Herpesvirus with Modified Glycoprotein H for Propagation in a Cell

Abstract

The present invention is directed to a recombinant herpesvirus which comprises the GCN4 yeast transcription factor or a part thereof fused to or inserted into glycoprotein H and is capable of binding to a target molecule present on a cell for propagation and production of the herpesvirus. The herpesvirus may comprise additional modification in glycoprotein D and/or glycoprotein B for retargeting the herpesvirus to a diseased cell. The present invention is further directed to a nucleic acid and a vector coding for the gH, a polypeptide comprising the gH, and a cell comprising the herpesvirus, nucleic acid, vector or polypeptide. Moreover, the present invention is directed to a cell having accessible on the surface a target molecule for the GCN4 yeast transcription factor or part thereof and to a method for producing the herpesvirus in said cell.

Claims

1. A recombinant herpesvirus comprising a peptide having a length of 5 to 274 amino acids, fused to or inserted into glycoprotein H (gH) present in the envelope of the herpesvirus.

2. The herpesvirus according to claim 1, wherein the peptide has a length of 5 to 200 amino acids, preferably of 11 to 29, 31 to 39, 41 to 49 or 51 to 200 amino acids, more preferably of 12 to 20 amino acids.

3. The herpesvirus according to claim 1 or 2, wherein the peptide comprises a part of the GCN4 yeast transcription factor, preferably the part of the GCN4 yeast transcription factor as comprised by SEQ ID NO: 13, most preferably the peptide is the peptide identified by SEQ ID NO: 13.

4. The herpesvirus according to any one of claims 1 to 3, wherein the peptide is inserted within the N-terminal region starting at any one of amino acids 19 to 23 and ending at any one of amino acids 48 to 88 or starting at amino acid 116 and ending at amino acid 136 of the gH according to SEQ ID NO: 1 or a corresponding region of a homologous gH.

5. The herpesvirus according to any one of claims 1 to 4, wherein the peptide is inserted N-terminally of the H1A domain of gH.

6. The herpesvirus according to any one of claims 1 to 5, wherein one or more gH amino acids of the N-terminal region are deleted.

7. The herpesvirus according to any one of claims 1 to 6, wherein the herpesvirus has the capability of binding to a cell expressing or binding a target molecule via the peptide, preferably of fusing with the cell membrane, more preferably of entering the cell, most preferably of propagating within the cell.

8. The herpesvirus according to claim 7, wherein the target molecule is the scFv as comprised by SEQ ID NO: 5, most preferably the molecule identified by the sequence of SEQ ID NO: 7.

9. The herpesvirus according to any one of claims 1 to 8, wherein the herpesvirus comprises a gD which is modified to retarget the herpesvirus to a diseased cell and/or a gB which is modified to retarget the herpesvirus to a diseased cell.

10. The herpesvirus according to any one of claims 1 to 9, wherein the herpesvirus encodes one or more molecule(s) that stimulate(s) the host immune response against a cell, preferably a diseased cell.

11. A pharmaceutical composition comprising the herpesvirus according to any one of claims 1 to 10 and a pharmaceutically acceptable carrier, optionally additionally comprising one or more molecule(s) that stimulate(s) the host immune response against a cell, preferably a diseased cell.

12. The herpesvirus according to any one of claims 1 to 10, optionally in combination with one or more molecule(s) that stimulate(s) the host immune response against a cell, preferably a diseased cell, for use in the treatment of a tumor, infection, degenerative disorder or senescence-associated disease.

13. A nucleic acid molecule comprising a nucleic acid coding for the gH, as defined in any one of claims 1 to 8, having fused or inserted the peptide.

14. A vector comprising the nucleic acid molecule according to claim 13.

15. A polypeptide comprising the gH, as defined in any one of claims 1 to 8, having fused or inserted the peptide.

16. A cell comprising the herpesvirus according to any one of claims 1 to 10, the nucleic acid molecule according to claim 13, the vector according to claim 14, or the polypeptide according to claim 15.

