCGAC C GA (SEQIDNO:25) (SEQIDNO:26) 215 CD1D GCGCGTAGCGGCGTTTC CCCATATCGCCCGACGTA (SEQIDNO:9) A (SEQIDNO:10) 222 LRRC4.4 GTTAATTTCGCGAGGTAG CGTAATACAATACTCTTA GCGACG TATATTAACGCCGCT (SEQIDNO:27) (SEQIDNO:28) 228 OPLAH TGCGTAGGTGATAGGGAG ACAAAACACATCCTATTA GGGTTAC ACGCGAA (SEQIDNO:47) (SEQIDNO:48) 101 CDKN2A GGGGCGTTGTTTAACGTATCGA GCTACAAACCCTCTACCCACCT ATAGTTAC AAATCGAC (SEQIDNO:17) (SEQIDNO:18) 77 DIO3 GtTCGtCGttCGGGtC TCCTTCGCTaCCGAAAaCG (SEQIDNO:21) (SEQIDNO:22) 83 FEM1B tTtttAtATTTCGGGAAtTtAG TaAaCCGaaaTTAaaaAAaaaa AAACGtC TTaCGCG (SEQIDNO:49) (SEQIDNO:50) 92 HUNK GttTCGttACGGATtCGtC TaCTCGTaaAAaaaCGCCG (SEQIDNO:23) (SEQIDNO:24) 171 ST3GAL6 GTTTCGTTCGAAAGGTAGGGGT CGAATCTCCCGAAAAATAAAAC TCG GTT (SEQIDNO:37) (SEQIDNO:38) 193 BMP3 GTTTAATTTTCGGTTTCGTCGT CGCTACGAAACACTCCGA CGCCGAGGCGGTTTTTTGCG C (SEQIDNO:14) (SEQIDNO:43) (SEQIDNO:13) 135 NDRG4 CGGTTTTCGTTCGTTTTTTCG CCGCCTTCTACGCGACTA CCACGGACGGTTCGTTTATCG (SEQIDNO:15) (SEQIDNO:16) (SEQIDNO:44) 194 VAV3 TCGGAGTCGAGTTTAGCGC CGAAATCGAAAAAACAAAAACC CGCCGAGGCGGCGTTCGCGA (SEQIDNO:39) GC (SEQIDNO:45) (SEQIDNO:40) 229 SFMBT2 GTCGTCGTTCGAGAGGGTA CGAACAAAAACGAACGAACGAA CCACGGACGATCGGTTTCGTT (SEQIDNO:41) (SEQIDNO:42) (SEQIDNO:46)
Phase 2 Methods and Results:

(201) 49 cases with and 36 controls without BE were recruited prior to endoscopy. Median age was 69 (range 63-73) and 59 (45-67) and men comprised 92% and 42%, respectively. BE cases had >1 cm (median=2 cm; IQR 4-8) of circumferential columnar mucosa with confirmed intestinal metaplasia; controls had no BE endoscopically. Specimens were obtained using a high capacity endoscopic cytology brush (Hobbs Medical, Stafford Springs Conn.); the cardia, BE (in cases), and full esophageal length were brushed to simulate a swallowed sponge sampling device. The brush was placed in a 2 ml vial containing lysis buffer and promptly frozen at 80 C. Samples were thawed and processed as a batch in blinded fashion. Following vigorous vortexing of the vial to remove all cellular material from the brush, DNA was purified using the Gentra Puregene kit (Qiagen). This method allows for the simultaneous harvesting of both free and cellular DNA. Samples were then treated with sodium bisulfite and recovered using the EZ DNA methylation kit (Zymo Research).

(202) Methylation of the 13 target genes was assayed by QMSP and QuARTs as before on Roche 480 LightCyclers. -actin and ZDHHC1 were also quantified as markers for total human DNA. Several markers (e.g. BMP3, CDKN2A, CD1D, HUNK, ELMO1, DIO3) showed exceptional discrimination for BE with AUCs 0.91-0.97; methylation level distributions from BE cases and controls differed substantially (FIG. 2). Methylation levels correlated with BE length and presence of dysplasia, p<0.05. FIG. 3 shows a hit matrix of top methylated DNA markers from Phase 2 highlighting complementarity (endoscopic brush study).

(203) 10 Barrett's specific markers were chosen for phase 3 testing: BMP3, NDRG4, VAV3, SFMBT2, DIO3, HUNK, ELMO1, CD1D, CDKN2A, and OPLAH. OPLAH was not included in the earlier phases, but was added here due to its excellent performance in discriminating esophageal cancers from normal tissue.

(204) Phase 3 Methods and Results:

(205) A capsule sponge device (EsophaCap, Capnostics) was swallowed and withdrawn in 10 cases with BE and 12 controls without apparent BE followed by endoscopy within 24 hours. Among 10 cases and 12 controls, median age was 65 (59-69) and 40 (34-61) and men comprised 70% and 45%, respectively. Median BE length was 4.5 cm (IQR 2-9). The device was then placed in a vial containing 20 mL of cell preservation buffer (PreservCyt). Samples were vortexed and transferred into a 50 mL centrifuge tube. This step was repeated with an additional aliquot of PreservCyt for a total of 40 ml. The cells were pelleted and lysed in 1 mL of buffer (Puregene Buccal Cell Kit) and extracted following the manufacturer's directions. A second extraction method (MaxwellPromega) was also tested. Following bisulfite conversion (Zymo Research), the samples were assayed by QPCR as before. Distributions of top markers from the sponge were highly discriminant for BE. At 100% specificity, a panel of markers detected all 9 BE cases (1 did not meet inclusion criteria) meeting inclusion criteria (100% sensitivity).

(206) FIG. 4 shows methylated DNA marker levels (PCR copies/30 ng DNA) in BE cases and normal (Nl) controls from Phase 3 (capsule sponge study).

(207) All publications and patents mentioned in the above specification are herein incorporated by reference in their entirety for all purposes. Various modifications and variations of the described compositions, methods, and uses of the technology will be apparent to those skilled in the art without departing from the scope and spirit of the technology as described. Although the technology has been described in connection with specific exemplary embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in pharmacology, biochemistry, medical science, or related fields are intended to be within the scope of the following claims.