17. The cell according to claim 16, wherein the cell is a cultured cell suitable for growth of herpesvirus, more preferably a cell line approved for growth of herpesvirus, still more preferably a Vero, 293, 293T, HEp-2, HeLa, BHK, or RS cell, most preferably a Vero cell.

18. A cell or the cell according to claim 16 or 17, wherein the cell comprises an artificial molecule capable of binding to the peptide comprised by the recombinant herpesvirus according to any one of claims 1 to 10, preferably to a part of the GCN4 yeast transcription factor, most preferably to the part of the GCN4 yeast transcription factor as comprised by SEQ ID NO: 13, accessible on the surface of the cell, preferably wherein the artificial molecule is an antibody, more preferably an antibody derivative, still more preferably an scFv, still more preferably an scFv capable of binding a part of the GCN4 yeast transcription factor, still more preferably an scFv capable of binding to the part of the GCN4 yeast transcription factor as comprised by SEQ ID NO: 13, still more preferably the scFv as comprised by SEQ ID NO: 5, most preferably the molecule identified by the sequence of SEQ ID NO: 7.

19. An in-vitro method for producing a recombinant herpesvirus in a cell using the herpesvirus according to any one of claims 1 to 10, wherein the cell comprises an artificial molecule capable of binding to the peptide comprised by the recombinant herpesvirus according to any one of claims 1 to 9, preferably to a part of the GCN4 yeast transcription factor, most preferably to the part of the GCN4 yeast transcription factor as comprised by SEQ ID NO: 13, accessible on the surface of the cell, preferably wherein the artificial molecule is an antibody, more preferably an antibody derivative, still more preferably an scFv, still more preferably an scFv capable of binding a part of the GCN4 yeast transcription factor, still more preferably an scFv capable of binding to the part of the GCN4 yeast transcription factor as comprised by SEQ ID NO: 13, still more preferably the scFv as comprised by SEQ ID NO: 5, most preferably the molecule identified by the sequence of SEQ ID NO: 7.

Description

FIGURES

[0086] FIG. 1 Schematic drawing of the chimeric scFv to GCN4Nectin receptor. The receptor presents N-terminal leader peptide and HA tag sequence, followed by the scFv to GCN4, placed between two short linker, GA and GSGA linker. The second part of the molecule corresponds to human Nectin-1 (PVRL1) residues Met143 to Val517 comprising the Nectin-1 extracellular domains 2 and 3, the TM segment and the intracellular cytoplasmic tail.

[0087] FIG. 2 Stability of Vero-GCN4 positive cells. The expression of the scFv GCN4-Nectin receptor was analyzed by FACS by means of Mab to HA tag. Diagrams show the percentage positive cells from Vero-GCN4 clone 11.2 cells at passages 10, 15, 30, 40. Result: the expression of the artificial receptor remained stable after 40 consecutive passages.

[0088] FIG. 3 Genome organization of R-VG213. Sequence arrangement of HSV-1 genome shows the inverted repeat sequences as rectangular boxes. The scFv-HER2 sequence (VL-linker-VH) is inserted in position 6-38 of gD, bracketed by upstream and downstream Gly-Ser linkers. LOX-P-bracketed p-Belo-BAC and EGFP sequences are inserted between UL3-UL4 region. The sequence encoding the GCN4 peptide is engineered in gH, at AA position 23-24.

[0089] FIG. 4 Tropism of R-VG213 vs R-LM113. J cells express no receptor for wt-HSV. J-HER2, J-Nectin1, J-HVEM only express the indicated receptor. The indicated cells were infected with R-VG213 (panel a-k) or R-LM113 (panel I-v) and monitored for EGFP by fluorescence microscopy. Cells in panel b,d,f,h, and m,o,q,s were infected in presence of Herceptin/Trastuzumab at neutralizing dose (28 g/ml). R-VG213 infects both the Vero-GCN4 cells (c), and the HER2-positive cancer cell line SK-OV-3 (e), in addition to the J-HER2 cells (g); it also infects wt-Vero cells, which express a simian ortholog of HER2 (a). Herceptin inhibits R-VG213 infection of wt-Vero, SK-OV-3 and J-HER2 cells (b, f, h), but not of Vero-GCN4 cells (d). R-VG213 fails to infect J-nectin1, J-HVEM and wt-J cells (i, j, k). The parental R-LM113, which is retargeted to HER2, but not to GCN4 peptide, infects HER2-positive cells (I, n, p, r), and fails to infect Vero-GCN4 cells treated with Herceptin (o).

[0090] FIG. 5 Yield of R-VG213 and R-LM5 in Vero-GCN4 cells. The extent of R-VG213 replication in Vero-GCN4 cells was compared to that of R-LM5 virus. Vero-GCN4 cell were infected at MOI 0.1 PFU/cell with R-VG213 or R-LM5 (inoculum titrated in Vero-GCN4). Samples were collected at 0, 24 and 48 hours post infection and progeny virus was titrated in Vero GCN4 cells.

[0091] FIG. 6 Yield of R-VG213, R-LM113, R-LM5 in SK-OV-3 cells, and extent of progeny R-VG213 release in extracellular medium of SK-OV-3 cells. (A, B) The extent of R-VG213 replication in SK-OV-3 cells was compared to that of R-LM113 and wt-R-LM5 viruses. SK-OV-3 cells were infected at MOI 0.1 PFU/cell (panel A) or MOI 0.01 PFU/cell (panel B) (inocula were titrated in SK-OV-3 cells). Samples were collected at 0, 24 and 48 hours post infection and progeny virus was titrated in SK-OV-3 cells. (C) SK-OV-3 cells were infected with R-VG213 or R-LM113 at MOI 0.1 PFU/cell as in panel A (inoculum was titrated in SK-OV-3 cells). Samples were collected at 48 hours post infection and progeny virions released in the extracellular medium, present in the cell-associated fraction, or cell-associated plus medium were titrated.

[0092] FIG. 7. Plating efficiency of R-VG213 in different cell lines. (A) Replicate aliquots of R-VG213 were plated in Vero-GCN4, wt-Vero, SK-OV-3 and J-HER2 cells and plaques were scored 3 days later. (B) Relative plaque size of R-VG213 in different cell lines. Replicate aliquots of R-VG213, R-LM113 and R-LM5 were plated in Vero-GCN4, Wt-Vero and SK-OV-3. Plaques were analyzed at fluorescence microscope 3 days post infection.

SEQUENCES

[0093] SEQ ID NO: 1: Amino acid sequence of gH wild type, precursor from HSV-1 (Human Herpesvirus 1 strain F, GenBank accession number: GU734771.1; gH encoded by positions 43741 to 46498).

[0094] SEQ ID NO: 2: Nucleotide sequence of chimeric gH-GCN4.

[0095] SEQ ID NO: 3: Amino acid sequence of gH precursor (SEQ ID NO: 1) having inserted the GCN4 peptide between amino acids 23 and 24, as encoded by the construct R-VG213. The GCN4 peptide is flanked by a Gly-Ser linker.

[0096] SEQ ID NO: 4: Nucleotide sequence of scFv to GCN4 peptide, optimized for human codon usage, and preceded by 96 nucleotide that form the signal sequence and the HA tag.

[0097] SEQ ID NO: 5: Amino acid sequence of scFv to GCN4 peptide (GenBank 1P4B), preceded by 32 AA that constitute the signal sequence and the HA tag. The sequence of the scFv to GCN4 peptide starts at amino acid 33.

[0098] SEQ ID NO: 6: Nucleotide sequence of scFv-GCN4 Nectin1 chimera.

[0099] SEQ ID NO: 7: Amino acid sequence of scFv-GCN4 Nectin1 chimera.

[0100] SEQ ID NO: 8: Primer gH5_galK_r

[0101] SEQ ID NO: 9: Primer gH6_galK_f

[0102] SEQ ID NO: 10: Primer galK_129_f

[0103] SEQ ID NO: 11: Primer galK_417_r

[0104] SEQ ID NO: 12: GCN4 peptide cassetteNucleotide sequence of GCN4 peptide, bracketed by upstream and downstream GS linkers.

[0105] SEQ ID NO: 13: GCN4 peptideAmino acid sequence of GCN4 peptide, bracketed by upstream and downstream GS linkers.

[0106] SEQ ID NO: 14: GCN4 epitope derived from Saccharomyces cerevisiae GCN4 mRNA (http://www.ncbi.nlm.nih.gov/nuccore/15811626/).

[0107] SEQ ID NO: 15: Oligonucleotide GCN4gH_23_42_JB

[0108] SEQ ID NO: 16: Oligonucleotide GCN4gH_23_24_rB

[0109] SEQ ID NO: 17: Primer gH_ext_r pallino

[0110] SEQ ID NO: 18: Primer gH_2176_2200_f

[0111] SEQ ID NO: 19: GenBank accession number AJ585687.1 (gene encoding the GCN4 transcription factor)

[0112] SEQ ID NO: 20: amino acid sequence of GCN4 yeast transcription factor UniProtKBP03069 (GCN4_YEAST)

EXAMPLES

Example 1: Generation of Vero-GCN4 Cell Line

[0113] The Vero-GCN4 cell line expresses an artificial chimeric receptor, made of a scFv to the GCN4 peptide (Zahnd et al., 2004), fused to Nectin-1. More in detail, a N-terminal signal peptide and HA tag sequence is present like in the pDISPLAY (Invitrogen) vector. This should ensure efficient and proper processing of the leader peptide. After the HA tag a short GA linker is present upstream of the scFv. The nucleotide and amino acid sequences of the scFv to GCN4, with sequence optimized for human codon usage, are reported in SEQ ID NOs: 4 and 5; included in those sequences are the signal peptide sequence and the sequence of the HA tag, which precede the sequences of the scFv. C-terminal to the scFv a short GSGA linker is present. The rest of the molecule corresponds to human Nectin-1 (PVRL1) residues Met143 to Val517 comprising the Nectin-1 extracellular domains 2 and 3, the TM segment and the intracellular cytoplasmic tail (FIG. 1). The chimera was synthesized in vitro by Gene Art, and cloned into pcDNA3.1Hygro(+), resulting in plasmid scFv_GCN4_Nectin1 chimera, whose insert has the nucleotide sequence reported as SEQ ID NO: 6, and the amino acid sequence identified as SEQ ID NO: 7.

[0114] The DNA from plasmid scFv_GCN4_Nectin1 chimera was transfected into Vero cells (ATCC CCL-81) by means of Lipofectamine 2000. Vero cells expressing the artificial receptor to GCN4 peptide were selected by means of hygromycin (200 ug/ml), and subsequently sorted by means of magnetic beads (Miltenyi), in combination with MAb to HA tag. The sorted cells were subjected to single cell cloning in 96 well (0.5 cell/well).

[0115] Single clones were analysed by FACS for detection of expression of the scFv to GCN4 peptide by means of MAb to HA tag. The selected clone was 11.2.

Example 2: Stability of Vero-GCN4 Cell Line

[0116] The inventors ascertained that during serial passages of the Vero-GCN4 cell line, the expression of the artificial receptor remained stable after 40 consecutive passages (FIG. 2).

Example 3: Description of the HSV Recombinant Named R-VG213 (FIG. 3), which Expresses a Genetically Modified gH Carrying the GCN4 Peptide, a gD Carrying a Single Chain Antibody (scFv) Directed to HER2 (scFv-HER2), and eGFP as Reporter Gene

[0117] Below is a description of the insertion of the sequence encoding the GCN4 peptide, between AA 23 and 24 of HSV gH. The insertion was carried out in the HSV recombinant named R-LM113, which expresses a scFv-HER2 in gD, in place of the deleted sequences AA 6-38. Specifically, the sequence encoding the GCN4 peptide was inserted between AA 23 and 24 of immature gH, corresponding to AA 5 and 6 of mature gH, after cleavage of the signal sequence, which encompasses AA 1-18. The starting genome was the BAC LM113, which carries scFv-HER2 in place of AA 6 to 38 of gD, LOX-P-bracketed pBeloBAC11 and eGFP sequences inserted between U.sub.L3 and U.sub.L4 of HSV-1 genome (Menotti et al., 2008). The engineering was performed by means of galK recombineering. In order to insert the GCN4 peptide in gH, the galK cassette with homology arms to gH was amplified by means of primers gH5_galK_r TCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGGTC AGCACTGTCCTGCTCCTT (SEQ ID NO: 8) and gH6_galK_f ATGCGGTCCATGCCCAGGCCATCCAAAAACCATGGGTCTGTCTGCTCAGTCC TGTTGACAATTAATCATCGGCA (SEQ ID NO: 9) using pGalK as template. This cassette was electroporated in SW102 bacteria carrying the BAC LM113. The recombinant clones carrying the galK cassette were selected on plates containing M63 medium (15 mM (NH.sub.4).sub.2SO.sub.4, 100 mM KH.sub.2PO.sub.4, 1.8 g FeSO.sub.4.H.sub.2O, adjusted to pH7) supplemented with 1 mg/L D-biotin, 0.2% galactose, 45 mg/L L-leucine, 1 mM MgSO.sub.4.7H.sub.2O and 12 g/ml chloramphenicol. In order to exclude galK false positive bacterial colonies, they were streaked also on MacConkey agar base plates supplemented with 1% galactose and 12 g/ml chloramphenicol and checked by colony-PCR with primer galK_129_f ACAATCTCTGTTTGCCAACGCATTTGG (SEQ ID NO: 10) and galK_417_r CATTGCCGCTGATCACCATGTCCACGC (SEQ ID NO: 11). Next, the DNA fragment encoding the GCN4 peptide cassette, with nucleotide sequence identified as SEQ ID NO: 12, encoding the GCN4 peptide having the AA sequence identified as SEQ ID NO: 13, bracketed by upstream and downstream Gly-Ser linkers, and by homology arms to gH, was generated through the annealing and extension of synthetic oligonucleotides GCN4gH_23_42_fB TCGTGGGGGTTATTATTTTGGGCGTTGCGTGGGGTCAGGTCCACGACTGGG GATCCAAGAACTACCACCTGGAGAACGAGGTGGCCAGACTGAAGAAGCTGG TGGGCAGC (SEQ ID NO: 15) and GCN4gH_23_24_rB ATGCGGTCCATGCCCAGGCCATCCAAAAACCATGGGTCTGTCTGCTCAGTGC TGCCCACCAGCTTCTTCAGTCTGGCCACCTCGTTCTCCAGGTGGTAGTTCTT GGATCC (SEQ ID NO: 16), which introduce a silent restriction site for the BamHI endonuclease, useful for screening of colonies by means of restriction analysis. The recombinant BAC R-VG-213 encodes the chimeric gH, whose nucleotide sequence is identified as SEQ ID NO: 2, and whose amino acid sequence is identified as SEQ ID NO: 3. The recombinant BAC R-VG213 bacterial clones were selected on plates containing M63 medium (see above) supplemented with 1 mg/L D-biotin, 0.2% deoxy-2-galactose, 0.2% glycerol, 45 mg/L L-leucine, 1 mM MgSO4.7H.sub.2O and 12 g/ml chloramphenicol. Bacterial colonies were checked for the presence of sequence of choice by means of colony PCR with primers gH_ext_r pallino GTTTCTTCCTTTTCCCCACCCCACCCC (SEQ ID NO: 17) and gH_2176_2200_f CAGGTAGGTCTTCGGGATGTAAAGC (SEQ ID NO: 18).

[0118] To reconstitute the recombinant virus R-VG213, 500 ng of recombinant BAC DNA was transfected into the Vero-GCN4 cell line by means of Lipofectamine 2000 (Life Technologies), and then grown in these cells. Virus growth was monitored by green fluorescence. The authenticity of the recombinants was verified by sequencing the entire gH and gD ORFs. Virus stocks were generated in Vero-GCN4 cells and titrated in Vero-GCN4 and SK-OV-3 cells.

Example 4: Double Tropism of R-VG213 for Vero-GCN4 and for HER2-Positive J-HER2 and SK-OV-3 Cells

[0119] It has previously been shown that the insertion of scFv-HER2 in gD confers to the recombinant virus R-LM113 the ability to enter cells through the HER2 receptor, and that R-LM113 is detargeted from the natural gD receptors Nectin1 and HVEM, because of the deletion of the gD region between AA 6-38. To verify whether the insertion of the GCN4 peptide enables R-VG213 to infected the Vero-GCN4 cells, the inventors made use of Vero-GCN4 cell line and its wt counterpart, wt Vero. To verify that R-VG213 is still capable to infect through the HER2 receptor, the inventors made us of the J-HER2 cells, which express HER2 as the sole receptor, and of the HER2-positive cancer cells, SK-OV-3 cells. In addition, to verify that R-VG213 maintains the detargeting from nectin1 and HVEM, the inventors made us of J-Nectin1 and J-HVEM, which express only the indicated receptor. Cells were infected with R-LM213 (FIG. 4 panel A) and with R-LM113 (FIG. 4 panel B). Where indicated, infection was carried out in the presence of MAb to HER2, named herceptin, at the concentration of 28 g/ml. Infection was carried out at 1 PFU/cell, and was monitored 24 hours later by fluorescence microscopy. As shown in FIG. 4 A, R-VG213 infected Vero-GCN4 cells; this infection was not inhibited by herceptin, indicating that it occurred through the GCN4 receptor. The infection seen in wt Vero was inhibited by herceptin, indication that it occurs through the simian ortholog of HER2. R-VG213 infected SK-OV-3 and J-HER2 cells, in a fashion inhibited by herceptin, i.e. HER2-dependent. As expected, R-VG213 did not infect J-nectin1, J-HVEM, and wt-J cells indicating that it preserved the detargeted phenotype. The infection of Vero-GCN4 cells with R-VG213 is in sharp contrast with that of R-LM113, which infects cells solely through HER2 (FIG. 4 B).

Example 5: Extent of R-VG213 Replication in Vero-GCN4 Cells, as Compared to that of the Wt-Virus R-LM5

[0120] The inventors compared the extent of replication in Vero-GCN4 cells of R-VG213 to that of R-LM5, a virus carrying wt gH and wt-gD. Vero-GCN4 cell were infected at MOI 0.1 PFU/cell with R-VG213 or R-LM5 (inoculum titrated in VERO-GCN4 cells), for 90 min at 37 C. Unabsorbed virus was inactivated by means of an acidic wash (40 mM citric acid, 10 mM KCl, 135 mM NaCl [pH 3]). Replicate cultures were frozen at the indicated times (0, 24 and 48 h) after infection and the progeny was titrated in VERO-GCN4 cells. It can be seen from FIG. 5 that R.VG213 grew about one log less than R-LM5 at 24 h. At 48 h the extent of replication was undistinguishable.

Example 6: Replication of R-VG213 in SK-OV-3 Cells, in Comparison to R-LM113 and R-LM5, and Extent of Progeny R-VG213 Release in Extracellular Medium of SK-OV-3 Cells

[0121] (A, B) The inventors compared the extent of replication of R-VG213 to that of the recombinant R-LM113, also retargeted to HER2 through the insertion of scFv-HER2 in gD, and of the wt R-LM5. Replication was measured in SK-OV-3 cells, which express HER2 and Nectin-1/HVEM as receptors. Replication was carried out at input MOI of 0.1 (panel A) or 0.01 (panel B) PFU/cell. Unabsorbed virus was inactivated by means of an acidic wash (40 mM citric acid, 10 mM KCl, 135 mM NaCl [pH 3]). Replicate cultures were frozen at the indicated times (0, 24 and 48 h) after infection and the progeny was titrated in SK-OV-3 cells. It can be seen from FIGS. 6 A and B that R-VG213 replication could not be differentiated from that of its parent R-LM113, and about half log less than the wt R-LM5. (C). The inventors compared R-VG213 and R-LM113 with respect to the extent of progeny virus release to the extracellular medium of SK-OV-3 cells infected at 0.1 PFU/cell (experiment shown in panel A). At 48 h after infection, replicate cultures were either frozen as whole lysates plus medium (cell-associated+medium), or medium and cell-associated fractions were separated and frozen. Progeny virus was titrated in SK-OV-3 cells. It can be seen that the efficiency of progeny release in the extracellular medium was very similar.

Example 7: Plating Efficiency of R-VG213 in Different Cell Lines

[0122] The inventors compared the ability of R-VG213 to form plaques in different cell lines, with respect to number of plaques (A), and to plaque size (B). (A) Replicate aliquots of R-VG213 were plated in Vero-GCN4, Wt-Vero, SK-OV-3 and J-HER2 cells and the number of plaques were scored 3 days later. It can be seen that the highest plating efficiency is reached in Vero-GCN4 cells. (B) Typical examples of relative plaque size of R-VG213 in different cells. Even by this parameter R-VG213 exhibits a large plaque phenotype in Vero-GCN4 cells.

[0123] Chowdary et al., 2010), one from the swine PrV (Backovic et al., 2012), also an alphaherpesvirus, and one from Epstein-Barr virus (Matsuura et al., 2010

REFERENCES

[0124] Abstract #P-28, 9.sup.th International conference on Oncolytic virus Therapeutics, Boston 2015 [0125] Arndt K. and Fin G. R., PNAS 1986, 83, 8516-8520 [0126] Backovic M. et al., PNAS, 2012, 107, 22635-22640 [0127] Chowdary T. K. et al., Nat Struct Mol Biol, 2010, 17, 882-888 [0128] Douglas J. T. et al., Nat Biotechnol, 1999, 17, 470-475 [0129] Florence G. et al., Virology: A Laboratory Manual, 1992, ISBN-13: 978-0121447304 [0130] Gatta V. et al., PLOS Pathogens, 2015, DOI: 10.1371/journal.ppat.1004907 [0131] Hope I. A. and Struhl K., EMBO J, 1987, 6, 2781-2784 [0132] Karlin S. and Altschul S. F., PNAS, 1990, 87, 2264-2268 [0133] Karlin S. and Altschul S. F., PNAS, 1993, 90, 5873-5877 [0134] Matsuura H. et al., PNAS, 2010, 107, 22641-22646 [0135] Menotti L, et al., J Virol, 2008, 82, 10153-10161; doi: 10.1128/JVI.01133-08. Epub 2008 Aug. 6. [0136] Nakamura T. et al., Nat Biotechnol, 2005, 23, 209-214. Epub 2005 Jan. 30 [0137] Needleman S. B. and Wunsch C. D., J Mol Biol, 1970, 48, 443-453 [0138] Pearson W. R. and Lipman D. J., PNAS, 1988, 85, 2444-2448 [0139] Peterson R. B. and Goyal S. M., Comp Immunol Microbiol Infect Dis. 1988, 11, 93-98 [0140] Sandri-Goldin R. M. et al., Alpha Herpesviruses: Molecular and Cellular Biology, Caister Academic Press, 2006 [0141] Smith T. F. and Waterman M. S., Add APL Math, 1981, 2, 482-489 [0142] Zahnd C. et al., J Biol Chem 2004; 279, 18870-18877